Access the full text.
Sign up today, get DeepDyve free for 14 days.
ACTA MEDICA MARTINIANA 2021 21/2 DOI: 10.2478/acm-2021-0007 DETECTION OF SUBCLINICAL PAROXYSMAL ATRIAL FIBRILLATION AND ITS CORRELATION WITH CANDIDATE GENES IN PATIENTS WITH CRYPTOGENIC ISCHEMIC STROKE AND TIA 1 2 3 4 3 5 PETROVICOVA A , KURCA E , ANDRASOVA A , BERNATOVA J , BLASKO P , BURJANIVOVA T , DURIS 4 6 7 5 2 3 8 2 T , GRENDAR M , HASILLA J , MALICHEROVA B , NOSAL V , OBONA P , PATROVIC L , SIVAK S , 7 9 †7 10 SNOPEK P ,SVETLOSAK M , VAHALA P ,CIERNY D Clinic of Neurology, Faculty Hospital Nitra, Špitálska 6, 949 01 Nitra, Slovak Republic Clinic of Neurology, Jessenius Faculty of Medicine in Martin, Comenius University in Bratislava, and University Hospital Martin, Kollárova 2, 036 59 Martin, Slovak Republic Cardiocenter Nitra, Špitálska 6, 949 01 Nitra, Slovak Republic Clinic of Internal Medicine, Faculty Hospital Nové Zámky, Slovenská ulica 11 A 940 34, Nové Zámky 1, Slovak Republic Department of Molecular Biology and Genomics, Jessenius Faculty of Medicine in Martin, Comenius University in Bratislava, Malá Hora 4C, 03601 Martin, Slovak Republic Bioinformatic centre, Biomedical Center Martin, Jessenius Faculty of Medicine in Martin, Comenius University in Bratislava, Malá Hora 4C, 036 01 Martin, Slovak Republic Clinic of Cardiology, Faculty Hospital Nitra, Špitálska 6, 949 01 Nitra, Slovak Republic Jessenius diagnostic centre, Špitálska 557, 949 01 Nitra, Slovak Republic Department of Arrhythmias and Cardiac Pacing, National Institute for Cardiovascular Diseases, Pod Krásnou hôrkou 1, 833 48 Bratislava 37, Slovak Republic Department of Clinical Biochemistry, Jessenius Faculty of Medicine in Martin, Comenius University in Bratislava, and University Hospital Martin, Kollárova 2, 036 59 Martin, Slovak Republic A b s t r a c t Introduction: Cardioembolic etiology is assumed to be the most frequent cause of cryptogenic strokes. The detec- tion of subclinical paroxysmal atrial fibrillation (AF) is important in the correct choice of preventive treatment. The aim of this prospective study was to detect the incidence of AF in patients with a cryptogenic stroke or transient ischemic attack (TIA) and to evaluate the association between the presence of AF and selected single-nucleotide polymorphisms (SNP). Methods: Patients with a cryptogenic stroke/ TIA (n=100) and a control group (n=15) of volunteers without sig- nificant cardiovascular disease were included in the study during the period of 2014 to 2019. To detect AF they underwent 12 months of ECG monitoring using an implanted loop recorder (ILR). Genotyping for SNPs rs10033464, rs2200733, rs225132, and rs2106261 was performed by a high resolution melting analysis. Results: We found AF to be present in 24 (24%) patients with a cryptogenic stroke/TIA, versus no subjects in the control group. The SNPs rs2106261, rs2200733, rs225132, and rs10033464 were not found to be associated with AF in our study (p=0.240; 1.000; 0.887; 0.589). However, a weak trend for a higher frequency of rs2106261 risk allele A homozygotes was observed in the patients with AF compared to the patients without AF (0.416 vs. 0.263, p=0.073). Homozygotes for allele A of rs2106261 were also present in a significantly higher frequency in AF patients compared to the controls (0.416 vs. 0.133, p = 0.012). Conclusion: In our study paroxysmal AF was a probable etiological factor in 24% of patients with cryptogenic ischemic stroke / TIA during the 12 months of monitoring. The homozygous allele A of rs2106261 was identified to be the possible genetic risk factor of AF, but this should be verified in larger cohorts. The study has been registered at www.clinicaltrials.gov, identifier NCT02216370. Key-words: transient ischemic attack, cryptogenic stroke, atrial fibrillation, implantable loop recorder, single- nucleotide polymorphisms Corresponding author: Daniel Cierny, e-mail: daniel.cierny@uniba.sk © 2021 Cierny D. et al. This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 License (https://creativecommons.org/licenses/by-nc-nd/4.0/) 43 ACTA MEDICA MARTINIANA 2021 21/2 INTRODUCTION An ischemic stroke (IS) is a heterogeneous multi-factor polygenic disease with a high mor- tality rate and long-term consequences. (1) One of the known, important, and independent risk factors for IS is atrial fibrillation (AF). (2) Its early detection is of fundamental prog- nostic importance. Paroxysmal AF is often considered a probable cause of cryptogenic stroke. (3) The detection of subclinical paroxysmal AF in this case is difficult because it can be asymptomatic, mainly in older people, and traditional 12-lead or Holter ECGs have a low level of detection due to the limited length of the recording. In recent years the higher detec- tion of AF is due to the introduction of long-term monitoring strategies. Non-stop long-term ECG monitoring using implantable devices is a better and clinically more effective technique than conventional monitoring, in particular following a cryptogenic stroke. In order to achieve maximum AF detection further factors should be identified in order to choose patients for a long-term monitoring. Greater attention is paid to genetic studies under the assumption that genetic tests might help define the subtype of a cryptogenic stroke. (4–8) The aim of the work was to define the following in a group of patients with a cryptogenic stroke/ transient ischemic attack (TIA): 1) the presence of AF using an implantable ECG loop recorder (ILR); 2) the number of recurrences of stroke/ TIA during the following 12 months; 3) the presence of new ischemic lesions during a magnetic resonance (MRI) exa mination 12 months later; 4) whether there is a relation between newly-diagnosed AF in our group of Slovak patients and the find of selected single-nucleotide polymorphisms (SNPs) in litera- ture associated with AF and cardioembolic infarction. METHODS Characteristics of the groups One hundred patients with an acute ischemic stroke or TIA were included in the study. The patients were hospitalised within 72 hours from the onset of the ischemic stroke at the Clinic of Neurology of the Faculty Hospital in Nitra from 2014 to 2019 and they met the defi - nition of cryptogenic etiology according to TOAST criteria (inclusion and exclusion criteria) during the screening period. Transient ischemic attack was defined as a temporary neuro- logical deficit of vascular origin without acute ischemic MRI changes. The possible etiolo - gical factors of ischemic stroke were excluded in all patients by: CT and MR imaging of the brain and intra/extracranial arteries, hematological testing for thrombophilia, rheumato- logical tests for vasculitis, 14 days lasting 12-lead Holter ECG for detection of paroxysmal AF, transthoracic and transoesophageal echocardiography for cardioembolism. The control group was made up of 15 volunteers without a significant cardiovascular and cerebrovas- cular disease adjusted by age and gender. The patients were monitored for 12 months. All patients and volunteers in the control group signed an informed consent form. Examinations The diagnosis of an ischemic stroke required consistent neuroimaging findings on CT and MRI. In control individuals MRI had not been performed before participating in the study. All subjects in patient and control groups in addition underwent a follow-up MRI once the monitoring was finished. Standard non-contrast CT and CT angiography of the aortic arch, cervical and intracranial arteries (SIEMENS Somatom Definition, dual source 2x128, Stellar upgrade, SIEMENS Somatom Edge 128), and brain MRI (SIEMENS Skyra 3.0T, SIEMENS Magnetom Avanto 1.5T, SIEMENS Magnetom Symphony 1.5T (protocol T2wTSE SAG + TRA, FLAIR T2wTIRM dark fluid - TRA, DWI – epi2ddiffusion – TRA + ADC, MRA-TOF3D mul tislab – TRA + MPR + MIP + VRT, CE imag.-i.v. inject. application + aqua flush 30ml – T1w mpr ISO – TRA + MPR / COR + SAG) were carried out at the JESSENIUS diagnostics centre. The CT and MRI findings were evaluated by independent radiologists. 44 ACTA MEDICA MARTINIANA 2021 21/2 Implantation of a long-term ECG loop recorder The implantation of a ILR (REVEAL LINQ / XT, Medtronic Inc., Minneapolis, USA) was carried out within 6 months of the onset of the ischemic stroke/ TIA as arranged with a car- diologist in the following sites: Clinic of Cardiology of the Faculty Hospital in Nitra; Kardiocentrum Nitra s.r.o.; Department of Arrhythmology of the National Institute of Car - diovascular Diseases and the Clinic of Internal Medicine of the Faculty Hospital in Nové Zámky. AF was defined as an episode of irregular cardiac rhythm without the presence of a P wave, lasting for more than 2 minutes. The ECG output obtained from the ILR during check-ups was assessed by an arrhythmologist. Check-up examination During the final check-up examination after 12 months we assessed the AF finding, the result of the follow-up brain MRI examination, the recurrence of acute stroke, and a change in treatment in the secondary prevention of acute stroke. In cases where AF was detected by ILR in the course of the 12-month monitoring period the patients and the control sub- jects underwent an unplanned neurological check-up with a change from antiplatelet treat- ment to anticoagulation. An unplanned neurological check-up was also undergone in the case of a recurrence of acute stroke. Genetical analysis The genetic examination was carried out at the Department of Molecular Biology and Genomics, the Jessenius Faculty of Medicine in Martin and BioMed, Comenius Univer sity in Bratislava, in cooperation with the Department of Clinical Biochemistry, Jessenius Faculty of Medicine in Martin, Comenius University in Bratislava, and University Hospital Martin. Four SNPs were selected for genetic examination: rs10033464 (PITX2c gene), rs 2200733 (PITX2c gene), rs225132 (ERRF11 gene), and rs2106261 (ZFHX3 gene). The cha rac teristics of the analysed SNPs are shown in Table 1. Table 1 Selected single-nucleotide polymorphisms (SNP) SNP Genetic locus Chromosome Major / risk allele Susceptibility, population rs2106261 ZFHX3 16q22 G / A AF, Europeans ≈11% Han Chinese rs2200733 PITX2c 4q25 C / T AF, Europeans rs225132 ERRF11 1 T / G All types of ischemic stroke, coronary heart disease, Europeans rs10033464 PITX2c 4q25 G / T AF, Europeans Abbreviations: AF – atrial fibrillation The samples of peripheral blood were taken and dispensed into 3 ml tubes containing 5,4 mg of EDTA (Vacutest Kima S.r.l., Italy). DNA was isolated using DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA). The concentration and purity of the DNA were determined using Nanodrop (ND-1000, NanoDrop Technologies, Wilmington, DE). All samples were diluted in sterile distilled water to a 25-50 ng/μl final concentration. PCR amplification and genotyping was performed by a High Resolution Melting (HRM) analysis using the Roche LightCycler® 480 Instrument (Roche, USA). The reaction volume consisted of 10 μl of LC480 HRM Master Mix, 2,4 μl of MgCl (25 mM), 2 μl of genomic DNA sample (25–50 ng), 2 45 ACTA MEDICA MARTINIANA 2021 21/2 and 0.4 μl of 10μM primers (Ecoli, Czech Republic) filled up to a total volume of 20 μl by redistilled water. The oligonucleotide primers were designed with the online uDesignSM application (www.dna.utah.edu/udesign/index.html). The primer sequences are shown in Table 2. The reaction conditions for rs10033464 and rs2106261 were: 95°C for 10 minu - tes, (95°C for 10 seconds, 66°C for 15 seconds, 72°C for 10 seconds) x 45 cycles; 72°C for 5 minutes. Heteroduplex PCR was performed at 95°C for 1 minute, 40°C for 1 minute; and c) HRM: 65 to 95°C with a ramp rate set to 0.02°C/second and 25 acquisitions/°C. The reaction conditions for rs225132 and rs 2200733 were: 95°C for 10 minutes, (95°C for 10 se conds, 60°C for 15 seconds, 72°C for 10 seconds) x 45 cycles; 72°C for 5 minutes. Heteroduplex PCR was performed at 95°C for 1 minute, 40°C for 1 minute. HRM analysis was performed at 65 to 95°C with a ramp rate set to 0.02°C/second and 25 acquisitions/°C. To verify the quality of genotype determination several samples from each SNP were bi-direc- tionally sequenced by Sanger sequencing. PCR fragments were purified with ExoSap-IT (Applied Biosystems, Foster City, CA, USA). Sequencing of SNPs was performed using BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Ca, USA) on the ABI PRISM 3130x1 automatic sequencer (Applied Biosystems, CA, USA). Sequence data analy- sis was carried out by using Chromas software (http://www.technely-sium.com.au/chro- mas.html). Table 2 Primers used for HRM SNP Primer sequence rs2106261 F 5 CACAGATAGAGCTCGTCCAGAGAATTG R 5′ GCCACTTGGATATTTTAATGGATGGTT rs2200733 F 5′ GTGGTACTTGGGTTTTGATTTTGA R 5′ ACTACCTTAAATATTACCTGTTCTAATTTTCTC rs225132 F 5′ TCAGTGAAGAGGTGGTGAATGTAGGAAT R 5′ ACCATGTGCCATGAATGCAA rs10033464 F 5′ CAATTTAAAATTTTCTTTTTTTACATTGTTAGAGTCAAGAA R 5′ CTCAGAGCTTGATGAAAGCACT Abbreviations: AF – atrial fibrillation Statistics We used common methods of descriptive statistics. We evaluated the association between AF and the other categorical variable, SNPs, using a contingency table. The zero hypo thesis on the non-existence of an association between atrial fibrillation and another categorical variable (SNP) was tested using a Pearson’s Chi-squared test with Yates’ continuity correc- tion and a Cochran-Armitage trend test. All the data analyses were done in R [15], ver. 3.5.2. Registration of the study The study has been registered at www.clinicaltrials.gov under the identifier NCT02216370. 46 ACTA MEDICA MARTINIANA 2021 21/2 RESULTS Demographic data The mean age of the subjects in the patient group was 70.1 years (28–87) vs. 75.4 years (35–90) in the control group. The ratio of women in the patient group was 30% (30) vs. 66.6% (10) in the control group. 90% (90) of patients had experienced a cryptogenic ischemic stroke with a moderate neurological deficit; the median NIHSS was 6.9 (0–15). The ratio of TIA in the patient group was 10% (10). The subjects in the patient group showed an ave - rage CHA2DS2-VASc score of 3 (2–5) and 1.4 (0–3) in the control group. A total of 68 (68%) of the subjects in the patient group had an arterial hypertension in their personal history (18 (75%) patients with detected AF vs. 9 (60%) of the volunteers in the control group). In the patient group a total of 14 (14%) patients had diabetes mellitus, of which 1 (4.2%) patient had detected AF vs. 2 (13.3%) volunteers in the control group. Clinical characteris- tics of the involved individuals are summarised in Table 3. Table 3 Clinical characteristics of involved individuals Characteristics With AF Without AF Controls (n=24) (n=76) (n=15) Age (median) 64.29 62.59 75.46 Women % (n) 29.16 (7) 43.42 (23) 66.6 (10) Cryptogenic stroke 22 68 0 TIA 2 8 0 NIHSS median (range) 6.6 (0–13) 7.1 (0–15) 0 CHA DS VASc median (range) 3 (2–4) 3 (2–5) 1.4 (0–3) 2 2 Hypertension % (n) 75 (18) 65.8 (50) 60 (9) Diabetes mellitus % (n) 4.17 (1) 17.11 (13) 13.3 (2) Abbreviations: TIA – Transient ischemic attack, AF – Atrial fibrillation, NIHSS – The National Institutes of Health Stroke Scale, n – number Detection of atrial fibrillation, recurrence of acute ischemic stroke, and change of treatment AF was confirmed in 24% (n = 24) of the patients out of 100 in the patient group. The mean time interval between ILR and AF was 3.9 months (1–11 months). AF was not con- firmed in any volunteer in the control group. Within the course of the 12-month monito ring period no subject in the patient nor control groups experienced a clinical or asymptomatic recurrence of an ischemic stroke or a systemic embolism. After the 12 months of monito - ring MRI did not reveal any new ischemic brain lesions in the patient and control groups. In the patient group with AF (n = 24) the antiplatelet therapy was changed immediately to anti-coagulants (Table 4). 47 ACTA MEDICA MARTINIANA 2021 21/2 Table 4 Detection of atrial fibrillation, change in MRI finding, change in preventive treatment after 12 months Characteristics Patient group Control group (n = 100) (n = 15) With AF Without AF Without AF (n=24) (n=76) (n=15) Implantation of ICM% (n) 100 (24) 100 (76) 100 (15) Time before the implantation of ICM (m) 2.5 (1–4) 1–6 1–6 Time preceding detection of AF (m) 3.9 (1–11) 0 0 Recurrence of IS /SE 0 0 0 New MRI ischemic lesions after 12 m % (n) 0 (0) 0 (0) 0 (0) Change in preventive treatment % (n) 100 (24) 0 (0) 0 (0) Abbreviations: IS = ischemic stroke, SE = systemic embolisation 3. Analysis of the association of selected SNPs with AF in the patient group The genotype frequencies of the analysed SNPs in the subgroups of patients and in the controls are shown in Table 5. SNP rs2106261 had no statistically significant association with AF (p = 0.240). However, a weak trend for a higher frequency of homozygous form of rs2106261 risk allele A in patients with AF compared to the patients without AF was observed (41.6% vs. 26.3%, p = 0.073). Allele G of rs2106261 was present in 14 (58.4%) patients with AF vs. 56 (73.7%) without AF. The trend for association of rs2106261 with AF was also found when compared the patients with AF to the controls (p = 0.058). The AA homozygotes were 10 patients with AF compared to 2 individuals in the control group and the difference was statistically sig- nificant (41.6% vs. 13.3%; p = 0.012). Allele G of rs2106261 was found in 14 (58.4%) pa - tients with AF vs. 13 (86.7%) volunteers in the control group. We found a weak trend for the association of rs2106261 with AF (p = 0.076). Homozygotes for allele A of rs2106261 were present in a significantly higher frequency in AF patients compared to the controls (41.6% vs. 13.3%, p = 0.012). A positive finding of rs2200733 risk allele T homozygotes was observed in 5 (21%) patients with AF vs. 15 (20%) patients without AF. Allele C of rs2200733 was found in 19 (79%) patients with AF vs. 61 (80%) patients without AF. A statistically significant association of rs2200733 with AF was not found (p = 1). When comparing patients with AF to the control group, homozygotes for risk allele T of rs2200733 were in 5 (20.8%) patients vs. 3 (20%) volun teers in the control group. Allele T of rs2200733 in homozygous form was present in 19 (79.8%) patients with AF vs. 12 (80%) volunteers in the control group. In patients with AF compared to the control group, rs2200733 did not show any statistically significant associa tion with AF (p = 0.945). Homozygotes of rs225132 minor allele G were 5 (20.8%) patients with AF vs. 19 (25%) patients without AF. Ancestral allele T of rs225132 was found in 19 (79.2%) patients with AF vs. 57 (75%) patients without AF. A statistically significant association of rs225132 with AF was not confirmed (p=0.887). When comparing patients with AF to the control group, homozygous allele G of rs225132 was found in 5 (20.8%) patients vs. 5 (33.3%) volunteers in the control group. Allele T of rs225132 was confirmed in 19 (79.2%) patients with AF 48 ACTA MEDICA MARTINIANA 2021 21/2 Table 5 Genotype frequencies of the analysed SNPs in patients and controls SNP rs2106261 rs2200733 rs225132 rs10033464 AA GG + GA TT CC + CT GG TT + TG TT GG + GT Patients without AF 0.263 0.737 0.200 0.800 0.250 0.750 0.105 0.895 (n = 100) (n = 76) (n = 20) (n = 56) (n = 15) (n = 61) (n = 19) (n = 57) (n = 8) (n = 68) with AF 0.416 0.583 0.208 0.792 0.208 0.792 0.042 0.958 (n = 24) (n = 10) (n = 14) (n = 5) (n = 19) (n = 5) (n = 19) (n = 1) (n = 23) 2 test p-value 0.240 1.000 0.887 0.589 (with vs. without AF) Controls 0.133 0.867 0.200 0.800 0.333 0.667 0.267 0.733 ( n = 15) (n = 2) (n = 13) (n = 3) (n = 12) (n = 5) (n = 10) (n = 4) (n = 11) 2 test 0.058 0.945 0.884 0.261 p-value (AF patients vs. controls) 49 ACTA MEDICA MARTINIANA 2021 21/2 vs. 10 (66.4%) healthy volunteers. A statistically significant association of rs225132 with AF was also not shown when patients with AF were compared to the controls (p=0.884). Homozygous risk allele T of rs10033464 was present in 1 (4.2%) patient with AF vs. 8 (10.5%) patients without AF. Allele G of rs10033464 was found in 23 (95.8%) patients with AF vs. 68 (89.4%) patients without AF. A statistically significant association of rs10033464 with AF was not confirmed (p=0.589). When comparing patients with AF to the control group, homozygous rs10033464 risk allele T was present in 1 (4.2%) patient vs. 4 (26.7%) volunteers in the control group, and the difference was statistically significant (p=0.047). Ancestral allele G of rs10033464 was found in 23 (95.8%) patients vs. 11 (73.3%) volun- teers in the control group. DISCUSSION In our study we found that paroxysmal AF was a probable etiological factor in 24% of patients with cryptogenic ischemic stroke/ TIA. In the control individuals paroxysmal AF was not present during the 12 months of monitoring. In the randomised control CRYSTAL-AF clinical study the AF detection after 12 months was lower compared to our findings, 12.24% versus 24%. In the above-mentioned study a 30.0% detection rate was only achieved after 36 months of monitoring. (9) In the same manner, a lower detection rate of AF over an avera ge monitoring period of 365 days, compared to our results, was found by Marks et al. (2019) in a retrospective study based on real practice. Using an ILR the authors detected a subclinical AF in 35 patients (19.6%) in a group of 178 patients with cryptogenic ischemic stroke. (10) The detection rate of AF in our patients approximately correlates with the data of the meta-analysis of 28 studies processed by Tsivgoulis et al. (2019) in patients with cryptogenic ischemic stroke and embolic stroke of underdetermined source (ESUS) (of which 10 studies monitored patients from 6 to 12 months). (11) The cumulative AF detec- tion rate in patients with ILR was 26% of the above-mentioned meta-analysis. Depending on the duration of monitoring, the authors found significant differences in the AF detection rates (p <0.001) ( <6 months: 5%; ≥6 and ≤12 months: 21%; >12 and <24 months: 26% > 24 months: 34%). They did not confirm any association with other patient characteristics, such as the subtype of ischemic stroke (cryptogenic vs. ESUS), or the time from the be - ginning of the ischemic stroke to the implantation of the ILR. These findings can be extra - polated to our research. The time of ILR implantation in all our patients within 6 months of the ischemic stroke/ TIA, which was needed for the organisation, performance of examina- tions and assessment, did not affect the AF detection rate. In all 24 patients (100%) with AF an antiplatelet therapy was changed to anticoagulation following the recommendations of the ESC (European Society of Cardiology, 2016). (12) We noted no recurrence of ischemic stroke either in the patients or in the control group over the monitored period (12 months), probably due to a short period and an appropriate change of treatment. Unlike our findings, a population study in Oxfordshire, United Kingdom, performed by Li et al. (2015) in patients with a first TIA or cryptogenic ischemic stroke revealed that a 10-year risk of death was 46%, vascular death was 15%, and the recurrence of any form of ischemic stroke was 32%. The risk of recurrence of ischemic stroke/ TIA in this study was lower compared to patients with a cardioembolic etiology (p = 0.003). (13) We can only speculate whether the individual efficacy of antiplatelet therapy, possibly depending on p-selectin expression, could be related to a recurrency of ischemic stroke/TIA (14). A follow-up brain MRI after the 12 months of monitoring did not reveal new asymptomatic ischemic lesions in the patient and control groups. Studies dealing with the MRI detection of new ischemic lesions after a cryptogenic ischemic stroke focus more on proof of low-level symptomatic carotid stenosis, atherosclerosis of small intracranial arteries, or foramen ovale patens as etiological causes. On the other hand, Bal et al. (2012) in a group of 333 50 ACTA MEDICA MARTINIANA 2021 21/2 (48%) patients with cryptogenic ischemic stroke, out of the total number of patients with a mild stroke/ TIA (National Institutes of Health Stroke Scale score NIHSS ≤3), found that 6.6% of patients had new lesions at the 30-day and 14.5% of patients at the 90-day MRI follow-up. (15) This population showed a high rate of silent radiological recurrence, which points to the disease activity. However, the study does not mention the type of therapy administered as part of the secondary prevention of ischemic stroke. In our study the patients had a higher NIHSS score 7, they were given an antiplatelet therapy and an anti- coagulation therapy after the finding of AF. The relation between AF and brain lesions caused by a silent cerebral infarction (SCI) at an undefined time, diagnosed by MRI, has been examined in several studies. For example, the Framingham Offspring Study (Das et al., 2008) found a higher risk of SCI in patients with AF (OR 2.16). (16) On the contrary, Gaita et al. (2013) found white matter lesions in 92% of patients with persistent AF, in 89% of patients with paroxysmal AF, and in 46% of patients without AF. A relation between SCI prevalence and the duration of AF was not found. (17) Regarding the genetic analysis, in the case of rs2106261, we did not confirm a statisti- cally significant association with AF (p=0.240). However, we found a slight significant trend towards a higher frequency of rs2106261 AA homozygotes in patients with AF com- pared to the control individuals (p=0.076). Interestingly, a significantly higher frequency of AA homozygotes was also present in patients with AF when compared to the controls (p=0.012). Our results can be interpreted in accordance with the published data. Benjamin et al. (2009) in the meta-analysis of GWAS in patients with AF identified of a -7 new susceptibility locus ZFHX3, rs2106261 (RR = 1.19; p = 2.3 x 10 ). (4) These findings were replicated in a cohort study of Psaty et al. (2009) from the German AF Network -11 -15 (OR=1.44; p =1.6 x 10 ; combined RR = 1.25; combined p = 1.8 x 10 ). (5) It is inte - resting to note that the majority of available publications that identified the association of this SNP variant with AF mainly studied in Asian population by Li et al. (2011) and Zaw et al. (2017). (18, 19) In our study the rs2200733, rs225132, and rs10033464 did not show any significant association with AF. Our findings contradict Henninger et al. (2016) who found that patients with a cardioembolic stroke have a high-risk genetic profile, even despite age and numerous clinical co-morbidities. (20) Pulit et al. (2018) found that a polygenic risk score of AF explains ~20% of the hereditary component of the cardioem- bolic risk of ischemic stroke. (21) Contrary to our findings, Gretarsdottir et al. (2008) and Gudbjartsson et al. (2009) consider the variant rs2200733 as one of the most impor- tant genetic polymorphisms associated with AF and cardioembolic stroke. (6,7) This finding has been consistently replicated and validated in several cohorts of patients with a sta- tistical significance of p<0.05, in European and Asian populations by Wnuk et al. (2011), Viviani et al. (2008), Cao et al. (2013), and Sun et al. (2016). (22-25) The published infor- mation concerning rs10033464 is inconsistent and our negative findings indirectly and partially match the data in literature. Lemmens et al. (2010) found that rs10033464 is only weakly associated with AF and this variant has demonstrated no relation to ischemic stroke. (26) However, in an isolated population of patients in Iceland, Gretarsdottir et al. (2008) reported a strong association between rs10033464 risk allele T and cardioembolic -4 stroke (OR = 1.27; p = 6.1 x 10 ). (6) A strong association between rs10033464 and AF was also confirmed by Kääb et al. (2009) in cohorts of patients of European origin: the Framingham Heart Study (327 AF patients and 2006 controls, OR = 1.34; 95% CI 1.03–1.75; p = 0.031), the German AF Network (1715 patients with AF and 4073 controls, OR = 1.30; 95% CI 1.13-1.51; p =0.0002), and Rotterdam Study (910 AF patients and 5496 controls, OR = 1.17; 95% CI 1.13-1.51; 0.99 – 1.38, p = 0.07). (8) On the other hand, the association of rs10033464 with AF was not found in Vanderbilt AF Registry study that was performed in 556 patients with AF and 598 controls without AF (OR = 1.16; 95% CI 0.86-1.56; p = 0.33). (8) Interestingly, the autosomal dominant loci in ankyrin B protein 2 gene on chromosome 4q25 were showed to be associated also with ventricular arrythmias, particularly long QT syndrome. (27) 51 ACTA MEDICA MARTINIANA 2021 21/2 In the only publication dealing with rs225132 in context of AF, Traylor et al. (2012) (METASTROKE Collaboration) identified an association between the rs225132 variant −8 −8 and AF in patients with ischemic strokes (p=6.3×10 a 5.9×10 ), and this is not in con- cordance with our findings. (28) CONCLUSION In our study we identified the high sensitivity of long-term ECG monitoring using an ILR for detecting subclinical paroxysmal AF as a possible etiological factor of cryptogenic ischemic stroke/TIA comparable to the published sources. In the majority of our patients AF would probably not have been detected at all under a shorter ECG monitoring. The causal relationship between the detected AF and ischemic stroke will require a further analysis. A neurogenic type of AF known as AFDAS (atrial fibrillation detected after stroke), which is triggered by an acute ischemic brain lesion, could explain the time correlation between AF and stroke in some of our patients. One limitation of the study could be the selection of patients using the TOAST classifica- tion that is currently being shown to be insufficient, in particular for defining subgroups of patients with suspected subclinical AF. The selection of patients currently requires a close multidisciplinary (neurology-radiology-cardiology) cooperation, the inclusion of new dia - gnos tic procedures, markers, predictive risk scores that were not known at the time when the methodology for this study was being prepared, or were not routinely carried out. Due to a relatively small number of included patients and control subjects, defining a causal relation between paroxysmal AF detected after ischemic stroke (AFDAS) might appear prob- lematic and will require a further sub-analysis. For genetic testing we chose four well-known single nucleotide polymorphisms possibly associated with AF - rs10033464 in PITX2c gene, rs2200733 in PITX2c gene, rs225132 in ERRF11 gene, and rs2106261 in ZFHX3 gene. None of these polymorphisms was shown to be significantly associated with AF in our study. However, in patients with cryptogenic ischemic stroke/ TIA a positive trend for the association of rs2106261 allele A homozygotes with AF was observed. This insignificant direct correlation may relate to the above-men- tioned neurogenic subtype AFDAS which we did not analyse in our study. The possible con- founding factor of these findings can be a relatively small cohort of examined individuals, which was due to the financial limitations of a study, especially by the number of available implantable ECG loop recorders. At present, however, 150 candidate genes have been iden- tified for AF. Their variants could lead to a structural transformation of the heart in the form of atrial cardiomyopathy during intra-uterine development, or induced by stress in adult- hood. For this reason, to confirm our findings and to clarify the exact mechanisms of involvement of candidate SNPs in AF and cryptogenic ischemic stroke, the future genetic and mainly functional studies including a whole-genome sequencing analysis in larger cohorts of individuals in different populations are necessary. We assume that including a genomic approach in the management of patients with cryptogenic ischemic stroke/ TIA might offer a narrower selection of patients for the implantation of a financially costly ILR and an earlier onset of targeted preventive treatment. REFERENCES 1. Boehme AK, Esenwa C, Elkind MSV (2017) Stroke Risk Factors, Genetics, and Prevention. Circ Res 2017; 120:472–495. 2. Wolf PA, Abbott RD, Kannel WB Atrial fibrillation as an independent risk factor for stroke: the Framingham Study. Stroke 1991; 22:983–988. 52 ACTA MEDICA MARTINIANA 2021 21/2 3. Sanna T, Diener H-C, Passman RS et al. Cryptogenic Stroke and Underlying Atrial Fibrillation. N Engl J Med 2014; 370:2478–2486. 4. Benjamin EJ, Rice KM, Arking DE et al. Variants in ZFHX3 are associated with atrial fibrillation in individuals of European ancestry. Nat Genet 2009; 41:879–81. 5. Psaty BM, O’Donnell CJ, Gudnason V et al. Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) Consortium: Design of prospective meta-analyses of genome-wide asso- ciation studies from 5 cohorts. Circ Cardiovasc Genet 2 2009; 73–80. 6. Gretarsdottir S, Thorleifsson G, Manolescu A et al. Risk variants for atrial fibrillation on chromo- some 4q25 associate with ischemic stroke. Ann Neurol 2008; 64:402–9. 7. Gudbjartsson DF, Holm H, Gretarsdottir S et al. A sequence variant in ZFHX3 on 16q22 asso - ciates with atrial fibrillation and ischemic stroke. Nat Genet 2009; 41:876–8. 8. Kääb S, Darbar D, van Noord C et al. Large scale replication and meta-analysis of variants on chromosome 4q25 associated with atrial fibrillation. Eur Heart J 2009; 30:813–9. 9. Sanna T, Diener H-C, Passman RS et al. Cryptogenic stroke and underlying atrial fibrillation. N Engl J Med 2014; 370:2478–86. 10. Marks D, Ho R, Nathan K et al. Abstract 17142: A Real-world Experience For Implantable Loop Recorder Monitoring To Detect Subclinical Atrial Fibrillation In Patients With Cryptogenic Stroke. Circulation 2019; 140:A17142–A17142. 11. Tsivgoulis G, Katsanos AH, Köhrmann M et al. Duration of Implantable Cardiac Monitoring and Detection of Atrial Fibrillation in Ischemic Stroke Patients: A Systematic Review and Meta- Analysis. J stroke 2019; 21:302–311. 12. Kirchhof P, Benussi S, Kotecha D et al. 2016 ESC Guidelines for the management of atrial fibril- lation developed in collaboration with EACTS. Eur J Cardiothorac Surg 2016; 50:e1–e88. 13. Li L, Yiin GS, Geraghty OC et al. Incidence, outcome, risk factors, and long-term prognosis of cryp- togenic transient ischaemic attack and ischaemic stroke: a population-based study. Lancet Neurol 2015; 14:903–913. 14. Kalmarova K, Kurca E, Nosal V et al. Measurement of platelet p-selectin expression by flow cyto- metry in patients with acute ischemic stroke. Acta Medica Martiniana 2018; 18(1):14–20. 15. Bal S, Patel SK, Almekhlafi M, Modi J, Demchuk AM, Coutts SB. High rate of magnetic resonan- ce imaging stroke recurrence in cryptogenic transient ischemic attack and minor stroke patients. Stroke 2012; 43:3387–8 . 16. Das RR, Seshadri S, Beiser AS et al. Prevalence and correlates of silent cerebral infarcts in the Framingham offspring study. Stroke 2008; 39:2929–35. 17. Gaita F, Corsinovi L, Anselmino M et al. Prevalence of silent cerebral ischemia in paroxysmal and persistent atrial fibrillation and correlation with cognitive function. J Am Coll Cardiol 2013; 62:1990–1997. 18. Li C, Wang F, Yang Y et al. Significant association of SNP rs2106261 in the ZFHX3 gene with atrial fibrillation in a Chinese Han GeneID population. Hum Genet 2018; 129:239–46. 19. Zaw KTT, Sato N, Ikeda S et al. Association of ZFHX3 gene variation with atrial fibrillation, cere- bral infarction, and lung thromboembolism: An autopsy study. J Cardiol 2017; 70:180–184. 20. Henninger N, Goddeau RP, Karmarkar A, Helenius J, McManus DD. Atrial Fibrillation Is Asso - ciated With a Worse 90-Day Outcome Than Other Cardioembolic Stroke Subtypes. Stroke 2016; 47:1486–92. 21. Pulit SL, Weng L-C, McArdle PF et al. Atrial fibrillation genetic risk differentiates cardioembolic stroke from other stroke subtypes. Neurol Genet 2018; 4:e293. 22. Wnuk M, Pera J, Jagiełła J et al. The rs2200733 variant on chromosome 4q25 is a risk factor for cardioembolic stroke related to atrial fibrillation in Polish patients. Neurol Neurochir Pol 2011; 45:148–52. 23. Viviani Anselmi C, Novelli V, Roncarati R et al. Association of rs2200733 at 4q25 with atrial flut- ter/fibrillation diseases in an Italian population. Heart 2008; 94:1394–6. 24. Cao Y, Ma F, Wang Y, Wang DW, Ding H. Rs2200733 and rs10033464 on chromosome 4q25 con- fer risk of cardioembolic stroke: an updated meta-analysis. Mol Biol Rep 2013; 40:5977–85. 53 ACTA MEDICA MARTINIANA 2021 21/2 25. Sun L, Zhang Z, Xu J, Xu G, Liu X. Chromosome 4q25 Variants rs2200733, rs10033464, and rs1906591 Contribute to Ischemic Stroke Risk. Mol Neurobiol 2016; 53:3882–3890. 26. Lemmens R, Buysschaert I, Geelen V et al. The association of the 4q25 susceptibility variant for atrial fibrillation with stroke is limited to stroke of cardioembolic etiology. Stroke 2010; 41:1850–7. 27. Kujaník Š. Ventricular arrhytmias and genetics. Acta Medica Martiniana 2007; 7(1):3–9. 28. Traylor M, Farrall M, Holliday EG et al. Genetic risk factors for ischaemic stroke and its subtypes (the METASTROKE collaboration): a meta-analysis of genome-wide association studies. Lancet Neurol 2012; 11:951–62. Acknowledgements The authors would like to thank the patients with cryptogenic ischemic stroke and TIA and healthy control individuals for making this study possible. Received: April, 4, 2021 Accepted: May, 7, 2021
Acta Medica Martiniana – de Gruyter
Published: Aug 1, 2021
Keywords: transient ischemic attack; cryptogenic stroke; atrial fibrillation; implantable loop recorder; single-nucleotide polymorphisms
You can share this free article with as many people as you like with the url below! We hope you enjoy this feature!
Read and print from thousands of top scholarly journals.
Already have an account? Log in
Bookmark this article. You can see your Bookmarks on your DeepDyve Library.
To save an article, log in first, or sign up for a DeepDyve account if you don’t already have one.
Copy and paste the desired citation format or use the link below to download a file formatted for EndNote
Access the full text.
Sign up today, get DeepDyve free for 14 days.
All DeepDyve websites use cookies to improve your online experience. They were placed on your computer when you launched this website. You can change your cookie settings through your browser.