Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Aluminum-Induced Alterations in Purinergic System Parameters of BV-2 Brain Microglial Cells

Aluminum-Induced Alterations in Purinergic System Parameters of BV-2 Brain Microglial Cells Hindawi Journal of Immunology Research Volume 2021, Article ID 2695490, 10 pages https://doi.org/10.1155/2021/2695490 Research Article Aluminum-Induced Alterations in Purinergic System Parameters of BV-2 Brain Microglial Cells 1 1 Charles Elias Assmann , Vitor Bastianello Mostardeiro, 2 1 3 Grazielle Castagna Cezimbra Weis, Karine Paula Reichert, Audrei de Oliveira Alves, 1 4 1 Vanessa Valéria Miron, Margarete Dulce Bagatini, Taís Vidal Palma, 1 5 6 Cinthia Melazzo de Andrade, Micheli Mainardi Pillat, Fabiano Barbosa Carvalho, 7,8 3,9 Cristina Ruedell Reschke, Ivana Beatrice Mânica da Cruz, 1 1 Maria Rosa Chitolina Schetinger, and Vera Maria Melchiors Morsch Postgraduate Program in Biological Sciences, Toxicological Biochemistry, Department of Biochemistry and Molecular Biology, Federal University of Santa Maria, Santa Maria, RS, Brazil Postgraduate Program in Food Science and Technology, Department of Food Science and Technology, Federal University of Santa Maria, Santa Maria, RS, Brazil Postgraduate Program in Pharmacology, Department of Physiology and Pharmacology, Federal University of Santa Maria, Santa Maria, RS, Brazil Postgraduate Program in Biomedical Sciences, Federal University of Fronteira Sul, Chapecó, SC, Brazil Department of Microbiology and Parasitology, Federal University of Santa Maria, Santa Maria, RS, Brazil Federal University of Health Sciences of Porto Alegre, Porto Alegre, RS, Brazil School of Pharmacy and Biomolecular Sciences, Royal College of Surgeons in Ireland, Dublin, Ireland FutureNeuro Research Centre, Dublin, Ireland Postgraduate Program in Gerontology, Federal University of Santa Maria, Santa Maria, RS, Brazil Correspondence should be addressed to Charles Elias Assmann; charles.ufsm@gmail.com and Vera Maria Melchiors Morsch; veramorsch@gmail.com Received 21 April 2020; Revised 6 August 2020; Accepted 19 September 2020; Published 19 January 2021 Academic Editor: Peirong Jiao Copyright © 2021 Charles Elias Assmann et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Aluminum (Al) is ubiquitously present in the environment and known to be a neurotoxin for humans. The trivalent free Al anion 3+ (Al ) can cross the blood-brain barrier (BBB), accumulate in the brain, and elicit harmful effects to the central nervous system (CNS) cells. Thus, evidence has suggested that Al increases the risk of developing neurodegenerative diseases, particularly Alzheimer’s disease (AD). Purinergic signaling has been shown to play a role in several neurological conditions as it can modulate the functioning of several cell types, such as microglial cells, the main resident immune cells of the CNS. However, Al effects on microglial cells and the role of the purinergic system remain elusive. Based on this background, this study is aimed at assessing the modulation of Al on purinergic system parameters of microglial cells. An in vitro study was performed using brain microglial cells exposed to Al chloride (AlCl ) and lipopolysaccharide (LPS) for 96 h. The uptake of Al, metabolism of nucleotides (ATP, ADP, and AMP) and nucleoside (adenosine), and the gene expression and protein density of purinoceptors were investigated. The results showed that both Al and LPS increased the breakdown of adenosine, whereas they decreased nucleotide hydrolysis. Furthermore, the findings revealed that both Al and LPS triggered an increase in gene expression and protein density of P2X7R and A2AR receptors, whereas reduced the A1R receptor expression and density. Taken together, the results showed that Al and LPS altered the setup of the purinergic system of microglial cells. Thus, this study provides new insights into the involvement of the purinergic system in the mechanisms underlying Al toxicity in microglial cells. 2 Journal of Immunology Research 1. Introduction erative conditions. In this sense, this study is aimed at pri- marily investigating whether the exposure to Al (in the The prevalence of chronic neurodegenerative disorders, such AlCl form) could alter some purinergic system parameters as Alzheimer’s disease (AD), is growing considerably with using an in vitro model of microglial cells. the rise of global life expectancy. The gradual decline of motor and/or cognitive capacities associated with these mor- 2. Materials and Methods bidities is of major concern; however, the underlying mecha- nisms are still not fully understood [1, 2]. Evidence has 2.1. Chemicals and Reagents. This investigation used chemi- pointed out that some environmental factors, such as alumi- cals and reagents of analytical grade obtained from Sigma- num (Al), could be an etiological cause and associated with a Aldrich Inc. (St. Louis, MO, USA) and Merck KGaA (Darm- higher risk of developing AD [3, 4]. Al is a lightweight metal stadt, Germany). All other reagents otherwise not stated were ubiquitously found in the environment, resulting in a nearly of chemical purity. Materials used in cell culture procedures unavoidable contact of humans to this element [5]. Human were acquired from Kasvi (São José dos Pinhais, PR, Brazil), exposure to this metal can occur by several routes, including Corning Inc. (Corning, NY, USA), and Vitrocell Embriolife drinking water, foods, occupational exposure, and vaccines, (Campinas, SP, Brazil). Western blot and molecular biology among others [5, 6]. reagents were purchased from Bio-Rad Laboratories (Hercu- 3+ Its highly toxic form, the trivalent free Al ion (Al ), can les, CA, USA), Merck KGaA, and Sigma-Aldrich Inc. All cross the blood-brain barrier (BBB), alter membrane func- measurement analyses were carried out using a SpectraMax® tion, and accumulate in the human brain throughout life i3 Multimode Plate Reader (Molecular Devices, Sunnyvale, [6–9]. Literature data have indicated that Al is a neurotoxic CA, USA). The fluorescent images were captured using an metal that may lead to alterations associated with neurode- Olympus Fluorescent Microscope (Fluoview FV101, Olym- generation and brain aging, among others, characteristics pus, Tokyo, Japan). also found in AD [3, 9–11]. Moreover, recent evidence using 3+ a model of neural progenitor cells (NPCs) have suggested 2.2. Al. For this research, Al in the chloride form (AlCl ; 3+ −1 that Al may also affect neurogenesis [12] and purinergic molecular weight 133.34 g mol ; 99% purity) was purchased signaling [13]. from Sigma-Aldrich Inc. All laboratory materials (flasks, The purinergic signaling system includes a cascade of plates, tips, tubes, etc.) and glassware were immersed in a extracellular nucleotides- and nucleoside-catalyzing enzymes 10% HNO /ethanol (v/v) solution for 48 h and then washed that participate in the metabolism of ATP (adenosine tri- with Milli-Q® ultrapure water to avoid external contamina- phosphate) to ADP (adenosine diphosphate) and/or AMP tion by the metal. All solutions were prepared using deconta- (adenosine monophosphate) (NTPDase/CD39, nucleoside minated materials and Milli-Q® ultrapure water. All triphosphate diphosphohydrolase), followed by the conver- laboratory and cell culture protocols were performed in a ′ ′ sion of AMP to adenosine (5 -NT/CD73, 5 -nucleotidase) clean workbench to avoid contamination by external Al sources. and of adenosine to inosine (ADA, adenosine deaminase) [14–17]. Moreover, ATP and adenosine can operate as sig- naling molecules through their binding to specific purinergic 2.3. Experimental Design of Cell Culture Protocols and Exposure to Toxicants. This in vitro study used the mouse receptors. P1 adenosine receptors (A1, A2A, A2B, and A3), which are all G protein-coupled receptors, are selective to brain BV-2 microglial cell line, purchased from the Rio de Janeiro Cell Bank (BCRJ, Rio de Janeiro, RJ, Brazil). The cells adenosine. Purine nucleotides, such as ATP and ADP, and pyrimidine nucleotides, such as UTP (uridine triphosphate) were cultured using Roswell Park Memorial Institute (RPMI) and UDP (uridine diphosphate), act on P2 receptors, which 1640 medium (4500 mg/L glucose, 1500 mg/L sodium bicar- bonate, 2 mM L-glutamine, and 1 mM sodium pyruvate), are subdivided into P2X ionotropic receptors (P2X1-7) and P2Y receptors (P2Y1/2/4/6/11/12/13/14) which are coupled added with fetal bovine serum (FBS) to a final concentration of 10% and supplemented with 1% penicillin/streptomycin to G proteins [18–20]. Purinergic signaling may operate in a wide range of bio- (10.000 U/mL; 10 mg/mL). The cells were grown in standard logical functions including neurotransmission and neuroin- conditions by using a humidified and controlled atmosphere of 5% carbon dioxide (CO )at 37 C. flammation and also in disease conditions [21–23]. Particularly in the central nervous system (CNS), this signal- The cells were treated with an increasing concentration- 3+ effect curve of the trivalent free Al ion (Al ) in the form of ing pathway may also orchestrate immune cell responses, including microglial activation and the release of inflamma- Al chloride (AlCl ), consisting of 1, 5, 10, 50, 100, 500, and tory cytokines, among others [22, 24]. Microglia comprise 1000 μM of AlCl , based on a previous work [27]. The control the main cells of the neuroimmune system acting in the clear- group (C) consisted of cells that received only the culture ance of noxious stimuli and limiting tissue damage [25, 26] medium. Lipopolysaccharide (LPS) at the concentration of 1 μg/mL was used as a positive inflammatory control since and exhibit fundamentally all the repertoire of components of the purinergic system [22, 24]. it has been suggested that this agent causes neuroinflamma- However, mechanisms of Al toxicity in the brain related tory states [28, 29]. For culture protocols, cells were grown to the purinergic system, especially on microglial cells, in 6-well plates at the concentration of 1×10 cells/mL for remain elusive and it is essential to understand the role of this 96 h to investigate the subchronic effects of Al and LPS metal in the neuroinflammatory responses and neurodegen- exposure. Journal of Immunology Research 3 ° ° the reaction were as follows: 25 2.4. Al Staining. Lumogallion (Santa Cruz Biotechnology, C for 5 min, 42 C for ° ° Inc., Dallas, TX, USA) is a reagent that can be used for the 30 min, 85 C for 5 min, and a final step of 5 C for 60 min, per- detection of Al in both tissues and cells. In brief, for this formed using a thermal cycler equipment. assay, cells were initially prepared on poly-lysine-coated The RT-qPCR reaction was performed using 19 μLofa slides and then incubated in the dark at 37 C for 24 h with mix containing the iTaq Universal SYBR Green Supermix Lumogallion (100 μM). Then, slides were washed with ultra- (Bio-Rad Laboratories) and 1 μL of the cDNA sample. The pure water, air-dried, and fixed in paraformaldehyde (PFA, parameters used were a holding step of 3 min at 95 C, ° ° 4%) at room temperature for 15 min and washed again. DAPI followed by a cycling step of 40 cycles at 95 C for 10 s, 60 C ′ for 30 s, and last a melting step with a melting curve of (4 ,6-diamidino-2-phenylindole) reagent (0.3 mg/mL, ° ° ° 65 Cto95 C with an increase of 0.5 C for 5 s. The relative Sigma-Aldrich Inc.) was used to stain cell nuclei. Labeling expression of each gene was represented as the fold expres- with DAPI was performed protected from light during sion compared to the control group and calculated by using 5 min at room temperature, and subsequently, the staining ΔΔ the comparative CT value. The β-actin (Actb) gene was solution was removed, cells were washed, and coverslips were used as the internal control to normalize gene expression. placed on slides, following similar procedures described before [30, 31]. Finally, images were taken using an Olympus ′ ′ The forward and reverse sequences of oligos (5 -3 ) used Fluorescent Microscope. for each gene were as follows: β-actin (F): CCGTAAAGA CCTCTATGCCAAC; β-actin (R): AGGAGCCAGAGCAG 2.5. Purinergic System Enzyme Activities TAATCT; P2X7R (F): CTTTGCTTTGGTGAGCGATAAG; P2X7R (R): CACCTCTGCTATGCCTTTGA; A1R (F): 2.5.1. NTPDase and 5 -NT Activities. The release of inorganic GGCCATAAAGTCCTTGGGAAT; A1R (R): CAGGAA phosphate was employed to determine the enzymatic activi- GTTCAGGGCAAGAA; A2AR (F): TCACGTCTCAGGAT ties of NTPDase [32] and 5 -NT [33], similarly to guidelines TGAGTTTAG; A2AR (R): CCCGAAGGAAAGGCAGTAG. published before. Briefly, cells were initially suspended in saline (NaCl, 0.9%), and 20 μL of samples was added to the 2.6.2. Protein Density. Protein density by Western blot anal- reaction mixture of each enzyme and preincubated at 37 C ysis of the P2X7R, A2AR, and A1R receptors was performed for 10 min. The enzymatic reaction was initiated by adding based on a prior work [36]. In brief, cells were initially the specific substrates for each enzyme: ATP and ADP for homogenized in ice-cold radioimmunoprecipitation assay NTPDase and AMP for 5 -NT. (RIPA) buffer added with 1 mM phosphatase and protease The reactions were stopped by the addition of trichloro- inhibitors and centrifuged at 12,000 rpm at 4 C for 10 min. acetic acid (TCA, 10%), and the released inorganic phosphate Subsequently, samples were separated using sodium dodecyl due to ATP, ADP, and AMP hydrolysis was determined by sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and using malachite green as the colorimetric reagent. A standard transferred to Immun-Blot® PVDF membranes (Bio-Rad curve was prepared with KH PO , and absorbance was read 2 4 Laboratories). After blocking, membranes were incubated at 630 nm. Controls were performed to correct for nonenzy- overnight at 4 C with the primary antibodies: P2X7R (dilu- matic hydrolysis. Enzyme-specific activities were reported as tion 1 : 500), A2AR (dilution 1 : 800), and A1R (dilution nmol of Pi released per min per mg of protein. 1 : 500), all obtained from Santa Cruz Biotechnology, Inc. After this step, membranes were washed with Tris-buffered 2.5.2. ADA Activity. ADA activity was performed based on saline (pH 7.6) with 0.1% Tween 20 (TBST) and further incu- the measurement of ammonia produced when this enzyme bated with anti-rabbit or anti-mouse secondary antibodies acts in the excess of adenosine, following a previously pub- (dilution 1 : 10.000, Santa Cruz Biotechnology, Inc.) at room lished method [34]. In brief, 50 μL of cell suspension reacted temperature for 90 min. The membranes were washed again, with 21 mmol/L of adenosine (pH 6.5) at 37 C for 60 min. incubated with an enhanced chemifluorescent substrate After the incubation period, the reaction was stopped by (Immobilon® Forte Western HRP Substrate, Merck KGaA), the addition of 167.8 mM sodium nitroprusside, 106.2 mM and analyzed with a ChemiDoc Imaging System (Bio-Rad phenol, and a sodium hypochlorite solution. The amount of Laboratories). As a control for protein concentration, mem- ammonia produced was quantified at 620 nm, and the results branes were reprobed and tested for β-actin immunoreactiv- were expressed as U Ado (adenosine) per mg of protein. ity (dilution 1 : 1000, Santa Cruz Biotechnology, Inc.). 2.6. Purinergic System Receptors 2.7. Protein Determination. The protein in samples was 2.6.1. Gene Expression. The gene expression modulation of determined using the Coomassie Blue reagent following the the purinergic receptors P2X7R (P2rx7), A2AR (Adora2a), method previously described and using serum albumin as and A1R (Adora1) was carried out by real-time quantitative standard [37]. The protein of samples (mg/mL) was adjusted polymerase chain reaction (RT-qPCR) analysis, based on a according to each assay. previous report [35]. Briefly, RNA was initially obtained from samples with TRIzol™ reagent (Invitrogen™), quanti- 2.8. Statistical Analysis. The results were compared by one- fied spectrophotometrically, and reversely transcribed into way analysis of variance (ANOVA) followed by Tukey’s post cDNA with the iScript™ cDNA synthesis kit (Bio-Rad Labo- hoc test and presented as the mean ± SD. The GraphPad ratories), by the addition to each sample of 1 μL of iScript Prism software version 6 (GraphPad Software, Inc.; La Jolla, reverse transcriptase and 4 μL of the iScript Mix. Steps of CA, USA) was used to perform statistical analysis. The results 4 Journal of Immunology Research (a) (b) (c) (a) (b) (c) (d) (e) (f ) (d) (e) (f) (g) (h) (i) (g) (h) (i) Figure 1: Representative fluorescence microscopy of microglial cells stained with DAPI (blue, cell nuclei) and Lumogallion probe (orange) to track uptake of Al: (a) control; (b) lipopolysaccharide (LPS, 1 μg/mL); (c) AlCl (1 μM); (d) AlCl (5 μM); (e) AlCl (10 μM); (f) AlCl 3 3 3 3 (50 μM); (g) AlCl (100 μM); (h) AlCl (500 μM); (i) AlCl (1000 μM). Magnification = 200x. Scale bar = 20 μm. n =3. 3 3 3 were considered statistically significant when p <0:05. All activity of purinergic system ectoenzymes, the breakdown experiments were carried out in triplicate. of nucleotides and nucleoside was evaluated in microglial cells and the results are shown in Figure 2. NTPDase activity was assessed by ATP and ADP hydrolysis (Figures 2(a) and 3. Results 2(b)). LPS was shown to significantly reduce the hydrolysis of ATP and ADP when compared to control cells. Moreover, 3.1. Al Can Be Tracked by Lumogallion Fluorescent Probe in BV-2 Microglial Cells. To track the possible uptake of Al by the AlCl concentrations of 500 and 1000 μM also reduced cells, we used Lumogallion staining and demonstrative ATP hydrolysis, and AlCl at 1000 μM also decreased ADP images are shown in Figure 1. Control cells (Figure 1(a)) hydrolysis when compared to control cells. The activity of and cells cultured with LPS (Figure 1(b)), both in the absence ′ 5 -NT was assessed by AMP hydrolysis (Figure 2(c)), and of Al, only showed blue fluorescence produced by DAPI, results revealed that LPS and AlCl at 500 and 1000 μM which is used to indicate cell nuclei. In this case, when images decreased AMP hydrolysis when compared to control cells. taken with DAPI and Lumogallion reagent were overlaid, Following the ectoenzyme cascade, ADA activity only blue fluorescence was emitted. However, cells cultured (Figure 2(d)) was measured by the deamination of adenosine in the presence of AlCl at the concentrations of 1-1000 μM and findings revealed that LPS and AlCl at the concentra- (Figure 1(c)–1(i)) showed an orange labeling representative tions of 500 and 1000 μM augmented nucleoside breakdown of Lumogallion staining, and overlaid images also revealed compared to control cells. a blue fluorescence related to DAPI nuclei staining. Thus, the free Al ion can be internalized by microglial cells as sug- 3.3. Al and LPS Modulate the Expression and Density of gested by the orange concentration-dependent intensity Purinoceptors. Since Al and LPS modulated ectoenzyme tracked by Lumogallion staining. activities, we also investigated whether these compounds could alter the expression and density of purinergic recep- 3.2. Al and LPS Alter the Activity of Purinergic System tors. Figure 3 shows the results from the analysis by RT- Ectoenzymes. To verify if Al and LPS could modulate the qPCR performed to assess the modulation of the P2X7R, Journal of Immunology Research 5 ATP hydrolysis ADP hydrolysis 40 40 30 30 ⁎⁎ ⁎⁎⁎ ⁎⁎ ⁎⁎ ⁎⁎ 20 20 10 10 0 0 C LPS 1 5 10 50 100 500 1000 C LPS 1 5 10 50 100 500 1000 AlCl (𝜇M) AlCl (𝜇M) 3 3 (a) (b) AMP hydrolysis Adenosine breakdown ⁎⁎⁎ ⁎⁎ ⁎⁎ C LPS 1 5 10 50 100 500 1000 C LPS 1 5 10 50 100 500 1000 AlCl (𝜇M) AlCl (𝜇M) 3 3 (c) (d) Figure 2: Purinergic enzyme activities of microglial cells treated with LPS (1 μg/mL) and increasing concentrations of AlCl (1–1000 μM) for 96 h. NTPDase activity using (a) ATP and (b) ADP as substrates, (c) 5′-NT activity using AMP as substrate, (d) ADA activity using adenosine as substrate. C = control group; LPS = lipopolysaccharide. Values are expressed as mean ± SD (n =3). Statistical significance in comparison ∗ ∗∗ ∗∗∗ to the control group. p <0:05, p <0:01, and p <0:001. One-way ANOVA followed by Tukey’s post hoc test. A2AR, and A1R purinoceptor gene expression. Results the changes in ectoenzymes activities and expression/den- showed that both LPS and Al significantly upregulated the sity of purinoceptors. 3+ expression of the P2X7R and A2AR purinoceptors whereas Since Al , the neurotoxic and biologically reactive Al they downregulated the expression of the A1R purinoceptor free ion, can pass the BBB and deposit in the brain tissue when compared to the control group. Complementary to [6–9], microglial cells are within the reach of this element. RT-qPCR findings, Western blot analysis also showed that Therefore, the possible uptake of Al was tracked qualitatively LPS and Al were capable of modulating the protein levels of using Lumogallion fluorescent probe. This chemical has been purinoceptors by significantly upregulating the density of the proposed to generate an orange fluorescence signal when 3+ P2X7R and A2AR receptors and downregulating the density binding to the soluble Al free ion [13, 31], as indicated in of the A1R receptor compared to the control group (Figure 4). Figure 1(c)–1(i), leading to the suggestion that Al can be internalized by these immune cells. Based on this assumption, it is relevant to comprehend the 4. Discussion possible mechanisms related to the toxicity of the different stimuli used here in microglial cells. It is also noteworthy to Literature data have underlined the involvement of the comment that, although there are shortcomings of employing purinergic system in the inflammatory responses and in vitro cellular models, the cell line used here has been pro- microglia behavior within the CNS [22, 24]. However, posed as a valuable substitute platform for in vivo microglia [38], suggesting these immune cells as a potential tool to inves- the impact of Al on the modulation of the purinergic sys- tem in microglial cells is poorly understood. In the current tigate the effects triggered by the exposure to toxic agents. study, we showed that Al, and also LPS, disturbed some Insults and noxious stimuli that alter CNS homeostasis, purinergic system parameters of BV-2 cells, evidenced by such as Al and LPS, may trigger the outpour of key purinergic NTPDase activity 5′-NT activity (nmol Pi/min/mg of protein) (nmol Pi/min/mg of protein) ADA activity NTPDase activity (U Ado/mg of protein) (nmol Pi/min/mg of protein) 6 Journal of Immunology Research P2X7R A2AR 4 6 ⁎⁎⁎⁎ ⁎⁎⁎⁎ ⁎⁎⁎ ⁎⁎ 𝛽 𝛽 Control LPS Al Control LPS Al (a) (b) A1R 1.5 1.0 ⁎⁎⁎ 0.5 0.0 Control LPS Al (c) Figure 3: Gene expression of purinoceptors by RT-qPCR analysis of microglial cells treated with LPS (1 μg/mL) and AlCl (1000 μM) for 96 h. Al = aluminum; LPS = lipopolysaccharide. Values are expressed as mean ± SD (n =3) of the relative concentration compared to the ∗ ∗ ∗∗ ∗∗∗ ∗∗∗∗ control group. Statistical significance in comparison to the control group. p <0:05, p <0:01, p <0:001, and p <0:001. One-way ANOVA followed by Tukey’s post hoc test. ~ 45 kDa P2X7R ~ 65 kDa A2AR 𝛽-Actin ~ 42 kDa 𝛽-Actin ~ 42 kDa 250 ⁎⁎⁎⁎ ⁎⁎⁎⁎ ⁎⁎ ⁎⁎⁎ Control LPS Al Control LPS Al (a) (b) ~ 37 kDa A1R ~ 42 kDa 𝛽-Actin ⁎⁎⁎ Control LPS Al (c) Figure 4: Protein density of purinoceptors by Western blot analysis of microglial cells treated with LPS (1 μg/mL) and AlCl (1000 μM) for 96 h. Al = aluminum; LPS = lipopolysaccharide. Values are expressed as mean ± SD (n =3). Statistical significance in comparison to the ∗ ∗∗ ∗∗∗ ∗∗∗∗ control group. p <0:05, p <0:01, p <0:001, and p <0:001. One-way ANOVA followed by Tukey’s post hoc test. messengers from microglial cells [24]. Changes in the levels [14–17]. In this way, the possible changes in the activity of of extracellular molecules, such as ATP and its breakdown these key enzymes were further investigated. Similar to our products, are sensed by membrane-bound enzymes of the findings, a previous investigation using blood lymphocytes purinergic pathway, including NTPDase, 5 -NT, and ADA of rats [39] also reported that LPS may affect the metabolism P2X7R % of the control (% of the control) (-actin normalized) A1R % of the control (% of the control) (-actin normalized) A2AR % of the control (% of the control) (-actin normalized) Journal of Immunology Research 7 density of the A1R receptor were found decreased whereas of nucleotides and nucleoside, reducing ATP hydrolysis and increasing adenosine breakdown. Moreover, ATP and AMP A2AR receptor expression/density were increased. These hydrolysis as well as NTPDase1 and 5 -NT expression have findings are of significance considering that A1R receptors been shown diminished in a model of M1 macrophages (inhibitory) have been mainly associated with neuroprotec- (challenged with LPS) [40]. tion whereas the A2AR receptors (facilitatory) to neurode- Concerning the effects observed for Al on enzyme activi- generation and neuroinflammation. Moreover, the 3+ ties, these could reflect the capacity of Al to substitute metal antagonism of A2AR receptors may also provide neuropro- ions and/or its interaction with nucleotides. The Al free ion tection in several disease conditions [47, 48, 56–58]. How- 2+ ever, inhibition of both adenosine receptors, A1R and may be able to displace native ions, such as Mg , at protein binding sites, thus being able to affect their biological func- A2AR, has also been suggested to afford neuroprotection against AlCl tions [9, 41–43]. For instance, NTPDase is a metalloenzyme exposure in neuroblastoma cells [59]. There- 2+ 2+ that requires Ca or Mg ions for its optimal activity and fore, these outcomes and the findings of our study highlight may have its functioning altered in the lack of these ions that adenosine receptors are also candidates for further 3+ [15]. Moreover, the ability of Al to interact with molecules, investigation. such as ATP [43], could reduce the availability of this nucle- Taken together, our findings suggested that microglial 3+ otide and interfere with the activity of membrane-bound cells can uptake the Al free ion, displayed by the orange enzymes of the purinergic pathway [13]. fluorescence labeling tracked by Lumogallion reagent. The activities of ectoenzymes showed a decrease/increase in the A coordinated upregulation of 5 -NT and purinocep- metabolism of nucleotides/nucleoside, respectively, when tor expression, particularly A2AR expression, has been cells were exposed to both stimuli. Moreover, Al and LPS suggested by previous reports such as in hippocampal upregulated the expression/density of purinoceptors gener- astrocytes of human patients with mesial temporal lobe epilepsy (MTLE) [44], in a rat model of Parkinson’s dis- ally associated with neurotoxicity and neuroinflammation ease [45], and in a rat model of AD [46]. However, and downregulated the expression/density of purinoceptors although our results regarding the A2AR receptor are in related to neuroprotection. In this sense, our current findings provide a possible link between Al and also LPS toxic effects agreement with these previous reports, the decrease in 5 and purinergic system alterations in microglial cells and sup- -NT activity was also indicated when neurospheres were 3+ treated with Al [13]. port future studies to clarify these issues. Also, an increase in ADA enzyme activity for cells treated with Al and LPS was found here. Adenosine, the main ATP 5. Conclusions breakdown product binds to P1 type of receptors, including In summary, to the best of our knowledge, our results report A1R and A2AR subtypes of receptors, and together with some first indication on the possible involvement of the pur- ATP presents central neuromodulatory and immunomodu- inergic system in the mechanisms of Al toxicity in brain latory functions in the brain [19, 22, 47, 48]. Thus, the alter- microglial cells. This agent evoked alterations in the setup ations evoked by LPS and Al regarding purinergic parameters of the purinergic system suggesting that this signaling path- could also influence immune/microglial responses in the way may be further investigated as a pivotal factor to under- brain, but these effects are issues to be addressed in more stand the effects triggered by toxic compounds in the CNS. detail by further studies. As microglial cells are recognized to express essentially all types of purinergic system proteins [22, 24], the effect of Al Abbreviations and LPS exposure on the modulation of purinoceptors could ′ ′ 5 -NT: 5 -Nucleotidase also be a relevant mechanism underlying the toxicity of these agents in neuroimmune cells. P2X7R receptors are ATP- A1R: Adenosine A1 receptor A2AR: Adenosine A2A receptor gated ionotropic channels indicated to present a major role AD: Alzheimer’s disease in neurodegeneration and neuroinflammation [49]. The ADA: Adenosine deaminase increased expression of P2X7R receptors has also been sug- Ado: Adenosine gested in microglial cells of Aβ-injected rat brains and ADP: Adenosine diphosphate human brains of AD patients [50], in microglia of a model Al: Aluminum using LPS administration [51], in immature rat brains 3+ Al : Al trivalent ion exposed to lead (Pb) [52], and in the hippocampus of mouse AlCl : Aluminum chloride pups also exposed to Pb [53]. In this sense, P2X7R receptors AMP: Adenosine monophosphate and downstream signaling pathways triggered by their acti- ANOVA: Analysis of variance vation may have a central contribution in the toxic mecha- ATP: Adenosine triphosphate nisms triggered by Al and LPS and offer the possibility for BBB: Blood-brain barrier future exploration. CNS: Central nervous system Adenosine signaling is also of particular relevance in the DAPI: ′ brain [47, 48]. For instance, an increased expression of the 4 ,6-Diamidino-2-phenylindole A2AR receptor has also been indicated for other brain insult FBS: Fetal bovine serum models, for example, perinatal brain injury [54] and in LPS- LPS: Lipopolysaccharide treated microglial cells [55]. In our study, the expression/- NPCs: Neural progenitor cells 8 Journal of Immunology Research NTPDase: Nucleoside triphosphate diphosphohydrolase [3] Z. Wang, X. Wei, J. Yang et al., “Chronic exposure to alumi- num and risk of Alzheimer’s disease: a meta-analysis,” Neuro- P1: Adenosine receptors science Letters, vol. 610, pp. 200–206, 2016. P2: ATP/ADP receptors [4] C. Exley, “Aluminum should now be considered a primary eti- PFA: Paraformaldehyde ological factor in Alzheimer’s disease,” Journal of Alzheimer’s RT-qPCR: Real-time quantitative polymerase chain Disease Reports, vol. 1, no. 1, pp. 23–25, 2017. reaction [5] C. Exley, “Human exposure to aluminium,” Environmental RIPA: Radioimmunoprecipitation assay Science: Processes and Impacts, vol. 15, no. 10, pp. 1807– TBST: Tris-buffered saline with Tween 1816, 2013. UDP: Uridine diphosphate [6] A. Becaria, A. Campbell, and S. C. Bondy, “Aluminum as a tox- UTP: Uridine triphosphate icant,” Toxicology and Industrial Health, vol. 18, no. 7, pp. 309–320, 2002. Data Availability [7] W. A. Banks and A. J. Kastin, “Aluminum-induced neurotox- icity: alterations in membrane function at the blood-brain bar- The data used to support the findings of this study are avail- rier,” Neuroscience & Biobehavioral Reviews, vol. 13, no. 1, able from the corresponding author, upon reasonable pp. 47–53, 1989. request. [8] D. Julka, R. K. Vasishta, and K. D. Gill, “Distribution of aluminum in different brain regions and body organs of Additional Points rat,” Biological Trace Element Research, vol. 52, no. 2, pp. 181–192, 1996. Highlights. Aluminum (Al) and lipopolysaccharide (LPS) [9] C. Exley, “What is the risk of aluminium as a neurotoxin?,” modulated purinergic system parameters of BV-2 brain Expert Review of Neurotherapeutics, vol. 14, no. 6, pp. 589– microglial cells. Al and LPS altered the metabolism of nucle- 591, 2014. otides (ATP, ADP, and AMP) and nucleoside (adenosine). Al [10] S. C. Bondy, “Prolonged exposure to low levels of aluminum and LPS upregulated the expression/density of purinoceptors leads to changes associated with brain aging and neurodegen- associated with neurodegeneration and neuroinflammation. eration,” Toxicology, vol. 315, pp. 1–7, 2014. Al and LPS downregulated the expression/density of purino- [11] S. C. Bondy, “Low levels of aluminum can lead to behavioral ceptors associated with neuroprotection. and morphological changes associated with Alzheimer’s dis- ease and age-related neurodegeneration,” Neurotoxicology, Disclosure vol. 52, pp. 222–229, 2016. [12] K. P. Reichert, M. R. C. Schetinger, M. M. Pillat et al., “Alumi- The funding agencies had no role in the study design, in the num affects neural phenotype determination of embryonic collection, analysis, and interpretation of the data, in the neural progenitor cells,” Archives of Toxicology, vol. 93, no. 9, writing of the manuscript, and in the decision for pp. 2515–2524, 2019. publication. [13] K. P. Reichert, M. M. Pillat, M. R. C. Schetinger et al., “Alumi- num-induced alterations of purinergic signalling in embryonic Conflicts of Interest neural progenitor cells,” Chemosphere, vol. 251, p. 126642, The authors declare that there are no conflicts of interest. [14] H. Zimmermann, “Ectonucleotidases in the nervous system,” Novartis Foundation Symposium, vol. 276, pp. 113–128, 2006. Acknowledgments [15] M. R. C. Schetinger, V. M. Morsch, C. D. Bonan, and A. T. S. Wyse, “NTPDase and 5′-nucleotidase activities in physiologi- The authors are grateful for the funding provided by Con- cal and disease conditions: new perspectives for human selho Nacional de Desenvolvimento Científico e Tecnológico health,” BioFactors, vol. 31, no. 2, pp. 77–98, 2007. (CNPq), Fundação de Amparo à Pesquisa do Estado do Rio [16] G. G. Yegutkin, “Nucleotide- and nucleoside-converting Grande do Sul (FAPERGS), and Coordenação de Aperfeiçoa- ectoenzymes: important modulators of purinergic signalling mento de Pessoal de Nível Superior (CAPES/PROEX fellow- cascade,” Biochimica et Biophysica Acta-Molecular Cell ship grant, process number 88882.182154/2018-01). Research, vol. 1783, no. 5, pp. 673–694, 2008. CAPES/PrInt process number 88881.310287/2018-01 is also [17] H. Zimmermann, M. Zebisch, and N. Sträter, “Cellular func- acknowledged. tion and molecular structure of ecto-nucleotidases,” Purinergic Signalling, vol. 8, no. 3, pp. 437–502, 2012. References [18] B. B. Fredholm, A. P. IJzerman, K. A. Jacobson, K. N. Klotz, and J. Linden, “International Union of Pharmacology. XXV. [1] M. Prince, R. Bryce, E. Albanese, A. Wimo, W. Ribeiro, and Nomenclature and classification of adenosine receptors,” C. P. Ferri, “The global prevalence of dementia: a systematic Pharmacological Reviews, vol. 53, no. 4, pp. 527–552, 2001. review and metaanalysis,” Alzheimer’s & Dementia, vol. 9, [19] G. Burnstock, B. B. Fredholm, and A. Verkhratsky, “Adeno- no. 1, pp. 63–75, 2013. sine and ATP receptors in the brain,” Current Topics in Medic- [2] L. Gan, M. R. Cookson, L. Petrucelli, and A. R. La Spada, “Con- inal Chemistry, vol. 11, no. 8, pp. 973–1011, 2011. verging pathways in neurodegeneration, from genetics to mechanisms,” Nature Neuroscience, vol. 21, no. 10, pp. 1300– [20] G. Burnstock, “Purine and purinergic receptors,” Brain and 1309, 2018. Neuroscience Advances, vol. 2, 2018. Journal of Immunology Research 9 [38] A. Henn, S. Lund, M. Hedtjärn, A. Schrattenholz, P. Pörzgen, [21] G. Burnstock, “Purinergic signalling and disorders of the cen- tral nervous system,” Nature Reviews Drug Discovery, vol. 7, and M. Leist, “The suitability of BV2 cells as alternative model no. 7, pp. 575–590, 2008. system for primary microglia cultures or for animal experi- ments examining brain inflammation,” ALTEX, vol. 26, [22] E. Beamer, F. Gölöncsér, G. Horváth et al., “Purinergic mech- no. 2, pp. 83–94, 2009. anisms in neuroinflammation: an update from molecules to behavior,” Neuropharmacology, vol. 104, pp. 94–104, 2016. [39] V. V. Miron, N. B. Bottari, C. E. Assmann et al., “Physical exer- cise prevents alterations in purinergic system and oxidative [23] G. Burnstock, “Purinergic signalling and neurological diseases: status in lipopolysaccharide-induced sepsis in rats,” Journal an update,” CNS & Neurological Disorders Drug Targets, of Cellular Biochemistry, vol. 120, no. 3, pp. 3232–3242, 2018. vol. 16, no. 3, pp. 257–265, 2017. [40] R. F. Zanin, E. Braganhol, L. S. Bergamin et al., “Differential [24] S. Calovi, P. Mut-Arbona, and B. Sperlágh, “Microglia and the macrophage activation alters the expression profile of purinergic signaling system,” Neuroscience, vol. 405, pp. 137– NTPDase and ecto-5′-nucleotidase,” PLoS One, vol. 7, no. 2, 147, 2019. article e31205, 2012. [25] V. H. Perry, J. A. R. Nicoll, and C. Holmes, “Microglia in neu- [41] T. Kiss, K. Gajda-Schrantz, and P. F. Zatta, “The role of alumi- rodegenerative disease,” Nature Reviews Neurology, vol. 6, num in neurotoxic and neurodegenerative processes,” In: Neu- no. 4, pp. 193–201, 2010. rodegenerative Diseases and Metal Ions, vol. 1, pp. 371–393, [26] S. Hickman, S. Izzy, P. Sen, L. Morsett, and J. El Khoury, “Microglia in neurodegeneration,” Nature Neuroscience, [42] E. Rezabal, J. M. Mercero, X. Lopez, and J. M. Ugalde, “Protein vol. 21, no. 10, pp. 1359–1369, 2018. side chains facilitate Mg/Al exchange in model protein binding [27] T. Toimela and H. Tähti, “Mitochondrial viability and apopto- sites,” ChemPhysChem, vol. 8, no. 14, pp. 2119–2124, 2007. sis induced by aluminum, mercuric mercury and methylmer- cury in cell lines of neural origin,” Archives of Toxicology, [43] P. Cardiano, C. Foti, F. Giacobello, O. Giuffrè, and 3+ S. Sammartano, “Study of Al interaction with AMP, ADP vol. 78, no. 10, pp. 565–574, 2004. and ATP in aqueous solution,” Biophysical Chemistry, [28] L. Qin, X. Wu, M. L. Block et al., “Systemic LPS causes chronic vol. 234, pp. 42–50, 2018. neuroinflammation and progressive neurodegeneration,” Glia, vol. 55, no. 5, pp. 453–462, 2007. [44] A. R. Barros-Barbosa, F. Ferreirinha, Â. Oliveira et al., “Aden- osine A2A receptor and ecto-5 -nucleotidase/CD73 are upreg- [29] A. D. Bachstetter, B. Xing, L. de Almeida, E. R. Dimayuga, ulated in hippocampal astrocytes of human patients with D. M. Watterson, and L. J. Van Eldik, “Microglial p38α MAPK mesial temporal lobe epilepsy (MTLE),” Purinergic Signalling, is a key regulator of proinflammatory cytokine up-regulation vol. 12, no. 4, pp. 719–734, 2016. induced by toll-like receptor (TLR) ligands or beta-amyloid (Aβ),” Journal of Neuroinflammation, vol. 8, p. 79, 2011. [45] M. Carmo, F. Q. Gonçalves, P. M. Canas et al., “Enhanced ATP release and CD73-mediated adenosine formation sustain [30] M. Mold, H. Eriksson, P. Siesjö, A. Darabi, E. Shardlow, and adenosine A2A receptor over-activation in a rat model of Par- C. Exley, “Unequivocal identification of intracellular alumin- kinson’s disease,” British Journal of Pharmacology, vol. 176, ium adjuvant in a monocytic THP-1 cellline,” Scientific no. 18, pp. 3666–3680, 2019. Reports, vol. 4, p. 6287, 2014. [46] F. Q. Gonçalves, J. P. Lopes, H. B. Silva et al., “Synaptic and [31] M. Mold, M. Kumar, A. Mirza, E. Shardlow, and C. Exley, memory dysfunction in a β-amyloid model of early Alzhei- “Intracellular tracing of amyloid vaccines through direct mer’s disease depends on increased formation of ATP- fluorescent labelling,” Scientific Reports, vol. 8, no. 1, derived extracellular adenosine,” Neurobiology of Disease, p. 2437, 2018. vol. 132, article 104570, 2019. [32] M. R. Schetinger, N. M. Porto, M. B. Moretto et al., “New ben- [47] R. A. Cunha, “Neuroprotection by adenosine in the brain: zodiazepines alter acetylcholinesterase and ATPDase acti- from A1 receptor activation to A2A receptor blockade,” Puri- vites,” Neurochemical Research, vol. 25, pp. 949–955, 2000. nergic Signalling, vol. 1, no. 2, pp. 111–134, 2005. [33] D. Heymann, M. Reddington, and G. W. Kreutzberg, “Subcel- ′ [48] R. A. Cunha, “How does adenosine control neuronal dysfunc- lular localization of 5 -nucleotidase in rat brain,” Journal of tion and neurodegeneration?,” Journal of Neurochemistry, Neurochemistry, vol. 43, no. 4, pp. 971–978, 1984. vol. 139, no. 6, pp. 1019–1055, 2016. [34] G. Giusti and B. Galanti, “Colorimetric method,” in Methods of [49] S. D. Skaper, P. Debetto, and P. Giusti, “The P2X7 purinergic Enzymatic Analysis, H. U. Bergmeyer, Ed., pp. 315–323, Verlag receptor: from physiology to neurological disorders,” FASEB Chemie, Berlin, Weinheim, Germany, 3rd edition, 1984. Journal, vol. 24, no. 2, pp. 337–345, 2009. [35] C. E. Assmann, F. C. Cadoná, B. S. R. Bonadiman, E. B. Dor- [50] J. G. McLarnon, J. K. Ryu, D. G. Walker, and H. B. Choi, nelles, G. Trevisan, and I. B. M. da Cruz, “Tea tree oil presents in vitro antitumor activity on breast cancer cells without cyto- “Upregulated expression of purinergic P2X(7) receptor in Alz- heimer disease and amyloid-beta peptide-treated microglia toxic effects on fibroblasts and on peripheral blood mononu- clear cells,” Biomedicine & Pharmacotherapy, vol. 103, and in peptide-injected rat hippocampus,” Journal of Neuropa- thology and Experimental Neurology, vol. 65, no. 11, pp. 1090– pp. 1253–1261, 2018. 1097, 2006. [36] N. Rebola, P. C. Pinheiro, C. R. Oliveira, J. O. Malva, and R. A. [51] H. B. Choi, J. K. Ryu, S. U. Kim, and J. G. McLarnon, “Modu- Cunha, “Subcellular localization of adenosine A (1) receptors in nerve terminals and synapses of the rat hippocampus,” lation of the purinergic P2X7 receptor attenuates lipopolysaccharide-mediated microglial activation and neuro- Brain Research, vol. 987, no. 1, pp. 49–58, 2003. nal damage in inflamed brain,” Journal of Neuroscience, [37] M. M. Bradford, “A rapid and sensitive method for the quan- vol. 27, no. 18, pp. 4957–4968, 2007. titation of microgram quantities of protein utilizing the princi- ple of protein-dye binding,” Analytical Biochemistry, vol. 72, [52] I. Baranowska-Bosiacka, B. Dąbrowska-Bouta, and no. 1-2, pp. 248–254, 1976. L. Strużyńska, “Regional changes in purines and selected 10 Journal of Immunology Research purinergic receptors in immature rat brain exposed to lead,” Toxicology, vol. 279, no. 1-3, pp. 100–107, 2011. [53] N. Li, P. Zhang, M. Qiao, J. Shao, H. Li, and W. Xie, “The effects of early life lead exposure on the expression of P2X7 receptor and synaptophysin in the hippocampus of mouse pups,” Journal of Trace Elements in Medicine and Biology, vol. 30, pp. 124–128, 2015. [54] M. Colella, M. Zinni, J. Pansiot et al., “Modulation of micro- glial activation by adenosine A2a receptor in animal models of perinatal brain injury,” Frontiers in Neurology, vol. 9, p. 605, 2018. [55] A. G. Orr, A. L. Orr, X.-J. Li, R. E. Gross, and S. F. Traynelis, “Adenosine A2A receptor mediates microglial process retrac- tion,” Nature Neuroscience, vol. 12, no. 7, pp. 872–878, 2009. [56] N. Rebola, A. P. Simões, P. M. Canas et al., “Adenosine A2A receptors control neuroinflammation and consequent hippo- campal neuronal dysfunction,” Journal of Neurochemistry, vol. 117, no. 1, pp. 100–111, 2011. [57] J. Stockwell, E. Jakova, and F. S. Cayabyab, “Adenosine A1 and A2A receptors in the brain: current research and their role in neurodegeneration,” Molecules, vol. 22, no. 4, p. 676, 2017. [58] R. Franco and G. Navarro, “Adenosine A2A receptor antago- nists in neurodegenerative diseases: huge potential and huge challenges,” Frontiers in Psychiatry, vol. 9, p. 68, 2018. [59] S. Giunta, V. Andriolo, and A. Castorina, “Dual blockade of the A1 and A2A adenosine receptor prevents amyloid beta toxicity in neuroblastoma cells exposed to aluminum chlo- ride,” The International Journal of Biochemistry & Cell Biology, vol. 54, pp. 122–136, 2014. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Immunology Research Hindawi Publishing Corporation

Loading next page...
 
/lp/hindawi-publishing-corporation/aluminum-induced-alterations-in-purinergic-system-parameters-of-bv-2-mVwPGeNIsn

References (61)

Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2021 Charles Elias Assmann et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
2314-8861
eISSN
2314-7156
DOI
10.1155/2021/2695490
Publisher site
See Article on Publisher Site

Abstract

Hindawi Journal of Immunology Research Volume 2021, Article ID 2695490, 10 pages https://doi.org/10.1155/2021/2695490 Research Article Aluminum-Induced Alterations in Purinergic System Parameters of BV-2 Brain Microglial Cells 1 1 Charles Elias Assmann , Vitor Bastianello Mostardeiro, 2 1 3 Grazielle Castagna Cezimbra Weis, Karine Paula Reichert, Audrei de Oliveira Alves, 1 4 1 Vanessa Valéria Miron, Margarete Dulce Bagatini, Taís Vidal Palma, 1 5 6 Cinthia Melazzo de Andrade, Micheli Mainardi Pillat, Fabiano Barbosa Carvalho, 7,8 3,9 Cristina Ruedell Reschke, Ivana Beatrice Mânica da Cruz, 1 1 Maria Rosa Chitolina Schetinger, and Vera Maria Melchiors Morsch Postgraduate Program in Biological Sciences, Toxicological Biochemistry, Department of Biochemistry and Molecular Biology, Federal University of Santa Maria, Santa Maria, RS, Brazil Postgraduate Program in Food Science and Technology, Department of Food Science and Technology, Federal University of Santa Maria, Santa Maria, RS, Brazil Postgraduate Program in Pharmacology, Department of Physiology and Pharmacology, Federal University of Santa Maria, Santa Maria, RS, Brazil Postgraduate Program in Biomedical Sciences, Federal University of Fronteira Sul, Chapecó, SC, Brazil Department of Microbiology and Parasitology, Federal University of Santa Maria, Santa Maria, RS, Brazil Federal University of Health Sciences of Porto Alegre, Porto Alegre, RS, Brazil School of Pharmacy and Biomolecular Sciences, Royal College of Surgeons in Ireland, Dublin, Ireland FutureNeuro Research Centre, Dublin, Ireland Postgraduate Program in Gerontology, Federal University of Santa Maria, Santa Maria, RS, Brazil Correspondence should be addressed to Charles Elias Assmann; charles.ufsm@gmail.com and Vera Maria Melchiors Morsch; veramorsch@gmail.com Received 21 April 2020; Revised 6 August 2020; Accepted 19 September 2020; Published 19 January 2021 Academic Editor: Peirong Jiao Copyright © 2021 Charles Elias Assmann et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Aluminum (Al) is ubiquitously present in the environment and known to be a neurotoxin for humans. The trivalent free Al anion 3+ (Al ) can cross the blood-brain barrier (BBB), accumulate in the brain, and elicit harmful effects to the central nervous system (CNS) cells. Thus, evidence has suggested that Al increases the risk of developing neurodegenerative diseases, particularly Alzheimer’s disease (AD). Purinergic signaling has been shown to play a role in several neurological conditions as it can modulate the functioning of several cell types, such as microglial cells, the main resident immune cells of the CNS. However, Al effects on microglial cells and the role of the purinergic system remain elusive. Based on this background, this study is aimed at assessing the modulation of Al on purinergic system parameters of microglial cells. An in vitro study was performed using brain microglial cells exposed to Al chloride (AlCl ) and lipopolysaccharide (LPS) for 96 h. The uptake of Al, metabolism of nucleotides (ATP, ADP, and AMP) and nucleoside (adenosine), and the gene expression and protein density of purinoceptors were investigated. The results showed that both Al and LPS increased the breakdown of adenosine, whereas they decreased nucleotide hydrolysis. Furthermore, the findings revealed that both Al and LPS triggered an increase in gene expression and protein density of P2X7R and A2AR receptors, whereas reduced the A1R receptor expression and density. Taken together, the results showed that Al and LPS altered the setup of the purinergic system of microglial cells. Thus, this study provides new insights into the involvement of the purinergic system in the mechanisms underlying Al toxicity in microglial cells. 2 Journal of Immunology Research 1. Introduction erative conditions. In this sense, this study is aimed at pri- marily investigating whether the exposure to Al (in the The prevalence of chronic neurodegenerative disorders, such AlCl form) could alter some purinergic system parameters as Alzheimer’s disease (AD), is growing considerably with using an in vitro model of microglial cells. the rise of global life expectancy. The gradual decline of motor and/or cognitive capacities associated with these mor- 2. Materials and Methods bidities is of major concern; however, the underlying mecha- nisms are still not fully understood [1, 2]. Evidence has 2.1. Chemicals and Reagents. This investigation used chemi- pointed out that some environmental factors, such as alumi- cals and reagents of analytical grade obtained from Sigma- num (Al), could be an etiological cause and associated with a Aldrich Inc. (St. Louis, MO, USA) and Merck KGaA (Darm- higher risk of developing AD [3, 4]. Al is a lightweight metal stadt, Germany). All other reagents otherwise not stated were ubiquitously found in the environment, resulting in a nearly of chemical purity. Materials used in cell culture procedures unavoidable contact of humans to this element [5]. Human were acquired from Kasvi (São José dos Pinhais, PR, Brazil), exposure to this metal can occur by several routes, including Corning Inc. (Corning, NY, USA), and Vitrocell Embriolife drinking water, foods, occupational exposure, and vaccines, (Campinas, SP, Brazil). Western blot and molecular biology among others [5, 6]. reagents were purchased from Bio-Rad Laboratories (Hercu- 3+ Its highly toxic form, the trivalent free Al ion (Al ), can les, CA, USA), Merck KGaA, and Sigma-Aldrich Inc. All cross the blood-brain barrier (BBB), alter membrane func- measurement analyses were carried out using a SpectraMax® tion, and accumulate in the human brain throughout life i3 Multimode Plate Reader (Molecular Devices, Sunnyvale, [6–9]. Literature data have indicated that Al is a neurotoxic CA, USA). The fluorescent images were captured using an metal that may lead to alterations associated with neurode- Olympus Fluorescent Microscope (Fluoview FV101, Olym- generation and brain aging, among others, characteristics pus, Tokyo, Japan). also found in AD [3, 9–11]. Moreover, recent evidence using 3+ a model of neural progenitor cells (NPCs) have suggested 2.2. Al. For this research, Al in the chloride form (AlCl ; 3+ −1 that Al may also affect neurogenesis [12] and purinergic molecular weight 133.34 g mol ; 99% purity) was purchased signaling [13]. from Sigma-Aldrich Inc. All laboratory materials (flasks, The purinergic signaling system includes a cascade of plates, tips, tubes, etc.) and glassware were immersed in a extracellular nucleotides- and nucleoside-catalyzing enzymes 10% HNO /ethanol (v/v) solution for 48 h and then washed that participate in the metabolism of ATP (adenosine tri- with Milli-Q® ultrapure water to avoid external contamina- phosphate) to ADP (adenosine diphosphate) and/or AMP tion by the metal. All solutions were prepared using deconta- (adenosine monophosphate) (NTPDase/CD39, nucleoside minated materials and Milli-Q® ultrapure water. All triphosphate diphosphohydrolase), followed by the conver- laboratory and cell culture protocols were performed in a ′ ′ sion of AMP to adenosine (5 -NT/CD73, 5 -nucleotidase) clean workbench to avoid contamination by external Al sources. and of adenosine to inosine (ADA, adenosine deaminase) [14–17]. Moreover, ATP and adenosine can operate as sig- naling molecules through their binding to specific purinergic 2.3. Experimental Design of Cell Culture Protocols and Exposure to Toxicants. This in vitro study used the mouse receptors. P1 adenosine receptors (A1, A2A, A2B, and A3), which are all G protein-coupled receptors, are selective to brain BV-2 microglial cell line, purchased from the Rio de Janeiro Cell Bank (BCRJ, Rio de Janeiro, RJ, Brazil). The cells adenosine. Purine nucleotides, such as ATP and ADP, and pyrimidine nucleotides, such as UTP (uridine triphosphate) were cultured using Roswell Park Memorial Institute (RPMI) and UDP (uridine diphosphate), act on P2 receptors, which 1640 medium (4500 mg/L glucose, 1500 mg/L sodium bicar- bonate, 2 mM L-glutamine, and 1 mM sodium pyruvate), are subdivided into P2X ionotropic receptors (P2X1-7) and P2Y receptors (P2Y1/2/4/6/11/12/13/14) which are coupled added with fetal bovine serum (FBS) to a final concentration of 10% and supplemented with 1% penicillin/streptomycin to G proteins [18–20]. Purinergic signaling may operate in a wide range of bio- (10.000 U/mL; 10 mg/mL). The cells were grown in standard logical functions including neurotransmission and neuroin- conditions by using a humidified and controlled atmosphere of 5% carbon dioxide (CO )at 37 C. flammation and also in disease conditions [21–23]. Particularly in the central nervous system (CNS), this signal- The cells were treated with an increasing concentration- 3+ effect curve of the trivalent free Al ion (Al ) in the form of ing pathway may also orchestrate immune cell responses, including microglial activation and the release of inflamma- Al chloride (AlCl ), consisting of 1, 5, 10, 50, 100, 500, and tory cytokines, among others [22, 24]. Microglia comprise 1000 μM of AlCl , based on a previous work [27]. The control the main cells of the neuroimmune system acting in the clear- group (C) consisted of cells that received only the culture ance of noxious stimuli and limiting tissue damage [25, 26] medium. Lipopolysaccharide (LPS) at the concentration of 1 μg/mL was used as a positive inflammatory control since and exhibit fundamentally all the repertoire of components of the purinergic system [22, 24]. it has been suggested that this agent causes neuroinflamma- However, mechanisms of Al toxicity in the brain related tory states [28, 29]. For culture protocols, cells were grown to the purinergic system, especially on microglial cells, in 6-well plates at the concentration of 1×10 cells/mL for remain elusive and it is essential to understand the role of this 96 h to investigate the subchronic effects of Al and LPS metal in the neuroinflammatory responses and neurodegen- exposure. Journal of Immunology Research 3 ° ° the reaction were as follows: 25 2.4. Al Staining. Lumogallion (Santa Cruz Biotechnology, C for 5 min, 42 C for ° ° Inc., Dallas, TX, USA) is a reagent that can be used for the 30 min, 85 C for 5 min, and a final step of 5 C for 60 min, per- detection of Al in both tissues and cells. In brief, for this formed using a thermal cycler equipment. assay, cells were initially prepared on poly-lysine-coated The RT-qPCR reaction was performed using 19 μLofa slides and then incubated in the dark at 37 C for 24 h with mix containing the iTaq Universal SYBR Green Supermix Lumogallion (100 μM). Then, slides were washed with ultra- (Bio-Rad Laboratories) and 1 μL of the cDNA sample. The pure water, air-dried, and fixed in paraformaldehyde (PFA, parameters used were a holding step of 3 min at 95 C, ° ° 4%) at room temperature for 15 min and washed again. DAPI followed by a cycling step of 40 cycles at 95 C for 10 s, 60 C ′ for 30 s, and last a melting step with a melting curve of (4 ,6-diamidino-2-phenylindole) reagent (0.3 mg/mL, ° ° ° 65 Cto95 C with an increase of 0.5 C for 5 s. The relative Sigma-Aldrich Inc.) was used to stain cell nuclei. Labeling expression of each gene was represented as the fold expres- with DAPI was performed protected from light during sion compared to the control group and calculated by using 5 min at room temperature, and subsequently, the staining ΔΔ the comparative CT value. The β-actin (Actb) gene was solution was removed, cells were washed, and coverslips were used as the internal control to normalize gene expression. placed on slides, following similar procedures described before [30, 31]. Finally, images were taken using an Olympus ′ ′ The forward and reverse sequences of oligos (5 -3 ) used Fluorescent Microscope. for each gene were as follows: β-actin (F): CCGTAAAGA CCTCTATGCCAAC; β-actin (R): AGGAGCCAGAGCAG 2.5. Purinergic System Enzyme Activities TAATCT; P2X7R (F): CTTTGCTTTGGTGAGCGATAAG; P2X7R (R): CACCTCTGCTATGCCTTTGA; A1R (F): 2.5.1. NTPDase and 5 -NT Activities. The release of inorganic GGCCATAAAGTCCTTGGGAAT; A1R (R): CAGGAA phosphate was employed to determine the enzymatic activi- GTTCAGGGCAAGAA; A2AR (F): TCACGTCTCAGGAT ties of NTPDase [32] and 5 -NT [33], similarly to guidelines TGAGTTTAG; A2AR (R): CCCGAAGGAAAGGCAGTAG. published before. Briefly, cells were initially suspended in saline (NaCl, 0.9%), and 20 μL of samples was added to the 2.6.2. Protein Density. Protein density by Western blot anal- reaction mixture of each enzyme and preincubated at 37 C ysis of the P2X7R, A2AR, and A1R receptors was performed for 10 min. The enzymatic reaction was initiated by adding based on a prior work [36]. In brief, cells were initially the specific substrates for each enzyme: ATP and ADP for homogenized in ice-cold radioimmunoprecipitation assay NTPDase and AMP for 5 -NT. (RIPA) buffer added with 1 mM phosphatase and protease The reactions were stopped by the addition of trichloro- inhibitors and centrifuged at 12,000 rpm at 4 C for 10 min. acetic acid (TCA, 10%), and the released inorganic phosphate Subsequently, samples were separated using sodium dodecyl due to ATP, ADP, and AMP hydrolysis was determined by sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and using malachite green as the colorimetric reagent. A standard transferred to Immun-Blot® PVDF membranes (Bio-Rad curve was prepared with KH PO , and absorbance was read 2 4 Laboratories). After blocking, membranes were incubated at 630 nm. Controls were performed to correct for nonenzy- overnight at 4 C with the primary antibodies: P2X7R (dilu- matic hydrolysis. Enzyme-specific activities were reported as tion 1 : 500), A2AR (dilution 1 : 800), and A1R (dilution nmol of Pi released per min per mg of protein. 1 : 500), all obtained from Santa Cruz Biotechnology, Inc. After this step, membranes were washed with Tris-buffered 2.5.2. ADA Activity. ADA activity was performed based on saline (pH 7.6) with 0.1% Tween 20 (TBST) and further incu- the measurement of ammonia produced when this enzyme bated with anti-rabbit or anti-mouse secondary antibodies acts in the excess of adenosine, following a previously pub- (dilution 1 : 10.000, Santa Cruz Biotechnology, Inc.) at room lished method [34]. In brief, 50 μL of cell suspension reacted temperature for 90 min. The membranes were washed again, with 21 mmol/L of adenosine (pH 6.5) at 37 C for 60 min. incubated with an enhanced chemifluorescent substrate After the incubation period, the reaction was stopped by (Immobilon® Forte Western HRP Substrate, Merck KGaA), the addition of 167.8 mM sodium nitroprusside, 106.2 mM and analyzed with a ChemiDoc Imaging System (Bio-Rad phenol, and a sodium hypochlorite solution. The amount of Laboratories). As a control for protein concentration, mem- ammonia produced was quantified at 620 nm, and the results branes were reprobed and tested for β-actin immunoreactiv- were expressed as U Ado (adenosine) per mg of protein. ity (dilution 1 : 1000, Santa Cruz Biotechnology, Inc.). 2.6. Purinergic System Receptors 2.7. Protein Determination. The protein in samples was 2.6.1. Gene Expression. The gene expression modulation of determined using the Coomassie Blue reagent following the the purinergic receptors P2X7R (P2rx7), A2AR (Adora2a), method previously described and using serum albumin as and A1R (Adora1) was carried out by real-time quantitative standard [37]. The protein of samples (mg/mL) was adjusted polymerase chain reaction (RT-qPCR) analysis, based on a according to each assay. previous report [35]. Briefly, RNA was initially obtained from samples with TRIzol™ reagent (Invitrogen™), quanti- 2.8. Statistical Analysis. The results were compared by one- fied spectrophotometrically, and reversely transcribed into way analysis of variance (ANOVA) followed by Tukey’s post cDNA with the iScript™ cDNA synthesis kit (Bio-Rad Labo- hoc test and presented as the mean ± SD. The GraphPad ratories), by the addition to each sample of 1 μL of iScript Prism software version 6 (GraphPad Software, Inc.; La Jolla, reverse transcriptase and 4 μL of the iScript Mix. Steps of CA, USA) was used to perform statistical analysis. The results 4 Journal of Immunology Research (a) (b) (c) (a) (b) (c) (d) (e) (f ) (d) (e) (f) (g) (h) (i) (g) (h) (i) Figure 1: Representative fluorescence microscopy of microglial cells stained with DAPI (blue, cell nuclei) and Lumogallion probe (orange) to track uptake of Al: (a) control; (b) lipopolysaccharide (LPS, 1 μg/mL); (c) AlCl (1 μM); (d) AlCl (5 μM); (e) AlCl (10 μM); (f) AlCl 3 3 3 3 (50 μM); (g) AlCl (100 μM); (h) AlCl (500 μM); (i) AlCl (1000 μM). Magnification = 200x. Scale bar = 20 μm. n =3. 3 3 3 were considered statistically significant when p <0:05. All activity of purinergic system ectoenzymes, the breakdown experiments were carried out in triplicate. of nucleotides and nucleoside was evaluated in microglial cells and the results are shown in Figure 2. NTPDase activity was assessed by ATP and ADP hydrolysis (Figures 2(a) and 3. Results 2(b)). LPS was shown to significantly reduce the hydrolysis of ATP and ADP when compared to control cells. Moreover, 3.1. Al Can Be Tracked by Lumogallion Fluorescent Probe in BV-2 Microglial Cells. To track the possible uptake of Al by the AlCl concentrations of 500 and 1000 μM also reduced cells, we used Lumogallion staining and demonstrative ATP hydrolysis, and AlCl at 1000 μM also decreased ADP images are shown in Figure 1. Control cells (Figure 1(a)) hydrolysis when compared to control cells. The activity of and cells cultured with LPS (Figure 1(b)), both in the absence ′ 5 -NT was assessed by AMP hydrolysis (Figure 2(c)), and of Al, only showed blue fluorescence produced by DAPI, results revealed that LPS and AlCl at 500 and 1000 μM which is used to indicate cell nuclei. In this case, when images decreased AMP hydrolysis when compared to control cells. taken with DAPI and Lumogallion reagent were overlaid, Following the ectoenzyme cascade, ADA activity only blue fluorescence was emitted. However, cells cultured (Figure 2(d)) was measured by the deamination of adenosine in the presence of AlCl at the concentrations of 1-1000 μM and findings revealed that LPS and AlCl at the concentra- (Figure 1(c)–1(i)) showed an orange labeling representative tions of 500 and 1000 μM augmented nucleoside breakdown of Lumogallion staining, and overlaid images also revealed compared to control cells. a blue fluorescence related to DAPI nuclei staining. Thus, the free Al ion can be internalized by microglial cells as sug- 3.3. Al and LPS Modulate the Expression and Density of gested by the orange concentration-dependent intensity Purinoceptors. Since Al and LPS modulated ectoenzyme tracked by Lumogallion staining. activities, we also investigated whether these compounds could alter the expression and density of purinergic recep- 3.2. Al and LPS Alter the Activity of Purinergic System tors. Figure 3 shows the results from the analysis by RT- Ectoenzymes. To verify if Al and LPS could modulate the qPCR performed to assess the modulation of the P2X7R, Journal of Immunology Research 5 ATP hydrolysis ADP hydrolysis 40 40 30 30 ⁎⁎ ⁎⁎⁎ ⁎⁎ ⁎⁎ ⁎⁎ 20 20 10 10 0 0 C LPS 1 5 10 50 100 500 1000 C LPS 1 5 10 50 100 500 1000 AlCl (𝜇M) AlCl (𝜇M) 3 3 (a) (b) AMP hydrolysis Adenosine breakdown ⁎⁎⁎ ⁎⁎ ⁎⁎ C LPS 1 5 10 50 100 500 1000 C LPS 1 5 10 50 100 500 1000 AlCl (𝜇M) AlCl (𝜇M) 3 3 (c) (d) Figure 2: Purinergic enzyme activities of microglial cells treated with LPS (1 μg/mL) and increasing concentrations of AlCl (1–1000 μM) for 96 h. NTPDase activity using (a) ATP and (b) ADP as substrates, (c) 5′-NT activity using AMP as substrate, (d) ADA activity using adenosine as substrate. C = control group; LPS = lipopolysaccharide. Values are expressed as mean ± SD (n =3). Statistical significance in comparison ∗ ∗∗ ∗∗∗ to the control group. p <0:05, p <0:01, and p <0:001. One-way ANOVA followed by Tukey’s post hoc test. A2AR, and A1R purinoceptor gene expression. Results the changes in ectoenzymes activities and expression/den- showed that both LPS and Al significantly upregulated the sity of purinoceptors. 3+ expression of the P2X7R and A2AR purinoceptors whereas Since Al , the neurotoxic and biologically reactive Al they downregulated the expression of the A1R purinoceptor free ion, can pass the BBB and deposit in the brain tissue when compared to the control group. Complementary to [6–9], microglial cells are within the reach of this element. RT-qPCR findings, Western blot analysis also showed that Therefore, the possible uptake of Al was tracked qualitatively LPS and Al were capable of modulating the protein levels of using Lumogallion fluorescent probe. This chemical has been purinoceptors by significantly upregulating the density of the proposed to generate an orange fluorescence signal when 3+ P2X7R and A2AR receptors and downregulating the density binding to the soluble Al free ion [13, 31], as indicated in of the A1R receptor compared to the control group (Figure 4). Figure 1(c)–1(i), leading to the suggestion that Al can be internalized by these immune cells. Based on this assumption, it is relevant to comprehend the 4. Discussion possible mechanisms related to the toxicity of the different stimuli used here in microglial cells. It is also noteworthy to Literature data have underlined the involvement of the comment that, although there are shortcomings of employing purinergic system in the inflammatory responses and in vitro cellular models, the cell line used here has been pro- microglia behavior within the CNS [22, 24]. However, posed as a valuable substitute platform for in vivo microglia [38], suggesting these immune cells as a potential tool to inves- the impact of Al on the modulation of the purinergic sys- tem in microglial cells is poorly understood. In the current tigate the effects triggered by the exposure to toxic agents. study, we showed that Al, and also LPS, disturbed some Insults and noxious stimuli that alter CNS homeostasis, purinergic system parameters of BV-2 cells, evidenced by such as Al and LPS, may trigger the outpour of key purinergic NTPDase activity 5′-NT activity (nmol Pi/min/mg of protein) (nmol Pi/min/mg of protein) ADA activity NTPDase activity (U Ado/mg of protein) (nmol Pi/min/mg of protein) 6 Journal of Immunology Research P2X7R A2AR 4 6 ⁎⁎⁎⁎ ⁎⁎⁎⁎ ⁎⁎⁎ ⁎⁎ 𝛽 𝛽 Control LPS Al Control LPS Al (a) (b) A1R 1.5 1.0 ⁎⁎⁎ 0.5 0.0 Control LPS Al (c) Figure 3: Gene expression of purinoceptors by RT-qPCR analysis of microglial cells treated with LPS (1 μg/mL) and AlCl (1000 μM) for 96 h. Al = aluminum; LPS = lipopolysaccharide. Values are expressed as mean ± SD (n =3) of the relative concentration compared to the ∗ ∗ ∗∗ ∗∗∗ ∗∗∗∗ control group. Statistical significance in comparison to the control group. p <0:05, p <0:01, p <0:001, and p <0:001. One-way ANOVA followed by Tukey’s post hoc test. ~ 45 kDa P2X7R ~ 65 kDa A2AR 𝛽-Actin ~ 42 kDa 𝛽-Actin ~ 42 kDa 250 ⁎⁎⁎⁎ ⁎⁎⁎⁎ ⁎⁎ ⁎⁎⁎ Control LPS Al Control LPS Al (a) (b) ~ 37 kDa A1R ~ 42 kDa 𝛽-Actin ⁎⁎⁎ Control LPS Al (c) Figure 4: Protein density of purinoceptors by Western blot analysis of microglial cells treated with LPS (1 μg/mL) and AlCl (1000 μM) for 96 h. Al = aluminum; LPS = lipopolysaccharide. Values are expressed as mean ± SD (n =3). Statistical significance in comparison to the ∗ ∗∗ ∗∗∗ ∗∗∗∗ control group. p <0:05, p <0:01, p <0:001, and p <0:001. One-way ANOVA followed by Tukey’s post hoc test. messengers from microglial cells [24]. Changes in the levels [14–17]. In this way, the possible changes in the activity of of extracellular molecules, such as ATP and its breakdown these key enzymes were further investigated. Similar to our products, are sensed by membrane-bound enzymes of the findings, a previous investigation using blood lymphocytes purinergic pathway, including NTPDase, 5 -NT, and ADA of rats [39] also reported that LPS may affect the metabolism P2X7R % of the control (% of the control) (-actin normalized) A1R % of the control (% of the control) (-actin normalized) A2AR % of the control (% of the control) (-actin normalized) Journal of Immunology Research 7 density of the A1R receptor were found decreased whereas of nucleotides and nucleoside, reducing ATP hydrolysis and increasing adenosine breakdown. Moreover, ATP and AMP A2AR receptor expression/density were increased. These hydrolysis as well as NTPDase1 and 5 -NT expression have findings are of significance considering that A1R receptors been shown diminished in a model of M1 macrophages (inhibitory) have been mainly associated with neuroprotec- (challenged with LPS) [40]. tion whereas the A2AR receptors (facilitatory) to neurode- Concerning the effects observed for Al on enzyme activi- generation and neuroinflammation. Moreover, the 3+ ties, these could reflect the capacity of Al to substitute metal antagonism of A2AR receptors may also provide neuropro- ions and/or its interaction with nucleotides. The Al free ion tection in several disease conditions [47, 48, 56–58]. How- 2+ ever, inhibition of both adenosine receptors, A1R and may be able to displace native ions, such as Mg , at protein binding sites, thus being able to affect their biological func- A2AR, has also been suggested to afford neuroprotection against AlCl tions [9, 41–43]. For instance, NTPDase is a metalloenzyme exposure in neuroblastoma cells [59]. There- 2+ 2+ that requires Ca or Mg ions for its optimal activity and fore, these outcomes and the findings of our study highlight may have its functioning altered in the lack of these ions that adenosine receptors are also candidates for further 3+ [15]. Moreover, the ability of Al to interact with molecules, investigation. such as ATP [43], could reduce the availability of this nucle- Taken together, our findings suggested that microglial 3+ otide and interfere with the activity of membrane-bound cells can uptake the Al free ion, displayed by the orange enzymes of the purinergic pathway [13]. fluorescence labeling tracked by Lumogallion reagent. The activities of ectoenzymes showed a decrease/increase in the A coordinated upregulation of 5 -NT and purinocep- metabolism of nucleotides/nucleoside, respectively, when tor expression, particularly A2AR expression, has been cells were exposed to both stimuli. Moreover, Al and LPS suggested by previous reports such as in hippocampal upregulated the expression/density of purinoceptors gener- astrocytes of human patients with mesial temporal lobe epilepsy (MTLE) [44], in a rat model of Parkinson’s dis- ally associated with neurotoxicity and neuroinflammation ease [45], and in a rat model of AD [46]. However, and downregulated the expression/density of purinoceptors although our results regarding the A2AR receptor are in related to neuroprotection. In this sense, our current findings provide a possible link between Al and also LPS toxic effects agreement with these previous reports, the decrease in 5 and purinergic system alterations in microglial cells and sup- -NT activity was also indicated when neurospheres were 3+ treated with Al [13]. port future studies to clarify these issues. Also, an increase in ADA enzyme activity for cells treated with Al and LPS was found here. Adenosine, the main ATP 5. Conclusions breakdown product binds to P1 type of receptors, including In summary, to the best of our knowledge, our results report A1R and A2AR subtypes of receptors, and together with some first indication on the possible involvement of the pur- ATP presents central neuromodulatory and immunomodu- inergic system in the mechanisms of Al toxicity in brain latory functions in the brain [19, 22, 47, 48]. Thus, the alter- microglial cells. This agent evoked alterations in the setup ations evoked by LPS and Al regarding purinergic parameters of the purinergic system suggesting that this signaling path- could also influence immune/microglial responses in the way may be further investigated as a pivotal factor to under- brain, but these effects are issues to be addressed in more stand the effects triggered by toxic compounds in the CNS. detail by further studies. As microglial cells are recognized to express essentially all types of purinergic system proteins [22, 24], the effect of Al Abbreviations and LPS exposure on the modulation of purinoceptors could ′ ′ 5 -NT: 5 -Nucleotidase also be a relevant mechanism underlying the toxicity of these agents in neuroimmune cells. P2X7R receptors are ATP- A1R: Adenosine A1 receptor A2AR: Adenosine A2A receptor gated ionotropic channels indicated to present a major role AD: Alzheimer’s disease in neurodegeneration and neuroinflammation [49]. The ADA: Adenosine deaminase increased expression of P2X7R receptors has also been sug- Ado: Adenosine gested in microglial cells of Aβ-injected rat brains and ADP: Adenosine diphosphate human brains of AD patients [50], in microglia of a model Al: Aluminum using LPS administration [51], in immature rat brains 3+ Al : Al trivalent ion exposed to lead (Pb) [52], and in the hippocampus of mouse AlCl : Aluminum chloride pups also exposed to Pb [53]. In this sense, P2X7R receptors AMP: Adenosine monophosphate and downstream signaling pathways triggered by their acti- ANOVA: Analysis of variance vation may have a central contribution in the toxic mecha- ATP: Adenosine triphosphate nisms triggered by Al and LPS and offer the possibility for BBB: Blood-brain barrier future exploration. CNS: Central nervous system Adenosine signaling is also of particular relevance in the DAPI: ′ brain [47, 48]. For instance, an increased expression of the 4 ,6-Diamidino-2-phenylindole A2AR receptor has also been indicated for other brain insult FBS: Fetal bovine serum models, for example, perinatal brain injury [54] and in LPS- LPS: Lipopolysaccharide treated microglial cells [55]. In our study, the expression/- NPCs: Neural progenitor cells 8 Journal of Immunology Research NTPDase: Nucleoside triphosphate diphosphohydrolase [3] Z. Wang, X. Wei, J. Yang et al., “Chronic exposure to alumi- num and risk of Alzheimer’s disease: a meta-analysis,” Neuro- P1: Adenosine receptors science Letters, vol. 610, pp. 200–206, 2016. P2: ATP/ADP receptors [4] C. Exley, “Aluminum should now be considered a primary eti- PFA: Paraformaldehyde ological factor in Alzheimer’s disease,” Journal of Alzheimer’s RT-qPCR: Real-time quantitative polymerase chain Disease Reports, vol. 1, no. 1, pp. 23–25, 2017. reaction [5] C. Exley, “Human exposure to aluminium,” Environmental RIPA: Radioimmunoprecipitation assay Science: Processes and Impacts, vol. 15, no. 10, pp. 1807– TBST: Tris-buffered saline with Tween 1816, 2013. UDP: Uridine diphosphate [6] A. Becaria, A. Campbell, and S. C. Bondy, “Aluminum as a tox- UTP: Uridine triphosphate icant,” Toxicology and Industrial Health, vol. 18, no. 7, pp. 309–320, 2002. Data Availability [7] W. A. Banks and A. J. Kastin, “Aluminum-induced neurotox- icity: alterations in membrane function at the blood-brain bar- The data used to support the findings of this study are avail- rier,” Neuroscience & Biobehavioral Reviews, vol. 13, no. 1, able from the corresponding author, upon reasonable pp. 47–53, 1989. request. [8] D. Julka, R. K. Vasishta, and K. D. Gill, “Distribution of aluminum in different brain regions and body organs of Additional Points rat,” Biological Trace Element Research, vol. 52, no. 2, pp. 181–192, 1996. Highlights. Aluminum (Al) and lipopolysaccharide (LPS) [9] C. Exley, “What is the risk of aluminium as a neurotoxin?,” modulated purinergic system parameters of BV-2 brain Expert Review of Neurotherapeutics, vol. 14, no. 6, pp. 589– microglial cells. Al and LPS altered the metabolism of nucle- 591, 2014. otides (ATP, ADP, and AMP) and nucleoside (adenosine). Al [10] S. C. Bondy, “Prolonged exposure to low levels of aluminum and LPS upregulated the expression/density of purinoceptors leads to changes associated with brain aging and neurodegen- associated with neurodegeneration and neuroinflammation. eration,” Toxicology, vol. 315, pp. 1–7, 2014. Al and LPS downregulated the expression/density of purino- [11] S. C. Bondy, “Low levels of aluminum can lead to behavioral ceptors associated with neuroprotection. and morphological changes associated with Alzheimer’s dis- ease and age-related neurodegeneration,” Neurotoxicology, Disclosure vol. 52, pp. 222–229, 2016. [12] K. P. Reichert, M. R. C. Schetinger, M. M. Pillat et al., “Alumi- The funding agencies had no role in the study design, in the num affects neural phenotype determination of embryonic collection, analysis, and interpretation of the data, in the neural progenitor cells,” Archives of Toxicology, vol. 93, no. 9, writing of the manuscript, and in the decision for pp. 2515–2524, 2019. publication. [13] K. P. Reichert, M. M. Pillat, M. R. C. Schetinger et al., “Alumi- num-induced alterations of purinergic signalling in embryonic Conflicts of Interest neural progenitor cells,” Chemosphere, vol. 251, p. 126642, The authors declare that there are no conflicts of interest. [14] H. Zimmermann, “Ectonucleotidases in the nervous system,” Novartis Foundation Symposium, vol. 276, pp. 113–128, 2006. Acknowledgments [15] M. R. C. Schetinger, V. M. Morsch, C. D. Bonan, and A. T. S. Wyse, “NTPDase and 5′-nucleotidase activities in physiologi- The authors are grateful for the funding provided by Con- cal and disease conditions: new perspectives for human selho Nacional de Desenvolvimento Científico e Tecnológico health,” BioFactors, vol. 31, no. 2, pp. 77–98, 2007. (CNPq), Fundação de Amparo à Pesquisa do Estado do Rio [16] G. G. Yegutkin, “Nucleotide- and nucleoside-converting Grande do Sul (FAPERGS), and Coordenação de Aperfeiçoa- ectoenzymes: important modulators of purinergic signalling mento de Pessoal de Nível Superior (CAPES/PROEX fellow- cascade,” Biochimica et Biophysica Acta-Molecular Cell ship grant, process number 88882.182154/2018-01). Research, vol. 1783, no. 5, pp. 673–694, 2008. CAPES/PrInt process number 88881.310287/2018-01 is also [17] H. Zimmermann, M. Zebisch, and N. Sträter, “Cellular func- acknowledged. tion and molecular structure of ecto-nucleotidases,” Purinergic Signalling, vol. 8, no. 3, pp. 437–502, 2012. References [18] B. B. Fredholm, A. P. IJzerman, K. A. Jacobson, K. N. Klotz, and J. Linden, “International Union of Pharmacology. XXV. [1] M. Prince, R. Bryce, E. Albanese, A. Wimo, W. Ribeiro, and Nomenclature and classification of adenosine receptors,” C. P. Ferri, “The global prevalence of dementia: a systematic Pharmacological Reviews, vol. 53, no. 4, pp. 527–552, 2001. review and metaanalysis,” Alzheimer’s & Dementia, vol. 9, [19] G. Burnstock, B. B. Fredholm, and A. Verkhratsky, “Adeno- no. 1, pp. 63–75, 2013. sine and ATP receptors in the brain,” Current Topics in Medic- [2] L. Gan, M. R. Cookson, L. Petrucelli, and A. R. La Spada, “Con- inal Chemistry, vol. 11, no. 8, pp. 973–1011, 2011. verging pathways in neurodegeneration, from genetics to mechanisms,” Nature Neuroscience, vol. 21, no. 10, pp. 1300– [20] G. Burnstock, “Purine and purinergic receptors,” Brain and 1309, 2018. Neuroscience Advances, vol. 2, 2018. Journal of Immunology Research 9 [38] A. Henn, S. Lund, M. Hedtjärn, A. Schrattenholz, P. Pörzgen, [21] G. Burnstock, “Purinergic signalling and disorders of the cen- tral nervous system,” Nature Reviews Drug Discovery, vol. 7, and M. Leist, “The suitability of BV2 cells as alternative model no. 7, pp. 575–590, 2008. system for primary microglia cultures or for animal experi- ments examining brain inflammation,” ALTEX, vol. 26, [22] E. Beamer, F. Gölöncsér, G. Horváth et al., “Purinergic mech- no. 2, pp. 83–94, 2009. anisms in neuroinflammation: an update from molecules to behavior,” Neuropharmacology, vol. 104, pp. 94–104, 2016. [39] V. V. Miron, N. B. Bottari, C. E. Assmann et al., “Physical exer- cise prevents alterations in purinergic system and oxidative [23] G. Burnstock, “Purinergic signalling and neurological diseases: status in lipopolysaccharide-induced sepsis in rats,” Journal an update,” CNS & Neurological Disorders Drug Targets, of Cellular Biochemistry, vol. 120, no. 3, pp. 3232–3242, 2018. vol. 16, no. 3, pp. 257–265, 2017. [40] R. F. Zanin, E. Braganhol, L. S. Bergamin et al., “Differential [24] S. Calovi, P. Mut-Arbona, and B. Sperlágh, “Microglia and the macrophage activation alters the expression profile of purinergic signaling system,” Neuroscience, vol. 405, pp. 137– NTPDase and ecto-5′-nucleotidase,” PLoS One, vol. 7, no. 2, 147, 2019. article e31205, 2012. [25] V. H. Perry, J. A. R. Nicoll, and C. Holmes, “Microglia in neu- [41] T. Kiss, K. Gajda-Schrantz, and P. F. Zatta, “The role of alumi- rodegenerative disease,” Nature Reviews Neurology, vol. 6, num in neurotoxic and neurodegenerative processes,” In: Neu- no. 4, pp. 193–201, 2010. rodegenerative Diseases and Metal Ions, vol. 1, pp. 371–393, [26] S. Hickman, S. Izzy, P. Sen, L. Morsett, and J. El Khoury, “Microglia in neurodegeneration,” Nature Neuroscience, [42] E. Rezabal, J. M. Mercero, X. Lopez, and J. M. Ugalde, “Protein vol. 21, no. 10, pp. 1359–1369, 2018. side chains facilitate Mg/Al exchange in model protein binding [27] T. Toimela and H. Tähti, “Mitochondrial viability and apopto- sites,” ChemPhysChem, vol. 8, no. 14, pp. 2119–2124, 2007. sis induced by aluminum, mercuric mercury and methylmer- cury in cell lines of neural origin,” Archives of Toxicology, [43] P. Cardiano, C. Foti, F. Giacobello, O. Giuffrè, and 3+ S. Sammartano, “Study of Al interaction with AMP, ADP vol. 78, no. 10, pp. 565–574, 2004. and ATP in aqueous solution,” Biophysical Chemistry, [28] L. Qin, X. Wu, M. L. Block et al., “Systemic LPS causes chronic vol. 234, pp. 42–50, 2018. neuroinflammation and progressive neurodegeneration,” Glia, vol. 55, no. 5, pp. 453–462, 2007. [44] A. R. Barros-Barbosa, F. Ferreirinha, Â. Oliveira et al., “Aden- osine A2A receptor and ecto-5 -nucleotidase/CD73 are upreg- [29] A. D. Bachstetter, B. Xing, L. de Almeida, E. R. Dimayuga, ulated in hippocampal astrocytes of human patients with D. M. Watterson, and L. J. Van Eldik, “Microglial p38α MAPK mesial temporal lobe epilepsy (MTLE),” Purinergic Signalling, is a key regulator of proinflammatory cytokine up-regulation vol. 12, no. 4, pp. 719–734, 2016. induced by toll-like receptor (TLR) ligands or beta-amyloid (Aβ),” Journal of Neuroinflammation, vol. 8, p. 79, 2011. [45] M. Carmo, F. Q. Gonçalves, P. M. Canas et al., “Enhanced ATP release and CD73-mediated adenosine formation sustain [30] M. Mold, H. Eriksson, P. Siesjö, A. Darabi, E. Shardlow, and adenosine A2A receptor over-activation in a rat model of Par- C. Exley, “Unequivocal identification of intracellular alumin- kinson’s disease,” British Journal of Pharmacology, vol. 176, ium adjuvant in a monocytic THP-1 cellline,” Scientific no. 18, pp. 3666–3680, 2019. Reports, vol. 4, p. 6287, 2014. [46] F. Q. Gonçalves, J. P. Lopes, H. B. Silva et al., “Synaptic and [31] M. Mold, M. Kumar, A. Mirza, E. Shardlow, and C. Exley, memory dysfunction in a β-amyloid model of early Alzhei- “Intracellular tracing of amyloid vaccines through direct mer’s disease depends on increased formation of ATP- fluorescent labelling,” Scientific Reports, vol. 8, no. 1, derived extracellular adenosine,” Neurobiology of Disease, p. 2437, 2018. vol. 132, article 104570, 2019. [32] M. R. Schetinger, N. M. Porto, M. B. Moretto et al., “New ben- [47] R. A. Cunha, “Neuroprotection by adenosine in the brain: zodiazepines alter acetylcholinesterase and ATPDase acti- from A1 receptor activation to A2A receptor blockade,” Puri- vites,” Neurochemical Research, vol. 25, pp. 949–955, 2000. nergic Signalling, vol. 1, no. 2, pp. 111–134, 2005. [33] D. Heymann, M. Reddington, and G. W. Kreutzberg, “Subcel- ′ [48] R. A. Cunha, “How does adenosine control neuronal dysfunc- lular localization of 5 -nucleotidase in rat brain,” Journal of tion and neurodegeneration?,” Journal of Neurochemistry, Neurochemistry, vol. 43, no. 4, pp. 971–978, 1984. vol. 139, no. 6, pp. 1019–1055, 2016. [34] G. Giusti and B. Galanti, “Colorimetric method,” in Methods of [49] S. D. Skaper, P. Debetto, and P. Giusti, “The P2X7 purinergic Enzymatic Analysis, H. U. Bergmeyer, Ed., pp. 315–323, Verlag receptor: from physiology to neurological disorders,” FASEB Chemie, Berlin, Weinheim, Germany, 3rd edition, 1984. Journal, vol. 24, no. 2, pp. 337–345, 2009. [35] C. E. Assmann, F. C. Cadoná, B. S. R. Bonadiman, E. B. Dor- [50] J. G. McLarnon, J. K. Ryu, D. G. Walker, and H. B. Choi, nelles, G. Trevisan, and I. B. M. da Cruz, “Tea tree oil presents in vitro antitumor activity on breast cancer cells without cyto- “Upregulated expression of purinergic P2X(7) receptor in Alz- heimer disease and amyloid-beta peptide-treated microglia toxic effects on fibroblasts and on peripheral blood mononu- clear cells,” Biomedicine & Pharmacotherapy, vol. 103, and in peptide-injected rat hippocampus,” Journal of Neuropa- thology and Experimental Neurology, vol. 65, no. 11, pp. 1090– pp. 1253–1261, 2018. 1097, 2006. [36] N. Rebola, P. C. Pinheiro, C. R. Oliveira, J. O. Malva, and R. A. [51] H. B. Choi, J. K. Ryu, S. U. Kim, and J. G. McLarnon, “Modu- Cunha, “Subcellular localization of adenosine A (1) receptors in nerve terminals and synapses of the rat hippocampus,” lation of the purinergic P2X7 receptor attenuates lipopolysaccharide-mediated microglial activation and neuro- Brain Research, vol. 987, no. 1, pp. 49–58, 2003. nal damage in inflamed brain,” Journal of Neuroscience, [37] M. M. Bradford, “A rapid and sensitive method for the quan- vol. 27, no. 18, pp. 4957–4968, 2007. titation of microgram quantities of protein utilizing the princi- ple of protein-dye binding,” Analytical Biochemistry, vol. 72, [52] I. Baranowska-Bosiacka, B. Dąbrowska-Bouta, and no. 1-2, pp. 248–254, 1976. L. Strużyńska, “Regional changes in purines and selected 10 Journal of Immunology Research purinergic receptors in immature rat brain exposed to lead,” Toxicology, vol. 279, no. 1-3, pp. 100–107, 2011. [53] N. Li, P. Zhang, M. Qiao, J. Shao, H. Li, and W. Xie, “The effects of early life lead exposure on the expression of P2X7 receptor and synaptophysin in the hippocampus of mouse pups,” Journal of Trace Elements in Medicine and Biology, vol. 30, pp. 124–128, 2015. [54] M. Colella, M. Zinni, J. Pansiot et al., “Modulation of micro- glial activation by adenosine A2a receptor in animal models of perinatal brain injury,” Frontiers in Neurology, vol. 9, p. 605, 2018. [55] A. G. Orr, A. L. Orr, X.-J. Li, R. E. Gross, and S. F. Traynelis, “Adenosine A2A receptor mediates microglial process retrac- tion,” Nature Neuroscience, vol. 12, no. 7, pp. 872–878, 2009. [56] N. Rebola, A. P. Simões, P. M. Canas et al., “Adenosine A2A receptors control neuroinflammation and consequent hippo- campal neuronal dysfunction,” Journal of Neurochemistry, vol. 117, no. 1, pp. 100–111, 2011. [57] J. Stockwell, E. Jakova, and F. S. Cayabyab, “Adenosine A1 and A2A receptors in the brain: current research and their role in neurodegeneration,” Molecules, vol. 22, no. 4, p. 676, 2017. [58] R. Franco and G. Navarro, “Adenosine A2A receptor antago- nists in neurodegenerative diseases: huge potential and huge challenges,” Frontiers in Psychiatry, vol. 9, p. 68, 2018. [59] S. Giunta, V. Andriolo, and A. Castorina, “Dual blockade of the A1 and A2A adenosine receptor prevents amyloid beta toxicity in neuroblastoma cells exposed to aluminum chlo- ride,” The International Journal of Biochemistry & Cell Biology, vol. 54, pp. 122–136, 2014.

Journal

Journal of Immunology ResearchHindawi Publishing Corporation

Published: Jan 19, 2021

There are no references for this article.