Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/de-gruyter/entomopathogenic-nematode-steinernema-carpocapsae-weiser-rhabditida-9sPRwClaUC
- Publisher
- de Gruyter
- Copyright
- Copyright © 2008 by the
- ISSN
- 1581-9175
- eISSN
- 1854-1941
- DOI
- 10.2478/v10014-008-0015-4
- Publisher site
- See Article on Publisher Site
Abstract
In April 2008, 120 soil samples from 24 locations were collected in Gorenjska, Notranjska and Primorska regions as well as in Ljubljansko barje. The presence of entomopathogenic nematodes was confirmed in 9 samples from 6 locations. Only the sample C101, which was taken in the village Svino in the area of Breginjski kot (western part of Slovenia, the vicinity of Italian border), was sent to genetic analysis. Molecular biological analysis was proved the identity of the sample with the species Steinernema carpocapsae (Weiser). This was the first record of Steinernema carpocapsae in Slovenia. In preceding researches on the fauna of entomopathogenic nematodes in Slovenia, which started in 2007, we already established the occurrence of Steinernema affine (Bovien) and Steinernema feltiae (Filipjev). Key words: entomopathogenic nematodes, Slovenia, Steinernema carpocapsae, biological control IZVLEýEK ENTOMOPATOGENA OGORýICA Steinernema carpocapsae (Weiser) (Rhabditida: Steinernematidae), NOVI PREDSTAVNIK SLOVENSKE FAVNE V aprilu 2008 smo na obmoþju Gorenjske, Notranjske, Primorske in Ljubljanskega barja na 24 lokacijah nabrali 120 talnih vzorcev. Zastopanost entomopatogenih ogorþic smo ugotovili v 9 Young researcher, B. Sc., Jamnikarjeva 101, SI-1111 Ljubljana, email:ziga.laznik@bf.uni-lj.si Ph. D student, M. Sc., Vadastag 2, H-4244 Újfehértó, Hungary Ph. D, Vadastag 2, H-4244 Újfehértó, Hungary Assist. Prof., Ph. D, Jamnikarjeva 101, SI-1111 Ljubljana 352 Acta agriculturae Slovenica, 91 - 2, september 2008 vzorcih s 6 lokacij. V nadaljnjo genetsko analizo smo poslali le vzorec C101. Ta je bil odvzet v vasi Svino na obmoþju Breginjskega kota (skrajni zahod Slovenije na meji z Italijo). Z molekulsko analizo smo identificirali vrsto Steinernema carpocapsae (Weiser). Gre za prvo odkritje omenjene vrste entomopatogene ogorþice pri nas. V predhodnjih raziskavah preuþevanja faune entomopatogenih ogorþic v Sloveniji, ki potekajo od leta 2007, smo ugotovili zastopanost vrst Steinernema affine (Bovien) in Steinernema feltiae (Filipjev). Kljuþne besede: entomopatogene ogorþice, Slovenija, Steinernema carpocapsae, biotiþno varstvo INTRODUCTION It is well known that entomopathogenic nematodes, which are classified into Steinernematidae and Heterorhabditidae families, have great potential as biological control agents in plant protection (Klein, 1990). Their activity against different pest insects is already well studied (Kaya in Gaugler, 1993; Ebssa, 2005). Entomopathogenic nematodes are soil organisms, which live with bacteria in symbiotic-mutualistic relationship. For the first time their importance in biological control was discovered in the United States of America in the thirties of past century (Laznik in Trdan, 2008). At the time of the first record of entomopathogenic nematodes, a hypothesis was raised that these agents by themselves cause death of attacked insects (Gaugler in Kaya, 1990). In 1937, Bovien first mentioned a possibility of symbiotic bacteria to live in mutualistic relationship with entomopathogenic nematodes. His hypothesis was confirmed in 1955 by Dutky and Weiser (Weiser, 1955). In 1982, Boemare gave a proof for production of toxic substances by the nematodes from genus Steinernema. These substances have negative influence on the immune system of infected insect and could also cause death of the host without the presence of symbiotic bacteria. Until now no evidence was given that nematodes from genus Heterorhabditis are capable for their own production of toxins, which would be able to influence a poor viability of invaded insects (Klein, 1990). It is discussed upon symbiotic-mutualistic relationship because nematodes provide shelter and protection for bacteria in an exchange for killing the attacked insects. Latter, bacteria also produce antibiotics, which prevent the development of intraand interspecific competitors, which would also feed on cadavers. Bacteria transform the content of the host into feed, suitable for nematodes and also bacteria themselves are feed for nematodes (Kaya in Koppenhöfer, 1999). Nematodes from the family Steinernematidae live in symbiosis with bacteria from genus Xenorhabdus, meanwhile it is well know for the ones from the family Heterorhabditidae that they have the same association with bacteria from genus Photorhabdus (Forst et al., 1997). In Slovenia, momentarily only entomopathogenic nematode Steinernema feltiae has a status of indigenous species (MAFF, 2008); therefore only this species can be applied in the field. With the researches, which results we also present in this paper, we want to enlist as more species of entomopathogenic nematodes as it is possible, LAZNIK, Z. et al.: Entomopathogenic nematode Steinernema carpocapsae (Weiser)... 353 while in foreign countries they worth as alternatives to insecticides in controling pest insects. The strain C101, which we present in a current paper, we plan to use in extensive experiments in the future; first in the laboratory and afterward, when its status will be administratively entrenched, also in the field. 2 MATERIALS AND METHODS In April 2008, we examined 120 soil samples from 24 different locations on the occurrence of EPNs in Slovenia. The soil samples, four from each region, were taken in Gorenjska, Notranjska and Primorska region as well as in Ljubljansko barje. We used »Galleria bait method«, which is the most frequently used method of EPNs detection from soil. After the death of greater wax moth (Galleria mellonella [Linnaeus]) larvae, we dried cadavers for 12 days and put them in so called »White trap« (Bedding and Akhurst, 1975) to separate the nematodes from death larvae. The suspension, which was acquired in this way, was used for artificial infection of the larvae of greater wax moth. Following procedure contained the use of centrifuge and 5 % concentration of sodium hypochlorate. The aim of this process was to acquire infective juveniles from the suspension. We confirmed the presence of nematodes in 9 soil samples of 6 locations. Only 1 positive sample, C101 (taken on the arable field near village Svino in Breginjski kot (NW Slovenia, 46°14 N, 13°33 E, 285 m alt.) was identified to this time. RESULTS To confirm the identification of isolated nematodes from larvae of wax moth, a selected sample was analysed by molecular biological approach. Genomic DNA was extracted from individual nematodes and PCR was performed to multiply ITS region using primers TW81 and AB28 after Hominick et al. (1997). PCR product were reisolated from 1 % TAE-buffered agarose gel using QIAquick Gel Extraction Kit (Qiagen, USA). Reisolated sample was sequenced in the laboratory of Biological Research Centre in Szeged, Hungary. The sequence was submitted into GenBank public database (Accession Number: EU914854). Sample DNA sequence was compared to sequences of species Steinernema using BLAST search in National Centre for Biotechnology Information (NCBI) web site (www.ncbi.nlm.nih.gov). The sequences producing significant alignments and at least 99 % identity were derived from Steinernema carpocapsae: GenBank Accession No. AY171282 and EU122951 (Spiridonov et al., 2004) (Fig. 1). 9833 1 GGAA-GA-CATTATTGAGCTAATATT-TTCC-TTTTCT-ATCAAGTTTTCGCTGCTCGT 54 AY171282 1 .............-....-....-.A...............T.... 43 EU122951 103 ....G..T..................-....-....-.A...............T.... 158 AY171280 1 ..........-..C....A....-A....G..C...-....T.... 43 9833 55 TTCTAAGCTTTAACTTGACCTCTAACGGCTTTGAAAGGTTTCTACAGATGTTTGGAGCA 113 AY171282 44 ..................T........................................ 102 354 Acta agriculturae Slovenica, 91 - 2, september 2008 EU122951 159 .................-G........................................ 216 AY171280 44 ........A..G...C..--..-.--T........T........T...C.......... 97 9833 114 GTTG-TAT-GAGCGTGACTGTGCTGATGAACATTGTACATTGTTATCTAAGC-GTTTCG 169 AY171282 103 ....-...-...........................................-...... 158 EU122951 217 ....-...-...........................................-...... 272 AY171280 98 ..CA-.-.CA............G....-..G.G..T...T...C..-.--..A.-.... 149 9833 170 ATGTTTCTAGAATGCTTAGTGATGAGAATTAAAGAGGTCTGCTGACTCGCCATTCTTTG 228 AY171282 159 ........................................................... 217 EU122951 273 ........................................................... 331 AY171280 150 .C......T..........C...............A..................-.... 207 9833 229 ATTGCTAACAAAAACGTTTTGTTTCGATAATTGTGTCACTCGTTGATGCATTTTTTAAA287 AY171282 218 ..........................................................T276 EU122951 332 ..............-......G..-.......-................-.....-..- 384 AY171280 208 ........................T...TT..........T......A....A..C..T266 9833 288 NATCAAGTCTTATCGGTGGATCACTCGGTTCGTAGGTCGATGAAAAACGGGGCAAAAAC 346 AY171282 277 T.......................................................... 335 EU122951 385 TT..-......A.........................................-..... 441 AY171280 267 T.......................................................... 325 9833 347 CGTTATTTGGCGTGAATTGCAGACATATTGAGCGCTAAAATTTTGAACGCAAATGGCACT 406 AY171282 336 ............................................................ 395 EU122951 442 ........................-.................................. 499 LAZNIK, Z. et al.: Entomopathogenic nematode Steinernema carpocapsae (Weiser)... 355 AY171280 326 ............................................................ 385 9833 407 AACAGGTTTTTATCTGTTAGTATGTTCAATTGAGGGTCTTTTGACTAGAATCTGGCAATC 466 AY171282 396 ............................................................ 455 EU122951 500 ........................................................... 558 AY171280 386 ......G..-................................................. 443 9833 467 --G-T-G--AA AY171282 456 --.-.-.--.. EU122951 559 --.-.-.--.. AY171280 444 --.-.A.TG.. CGCTGTGATTGCTTTTTCGGTAA-GCTACTTTGCT-T-T--T-508 G......................-...........-.-.--.-497 G......................-...........-.-.--.-600 G.............C.....A..-...........-.-.AG.-490 9833 509 GTACCTTTTCNGTATGGCTATTTGATTGTCTAACGGATGTCTGGCTAGCTGCTTCTTTGC 568 AY171282 498 ..........G......................T.................T........ 557 EU122951 601 ..........G......................T.................T........ 660 AY171280 491 ..........G..................A...T..........T......T........ 550 9833 569 TAGACGTCTGCAATCATTCGGCATTGCGTAGTGTTTGATTAATGGTTTAGCGCGTTTCT 627 AY171282 558 ..................T........................................ 616 EU122951 661 ..................T........................................ 719 AY171280 551 ..................T...T...............AC...A....-........... 609 9833 628 TGCTAACTGACTTTTACACAAGCAAGTGTAATACGTTTCTTAAAGTCAGCTCATTAATCA 687 AY171282 617 ............................................................ 676 356 Acta agriculturae Slovenica, 91 - 2, september 2008 EU122951 720 ............................................................ 779 AY171280 610 ...............G................T........G.........-....T... 668 9833 688 ATGTGGTTTTCTGACTTGATTTGTCGGTCAATTGTGCTATGCTCTG-CTAATCTTTTCG 745 AY171282 677 ..............................................-............ 734 EU122951 780 ..............................................-............ 837 AY171280 669 ..T.............C.C.........TT.C..............T.-.......... 726 9833 AY171282 EU122951 AY171280 746 735 838 727 AACT-AGACCTCAATT-GAGC ....-....... ....-...........T.... ....-......... 764 745 857 739 Figure 1: Multiple sequence alignment of the ITS rDNA region (including partial fragments of the 18S and 28S rRNA genes) of 4 Steinernema species. Code 9833 correspond to the Slovenian isolate of Steinernema carpocapsae (C101). Codes AY171282 and EU122951 are Steinernema carpocapsae strains from Russia and Iran, respectively. Code AY171280 correspond to Steinernema tami strain from Vietnam. DISCUSSION Genetic studies proved that the nematode species is Steinernema carpocapsae (Weiser, 1955) (Fig. 1). The ITS1-5.8S-ITS2 region, including the partial 18S and 28S rRNA genes (flanked by above primers) of Slovenian isolate C101 is 746 bp long. BLAST searches (Altschul et al., 1990) in GenBank showed that Slovenian isolate C101 (Fig. 2) has a high similarity (99 %) with those sequences available for S. carpocapsae populations (e.g. accession numbers AY171282 and EU122951). Sequence of other species from carpocapsae group, namely S. tami was obtained from GenBank searches that exhibited a lesser degree of similarity with the Slovenian isolate and other S. carpocapsae populations (e.g. accesion number AY171280) (Fig. 1). The present study constitutes the first report of S. carpocapsae in Slovenia. S. carpocapsae has a wide distribution in temperate regions, being one of the most common species found in Europe (overall in 15 countries), and in many other parts of the world (for a detailed EPN species distribution see Hominick, 2002). We can place mentioned species into »carpocapsae group« of nematodes from genus Steinernema (Nguyen, 2006); for infective juveniles it is known that they are less than 600 m long (Fig. 2). This nematode lives in symbiosis with bacterium Xenorhabdus nematophila (Akhurst, 1980). The nematode was first recorded in LAZNIK, Z. et al.: Entomopathogenic nematode Steinernema carpocapsae (Weiser)... 357 1955. Steinernema carpocapsae is the most studied, available, and versatile of all entomopathogenic nematodes (Gaugler, 2002). Figure 2: Entomopathogenic nematode Steinernema carpocapsae (strain C101). Important attributes include ease of mass production and ability to formulate in a partially desiccated state that provides several months of room-temperature shelf-life (Gaugler et al., 2002). Particularly effective against lepidopterous larvae, including various webworms, cutworms, armyworms, girdlers, and wood-borers (Georgis et al., 1991). This species is a classic sit-and-wait or "ambush" forager, standing on its tail in an upright position near the soil surface and attaching to passing hosts (Campbell et al., 2003). Consequently, S. carpocapsae tends to be most effective when applied against highly mobile surface-adapted insects. Highly responsive to carbon dioxide once a host has been contacted, the spiracles are a key portal of host entry. It is most effective at temperatures ranging from 22 to 28 °C (Georgis et al., 1991). 358 Acta agriculturae Slovenica, 91 - 2, september 2008 In Europe, the occurrence of S. carpocapsae was up to now confirmed in Austria, Bulgaria, Czech Republic, France, Germany, Great Britain, Italy, Norway, Poland, Portugal, Slovakia, Spain, Sweden and Switzerland (Hominick, 2002). Among entomopathogenic nematodes only Steinernema feltiae has a status of indigenous species for the time being (Laznik et al., 2008; MAFF, 2008). While in Slovenia, the effectiveness of this species was already tested in the field experiment (Laznik, 2008, unpubl.), this was yet not the case for S. carpocapsae. When also the latter species will shift from exotic agents list, we will test its activity against the pest insects in the open too. The most intensive experiments will be done against these insect pests against which we do not have registered insecticides, their number is limited, and specially against the insects, which already developed the resistance to insecticides. ACKNOWLEDGEMENTS This work is a part of program Horticulture No P4-0013-0481 granted by Slovenian Ministry of Higher Education, Science and Technology.
Journal
Acta Agriculturae Slovenica – de Gruyter
Published: Sep 1, 2008