Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

LncRNA PVT1 Mediates Antiapoptosis and 5-Fluorouracil Resistance via Increasing Bcl2 Expression in Gastric Cancer

LncRNA PVT1 Mediates Antiapoptosis and 5-Fluorouracil Resistance via Increasing Bcl2 Expression... Hindawi Journal of Oncology Volume 2019, Article ID 9325407, 10 pages https://doi.org/10.1155/2019/9325407 Research Article LncRNA PVT1 Mediates Antiapoptosis and 5-Fluorouracil Resistance via Increasing Bcl2 Expression in Gastric Cancer 1 1 1 1 2 1 Peizhun Du, Cheng’en Hu, Yunyun Qin, Jing Zhao, Rajan Patel, Yan Fu , 3 3 1 Mengqi Zhu, Wenhong Zhang , and Guangjian Huang Department of GeneralSurgery,Huashan Hospital,FudanUniversity,Shanghai, China Primary Care,  Deanna Dr, Gaithersburg, MD , USA Department of Infectious Diseases, Huashan Hospital, Fudan University, Shanghai, China Correspondence should be addressed to Wenhong Zhang; zhangwenhong@fudan.edu.cn and Guangjian Huang; huangguangjian12@126.com Received 24 July 2018; Revised 31 January 2019; Accepted 18 February 2019; Published 8 May 2019 Academic Editor: Shinji Miwa Copyright © 2019 Peizhun Du et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Purpose. Plasmacytoma variant translocation 1 (PVT1) is a long noncoding RNA encoded by the human PVT1 gene, which has been verified to mediate tumorigenesis in gastric cancer. However, the underlying molecular mechanisms of PVT1 in gastric cancer (GC) remain largely unknown. Methods. eTh tumorigenic ability of PVT1 was verified by subcutaneous and orthotopic mouse models. Flow cytometry assay and TdT-mediated dUTP Nick-End Labeling staining were conducted to explore the effects of PVT1 on gastric cancer cell apoptosis. We investigated the relative gene and protein that are involved in apoptosis in real-time PCR and western blot assay. The resistance to 5- Fluorouracil (5-Fu) caused by PVT1 was evaluated using cell viability assay. en, Th to confirm the eeff cts of PVT1 on 5-Fu resistance, we conducted the Kaplan-Meier analysis based on three public databases. Results. We confirmed that PVT1 can promote the progression of gastric cancer. PVT1 inhibited the apoptosis of GC cells, which may account for its promotion on GC. We confirmed that PVT1 can regulate the expression of Bcl2 and enhance drug-resistance of gastric cancer to 5-Fu. Kaplan-Meier analysis showed that patients with high PVT1 expression do not experience survival related benefits from 5- Fu based chemotherapy; instead, therapy containing no 5-Fu chemotherapy can improve the first progression survival and overall survival of high PVT1 expression GC patients significantly. Conclusion. Our results showed that PVT1 can inhibit the apoptosis and enhance the 5-Fu resistance of gastric cancer through the activation of Bcl2. PVT1 has the potential to serve as an indicator to predict 5-Fu treatment resistance. 1. Introduction Recently, the function of long noncoding RNA (lncRNA) in malignant tumors has attracted increasing attention. Gastric cancer (GC) is the second common cancer and the LncRNA is identified as the noncoding RNA, which is third most common cause of cancer death worldwide [1]. longer than 200 nucleotides and has limited protein-coding Although radical surgery and perioperative chemotherapy ability. Because of the lack of ability to encode protein, lncRNA was regarded as evolutionary “junk” or “transcrip- can improve survival of GC patients, the overall survival rate of advanced GC is still less than one year [2]. Many tional noise” in transcription at the beginning stage. But aberrantly expressed genes in GC have been explored in the with deepening of exploration, many crucial functionali- past decades, but novel molecular markers that can be useful ties of lncRNA in physiological and pathological processes, in early diagnosis and treatment of GC are still urgently such as chromatin modica fi tion, transcription, and post- needed. New therapeutic methods are likely to derive from transcriptional processing, were revealed. eTh dysregulation the improved understanding of the mechanisms of GC. expressed with lncRNA has been demonstrated in multiple Formerly, the exploration of mechanisms of malig- malignancies, which provides new insight into the cancer development. nant tumors was mainly focused on protein-coding genes. 2 Journal of Oncology The plasmacytoma variant translocation 1 (PVT1) gene PVT1-RT-F: CCTGTGACCTGTGGAGACAC; locatedonchromosome8q24isamongthetoptargetsofcopy PVT1-RT-R: GTCCGTCCAGAGTGCTGAAA; number alteration in cancer [3]. An increasing number of studies indicate that lncRNA PVT1 has carcinogenic potential Bcl2-RT-F: GGAGGCTGGGATGCCTTTGT; in a variety of tumors. In colorectal cancer cells, silencing Bcl2-RT-R: AAAGCCAGCTTCCCCAATGA; PVT1 can decrease proliferation and invasion capabilities by activating TGF–𝛽 [4]. In hepatocellular carcinoma, PVT1 can GAPDH-RT-F: TCGACAGTCAGCCGCATCTTC- promote proliferation and stem cell-like properties of cells TTT; by stabilizing NOP2 [5]. In pancreatic cancer, lncRNAPVT1 GAPDH-RT-R: ACCAAATCCGTTGACTCCGAC- can promote cell proliferation and migration through acting CTT. as a molecular sponge to regulate miR-448 [6]. Similarly, in gastriccancer,highPVT1expressionisalwaysassociatedwith Other premier sequences are listed in Table S1. a poor prognosis. It was reported that PVT1 can function as a competing endogenous RNA by sponging miR-186 [7] .. Western Blotting Assay. Total protein was obtained from and miR-152 [8]. It can also directly bind the FOXM1 protein GC cell lines. The total protein was lysated using RIPA and increase FOXM1 posttranslationally and epigenetically with PMSF and quantified using the BCA method. After [9] and can regulate p15 and p16 [10]. However, the current electrophoretically separated on SDS-PAGE (Sangon Biotech, understanding of PVT1 in GC is still in its infancy, and the SD6013), the protein was electrophoresed in 10% or 12% previous investigations mainly focused on its tumorigenic ploy-acrylamide gel. Aer ft transferring the protein onto mechanisminproliferation.Hence theroleofPVT1inother the NC membrane, we blocked the membrane with 5% biological process is worth further exploring. BSA and incubated it in 1:1000 diluted antibodies against Apoptosisisprogrammedcelldeath,which isessen- Bcl2 (#2870, CST, USA), Bax (#5023, CST, USA) Caspase tial fordevelopment andsurvivaloflivingorganisms.It 3 (#9665, CST, USA), and 𝛽-actin (#12620, CST, USA) at regulates the number of cells by controlling cell activity, 4 C. Secondaryantibodywasdetectedusing theOdyssey differentiation, and proliferation. The defects in apoptotic system. pathways are now thought to contribute to tumor initiation, progression, and metastasis. What is more, it is well-known now that anticancer agents induce apoptosis and that the .. Apoptosis Detection Assay. Apoptosis detection was con- dysregulation in apoptotic process can lead to drug-resistance ducted by using the FITC Annexin V Apoptosis Detection [11]. Biological function of PVT1 in regulating GC apoptosis Kit I (BD Pharmingen, 556547). After digesting the GC cell have been mentioned in relative studies [10, 12], but the with trypsin,theisolatedcellwas incubatedinAnnexinV- internal mechanism of this process is still largely unknown. FITC, an early-stage apoptosis indicator, and then in pro- In the present study, we confirmed PVT1 can inhibit the pidium iodide, a late-stage apoptosis indicator. eTh percent apoptosis of GC through activating the antiapoptosis factor of apoptotic cells were detected by cytometry using the BD B cell leukemia 2(Bcl2). This dysfunction in apoptosis caused FACS CantoTM Flow Cytometer. by PVT1 increased the resistance of GC to anticancer agent 5-Fluorouracil (5-Fu) and made PVT1 a potential reference . . Plate Clone Formation Assay. Trypsin-digested SGC- point in formulating individualized treatment plans. 7901 cells were seeded into 6-wells plates with 1.5×10 cells. Evenly dispersed cell were incubated at 37 Cwith5%CO2 2. Materials and Methods until the visible clones appeared. Next, we discarded the medium and washed the cells with PBS twice. We stained the .. Cell Culture. Human GC cell lines SGC-7901 was pur- cells with Gentian violet solution aer ft fixing it with methanol. chased from the Chinese Academy of Sciences (Shang- eTh nwewashedthe cellsand calculatedtheclone withan hai, China). It was maintained in RPMI-1640 (Invitrogen, ordinary optical microscope. 22400089) medium with 10% fetal bovine serum and 100 u/ml penicillin and 100 ug/ml streptomycin sulphate. The cell was ∘ . . Experimental Animals. Briefly, the 3-4-week-old 20g cultured in a humidified 5% CO at 37 C. Nod/SCID mice were kept in the SPF animal laboratory. Trypsin-digested SGC-7901 cells were inoculated in sub- .. Quantitative Real-Time Reverse Transcription. Trizol cutaneous tissue of the back or stomach to establish sub- reagent was used to extract total RNA. eTh reverse transcrip- cutaneous or orthotopic models. Each site was injected tion and real-time PCR (RT-PCR) were conducted by using with 1×10 cells. eTh subcutaneous xenograft grew for 1 PrimeScript RT reagent kit (TaKaRa, RR037A) and SYBR month, and the orthotopic xenograft grew for 2 months, Premix EX Taq II kit (TaKaRa, RR820A) kit, respectively. then the mice were satisfied by anaesthesia. To compare RT-PCR was implemented under the ABI PRISM 7500 HT the tumorigenicity of GC, the subcutaneous tumors of Sequence Detection System. GAPDH was adopted as an different groups were measured for diameter. All exper- internal control in RT-PCR to standardize the variants among iments were performed in accordance with the National -ΔΔct the different samples. eTh 2 of RNAs were calculated by Institutes of Health guidelines (NIH Publications No. premier sequences: 8023). Journal of Oncology 3 .. Immunohistochemistry (IHC) and TdT-Mediated dUTP 3. Results Nick-End Labeling (TUNEL) Assay. All the GC tissue sec- .. LncRNA PVT Can Regulate the Growth of GC. tions were fixed in 4% formalin overnight and embedded First, we explored the expression of PVT1 in different in paraffin with standard techniques. eTh immunohisto- stages of GC using the Cancer RNA-Seq Nexus (CRN; chemistry detection was conducted by using a SABC kit. http://syslab4.nchu.edu.tw) so that we could access PVT1 Upon blocking using 5% BSA for 1 hour, the sections were gene expression data of GC patients from the TCGA stomach incubated in 1:100 diluted anti-Bcl2 antibody overnight at carcinoma RNA-Seq dataset [14]. As shown in Figure 1(a), 4 C.Then,thesectionswerewashedwithPBS twice. eTh n the expression of PVT1 increased with cancer progression, we added biotin labeled secondary antibody to the slides and compared to that of adjacent normal tissues. To explore the sequentially stained the slides with DAB and hematoxylin. effects of PVT1 on GC, we stably overexpressed and stably eTh stained slides were recorded using the Nikon microscope. silenced PVT1 expression in SGC-7901 cells (Figure 1(b)) In TUNEL assay, the slides were stained with the terminal and observed the influence of PVT1 on the tumorigenicity deoxynucleotidyl transferase-mediated dUTP-biotin nick- of gastric cancer cells in a mouse model. We noticed that the end labeling (TUNEL) method, using an apoptosis in situ subcutaneous xenograsft formed from PVT1-overexpressed detection kit (Wako Pure Chemical, Osaka, Japan). eTh GC cells had larger volume than xenograsft formed from FITC-labeled TUNEL-positive cells were imaged using the vector-control cells (Figures 1(c) left panel and 1(d)). Nikon fluorescent microscope. Conversely, the subcutaneous xenografts formed from PVT1- silenced GC cells had smaller volume than vector-control .. Plasmids and Transfection. Full-length lncRNA PVT1 tumors (Figures 1(c) right panel and 1(e)). An orthotopic sequences were cloned into a pcDNA 3.1 vector, termed mousemodel wasalsoestablished.Asshown inFigure 1(f), pcDNA3.1-PVT1, and were selected along with neomycin for the orthotopic xenograft formed from PVT1-overexpressed four weeks. LncRNA PVT1 shRNA oligos were synthesized, SGC-7901 cells also exhibited larger volume. Based on these annealed, and then inserted into a lentiviral pLKO.1-Puro results, we believe that PVT1 can regulate the growth of GC, plasmid, termed shRNA-pLKO.1-Puro. HEK-293T cells were and PVT1 may play a crucial role in the progression of GC. cotransfected with the above pLKO.1-Puro lentiviral vector, packaging vectors psPAX2, and pMD2.G envelope plasmid .. LncRNA PVT Can Regulate the Apoptosis of GC. Next, along with Lipofectamine2000 reagent (Invitrogen). SGC- we investigated the functions of PVT1 on GC cell behav- 7901 cells were transfected with either the pcDNA3.1-PVT1 iors. eTh clone formation assay showed that the count of plasmid (PVT1) or the pcDNA3.1-vector (CTR), labeled as clones formed by PVT1-overexpressed cells was significantly PVT1 overexpressing cells (positive control), and transfected increased (Figure 2(a)), but significantly decreased by PVT1- with the shRNA- pLKO.1-Puro plasmid (shPVT1) or pLKO.1- silenced cells (Figure 2(b)). In the apoptosis analysis, upreg- Puro plasmid (NC), labeled as PVT1 silencing cells (negative ulating PVT1 decreased the apoptosis of SGC-7901 cells; control). downregulating PVT1 increased the apoptosis of SGC-7901 cells (Figures 2(c) and 2(d)). To confirm the effects of PVT1 . . Cell Viability Assay. Cell viability was measured using on apoptosis, TUNEL staining was conducted to investigate the CCK8 method. In Brief, that entailed adding 10ul the apoptosis in the xenograsft . Compared to the control CCK-8 into the medium and mixed gently. eTh plate was xenograft, decreasing DNA fragmentation was observed in subsequently incubatedfor2handthentheabsorbance the subcutaneous xenograft formed by PVT1-overexpressed measurement was taken under a reference of 450nm. GC cells and increasing DNA fragmentation was observed from PVT1-silenced GC cells, respectively (Figures 2(e) and .. Online Kaplan-Meier Plotter (KM-Plotter) Analysis. 2(f)). Similar results were also observed in the orthotopic The KM-plotter is an online database (www.kmplot.com). xenograft (Figures 2(g) and 2(h)). Taken together, these It contains gene expression data and survival information results indicated that PVT1 can regulate the apoptosis of GC downloaded from gene expression omnibus (GEO), Euro- cells. pean Genome-phenome Archive (EGA), and the Cancer Genome Atlas (TCGA). KM-plotter software can provide .. LncRNA PVT Regulates Apoptosis by Affecting Bcl online survival analysis of GC patients with these avail- Expression. To elucidate the underlying mechanism of PVT1 able transcriptome and survival data according to different inducing apoptosis, we screened the common factors that screening conditions [13]. may be related to this apoptosis process using the RT-PCR. The results showed that the Bcl2 mRNA was significantly .. Statistical Analysis. Statistical analyses were performed increased when PVT1 was upregulated (Figure 3(a)) and sig- with the SPSS statistical package (SPSS, Inc., Chicago, nificantly decreased when PVT1 was silenced (Figure 3(b)). IL, USA) and GraphPad Prism 6.0 (GraphPad Software). Consistently, the following western blot indicated that the Experimental results were reported as a mean of at least PVT1 can regulate the expression of Bcl2 protein but has three independent experiments conducted in triplicate. Two- noeeff ctontheBaxprotein.Beyondthat,we noticedthat tailed Student’s t-test and Kaplan-Meier analyses were used the downstream apoptosis executor of Bcl2, cleaved caspase- as appropriate. P<0.05 were considered to be statistically 3, was decreased when the PVT1 was overexpressed and significant. increased when PVT1 was silenced (Figure 3(c)). To further 4 Journal of Oncology 1.5 n=39 3 ∗ n=57 15 1.0 n=78 n=55 0.5 n=35 0 0.0 CTR PVT1 NC shPVT1 (a) (b) Subcutaneous Tumor __________________________________ (c) 200 50 3d 7d 14d 21d 28d 3d 7d 14d 21d 28d PVT1 shPVT1 CTR NC (d) (e) Orthotopic Tumor CTR PVT1 (f) Figure 1: LncRNA PVT1 can regulate the growth of GC. (a) The expression of PVT1 in different stages of GC. A total of 431 samples were included in this dataset. es Th e samples were divided into different subsets according to the tumor stages. The numbers refer to the number of people in the corresponding subsets. (b) This shows the validation of stably overexpressed and silenced PVT1 in SGC-7901 cells via qRT-PCR. PVT1 refers to PVT1 overexpression; CTR indicates the control group of PVT1; shPVT1 represents PVT1 silenced by shRNA; NC indicates the control of shPVT1. (c) This shows the subcutaneous tumors derived from SGC-7901 cells with overexpressed or silenced PVT1 (n=3 for each group). (d, e) This shows that the tumor volumes were measured at the indicated time. (f) This shows the orthotopic malignant tumor from SGC-7901 cells with overexpressed PVT1. Results were measured in triplicate in each experiment.∗P< 0.05. verify the regulation of PVT1 on Bcl2, we evaluated the from PVT1-overexpressed SGC-7901 cells but weakened in expression of Bcl2 protein in xenografts through the IHC that from PVT1-silenced SGC-7901 cells (Figure 4(d)). Con- assay. eTh IHC assay showed that the Bcl2 staining was sistently, IHC showed Bcl2 staining was also strengthened evidently strengthened in subcutaneous xenografts formed when PVT1 was overexpressed in the orthotopic GC tumor Normal Stage IIB Stage IIIA Stage IIIB Stage IIIC Average tumor volume (ＧＧ ) Transcripts Per Million PVT1 CTR Relative Fold Change of lncRNA PVT1 Average tumor shPVT1 NC volume (ＧＧ ) Journal of Oncology 5 CTR PVT1 5 5 10 10 4 4 10 10 3 3 10 10 800 600 2 2 10 10 0 0 0 CTR PVT1 2 3 4 5 2 3 4 5 0 10 10 10 10 0 10 10 10 10 Annexin V-FITC Annexin V-FITC 200 NC shPVT1 10 10 0 4 10 10 10 NC shPVT1 CTR PVT1 3 3 10 10 0 0 2 3 4 5 2 3 4 5 0 0 10 10 10 10 0 10 10 10 10 Annexin V-FITC Annexin V-FITC NC shPVT1 (a) (b) (c) (d) Subcutaneous Tumor ∗ ∗ _____________________________________ DAPI TUNEL DAPI TUNEL (e) (f) Orthotopic Tumor __________________ DAPI TUNEL CTR PVT1 (g) (h) Figure 2: LncRNA PVT1 can regulate the apoptosis of GC. (a, b) This shows the clone formation assay of SGC-7901 with overexpressed and silenced PVT1. (c) eTh apoptosis cells were assessed using flow cytometry assay in PVT1 overexpressed and silenced SGC-7901 cells. (d) shows the quantitative results of the flow cytometry assay demonstrating the percentage of apoptotic cells. (e, g) TUNEL assay to detect apoptotic cells in xenografts tissues. eTh green cells indicate the TUNEL-positive apoptotic cells. The images of TUNEL-positive cells were captured by u fl orescence microscope (400×). (f) Quantitative results of TUNEL assay of subcutaneous tumors tissues. (h) Quantitative results of TUNEL assay of orthotopic tumor tissues. All of the data shown represent the mean± SD of three independent experiments.∗P< 0.05. CTR PVT1 shPVT1 NC Count of cells PVT1 CTR Count of cells PVT1 CTR shPVT1 NC Propidium Iodide Propidium Iodide Apoptosis cell (%) Propidium Iodide Propidium Iodide Apoptosis cell (%) Percent of cells (%) Percent of cells (%) 6 Journal of Oncology 1.5 3 ∗ 1.5 1.0 1.0 0.5 0.5 0.0 0.0 CTR NC PVT1 shPVT1 (a) (b) Subcutaneous Tumor _________________________________ CTR PVT1 NC shPVT1 CTR PVT1 Bcl2 -26kDa -20kDa Bax -19kDa C-casp 3 -17kDa -45kDa -actin NC shPVT1 (c) (d) FPS OS 100 100 P=0.002 P<0.001 Orthotopic Tumor _________________________________ 0 50 100 150 200 0 50 100 150 Months Months PVT1 & BCL2 Low(n=274) PVT1 & BCL2 Low(n=356) PVT1 & BCL2 Middle(n=288) PVT1 & BCL2 Middle(n=349) PVT1 & BCL2 High(n=79) PVT1 & BCL2 High(n=171) CTR PVT1 (e) (f) (g) Figure 3: LncRNA PVT1 regulates apoptosis by aec ff ting Bcl2 expression. (a, b) This shows the expression of common apoptosis related factors in PVT1 overexpressed or silenced SGC-7901 cells. Results for experiment were measured in triplicate.∗P< 0.05. (c) Western blot analysis showing protein levels of Bcl2, Bax, and cleaved caspase-3.𝛽-actin was the internal control. (d) Representative IHC results of Bcl2 staining in subcutaneous tumor tissues from PVT1 overexpressed and silenced SGC-7901 cells. Results were measured in triplicate for each experiment (n=3 for each group). (e) Representative IHC results of Bcl2 staining in orthotopic tumor tissues. (f, g) GSE microarray (including GSE-14210, GSE-15459, GSE-22377, GSE-29272, GSE-51105, and GSE-62254) data were divided into three groups based on PVT1 and Bcl2 expression values; patients with both high expression of PVT1 and high expression of Bcl2 were divided into high group. Patients with both low expression of PVT1 and low expression of Bcl2 were divided into low group. The remaining patients were assigned to the middle group. Kaplan-Meier analysis was performed to compare their FPS and OS differences among the three groups. Atm Apof-1 Bad Bak Bax Bcl2 Bcl-w Bid Bim CASP3 CASP6 CASP7 Fas Survivin Atm Apof-1 Bad Bak Bax Bcl2 Bcl-w Bid Bim CASP3 CASP6 CASP7 Fas Survivin Relative Fold Change Percent survival Relative Fold Change Percent survival Journal of Oncology 7 20 NC: IC50=6.57mM CTR: IC50=6.20mM shPVT1: IC50=3.45mM PVT1: IC50=18.73mM −1 0 123 −1 0123 log concentration (mM) log concentration (mM) NC CTR shPVT1 PVT1 0 0 CTR PVT1 NC shPVT1 (a) (b) CTR PVT1 ____________________ _____________________ 5-Fu -- + + Bcl2 -actin (c) (d) OS/GSE15459 FPS/GSE15459 100 100 50 50 n=15 n=15 n=40 n=42 P=0.57>0.05 P=0.45>0.05 0 0 0 50 100 150 0 50 100 150 Months Months PVT1 High: Surgery+5-Fu PVT1 High: Surgery+5-Fu PVT1 High: Surgery PVT1 High: Surgery (e) (f) OS/GSE62254 FPS/GSE62254 n=37 n=39 n=56 n=59 P<0.001 P<0.001 0 0 0 20406080 100 0 20406080 100 Months Months PVT1 High: Surgery+non 5-Fu PVT1 High: Surgery+non 5-Fu PVT1 High: Surgery PVT1 High: Surgery (g) (h) Figure 4: LncRNA PVT1 enhances drug-resistance of GC to 5-Fu. (a, b) Cell viability aer ft 5-Fu treatment of PVT1 overexpressed and silenced SGC-7901 cells. (c) mRNA level of Bcl2 aer ft 5-Fu treatment in SGC-7901 cells with or without overexpressed PVT1. Results were measured in triplicate for each experiment.∗P<0.05. (d) The alteration of Bcl2 protein aeft r 5-Fu treatment in SGC-7901 cells with or without overexpressed PVT1;𝛽-actin was the internal control. All of the data shown represent the mean ± SD of three independent experiments. (e, f) GSE15459 microarray data were divided into two groups based on the treatment, including high PVT1 level patients receiving both surgery and 5-Fu based adjuvant (PVT1 High: Surgery+5-Fu); high PVT1 level patients at stage III and IV receiving only surgery (PVT1 High: Surgery). Kaplan- Meier analysis was performed to compare their FPS and OS differences among the two groups. (g, h) eTh GSE62254 microarray data were divided into two groups, including high PVT1 level patients receiving both surgery and non-5-Fu adjuvant (PVT1 High: Surgery+non-5-Fu); high PVT1 level patients at stages III and IV receiving only surgery (PVT1 High: Surgery).∗P< 0.05. CTR PVT1 5-Fu treatment CTR 5-Fu treatment PVT1 Percent survival Percent survival Cell viability (% of control) Relative Fold Change of BCL2 IC50 (mM) Percent survival Percent survival Cell viability (% of control) IC50 (mM) 8 Journal of Oncology (Figure 4(e)). In addition, Kaplan-Meier survival analysis in response [19]. For malignant tumors, a large percentage of GEO datasets revealed that GC patients with both high level cell loss was due to apoptosis, especially in spontaneously of PVT1 and Bcl2 sueff red shortest rst fi progression survival regressing tumors and in tumors treated with cytotoxic (FPS) (Figure 4(f)) and overall survival (OS) (Figure 4(g)). anticancer agents. It was suggested that apoptosis is linked Collectively, those results demonstrated that the effects of tothehighrateofcelllossinmalignant tumors andcould PVT1 on apoptosis were achieved by regulating Bcl2. High promote the progression of the tumor [11]. In the present levels of PVT1 combined with Bcl2 can predict poor progno- study, we confirmed that PVT1 can inhibit the apoptosis of sis in GC. GC; although this inhibition is modest, the inhibitory eeff ct on apoptosis may be one of the pathways for PVT1 to promote the progression of GC. .. LncRNA PVT Enhances Drug-Resistance of GC to -Fu. There are mainly two independent apoptosis signal cas- It was reported that Bcl2 can determine the resistance of 5-Fu cades. eTh extrinsic apoptosis is always activated by the incarcinoma[15,16];hence,wesupposedPVT1maypossibly specific death receptors on the cellular membrane [20]. eTh enhance 5-fu resistance in GC via its promotion to Bcl2. intrinsic pathway is usually caused by DNA damage or To confirm this supposition, the IC50 values were estimated growth factor withdrawal, which can promote the release of from growth inhibition curves. eTh results showed that, cytochrome C and other proteins from the intermembranous compared with their matched control group, the IC50 of 5- space of the mitochondria [21]. eTh control and regulation Fu was significantly increased when PVT1 was overexpressed of intrinsic apoptotic mitochondrial events occur through (Figure 4(a)), but significantly decreased when PVT1 was members of the Bcl2 family of proteins, which comprises silenced (Figure 4(b)). eTh following RT-PCR and western both antiapoptotic proteins such as Bcl-2 and proapoptotic blotting assay showed that the 5-Fu treatment can decrease proteins such as Bax. Bcl2 is located primarily in the outer Bcl2 mRNA and protein of GC cells. Although 5-Fu had an mitochondrial membrane and blocks apoptosis by preventing inhibitory effect on Bcl2 in PVT1-overexpressed SGC-7901 cytochrome c release from the mitochondria, as well as cells, the same dose of 5-Fu treatment could not offset the by inhibiting caspase-3 activity. In contrast, proapoptosis promoting effect of PVT1 on Bcl2 and the level of Bcl2 after protein Bax can release cytochrome c from the mitochondria 5-Fu treatment was still signicfi antly high compared to the to promote apoptosis. High Bcl2/Bax ratio is regarded as norm (Figures 4(c) and 4(d)). a crucial factor of cellular resistance to apoptosis [22–25]. Next, we analyzed the prognosis of 5-Fu treatment in In this study, we revealed that overexpressing PVT1 can GC with high PVT1 expression using the follow-up data significantly increase the Bcl2/Bax ratio and decrease the from GEO. The KM-plotter analysis compared the FPS and expression of downstream cleaved caspase-3 (Figure 3(c)). OS of GC patients in later stages (stage III or IV), whereby This intrinsic mechanism may account for the inhibition of high PVT1 expression patients only received gastrectomy PVT1 on apoptosis. and patients with high PVT1 expression received both gas- In addition to apoptosis inhibition, the Bcl2 protein is trectomy and 5-Fu based adjuvant (or other non-5-fu based correlated with cancer resistance to chemotherapeutic drugs drug). Analyses showed that, in patients with high PVT1 [26]. Contrary to protecting cancer cells from drug induced expression, the addition of 5-Fu based adjuvant did not cell cycle arrest, Bcl2 can prolong their survival during improve the FPS (Figure 2(e)) and OS (Figure 2(f)) of GC this period; hence, proliferation resumes upon withdrawal patients; however, the adjuvant without 5-Fu improved the of the drug. It was reported that 5-Fu can decrease the FPS (Figure 2(g)) and OS (Figure 2(h)) of GC patients expressionofBcl2[22], andinour study, we observed the significantly. same results on GC. However, in PVT1-overexpressed GC Taken together, these ndin fi gs demonstrated that PVT1 cells, the expression of Bcl2 aer ft 5-Fu treatment was still can enhance the resistance of GC to 5-Fu. eTh therapeutic much higher than control cells (Figures 4(c) and 4(d)), which effect of 5-Fu based adjuvant is limited in high PVT1 expres- indicated that the Bcl2 activated by PVT1 was involved in sion GC patients. drug-resistance to 5-Fu. As a basic chemotherapeutic drug, 5-Fu is widely used in the treatment of a variety of cancers, including gastrointesti- 4. Discussion nal cancer, breast cancers, and neck cancers. By inhibiting A growing amount of evidence indicates that lncRNA can essential biosynthetic processes and disrupting DNA and play an important role in regulating the apoptosis in malig- RNA synthesis, 5-FU treatment can significantly decrease therecurrencerateoftumorsandimprovePFS andOSof nant tumors. It was reported that some lncRNAs are negative regulators of apoptosis in different types of cancer. For exam- patients [27].InGC, 5-Fuis thecoreofanticanceragents. ple, lncRNA GAS5 can inhibit apoptosis of non-small-cell 5-FU-based chemotherapy was recommended as the rfi st- lung cancer cells, through upregulating P53 expression and line treatment in adjuvant therapy, and in some cases, 5- downregulating transcription factor E2F1 expression [17]. u fl orouracil derivative has been delivered as a single agent according to the recent Japanese guidelines. As the most LncRNA AFAP1-AS1 was found to be hypomethylated and overexpressed in esophageal cancer [18]. LncRNA PlncRNA- commonly used anticancer agent in clinic, 5-FU-based agents 1 was upregulated in prostate cancer samples and cell lines, so have always been administrated as the first choice treatment modality in advanced GC but without sensitivity screening. it can work as an inhibitor of apoptosis through promoting the cleavage of PARP-1, a key component of the DNA damage Nonetheless, response rates for 5-FU chemotherapy for GC Journal of Oncology 9 are only 29.5% [28, 29]. Under these circumstances, the 5-Fu [3] M. Graham and J. M. Adams, “Chromosome 8 breakpoint far 3’ of the c-myc oncogene in a burkitt’s lymphoma 2;8 variant based chemotherapy strategy would miss the optimal period translocation is equivalent to the murine pvt-1 locus,” EMBO for adjuvant therapy and cause a waste of medical resources Journal,vol.5,no.11, pp.2845–2851,1986. and hurt the economy when it comes to patients with initial 5- [4] Y. Takahashi, G. Sawada, J. Kurashige et al., “Amplification of Furesistance.Thus,itisimperativetodevelopaneeff ctiveway PVT-1 is involved in poor prognosis via apoptosis inhibition in to predict the resistance to 5-Fu chemotherapy and then for- colorectal cancers,” British Journal of Cancer,vol.110,no.1,pp. mulate more reasonable and effective treatment plans. In our 164–171, 2014. study, we elucidated that high PVT1 can cause a resistance to [5] F. Wang, J.-H. Yuan, S.-B. Wang et al., “Oncofetal long non- 5-Fu (Figures 4(a) and 4(b)). Survival analyses indicated that, coding RNA PVT1 promotes proliferation and stem cell-like in GC patients with high levels, the addition of 5-Fu based property of hepatocellular carcinoma cells by stabilizing NOP2,” adjuvant aer ft gastrectomy did not bring additional benefit in Hepatology,vol.60,no.4,pp. 1278–1290,2014. prognosis than compared to only gastrectomy (Figures 2(e) [6] L.Zhao, H. Kong,H.Sun, Z. Chen,B.Chen, andM.Zhou, and 2(f)). On the contrary, chemotherapy without 5-Fu aer ft “LncRNA-PVT1 promotes pancreatic cancer cells proliferation gastrectomy could benefit these patients significantly (Figures and migration through acting as a molecular sponge to regulate 2(g) and 2(h)). We verified the resistance to 5-Fu induced by miR-448,” JournalofCellularPhysiology,vol.233,no. 5, pp. PVT1, and the study implicated that the relative level of PVT1 4044–4055, 2018. can serve as an indicator to predict the 5-Fu resistance of GC [7] T.Huang,H.W.Liu,J.Q.Chenetal.,“eTh long noncodingRNA and a reference to formulate suitable treatment plan. PVT1 functions as a competing endogenous RNA by sponging In summary, our results indicate that lncRNA PVT1 can miR-186 in gastric cancer,” Biomedicine & Pharmacotherapy, activate the expression of antiapoptosis factor Bcl2. This may vol.88,pp.302–308,2017. be one of the pathways for PVT1 to promote the progression [8] T. Li, X. Meng, and W. Yang, “Long noncoding RNA PVT1 acts of GC. In high PVT1 expression GC patients, PVT1 enhances as a “Sponge” to inhibit microRNA-152 in gastric cancer cells,” the drug-resistance of GC to 5-Fu; thus a non-5-FU based Digestive Diseases and Sciences,vol.62, no.11,pp.3021–3028, chemotherapy regimen may be a better treatment option. [9] M.Xu,Y.Wang,W.Wengetal.,“Apositivefeedback loop Data Availability of lncrna-pvt1 and foxm1 facilitates gastric cancer growth and invasion clinical cancer research,” An Official Journal of the eTh survival analysis data used to support the n fi d- American Association for Cancer Research,vol.23, no.8,pp. ings of this study were supplied by Kaplan-Meier Plotter 2071–2080, 2017. (http://kmplot.com/analysis/). [10] R. Kong, E.-B. Zhang, D.-D. Yin et al., “Long noncoding RNA PVT1 indicates a poor prognosis of gastric cancer and promotes cell proliferation through epigenetically regulating p15 and p16,” Ethical Approval Molecular Cancer,vol.14,no.1,article82,2015. All applicable international, national, and/or institutional [11] C. A. Schmitt and S. W. Lowe, “Apoptosis and therapy,” e Journal of Pathology,vol.187,pp. 127–137, 1999. guidelines for the care and use of animals were followed. [12] X.-W.Zhang,P.Bu,L.Liu,X.-Z.Zhang,and J.Li,“Overexpres- sion of long non-coding RNA PVT1 in gastric cancer cells pro- Conflicts of Interest motes the development of multidrug resistance,” Biochemical and Biophysical Research Communications,vol.462,no.3, pp. eTh authors declare that they have no conflicts of interest. 227–232, 2015. [13] A. Lanczky, A. Nagy,G.Bottaietal.,“miRpower: aweb-toolto Acknowledgments validate survival-associated miRNAs utilizing expression data from 2178 breast cancer patients,” Breast Cancer Research and This study was sponsored by Shanghai Sailing Program Treatment,vol.160,no. 3,pp.439–446,2016. (19YF1405100). [14] J. Li, C. Sun, W. Li et al., “Cancer RNA-Seq Nexus: a database of phenotype-specific transcriptome profiling in cancer cells,” Nucleic Acids Research,vol.44, no.D1, pp.D944–D951,2016. Supplementary Materials [15] X. Meng and R. Fu, “miR-206 regulates 5-FU resistance by Table S1: this table lists the premier of apoptosis related factors targeting Bcl-2 in colon cancer cells,” OncoTargets and erapy, in real-time PCR screening. (Supplementary Materials) vol. Volume 11, pp. 1757–1765, 2018. [16] S. Violette, L. Poulain, E. Dussaulx et al., “Resistance of colon cancer cells to long-term 5-fluorouracil exposure is correlated to References the relative level of Bcl-2 and Bcl-XL in addition toBax andp53 [1] L. A. Torre, F. Bray, R. L. Siegel, J. Ferlay, and J. Lortet- status,” International Journal of Cancer, vol. 98, no. 4, pp. 498– 504, 2002. Tieulent, “Global cancer statistics, 2012,” CA: A Cancer Journal for Clinicians,vol.65, no.2,pp. 87–108,2015. [17] X. Shi, M. Sun, H. Liu et al., “A critical role for the long non- [2] G. Group et al., “Role of chemotherapy for advanced/recurrent coding RNA GAS5 in proliferation and apoptosis in non-small- cell lung cancer,” Molecular Carcinogenesis,vol.54,1,pp.E1–E12, gastric cancer: an individual-patient-data meta-analysis,” Euro- pean journal of cancer, vol. 49, pp. 1565–1577, 2013. 2013. 10 Journal of Oncology [18] W. Wu, T. D. Bhagat, X. Yang et al., “Hypomethylation of noncoding DNA regions and overexpression of the long non- coding RNA, AFAP1-AS1, in Barrett’s esophagus and esophageal adenocarcinoma,” Gastroenterology, vol. 144, no. 5, pp. 956.e4– 966.e4, 2013. [19] Z. Cui, S. Ren, J. Lu et al., “eTh prostate cancer-up-regulated long noncoding RNA PlncRNA-1 modulates apoptosis and pro- liferation through reciprocal regulation of androgen receptor,” Urologic Oncology: Seminars and Original Investigations,vol.31, no. 7, pp. 1117–1123, 2013. [20] M. E. Guicciardi and G. J. Gores, “Life and death by death receptors,” e FASEB Journal,vol.23,no.6,pp.1625–1637,2009. [21] M. D’Amelio, E. Tino, and F. Cecconi, “The apoptosome: emerging insights and new potential targets for drug design,” Pharmaceutical Research,vol.25, no.4,pp. 740–751, 2008. [22] F. Edlich, “BCL-2 proteins and apoptosis: recent insights and unknowns,” Biochemical and Biophysical Research Communica- tions,vol.500,no. 1,pp.26–34,2018. [23] J. C. Reed et al., “BCL-2 family proteins: regulators of cell death involved in the pathogenesis of cancer and resistance to therapy,” Journal of Cellular Biochemistry,vol.60,pp.23–32, [24] R. L.Schenk,A.Strasser, andG.Dewson,“BCL-2:longand winding path from discovery to therapeutic target,” Biochemical and Biophysical Research Communications,vol.482,no. 3,pp. 459–469, 2017. [25] T. W. Sedlak, Z. N. Oltvai, E. Yang et al., “Multiple Bcl-2 family members demonstrate selective dimerizations with bax,” Proceedings of the National Acadamy of Sciences of the United States of America,vol.92,no.17,pp.7834–7838,1995. [26] J. Mirjolet, M. Barberi-Heyob, C. Didelot et al., “Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status,” British Journal of Cancer,vol.83, no.10, pp.1380– 1386, 2000. [27] D. B. Longley, D. P. Harkin, and P. G. Johnston, “5-Fluorouracil: mechanisms of action and clinical strategies,” Nature Reviews Cancer,vol.3,no. 5, pp.330–338,2003. [28] R. L. Comis and S. K. Carter, “A review of chemotherapy in gastric cancer,” Cancer,vol.34, no.5,pp.1576–1586, 1974. [29] D. Kelsen, “Chemotherapy of gastric cancer: a review,” Israel Journal of Medical Sciences, vol. 24, no. 9-10, pp. 557–561, 1988. MEDIATORS of INFLAMMATION The Scientific Gastroenterology Journal of World Journal Research and Practice Diabetes Research Disease Markers Hindawi Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 International Journal of Journal of Immunology Research Endocrinology Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com BioMed PPAR Research Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Journal of Obesity Evidence-Based Journal of Journal of Stem Cells Complementary and Ophthalmology International Alternative Medicine Oncology Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2013 Parkinson’s Disease Computational and Behavioural Mathematical Methods AIDS Oxidative Medicine and in Medicine Neurology Research and Treatment Cellular Longevity Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Oncology Hindawi Publishing Corporation

LncRNA PVT1 Mediates Antiapoptosis and 5-Fluorouracil Resistance via Increasing Bcl2 Expression in Gastric Cancer

Download PDF
11 pages

Loading next page...
 
/lp/hindawi-publishing-corporation/lncrna-pvt1-mediates-antiapoptosis-and-5-fluorouracil-resistance-via-U60kZ1wXtg

References (29)

Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2019 Peizhun Du et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
1687-8450
eISSN
1687-8469
DOI
10.1155/2019/9325407
Publisher site
See Article on Publisher Site

Abstract

Hindawi Journal of Oncology Volume 2019, Article ID 9325407, 10 pages https://doi.org/10.1155/2019/9325407 Research Article LncRNA PVT1 Mediates Antiapoptosis and 5-Fluorouracil Resistance via Increasing Bcl2 Expression in Gastric Cancer 1 1 1 1 2 1 Peizhun Du, Cheng’en Hu, Yunyun Qin, Jing Zhao, Rajan Patel, Yan Fu , 3 3 1 Mengqi Zhu, Wenhong Zhang , and Guangjian Huang Department of GeneralSurgery,Huashan Hospital,FudanUniversity,Shanghai, China Primary Care,  Deanna Dr, Gaithersburg, MD , USA Department of Infectious Diseases, Huashan Hospital, Fudan University, Shanghai, China Correspondence should be addressed to Wenhong Zhang; zhangwenhong@fudan.edu.cn and Guangjian Huang; huangguangjian12@126.com Received 24 July 2018; Revised 31 January 2019; Accepted 18 February 2019; Published 8 May 2019 Academic Editor: Shinji Miwa Copyright © 2019 Peizhun Du et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Purpose. Plasmacytoma variant translocation 1 (PVT1) is a long noncoding RNA encoded by the human PVT1 gene, which has been verified to mediate tumorigenesis in gastric cancer. However, the underlying molecular mechanisms of PVT1 in gastric cancer (GC) remain largely unknown. Methods. eTh tumorigenic ability of PVT1 was verified by subcutaneous and orthotopic mouse models. Flow cytometry assay and TdT-mediated dUTP Nick-End Labeling staining were conducted to explore the effects of PVT1 on gastric cancer cell apoptosis. We investigated the relative gene and protein that are involved in apoptosis in real-time PCR and western blot assay. The resistance to 5- Fluorouracil (5-Fu) caused by PVT1 was evaluated using cell viability assay. en, Th to confirm the eeff cts of PVT1 on 5-Fu resistance, we conducted the Kaplan-Meier analysis based on three public databases. Results. We confirmed that PVT1 can promote the progression of gastric cancer. PVT1 inhibited the apoptosis of GC cells, which may account for its promotion on GC. We confirmed that PVT1 can regulate the expression of Bcl2 and enhance drug-resistance of gastric cancer to 5-Fu. Kaplan-Meier analysis showed that patients with high PVT1 expression do not experience survival related benefits from 5- Fu based chemotherapy; instead, therapy containing no 5-Fu chemotherapy can improve the first progression survival and overall survival of high PVT1 expression GC patients significantly. Conclusion. Our results showed that PVT1 can inhibit the apoptosis and enhance the 5-Fu resistance of gastric cancer through the activation of Bcl2. PVT1 has the potential to serve as an indicator to predict 5-Fu treatment resistance. 1. Introduction Recently, the function of long noncoding RNA (lncRNA) in malignant tumors has attracted increasing attention. Gastric cancer (GC) is the second common cancer and the LncRNA is identified as the noncoding RNA, which is third most common cause of cancer death worldwide [1]. longer than 200 nucleotides and has limited protein-coding Although radical surgery and perioperative chemotherapy ability. Because of the lack of ability to encode protein, lncRNA was regarded as evolutionary “junk” or “transcrip- can improve survival of GC patients, the overall survival rate of advanced GC is still less than one year [2]. Many tional noise” in transcription at the beginning stage. But aberrantly expressed genes in GC have been explored in the with deepening of exploration, many crucial functionali- past decades, but novel molecular markers that can be useful ties of lncRNA in physiological and pathological processes, in early diagnosis and treatment of GC are still urgently such as chromatin modica fi tion, transcription, and post- needed. New therapeutic methods are likely to derive from transcriptional processing, were revealed. eTh dysregulation the improved understanding of the mechanisms of GC. expressed with lncRNA has been demonstrated in multiple Formerly, the exploration of mechanisms of malig- malignancies, which provides new insight into the cancer development. nant tumors was mainly focused on protein-coding genes. 2 Journal of Oncology The plasmacytoma variant translocation 1 (PVT1) gene PVT1-RT-F: CCTGTGACCTGTGGAGACAC; locatedonchromosome8q24isamongthetoptargetsofcopy PVT1-RT-R: GTCCGTCCAGAGTGCTGAAA; number alteration in cancer [3]. An increasing number of studies indicate that lncRNA PVT1 has carcinogenic potential Bcl2-RT-F: GGAGGCTGGGATGCCTTTGT; in a variety of tumors. In colorectal cancer cells, silencing Bcl2-RT-R: AAAGCCAGCTTCCCCAATGA; PVT1 can decrease proliferation and invasion capabilities by activating TGF–𝛽 [4]. In hepatocellular carcinoma, PVT1 can GAPDH-RT-F: TCGACAGTCAGCCGCATCTTC- promote proliferation and stem cell-like properties of cells TTT; by stabilizing NOP2 [5]. In pancreatic cancer, lncRNAPVT1 GAPDH-RT-R: ACCAAATCCGTTGACTCCGAC- can promote cell proliferation and migration through acting CTT. as a molecular sponge to regulate miR-448 [6]. Similarly, in gastriccancer,highPVT1expressionisalwaysassociatedwith Other premier sequences are listed in Table S1. a poor prognosis. It was reported that PVT1 can function as a competing endogenous RNA by sponging miR-186 [7] .. Western Blotting Assay. Total protein was obtained from and miR-152 [8]. It can also directly bind the FOXM1 protein GC cell lines. The total protein was lysated using RIPA and increase FOXM1 posttranslationally and epigenetically with PMSF and quantified using the BCA method. After [9] and can regulate p15 and p16 [10]. However, the current electrophoretically separated on SDS-PAGE (Sangon Biotech, understanding of PVT1 in GC is still in its infancy, and the SD6013), the protein was electrophoresed in 10% or 12% previous investigations mainly focused on its tumorigenic ploy-acrylamide gel. Aer ft transferring the protein onto mechanisminproliferation.Hence theroleofPVT1inother the NC membrane, we blocked the membrane with 5% biological process is worth further exploring. BSA and incubated it in 1:1000 diluted antibodies against Apoptosisisprogrammedcelldeath,which isessen- Bcl2 (#2870, CST, USA), Bax (#5023, CST, USA) Caspase tial fordevelopment andsurvivaloflivingorganisms.It 3 (#9665, CST, USA), and 𝛽-actin (#12620, CST, USA) at regulates the number of cells by controlling cell activity, 4 C. Secondaryantibodywasdetectedusing theOdyssey differentiation, and proliferation. The defects in apoptotic system. pathways are now thought to contribute to tumor initiation, progression, and metastasis. What is more, it is well-known now that anticancer agents induce apoptosis and that the .. Apoptosis Detection Assay. Apoptosis detection was con- dysregulation in apoptotic process can lead to drug-resistance ducted by using the FITC Annexin V Apoptosis Detection [11]. Biological function of PVT1 in regulating GC apoptosis Kit I (BD Pharmingen, 556547). After digesting the GC cell have been mentioned in relative studies [10, 12], but the with trypsin,theisolatedcellwas incubatedinAnnexinV- internal mechanism of this process is still largely unknown. FITC, an early-stage apoptosis indicator, and then in pro- In the present study, we confirmed PVT1 can inhibit the pidium iodide, a late-stage apoptosis indicator. eTh percent apoptosis of GC through activating the antiapoptosis factor of apoptotic cells were detected by cytometry using the BD B cell leukemia 2(Bcl2). This dysfunction in apoptosis caused FACS CantoTM Flow Cytometer. by PVT1 increased the resistance of GC to anticancer agent 5-Fluorouracil (5-Fu) and made PVT1 a potential reference . . Plate Clone Formation Assay. Trypsin-digested SGC- point in formulating individualized treatment plans. 7901 cells were seeded into 6-wells plates with 1.5×10 cells. Evenly dispersed cell were incubated at 37 Cwith5%CO2 2. Materials and Methods until the visible clones appeared. Next, we discarded the medium and washed the cells with PBS twice. We stained the .. Cell Culture. Human GC cell lines SGC-7901 was pur- cells with Gentian violet solution aer ft fixing it with methanol. chased from the Chinese Academy of Sciences (Shang- eTh nwewashedthe cellsand calculatedtheclone withan hai, China). It was maintained in RPMI-1640 (Invitrogen, ordinary optical microscope. 22400089) medium with 10% fetal bovine serum and 100 u/ml penicillin and 100 ug/ml streptomycin sulphate. The cell was ∘ . . Experimental Animals. Briefly, the 3-4-week-old 20g cultured in a humidified 5% CO at 37 C. Nod/SCID mice were kept in the SPF animal laboratory. Trypsin-digested SGC-7901 cells were inoculated in sub- .. Quantitative Real-Time Reverse Transcription. Trizol cutaneous tissue of the back or stomach to establish sub- reagent was used to extract total RNA. eTh reverse transcrip- cutaneous or orthotopic models. Each site was injected tion and real-time PCR (RT-PCR) were conducted by using with 1×10 cells. eTh subcutaneous xenograft grew for 1 PrimeScript RT reagent kit (TaKaRa, RR037A) and SYBR month, and the orthotopic xenograft grew for 2 months, Premix EX Taq II kit (TaKaRa, RR820A) kit, respectively. then the mice were satisfied by anaesthesia. To compare RT-PCR was implemented under the ABI PRISM 7500 HT the tumorigenicity of GC, the subcutaneous tumors of Sequence Detection System. GAPDH was adopted as an different groups were measured for diameter. All exper- internal control in RT-PCR to standardize the variants among iments were performed in accordance with the National -ΔΔct the different samples. eTh 2 of RNAs were calculated by Institutes of Health guidelines (NIH Publications No. premier sequences: 8023). Journal of Oncology 3 .. Immunohistochemistry (IHC) and TdT-Mediated dUTP 3. Results Nick-End Labeling (TUNEL) Assay. All the GC tissue sec- .. LncRNA PVT Can Regulate the Growth of GC. tions were fixed in 4% formalin overnight and embedded First, we explored the expression of PVT1 in different in paraffin with standard techniques. eTh immunohisto- stages of GC using the Cancer RNA-Seq Nexus (CRN; chemistry detection was conducted by using a SABC kit. http://syslab4.nchu.edu.tw) so that we could access PVT1 Upon blocking using 5% BSA for 1 hour, the sections were gene expression data of GC patients from the TCGA stomach incubated in 1:100 diluted anti-Bcl2 antibody overnight at carcinoma RNA-Seq dataset [14]. As shown in Figure 1(a), 4 C.Then,thesectionswerewashedwithPBS twice. eTh n the expression of PVT1 increased with cancer progression, we added biotin labeled secondary antibody to the slides and compared to that of adjacent normal tissues. To explore the sequentially stained the slides with DAB and hematoxylin. effects of PVT1 on GC, we stably overexpressed and stably eTh stained slides were recorded using the Nikon microscope. silenced PVT1 expression in SGC-7901 cells (Figure 1(b)) In TUNEL assay, the slides were stained with the terminal and observed the influence of PVT1 on the tumorigenicity deoxynucleotidyl transferase-mediated dUTP-biotin nick- of gastric cancer cells in a mouse model. We noticed that the end labeling (TUNEL) method, using an apoptosis in situ subcutaneous xenograsft formed from PVT1-overexpressed detection kit (Wako Pure Chemical, Osaka, Japan). eTh GC cells had larger volume than xenograsft formed from FITC-labeled TUNEL-positive cells were imaged using the vector-control cells (Figures 1(c) left panel and 1(d)). Nikon fluorescent microscope. Conversely, the subcutaneous xenografts formed from PVT1- silenced GC cells had smaller volume than vector-control .. Plasmids and Transfection. Full-length lncRNA PVT1 tumors (Figures 1(c) right panel and 1(e)). An orthotopic sequences were cloned into a pcDNA 3.1 vector, termed mousemodel wasalsoestablished.Asshown inFigure 1(f), pcDNA3.1-PVT1, and were selected along with neomycin for the orthotopic xenograft formed from PVT1-overexpressed four weeks. LncRNA PVT1 shRNA oligos were synthesized, SGC-7901 cells also exhibited larger volume. Based on these annealed, and then inserted into a lentiviral pLKO.1-Puro results, we believe that PVT1 can regulate the growth of GC, plasmid, termed shRNA-pLKO.1-Puro. HEK-293T cells were and PVT1 may play a crucial role in the progression of GC. cotransfected with the above pLKO.1-Puro lentiviral vector, packaging vectors psPAX2, and pMD2.G envelope plasmid .. LncRNA PVT Can Regulate the Apoptosis of GC. Next, along with Lipofectamine2000 reagent (Invitrogen). SGC- we investigated the functions of PVT1 on GC cell behav- 7901 cells were transfected with either the pcDNA3.1-PVT1 iors. eTh clone formation assay showed that the count of plasmid (PVT1) or the pcDNA3.1-vector (CTR), labeled as clones formed by PVT1-overexpressed cells was significantly PVT1 overexpressing cells (positive control), and transfected increased (Figure 2(a)), but significantly decreased by PVT1- with the shRNA- pLKO.1-Puro plasmid (shPVT1) or pLKO.1- silenced cells (Figure 2(b)). In the apoptosis analysis, upreg- Puro plasmid (NC), labeled as PVT1 silencing cells (negative ulating PVT1 decreased the apoptosis of SGC-7901 cells; control). downregulating PVT1 increased the apoptosis of SGC-7901 cells (Figures 2(c) and 2(d)). To confirm the effects of PVT1 . . Cell Viability Assay. Cell viability was measured using on apoptosis, TUNEL staining was conducted to investigate the CCK8 method. In Brief, that entailed adding 10ul the apoptosis in the xenograsft . Compared to the control CCK-8 into the medium and mixed gently. eTh plate was xenograft, decreasing DNA fragmentation was observed in subsequently incubatedfor2handthentheabsorbance the subcutaneous xenograft formed by PVT1-overexpressed measurement was taken under a reference of 450nm. GC cells and increasing DNA fragmentation was observed from PVT1-silenced GC cells, respectively (Figures 2(e) and .. Online Kaplan-Meier Plotter (KM-Plotter) Analysis. 2(f)). Similar results were also observed in the orthotopic The KM-plotter is an online database (www.kmplot.com). xenograft (Figures 2(g) and 2(h)). Taken together, these It contains gene expression data and survival information results indicated that PVT1 can regulate the apoptosis of GC downloaded from gene expression omnibus (GEO), Euro- cells. pean Genome-phenome Archive (EGA), and the Cancer Genome Atlas (TCGA). KM-plotter software can provide .. LncRNA PVT Regulates Apoptosis by Affecting Bcl online survival analysis of GC patients with these avail- Expression. To elucidate the underlying mechanism of PVT1 able transcriptome and survival data according to different inducing apoptosis, we screened the common factors that screening conditions [13]. may be related to this apoptosis process using the RT-PCR. The results showed that the Bcl2 mRNA was significantly .. Statistical Analysis. Statistical analyses were performed increased when PVT1 was upregulated (Figure 3(a)) and sig- with the SPSS statistical package (SPSS, Inc., Chicago, nificantly decreased when PVT1 was silenced (Figure 3(b)). IL, USA) and GraphPad Prism 6.0 (GraphPad Software). Consistently, the following western blot indicated that the Experimental results were reported as a mean of at least PVT1 can regulate the expression of Bcl2 protein but has three independent experiments conducted in triplicate. Two- noeeff ctontheBaxprotein.Beyondthat,we noticedthat tailed Student’s t-test and Kaplan-Meier analyses were used the downstream apoptosis executor of Bcl2, cleaved caspase- as appropriate. P<0.05 were considered to be statistically 3, was decreased when the PVT1 was overexpressed and significant. increased when PVT1 was silenced (Figure 3(c)). To further 4 Journal of Oncology 1.5 n=39 3 ∗ n=57 15 1.0 n=78 n=55 0.5 n=35 0 0.0 CTR PVT1 NC shPVT1 (a) (b) Subcutaneous Tumor __________________________________ (c) 200 50 3d 7d 14d 21d 28d 3d 7d 14d 21d 28d PVT1 shPVT1 CTR NC (d) (e) Orthotopic Tumor CTR PVT1 (f) Figure 1: LncRNA PVT1 can regulate the growth of GC. (a) The expression of PVT1 in different stages of GC. A total of 431 samples were included in this dataset. es Th e samples were divided into different subsets according to the tumor stages. The numbers refer to the number of people in the corresponding subsets. (b) This shows the validation of stably overexpressed and silenced PVT1 in SGC-7901 cells via qRT-PCR. PVT1 refers to PVT1 overexpression; CTR indicates the control group of PVT1; shPVT1 represents PVT1 silenced by shRNA; NC indicates the control of shPVT1. (c) This shows the subcutaneous tumors derived from SGC-7901 cells with overexpressed or silenced PVT1 (n=3 for each group). (d, e) This shows that the tumor volumes were measured at the indicated time. (f) This shows the orthotopic malignant tumor from SGC-7901 cells with overexpressed PVT1. Results were measured in triplicate in each experiment.∗P< 0.05. verify the regulation of PVT1 on Bcl2, we evaluated the from PVT1-overexpressed SGC-7901 cells but weakened in expression of Bcl2 protein in xenografts through the IHC that from PVT1-silenced SGC-7901 cells (Figure 4(d)). Con- assay. eTh IHC assay showed that the Bcl2 staining was sistently, IHC showed Bcl2 staining was also strengthened evidently strengthened in subcutaneous xenografts formed when PVT1 was overexpressed in the orthotopic GC tumor Normal Stage IIB Stage IIIA Stage IIIB Stage IIIC Average tumor volume (ＧＧ ) Transcripts Per Million PVT1 CTR Relative Fold Change of lncRNA PVT1 Average tumor shPVT1 NC volume (ＧＧ ) Journal of Oncology 5 CTR PVT1 5 5 10 10 4 4 10 10 3 3 10 10 800 600 2 2 10 10 0 0 0 CTR PVT1 2 3 4 5 2 3 4 5 0 10 10 10 10 0 10 10 10 10 Annexin V-FITC Annexin V-FITC 200 NC shPVT1 10 10 0 4 10 10 10 NC shPVT1 CTR PVT1 3 3 10 10 0 0 2 3 4 5 2 3 4 5 0 0 10 10 10 10 0 10 10 10 10 Annexin V-FITC Annexin V-FITC NC shPVT1 (a) (b) (c) (d) Subcutaneous Tumor ∗ ∗ _____________________________________ DAPI TUNEL DAPI TUNEL (e) (f) Orthotopic Tumor __________________ DAPI TUNEL CTR PVT1 (g) (h) Figure 2: LncRNA PVT1 can regulate the apoptosis of GC. (a, b) This shows the clone formation assay of SGC-7901 with overexpressed and silenced PVT1. (c) eTh apoptosis cells were assessed using flow cytometry assay in PVT1 overexpressed and silenced SGC-7901 cells. (d) shows the quantitative results of the flow cytometry assay demonstrating the percentage of apoptotic cells. (e, g) TUNEL assay to detect apoptotic cells in xenografts tissues. eTh green cells indicate the TUNEL-positive apoptotic cells. The images of TUNEL-positive cells were captured by u fl orescence microscope (400×). (f) Quantitative results of TUNEL assay of subcutaneous tumors tissues. (h) Quantitative results of TUNEL assay of orthotopic tumor tissues. All of the data shown represent the mean± SD of three independent experiments.∗P< 0.05. CTR PVT1 shPVT1 NC Count of cells PVT1 CTR Count of cells PVT1 CTR shPVT1 NC Propidium Iodide Propidium Iodide Apoptosis cell (%) Propidium Iodide Propidium Iodide Apoptosis cell (%) Percent of cells (%) Percent of cells (%) 6 Journal of Oncology 1.5 3 ∗ 1.5 1.0 1.0 0.5 0.5 0.0 0.0 CTR NC PVT1 shPVT1 (a) (b) Subcutaneous Tumor _________________________________ CTR PVT1 NC shPVT1 CTR PVT1 Bcl2 -26kDa -20kDa Bax -19kDa C-casp 3 -17kDa -45kDa -actin NC shPVT1 (c) (d) FPS OS 100 100 P=0.002 P<0.001 Orthotopic Tumor _________________________________ 0 50 100 150 200 0 50 100 150 Months Months PVT1 & BCL2 Low(n=274) PVT1 & BCL2 Low(n=356) PVT1 & BCL2 Middle(n=288) PVT1 & BCL2 Middle(n=349) PVT1 & BCL2 High(n=79) PVT1 & BCL2 High(n=171) CTR PVT1 (e) (f) (g) Figure 3: LncRNA PVT1 regulates apoptosis by aec ff ting Bcl2 expression. (a, b) This shows the expression of common apoptosis related factors in PVT1 overexpressed or silenced SGC-7901 cells. Results for experiment were measured in triplicate.∗P< 0.05. (c) Western blot analysis showing protein levels of Bcl2, Bax, and cleaved caspase-3.𝛽-actin was the internal control. (d) Representative IHC results of Bcl2 staining in subcutaneous tumor tissues from PVT1 overexpressed and silenced SGC-7901 cells. Results were measured in triplicate for each experiment (n=3 for each group). (e) Representative IHC results of Bcl2 staining in orthotopic tumor tissues. (f, g) GSE microarray (including GSE-14210, GSE-15459, GSE-22377, GSE-29272, GSE-51105, and GSE-62254) data were divided into three groups based on PVT1 and Bcl2 expression values; patients with both high expression of PVT1 and high expression of Bcl2 were divided into high group. Patients with both low expression of PVT1 and low expression of Bcl2 were divided into low group. The remaining patients were assigned to the middle group. Kaplan-Meier analysis was performed to compare their FPS and OS differences among the three groups. Atm Apof-1 Bad Bak Bax Bcl2 Bcl-w Bid Bim CASP3 CASP6 CASP7 Fas Survivin Atm Apof-1 Bad Bak Bax Bcl2 Bcl-w Bid Bim CASP3 CASP6 CASP7 Fas Survivin Relative Fold Change Percent survival Relative Fold Change Percent survival Journal of Oncology 7 20 NC: IC50=6.57mM CTR: IC50=6.20mM shPVT1: IC50=3.45mM PVT1: IC50=18.73mM −1 0 123 −1 0123 log concentration (mM) log concentration (mM) NC CTR shPVT1 PVT1 0 0 CTR PVT1 NC shPVT1 (a) (b) CTR PVT1 ____________________ _____________________ 5-Fu -- + + Bcl2 -actin (c) (d) OS/GSE15459 FPS/GSE15459 100 100 50 50 n=15 n=15 n=40 n=42 P=0.57>0.05 P=0.45>0.05 0 0 0 50 100 150 0 50 100 150 Months Months PVT1 High: Surgery+5-Fu PVT1 High: Surgery+5-Fu PVT1 High: Surgery PVT1 High: Surgery (e) (f) OS/GSE62254 FPS/GSE62254 n=37 n=39 n=56 n=59 P<0.001 P<0.001 0 0 0 20406080 100 0 20406080 100 Months Months PVT1 High: Surgery+non 5-Fu PVT1 High: Surgery+non 5-Fu PVT1 High: Surgery PVT1 High: Surgery (g) (h) Figure 4: LncRNA PVT1 enhances drug-resistance of GC to 5-Fu. (a, b) Cell viability aer ft 5-Fu treatment of PVT1 overexpressed and silenced SGC-7901 cells. (c) mRNA level of Bcl2 aer ft 5-Fu treatment in SGC-7901 cells with or without overexpressed PVT1. Results were measured in triplicate for each experiment.∗P<0.05. (d) The alteration of Bcl2 protein aeft r 5-Fu treatment in SGC-7901 cells with or without overexpressed PVT1;𝛽-actin was the internal control. All of the data shown represent the mean ± SD of three independent experiments. (e, f) GSE15459 microarray data were divided into two groups based on the treatment, including high PVT1 level patients receiving both surgery and 5-Fu based adjuvant (PVT1 High: Surgery+5-Fu); high PVT1 level patients at stage III and IV receiving only surgery (PVT1 High: Surgery). Kaplan- Meier analysis was performed to compare their FPS and OS differences among the two groups. (g, h) eTh GSE62254 microarray data were divided into two groups, including high PVT1 level patients receiving both surgery and non-5-Fu adjuvant (PVT1 High: Surgery+non-5-Fu); high PVT1 level patients at stages III and IV receiving only surgery (PVT1 High: Surgery).∗P< 0.05. CTR PVT1 5-Fu treatment CTR 5-Fu treatment PVT1 Percent survival Percent survival Cell viability (% of control) Relative Fold Change of BCL2 IC50 (mM) Percent survival Percent survival Cell viability (% of control) IC50 (mM) 8 Journal of Oncology (Figure 4(e)). In addition, Kaplan-Meier survival analysis in response [19]. For malignant tumors, a large percentage of GEO datasets revealed that GC patients with both high level cell loss was due to apoptosis, especially in spontaneously of PVT1 and Bcl2 sueff red shortest rst fi progression survival regressing tumors and in tumors treated with cytotoxic (FPS) (Figure 4(f)) and overall survival (OS) (Figure 4(g)). anticancer agents. It was suggested that apoptosis is linked Collectively, those results demonstrated that the effects of tothehighrateofcelllossinmalignant tumors andcould PVT1 on apoptosis were achieved by regulating Bcl2. High promote the progression of the tumor [11]. In the present levels of PVT1 combined with Bcl2 can predict poor progno- study, we confirmed that PVT1 can inhibit the apoptosis of sis in GC. GC; although this inhibition is modest, the inhibitory eeff ct on apoptosis may be one of the pathways for PVT1 to promote the progression of GC. .. LncRNA PVT Enhances Drug-Resistance of GC to -Fu. There are mainly two independent apoptosis signal cas- It was reported that Bcl2 can determine the resistance of 5-Fu cades. eTh extrinsic apoptosis is always activated by the incarcinoma[15,16];hence,wesupposedPVT1maypossibly specific death receptors on the cellular membrane [20]. eTh enhance 5-fu resistance in GC via its promotion to Bcl2. intrinsic pathway is usually caused by DNA damage or To confirm this supposition, the IC50 values were estimated growth factor withdrawal, which can promote the release of from growth inhibition curves. eTh results showed that, cytochrome C and other proteins from the intermembranous compared with their matched control group, the IC50 of 5- space of the mitochondria [21]. eTh control and regulation Fu was significantly increased when PVT1 was overexpressed of intrinsic apoptotic mitochondrial events occur through (Figure 4(a)), but significantly decreased when PVT1 was members of the Bcl2 family of proteins, which comprises silenced (Figure 4(b)). eTh following RT-PCR and western both antiapoptotic proteins such as Bcl-2 and proapoptotic blotting assay showed that the 5-Fu treatment can decrease proteins such as Bax. Bcl2 is located primarily in the outer Bcl2 mRNA and protein of GC cells. Although 5-Fu had an mitochondrial membrane and blocks apoptosis by preventing inhibitory effect on Bcl2 in PVT1-overexpressed SGC-7901 cytochrome c release from the mitochondria, as well as cells, the same dose of 5-Fu treatment could not offset the by inhibiting caspase-3 activity. In contrast, proapoptosis promoting effect of PVT1 on Bcl2 and the level of Bcl2 after protein Bax can release cytochrome c from the mitochondria 5-Fu treatment was still signicfi antly high compared to the to promote apoptosis. High Bcl2/Bax ratio is regarded as norm (Figures 4(c) and 4(d)). a crucial factor of cellular resistance to apoptosis [22–25]. Next, we analyzed the prognosis of 5-Fu treatment in In this study, we revealed that overexpressing PVT1 can GC with high PVT1 expression using the follow-up data significantly increase the Bcl2/Bax ratio and decrease the from GEO. The KM-plotter analysis compared the FPS and expression of downstream cleaved caspase-3 (Figure 3(c)). OS of GC patients in later stages (stage III or IV), whereby This intrinsic mechanism may account for the inhibition of high PVT1 expression patients only received gastrectomy PVT1 on apoptosis. and patients with high PVT1 expression received both gas- In addition to apoptosis inhibition, the Bcl2 protein is trectomy and 5-Fu based adjuvant (or other non-5-fu based correlated with cancer resistance to chemotherapeutic drugs drug). Analyses showed that, in patients with high PVT1 [26]. Contrary to protecting cancer cells from drug induced expression, the addition of 5-Fu based adjuvant did not cell cycle arrest, Bcl2 can prolong their survival during improve the FPS (Figure 2(e)) and OS (Figure 2(f)) of GC this period; hence, proliferation resumes upon withdrawal patients; however, the adjuvant without 5-Fu improved the of the drug. It was reported that 5-Fu can decrease the FPS (Figure 2(g)) and OS (Figure 2(h)) of GC patients expressionofBcl2[22], andinour study, we observed the significantly. same results on GC. However, in PVT1-overexpressed GC Taken together, these ndin fi gs demonstrated that PVT1 cells, the expression of Bcl2 aer ft 5-Fu treatment was still can enhance the resistance of GC to 5-Fu. eTh therapeutic much higher than control cells (Figures 4(c) and 4(d)), which effect of 5-Fu based adjuvant is limited in high PVT1 expres- indicated that the Bcl2 activated by PVT1 was involved in sion GC patients. drug-resistance to 5-Fu. As a basic chemotherapeutic drug, 5-Fu is widely used in the treatment of a variety of cancers, including gastrointesti- 4. Discussion nal cancer, breast cancers, and neck cancers. By inhibiting A growing amount of evidence indicates that lncRNA can essential biosynthetic processes and disrupting DNA and play an important role in regulating the apoptosis in malig- RNA synthesis, 5-FU treatment can significantly decrease therecurrencerateoftumorsandimprovePFS andOSof nant tumors. It was reported that some lncRNAs are negative regulators of apoptosis in different types of cancer. For exam- patients [27].InGC, 5-Fuis thecoreofanticanceragents. ple, lncRNA GAS5 can inhibit apoptosis of non-small-cell 5-FU-based chemotherapy was recommended as the rfi st- lung cancer cells, through upregulating P53 expression and line treatment in adjuvant therapy, and in some cases, 5- downregulating transcription factor E2F1 expression [17]. u fl orouracil derivative has been delivered as a single agent according to the recent Japanese guidelines. As the most LncRNA AFAP1-AS1 was found to be hypomethylated and overexpressed in esophageal cancer [18]. LncRNA PlncRNA- commonly used anticancer agent in clinic, 5-FU-based agents 1 was upregulated in prostate cancer samples and cell lines, so have always been administrated as the first choice treatment modality in advanced GC but without sensitivity screening. it can work as an inhibitor of apoptosis through promoting the cleavage of PARP-1, a key component of the DNA damage Nonetheless, response rates for 5-FU chemotherapy for GC Journal of Oncology 9 are only 29.5% [28, 29]. Under these circumstances, the 5-Fu [3] M. Graham and J. M. Adams, “Chromosome 8 breakpoint far 3’ of the c-myc oncogene in a burkitt’s lymphoma 2;8 variant based chemotherapy strategy would miss the optimal period translocation is equivalent to the murine pvt-1 locus,” EMBO for adjuvant therapy and cause a waste of medical resources Journal,vol.5,no.11, pp.2845–2851,1986. and hurt the economy when it comes to patients with initial 5- [4] Y. Takahashi, G. Sawada, J. Kurashige et al., “Amplification of Furesistance.Thus,itisimperativetodevelopaneeff ctiveway PVT-1 is involved in poor prognosis via apoptosis inhibition in to predict the resistance to 5-Fu chemotherapy and then for- colorectal cancers,” British Journal of Cancer,vol.110,no.1,pp. mulate more reasonable and effective treatment plans. In our 164–171, 2014. study, we elucidated that high PVT1 can cause a resistance to [5] F. Wang, J.-H. Yuan, S.-B. Wang et al., “Oncofetal long non- 5-Fu (Figures 4(a) and 4(b)). Survival analyses indicated that, coding RNA PVT1 promotes proliferation and stem cell-like in GC patients with high levels, the addition of 5-Fu based property of hepatocellular carcinoma cells by stabilizing NOP2,” adjuvant aer ft gastrectomy did not bring additional benefit in Hepatology,vol.60,no.4,pp. 1278–1290,2014. prognosis than compared to only gastrectomy (Figures 2(e) [6] L.Zhao, H. Kong,H.Sun, Z. Chen,B.Chen, andM.Zhou, and 2(f)). On the contrary, chemotherapy without 5-Fu aer ft “LncRNA-PVT1 promotes pancreatic cancer cells proliferation gastrectomy could benefit these patients significantly (Figures and migration through acting as a molecular sponge to regulate 2(g) and 2(h)). We verified the resistance to 5-Fu induced by miR-448,” JournalofCellularPhysiology,vol.233,no. 5, pp. PVT1, and the study implicated that the relative level of PVT1 4044–4055, 2018. can serve as an indicator to predict the 5-Fu resistance of GC [7] T.Huang,H.W.Liu,J.Q.Chenetal.,“eTh long noncodingRNA and a reference to formulate suitable treatment plan. PVT1 functions as a competing endogenous RNA by sponging In summary, our results indicate that lncRNA PVT1 can miR-186 in gastric cancer,” Biomedicine & Pharmacotherapy, activate the expression of antiapoptosis factor Bcl2. This may vol.88,pp.302–308,2017. be one of the pathways for PVT1 to promote the progression [8] T. Li, X. Meng, and W. Yang, “Long noncoding RNA PVT1 acts of GC. In high PVT1 expression GC patients, PVT1 enhances as a “Sponge” to inhibit microRNA-152 in gastric cancer cells,” the drug-resistance of GC to 5-Fu; thus a non-5-FU based Digestive Diseases and Sciences,vol.62, no.11,pp.3021–3028, chemotherapy regimen may be a better treatment option. [9] M.Xu,Y.Wang,W.Wengetal.,“Apositivefeedback loop Data Availability of lncrna-pvt1 and foxm1 facilitates gastric cancer growth and invasion clinical cancer research,” An Official Journal of the eTh survival analysis data used to support the n fi d- American Association for Cancer Research,vol.23, no.8,pp. ings of this study were supplied by Kaplan-Meier Plotter 2071–2080, 2017. (http://kmplot.com/analysis/). [10] R. Kong, E.-B. Zhang, D.-D. Yin et al., “Long noncoding RNA PVT1 indicates a poor prognosis of gastric cancer and promotes cell proliferation through epigenetically regulating p15 and p16,” Ethical Approval Molecular Cancer,vol.14,no.1,article82,2015. All applicable international, national, and/or institutional [11] C. A. Schmitt and S. W. Lowe, “Apoptosis and therapy,” e Journal of Pathology,vol.187,pp. 127–137, 1999. guidelines for the care and use of animals were followed. [12] X.-W.Zhang,P.Bu,L.Liu,X.-Z.Zhang,and J.Li,“Overexpres- sion of long non-coding RNA PVT1 in gastric cancer cells pro- Conflicts of Interest motes the development of multidrug resistance,” Biochemical and Biophysical Research Communications,vol.462,no.3, pp. eTh authors declare that they have no conflicts of interest. 227–232, 2015. [13] A. Lanczky, A. Nagy,G.Bottaietal.,“miRpower: aweb-toolto Acknowledgments validate survival-associated miRNAs utilizing expression data from 2178 breast cancer patients,” Breast Cancer Research and This study was sponsored by Shanghai Sailing Program Treatment,vol.160,no. 3,pp.439–446,2016. (19YF1405100). [14] J. Li, C. Sun, W. Li et al., “Cancer RNA-Seq Nexus: a database of phenotype-specific transcriptome profiling in cancer cells,” Nucleic Acids Research,vol.44, no.D1, pp.D944–D951,2016. Supplementary Materials [15] X. Meng and R. Fu, “miR-206 regulates 5-FU resistance by Table S1: this table lists the premier of apoptosis related factors targeting Bcl-2 in colon cancer cells,” OncoTargets and erapy, in real-time PCR screening. (Supplementary Materials) vol. Volume 11, pp. 1757–1765, 2018. [16] S. Violette, L. Poulain, E. Dussaulx et al., “Resistance of colon cancer cells to long-term 5-fluorouracil exposure is correlated to References the relative level of Bcl-2 and Bcl-XL in addition toBax andp53 [1] L. A. Torre, F. Bray, R. L. Siegel, J. Ferlay, and J. Lortet- status,” International Journal of Cancer, vol. 98, no. 4, pp. 498– 504, 2002. Tieulent, “Global cancer statistics, 2012,” CA: A Cancer Journal for Clinicians,vol.65, no.2,pp. 87–108,2015. [17] X. Shi, M. Sun, H. Liu et al., “A critical role for the long non- [2] G. Group et al., “Role of chemotherapy for advanced/recurrent coding RNA GAS5 in proliferation and apoptosis in non-small- cell lung cancer,” Molecular Carcinogenesis,vol.54,1,pp.E1–E12, gastric cancer: an individual-patient-data meta-analysis,” Euro- pean journal of cancer, vol. 49, pp. 1565–1577, 2013. 2013. 10 Journal of Oncology [18] W. Wu, T. D. Bhagat, X. Yang et al., “Hypomethylation of noncoding DNA regions and overexpression of the long non- coding RNA, AFAP1-AS1, in Barrett’s esophagus and esophageal adenocarcinoma,” Gastroenterology, vol. 144, no. 5, pp. 956.e4– 966.e4, 2013. [19] Z. Cui, S. Ren, J. Lu et al., “eTh prostate cancer-up-regulated long noncoding RNA PlncRNA-1 modulates apoptosis and pro- liferation through reciprocal regulation of androgen receptor,” Urologic Oncology: Seminars and Original Investigations,vol.31, no. 7, pp. 1117–1123, 2013. [20] M. E. Guicciardi and G. J. Gores, “Life and death by death receptors,” e FASEB Journal,vol.23,no.6,pp.1625–1637,2009. [21] M. D’Amelio, E. Tino, and F. Cecconi, “The apoptosome: emerging insights and new potential targets for drug design,” Pharmaceutical Research,vol.25, no.4,pp. 740–751, 2008. [22] F. Edlich, “BCL-2 proteins and apoptosis: recent insights and unknowns,” Biochemical and Biophysical Research Communica- tions,vol.500,no. 1,pp.26–34,2018. [23] J. C. Reed et al., “BCL-2 family proteins: regulators of cell death involved in the pathogenesis of cancer and resistance to therapy,” Journal of Cellular Biochemistry,vol.60,pp.23–32, [24] R. L.Schenk,A.Strasser, andG.Dewson,“BCL-2:longand winding path from discovery to therapeutic target,” Biochemical and Biophysical Research Communications,vol.482,no. 3,pp. 459–469, 2017. [25] T. W. Sedlak, Z. N. Oltvai, E. Yang et al., “Multiple Bcl-2 family members demonstrate selective dimerizations with bax,” Proceedings of the National Acadamy of Sciences of the United States of America,vol.92,no.17,pp.7834–7838,1995. [26] J. Mirjolet, M. Barberi-Heyob, C. Didelot et al., “Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status,” British Journal of Cancer,vol.83, no.10, pp.1380– 1386, 2000. [27] D. B. Longley, D. P. Harkin, and P. G. Johnston, “5-Fluorouracil: mechanisms of action and clinical strategies,” Nature Reviews Cancer,vol.3,no. 5, pp.330–338,2003. [28] R. L. Comis and S. K. Carter, “A review of chemotherapy in gastric cancer,” Cancer,vol.34, no.5,pp.1576–1586, 1974. [29] D. Kelsen, “Chemotherapy of gastric cancer: a review,” Israel Journal of Medical Sciences, vol. 24, no. 9-10, pp. 557–561, 1988. MEDIATORS of INFLAMMATION The Scientific Gastroenterology Journal of World Journal Research and Practice Diabetes Research Disease Markers Hindawi Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 International Journal of Journal of Immunology Research Endocrinology Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com BioMed PPAR Research Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Journal of Obesity Evidence-Based Journal of Journal of Stem Cells Complementary and Ophthalmology International Alternative Medicine Oncology Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2013 Parkinson’s Disease Computational and Behavioural Mathematical Methods AIDS Oxidative Medicine and in Medicine Neurology Research and Treatment Cellular Longevity Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Journal

Journal of Oncology – Hindawi Publishing Corporation

Published: May 8, 2019

There are no references for this article.