Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Overexpression of Kynurenine 3-Monooxygenase Correlates with Cancer Malignancy and Predicts Poor Prognosis in Canine Mammary Gland Tumors

Overexpression of Kynurenine 3-Monooxygenase Correlates with Cancer Malignancy and Predicts Poor... Hindawi Journal of Oncology Volume 2019, Article ID 6201764, 10 pages https://doi.org/10.1155/2019/6201764 Research Article Overexpression of Kynurenine 3-Monooxygenase Correlates with Cancer Malignancy and Predicts Poor Prognosis in Canine Mammary Gland Tumors 1,2 3 4 3 3,5 Yi-Han Chiu, Han-Jung Lei, Kuo-Chin Huang, Yi-Lin Chiang, and Chen-Si Lin Department of Nursing, St. Mary's Junior College of Medicine, Nursing and Management, Yilan , Taiwan Institute of Long-Term Care, Mackay Medical College, New Taipei City , Taiwan Graduate Institute of Veterinary Clinical Science, School of Veterinary Medicine, National Taiwan University, Taipei  , Taiwan Holistic Education Center, Mackay Medical College, New Taipei City , Taiwan Animal Cancer Center, College of Bioresources and Agriculture, National Taiwan University, No. , Sec. , Roosevelt Road, Taipei  , Taiwan Correspondence should be addressed to Chen-Si Lin; cslin100@ntu.edu.tw Received 20 February 2019; Accepted 8 April 2019; Published 2 May 2019 Guest Editor: Chia-Jung Li Copyright © 2019 Yi-Han Chiu et al. is Th is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Tumor biomarkers are developed to indicate tumor status, clinical outcome, or prognosis. Since currently there are no eeff ctive biomarkers for canine mammary tumor (CMT), this study intended to verify whether kynurenine 3-monooxygenase (KMO), one of the key enzymes involved in tryptophan catabolism, is competent for predicting prognosis in patients with CMT. By investigating a series of 86 CMT clinical cases, we found that both gene and protein expression of KMO discriminated malignant from benign CMTs and was significantly higher in stage IV and V tumors than in lower-stage CMTs. About 73.7% of malignant CMTs showed strong expression of KMO which correlated with lower overall survival rates in patients. Further, downregulation of KMO activity significantly inhibited cell proliferation of CMT cells. Taken together, the findings indicated that KMO is a potential biomarker for tumor diagnosis, and this might open up new perspectives for clinical applications of CMT. BRCA 1/2 made approximately equal contributions to early- 1. Introduction onset human breast cancer, and higher prevalence of BRCA Dogs are viewed as a desirable animal model for human gene mutation was found in breast cancer patients from cancer research, as they share a living environment closely China and England to show its relevance in the development related to humans, with similar development patterns of of breast cancer [4, 5]. Moreover, inbreeding traits within particular breeds of dogs result in low genetic variation spontaneous tumors and cancer epidemiology [1]. In addi- tion, the genes associated with cancer are much more closely [6], which may also aid the identification of potential risk related between dogs and humans than between mice and factors or biomarkers for both human and canine cancer malignancy. humans [2]. Recently, many studies have highlighted the similar risk factors are associated with breast cancer among Biomarkers are useful tools in cancer diagnosis, tumor dogs and humans. For example, the outbred nature of dogs monitoring, and prognosis. Most biomarkers are involved compared with mice provides a similar level of genetic in tumor development and therefore can be applied in diversity among dogs as that found among humans [1]. The cancer therapies [7–10]. Estrogen receptor (ER), progesterone BRCA gene acts as the tumor suppressor and is significant receptor (PR), and human epidermal growth factor receptor for the development of canine mammary tumors (CMTs) 2 (HER2) are biomarkers measured in routine examinations and human breast cancer [3]. Studies demonstrated that for human breast cancer. The progression of breast cancer 2 Journal of Oncology and canine mammary tumors is mainly stimulated by hor- KMO is a potential biomarker for the diagnosis of CMT mones. In human breast cancer, patients with tumors that and whether KMO can be a useful molecule in prognostic are ER-positive and/or PR-positive have a better response prediction and therapeutic development for mammary tumors in the future. to hormonal treatment and there is a lower risk of mor- tality after diagnosis as compared with patients with ER- negative and/or PR-negative tumors [11]. In canine mammary 2. Materials and Methods tumors, studies have demonstrated that the expression of ER-𝛼 or PR is related to the histological subtype of canine .. Canine Tissue Specimens. Canine mammary tumor tissue mammary tumors [12], the occurrence of metastases [13], specimens were collected in accordance with regulations of and the survival rate [14–16], but some studies showed the Institutional Animal Care and Use Committee (IACUC) no correlations between these factors [17, 18]. HER-2 is at National Taiwan University Veterinary Hospital and con- a cell membrane surface-bound receptor tyrosine kinase formed to the guidelines of the protocol IACUC-NTU-101- that is involved in several signal transduction pathways EL-106. The patients were diagnosed and underwent surgery and promotes cell growth. Protein overexpression or gene to remove tumors from 2012 to 2016. All of the patients amplicfi ation of HER-2 in breast cancer often correlates with underwent surgical removal of CMT without other therapy. poorer clinical outcomes [19–22], and therefore HER-2 is The clinical histories of the patients were recorded in depth, used as an indicator for prognosis [20, 23–25]. The role of and follow-up information was continually documented until HER-2 overexpression in canine mammary tumors is still May 2018. The histological classification and stage of CMT controversial. Some studies have demonstrated that a high were determined according to the guidelines of the World level of HER-2 protein is related to poorer outcomes, such Health Organization [41]. All tumor pathological diagnoses as a highertumor grade ora greatermitotic count [26, 27], in this study weredonebeforeanalyzing the roleofKMO in while other studies have demonstrated opposite results [28, CMT malignancy, but the blind tests were performed by our 29]. Although other molecular markers have shown potential operators to investigate the KMO gene and protein expression for diagnosis and prognosis, there is no sufficient evidence of the tumor cases. proving their efficacy for routine examination and treatment [30–32]. Therefore, it is important to discover new potential .. Real-Time RT-PCR. Total RNA was extracted from col- biomarkers for clinical application for canine mammary lected CMT specimens using TRIzol (Invitrogen) and treated tumor therapy. with DNase I (Fermentas) to remove contaminated genomic Kynurenine 3-monooxygenase (KMO) is a key enzyme DNA for real-time RT-PCR analysis. Reverse transcription in the kynurenine pathway. KMO catalyzes the hydroly- was carried out using a Mastercycler Personal thermal sis of kynurenine (KYN) to form 3-hydroxy kynurenine cycler (Eppendorf) with SuperScript II RT (Invitrogen) to (3-HK) and further generates the downstream metabolite synthesize complementary DNA. Primers that specifically quinolinic acid. Both 3-HK and quinolinic acid may lead bind to canine indoleamine 2,3-dioxygenase (IDO)and to excitotoxicity in the CNS and act as important factors KMO genes were designed using Primer Express sowa ft re in neurodegenerative diseases [33–36]. As KMO is located (Applied Biosystems). The housekeeping genes used were 𝛽 - at the critical branching point in the kynurenine pathway, actin and hypoxanthine-phosphoribosyl transferase (HPRT), elevation of KMO protein shifts the pathway towards the which represents one of the best reference genes for canine formation of 3-HK instead of kynurenine acid, which is an mammary gland [42] (Table 1). Real-time RT-PCR was per- antagonist of NMDA receptors to protect neuronal cells from formed on a Bio-Rad real-time PCR machine with the use the excitotoxicity. KMO plays a role in balancing NMDA of SYBR Green PCR Master Mix according to the procedure receptor agonists and antagonists; therefore, KMO inhibitors describedpreviously [43].Data were presentedas foldchange can be applied in therapy for neurodegenerative diseases in gene expression level in the sample normalized to the [37]. Presently little is known about KMO for its significance -ΔCt housekeeping genes using2 method. on tumor development. Jin et al. found that high KMO expression is correlated with aggressive malignant phenotype of human hepatocellular carcinoma (HCC) cells and poor .. Immunohistochemistry and Protein Scoring System. Sec- prognosis and thus concluded that KMO can be served as a tions (5-𝜇 m-thick) of formalin-xfi ed, paraffin-embedded promising biomarker of HCC prognosis [38]. A high level of tumor specimens were deparaffinized by submerging slides in KMO promotes the synthesis of downstream metabolites of two changes of xylene for 20 min each time. Fresh xylene was the kynurenine pathway, such as 3-HK, 3-hydroxyanthranilic used for the second tank. The sections were then rehydrated acid, and quinolinic acid, which participate in the regulation in graded ethanol for 5 min each. After rehydration, the of theimmuneresponseand tumor tolerance [39, 40]. On the sections were rinsed with distilled water and antigen retrieval other hand, a high level of quinolinic acid might stimulate was performed with citrate buffer (10.2 mM Trisodium citrate more NMDA receptors, which promotes tumor proliferation dihydrate, 1.9 mM Citric acid hydrate, pH 6.0) in a decloaking through the ERK pathway. chamber (BIOCARE MEDICAL) at 121 Cfor 3 min and No other study has investigated the role of KMO in then at 90 C for 30 s. Endogenous peroxidase activity was canine tumor development. In this study we disclose the quenched using 3% hydrogen peroxide in PBS for 30 min at association between KMO expression and the malignancy of room temperature, and then the slides were rinsed with Tris- canine mammary tumors. This study aimed to verify whether buffered saline (TBS, 24.7 mM Tris-base, 136.9 mM Sodium Journal of Oncology 3 Table 1: Primers for canine IDO, KMO,actin, and HPRT. Gene Forward Reverse IDO CAGCTCACCGGGACTTTCTT TCCATGGCATTAGTGCCTCC KMO ATGGAGTCATCAGACGTTCA GTGACCCCATGGAGTTTGCA Actin CGACCTGACCGACTACCTCA TTTGATGTCACGCACGATTT HPRT TGCTCGAGATGTGATGAAGG TCCCCTGTTGACTGGTCATT Table 2: Classification of KMO expression as determined by immunoreactive score (IRS). Intensity of immunoreactivity Score Proportion reactive Score No staining 0 No staining 0 Weak cytoplasmic staining 1 < 10% 1 Moderate cytoplasmic staining 2 10%-50% 2 Strong cytoplasmic staining 3 > 50% 3 chloride, pH 7.6) and were blocked with 3% bovine serum Lin CT of the School of Veterinary Medicine, National albumin (BSA) in TBS for 1 h at room temperature. After Taiwan University (Taipei, Taiwan). Both were cultured in blocking, the slides were incubated with rabbit anti-human Dulbecco’s modified Eagle’s Medium (DMEM, Gibco) sup- KMO polyclonal antibody (Proteintech) at a 1:50 dilution plemented with 10% fetal bovine serum (FBS, Caisson) and in blocking buffer. The rabbit anti-human KMO polyclonal 1% penicillin/streptomycin (Caisson) at 37 Cinahumidiefi d antibody was pretested on human and dog’s kidneys as a pos- atmosphere of 5% CO .Toverify the role of KMOin itive control. Rabbit normal serum (Biogenex) replaced the cell growth, 3000 cells/well of CMT-1 or MPG cells were primary antibody in the same protocol as a negative control. seeded in a 96-well plate and treated with KMO inhibitor, All of the slides were incubated with the primary antibodies Ro 61-8048 (Sigma-Aldrich), at the indicated concentrations overnight at 4 C. On the next day, the slides were rinsed for 24, 48, and 72 h. Aeft r the treatment, quanticfi ation with TBS buffer and the signals of proteins were detected by of cell proliferation was performed using WST-1 reagent BioGenex Super Sensitive Detection Systems (BioGenex). according to the manufacturer’s protocol (Roche). For KMO Briefly, the slides were incubated with Super enhancer  and knockdown, small interfering RNAs (siRNAs), including Polymer-HRP (BioGenex) for 1 h each at room temperature. control and KMO, were used, and the reagents were all TBS buffer was used to wash the slides following each purchased from Santa Cruz Biotech Inc. CMT-1 and MPG staining step. The slides were treated with Diaminobenzidine cells were transfected for 48 h with siRNAs against KMO 󸀠 󸀠 tetrahydrochloride (DAB) (BioGenex), which was used as (Forward 5 -CCAAGGUAUUCCCAUGAGATT-3 ,reverse 󸀠 󸀠 a substrate to visualize protein signals for 1 min and then 5 -UCUCAUGGGAAUACCUUGGTT-3 ;scramble siRNA 󸀠 󸀠 stained with Mayer’s hematoxylin (Sigma-Aldrich) for 30 s. duplex:forward:5 -UUCUCCGAACGUGUCACGUTT-3 ; 󸀠 󸀠 The sections were washed with distilled water for 10 min reverse: 5 -ACGUGACACGUUCGGAGAATT-3 ). The cell and then dried at room temperature. After dehydration, the viability of the cells was quantiefi d using WST-1 and cell slides were mounted by water-soluble glycerol gelation and extracts were analyzed by KMO immunoblotting. examined under a bright-eld fi microscope (Olympus). All of the immunohistochemical slides were examined by .. Western Immunoblotting. The sample (30 𝜇 gofpro- a veterinary pathologist who did not have the patients’ clinical information. A total of 5 random efi lds were chosen from tein/lane) was subjected to SDS-PAGE and blotted from 12% (w/v) polyacrylamide gel to a hydrophobic polyvinyli- tumor regions to evaluate the expression of each protein. The dene difluoride (PVDF) membrane for WB analysis. Aeft r IHC staining of the samples was evaluated by a gynecological blocking the PVDF membrane in PBS, 0.05% Tween 20 histopathologist using the immunoreactive scoring (IRS) (PBST) plus 5% skim milk for 2h, themembranewas then system as described previously [44]; the system is used to rank the protein expressions and the value that equals the sequentially incubated with the anti-human KMO polyclonal antibody (1:2000) (Proteintech) for 2h, and horseradish per- staining intensity multiplied by the percentage of positive oxidase conjugated anti-rabbit IgG (A9169, Sigma-Aldrich) cells [45]. Grading was performed in a blinded fashion. Samples were interpreted as COX-2-positive if the IRS was for 1 h at room temperature. Finally, the membrane was washed extensively with PBST and developed with a chemi- ≥4. The standard IRS scores are shown in Table 2. The level of luminescent peroxidase substrate (Sigma-Aldrich). KMO protein was examined under high-power microscopic fields (HPFs, 400 ×) and scored by the IRS system. The standard for staining intensity is shown in Figure 3. .. Statistical Analysis. Comparisons of mean values were performed using independent two-sample t tests with SPSS .. Assays for Verifying KMO Biofunctions. Canine CMT 16.0 statistics software. The associations between the variables cell lines CMT-1 and MPG were kindly provided by Dr. of the categorical factors, including clinical outcomes and the 4 Journal of Oncology ∗∗∗ ∗∗∗ 0.25 0.25 0.20 0.20 0.15 0.15 0.10 0.10 0.05 0.05 0.00 0.00 (a) (b) Figure 1: Comparison of the KMO gene expression in CMTs. (a) KMO gene expression in benign (n = 30) and malignant CMT tissues (n = 54). (b) KMO gene expression in canine malignant CMTs at stages I/II/III (n =37) andstagesIV/V(n =17).(∗∗∗P< 0.0001). 0.45 0.6 0.40 0.5 0.35 0.30 0.4 0.25 0.3 0.20 0.15 0.2 0.10 0.1 0.05 0.00 0.0 (a) (b) Figure 2: Expression level of the IDO gene in CMTs. (a) IDO gene expression in benign and malignant CMT tissues. (b) IDO gene expression in canine malignant CMTs at stages I/II/III and stages IV/V. expression of proteins, were calculated by Spearman’s corre- KMO gene expression discriminated dogs with malignant lation coefficient. The significance of the difference between CMTs from dogs with benign CMTs and indicated that the the variables of the categorical factors was determined using expression level of the KMO gene may provide valuable information for the diagnosis of malignancy and metastasis atwo-tailed 𝜒 test. The Kaplan–Meier method was used in canine CMTs. to estimate the survival durations through the follow-up period. .. e Correlation between the Expressions of KMO and Indoleamine-,-Dioxygenase Genes in CMTs. Indoleamine- 3. Results 2,3-dioxygenase (IDO) is located upstream of KMO in the .. KMO Gene Expression and Tumor Malignancy. KMO kynurenine pathway [46]. We therefore sought to clarify gene expression in clinical CMT specimens was rfi st iden- whether the overexpression of KMO was related to the IDO expression. The results showed that there was no significant tified in 84 cases using real-time PCR. Interestingly, signifi- cantly higher expressions of KMO (p< 0.0001) were observed difference in IDO expression between malignant and benign in malignant CMTs than in benign CMTs (Figure 1(a)). In CMTs or between CMTs with or without metastasis (Figures addition, the KMO gene (p < 0.0001) was overexpressed 2(a) and 2(b)). These findings indicated that KMO overex- in stage VI/V CMTs (Figure 1(b)). The data showed that pression was not IDO-dependent in CMTs. Benign Malignant Benign Stage I/II/III Stage IV/V Malignant Stage I/II/III Stage IV/V Relative fold change of IDO Relative fold change of KMO Relative fold change of KMO Relative fold change of IDO Journal of Oncology 5 (a) (b) (c) (d) Figure 3: Immunohistochemical analysis of KMO protein expression in CMTs. (a) CMT stained without antibody against KMO as a negative control, which did not show immunoreactivity in the cytoplasm. (b) CMT with weak KMO cytoplasmic staining (1+). (c) CMT with moderate KMO cytoplasmic staining (2+). (d) CMT with strong KMO cytoplasmic staining (3+). Scale bar = 50.00𝜇 m. .. e Correlation between KMO Protein Expression and ∗∗∗ CMT Malignancy. To further determine the association between KMO and tumor progression, KMO expression in CMTs was analyzed by immunohistochemistry and scored by immunoreactive scoring (IRS) under the conditions listed in Table 1: Primers for canine IDO, KMO,actin, and HPRT. Table 2 shows that the standards for scoring KMO pro- tein are shown in Figure 3. According to the IRS, KMO expression could be classified into three groups. us, Th tumors were identified as KMO negative (IRS 0-3), weak (IRS 4- 2 6), and strong (IRS 7-9). Further analysis showed that the level of KMO expression was significantly associated with N=44 ovariohysterectomy (OHE) status; 21/39 (53%) patients with a strong KMO expression had OHE prior to the surgery to remove tumors (p< 0.05). The level of KMO expression was also significantly associated with tumor malignancy, tumor size, and tumor recurrence. In total, of 39 CMTs with a strong KMO expression, 27/39 (69%) tumors were malignant Figure 4: Correlation between KMO IRS and pathologic malignancy (p < 0.001). The correlations between the level of KMO in CMTs. The expression of the KMO protein was analyzed by expression and the characteristics of the patients with CMTs immunohistochemistry and scored by immunoreactive score (IRS). are summarized in Table 3. Moreover, as shown in Figure 4, KMO IRS showed a statistically significant association with tumor KMO IRS in malignant CMTs was significantly higher than malignancy (P< 0.05). KMO IRS in malignant CMTs was signifi- that in benign CMTs (p< 0.001). These results suggested that cantly higher than that in benign CMTs (∗∗∗P< 0.001). Benign cMGT Malignant cMGT KMO IRS Score 6 Journal of Oncology Table 3: Characteristics of the patients correlated with expression of KMO protein. Characteristics KMO P value Negative 0-3 Weak 4-6 Strong 7-9 All patients 6/ 86 (7%) 41/86 (48%) 39/86 (45%) Age <9 years 4/6 (67%) 12/41 (29%) 6/39 (15%) ≥ 9 years 2/6 (33%) 29/41 (71%) 33/39 (85%) 0.271 Tumor size ≤ 5 cm maximum diameter 4/6 (67%) 31/41 (76%) 25/39 (64%) > 5 cm maximum diameter 2/6 (33%) 10/41 (24%) 14/39 (36%) .  ∗ Ovariohysterectomy status No 5/6 (100%) 37/41 (90%) 18/39 (47%) . ∗ Yes 1/6 (0%) 4/41 (10%) 21/39 (53%) Malignancy Benign 6/6 (100%) 31/41 (76%) 12/39 (31%) Malignant 0/6 (0%) 10/41 (24%) 27/39 (69%) . ∗∗ Tumor stage (N=) I, II and III --- 3/10 (30%) 11/27 (41%) IV and V --- 7/10 (70%) 16/27 (59%) . ∗ Lymph node metastasis No --- 7/10 (70%) 16/27 (59%) 0.208 Yes --- 3/10 (30%) 11/27 (41%) Distant metastasis No --- 8/10 (80%) 24/27 (89%) 0.951 Yes --- 2/10 (20%) 3/27 (11%) Recurrence No 6/6 (100%) 19/41 (46%) 9/27 (33%) Yes 0/6 (0%) 22/41 (54%) 18/27 (67%) . ∗ ∗P< 0.05;∗∗P< 0.01. ∗∗∗ P= 0.0001 the KMO level can be used to discriminate malignant CMTs from benign tumors. .. e Association between KMO Expression and the Sur- vival Time in CMT Patients. Because tumor malignancy determines the survival outcome of cancer patients, we next evaluated the association between KMO expression and the overall survival rate of dogs with CMTs. The KMO expression could be classified into three groups according to the IRS. 0 20 40 60 80 The Kaplan–Meier survival curves showed that patients with Months aer sur ft gery strong KMO-expressing tumors had a significantly shorter KMO negative or weak (N=24) survival time and a remarkably lower survival rate than those with negative or weak KMO-expressing tumors (p< KMO strong (N=19) 0.001) (Figure 5). Taken together, the results shown here were Figure 5: Association between KMO expression and survival time similar to the prole fi of the kmo gene, demonstrating that of CMT patients. Patients with KMO strong staining tumors had a KMO is a potential biomarker for predicting the prognosis significantly shorter survival time and a remarkably lower survival of CMT dogs. rate than those with KMO negative or weak tumors (∗∗∗P< 0.001). .. e Role of KMO in the Proliferation of CMT Cells. High KMO expression was proved to be associated with the malignancy of CMT and indicated a poor outcome of the identifiable KMO protein amounts (Figure 6(a)). Incubation patients. The role of KMO in CMT development was next of CMT-1 and MPG cells with a KMO inhibitor (Ro 61- verified. We first examined the KMO expression in CMT 8048) for 1∼3 days significantly inhibited cell proliferation cell lines (CMT-1 and MPG cells) and found that both had (Figure 6(b)), and similar results were also observed when Overall survival rates Journal of Oncology 7 CMT-1 MPG KMO -actin (a) 120 120 CMT-1 MPG 100 100 80 80 60 60 40 40 20 20 0 0 0 M 5 M 10 M 20 M 50 M 0 M 5 M 10 M 20 M 50 M Ro 61-8048 Concentration Ro 61-8048 Concentration 24 hr 24 hr 48 hr 48 hr 72 hr 72 hr (b) 80 ∗∗ ∗∗ CMT-1 MPG Negative siRNA KMO siRNA Negative KMO Negative KMO siRNA siRNA siRNA siRNA KMO KMO -actin -actin (c) Figure 6: Downregulated KMO activities with KMO inhibitor or siRNA inhibited cell proliferation in CMT cells. (a) KMO expression in CMT-1 and MPG cells. (b) Cells treated with Ro 61-8048 for 24, 48, and 72 hrs were found to exhibit significantly suppressed cell proliferation of CMT-1 and MPG cells. (c) Knockdown of KMO with siRNA reduced cell proliferation in comparison to cells with control siRNA treatment. Columns,mean; bars,SD (n =3).∗∗P< 0.01. Cell Viability (%) Cell Viability (%) Cell Viability (%) 8 Journal of Oncology silencing KMO expression with specific siRNAs against KMO mammary gland tumor. The different cell origins of CMT- (Figure 6(c)). The data suggested that KMO might play an 1 and MPG may have relied on differently growth signal important role in CMT cell growth. pathways and therefore have different sensitivities to KMO knockdown. KMO has been reported to play a role as an agonist for the N-methyl-D-aspartic acid (NMDA) receptor [56]. NMDA receptors are known to initiate gene activa- 4. Discussion tion and cell proliferation and promote cell survival via CMT is the most frequently diagnosed type of cancer in the extracellular signal-regulated kinase (ERK1/2) pathways [57]. Recently, a report showed that NMDA receptors were female dogs [47, 48], and approximately halfofCMTs are malignant [49]. Surgical excision is the most effective overexpressed in human breast cancer cell lines [58]. Another treatment for CMT, but dogs with CMT have around a 30- metabolite of kynurenine produced by the action of KMO, 3-hydroxyanthranilic acid, causes apoptosis of Th1 cells 58% recurrence or metastasis rate within 2 years following surgical removal [49, 50], and about 40-60% die from cancer- by activating caspase-8 [59] and induces apoptosis of T- related diseases within the first 2 years [51]. The low survival cells through the inhibition of NF-𝜅 B[60]. Taken together, rate of patients implies a low rate of specific diagnoses although the detailed mechanisms still need to be fully and ineffective therapies in CMT treatment. Challenges of elucidated, our results have offered significant evidences of involvement of KMO in CMT progression and provided CMT treatment include complex histological classification as well as unpredictable tumor behavior and prognosis [52]. precious advice for further study on human breast cancer Therefore, it is necessary to improve the accuracy of diagnosis therapy. to facilitate the determination of appropriate therapies. Herein, we identified KMO as a novel and potential 5. Conclusions biomarker in CMT, which can help to improve diagnosis and predict the prognosis of CMTs. Our results showed that 31.8% A significant parallel increase of KMO mRNA and protein of the total CMTs and 73.7% of the malignant CMTs had expression in malignant CMT was revealed and correlated strong expressions of KMO protein (Table 3). This indicated with shorter survival time in CMT patients. Our results that the expression of KMO protein issignificantly associated also showed that KMO plays a role in controlling cell with tumor malignancy and demonstrated the potential of growth and malignancy in canine mammary tumors. These KMO in discriminating malignant tumors from benign ones. findings indicate the potential applications of KMO in cancer Furthermore, the survival rate of patients with a strong prognosis and therapeutic developments. KMO protein expression was lower than that of those with weak or negative KMO expression. This result suggested that Data Availability KMO could be a promising biomarker not only for tumor malignancy but also for predicting the prognosis of CMT The data used to support the findings of this study are patients. available from the corresponding author upon request. KMO is involved in the metabolism of tryptophan and catalyzes the conversion of kynurenine into 3-HK and 3- hydroxyanthranilic acid, which are further converted into Disclosure quinolinic acid, generating NAD for essential cell survival [53]. The kynurenine pathway involves physiological and The results shown here have been patented in the United pathological processes in the nervous and immune systems. States with the Patent no. US204110275081 A1. KMO is notable because it has been proven to be a potential therapeutic target for stroke, seizures, and Huntington’s Conflicts of Interest disease [54]. IDO is located upstream of KMO in the kynurenine pathway [43]. The potential association between The authors declare that they have no conflicts of interest. IDO expression and cancer has been intensively studied [55]; however, their relationship is still ambiguous and sometimes controversial. Reports have shown that IDO overexpression Acknowledgments in human tumors is related to tumor growth, but other This study was supported by the National Science Council of reports have suggested that IDO expression in tumor cells Taiwan (NSC 102-2313-B-002-031-MY3). and antigen-presenting cells inhibits tumor proliferation [55]. In our results, KMO overexpression was independent of IDO expression in CMTs, suggesting that KMO might induce References tumor malignancy via a novel mechanism not involving IDO. We also demonstrated that knockdown of KMO expres- [1] M. Paoloni and C. Khanna, “Translation of new cancer treat- sion or blocking of its activity could suppress proliferation of ments from pet dogs to humans,” Nature Reviews Cancer,vol.8, no. 2, pp. 147–156, 2008. CMT cells. Herein, we found that though CMT-1 and MPG are both cell lines of canine mammary gland tumors, CMT- [2] M. M. Hoffman and E. Birney, “Estimating the neutral rate of 1 is developed from canine mammary carcinoma (epithelial nucleotide substitution using introns,” Molecular Biology and cell origin) while MPG is derived from the canine mixed Evolution,vol.24,no.2, pp. 522–531, 2007. Journal of Oncology 9 [3] P. J.Rivera, M.Melin,T.Biagi et al.,“Mammary tumor [17] W. Toniti, S. Buranasinsup, A. Kongcharoen, P. Charoonrut, P. development in dogs is associated with BRCA1 and BRCA2,” Puchadapirom, and C. Kasorndorkbua, “Immunohistochemi- Cancer Research,vol. 69, no.22, pp. 8770–8774,2009. cal determination of estrogen and progesterone receptors in canine mammary tumors,” Asian Pacific Journal of Cancer [4] J. Peto, N. Collins, R. Barfoot et al., “Prevalence of BRCA1 Prevention,vol. 10, no.5,pp.907–912, 2009. and BRCA2 gene mutations in patients with early-onset breast [18] F. Sassi,C.Benazzi,G. Castellani, and G. Sarli,“Molecular- cancer,” Journal of the National Cancer Institute, vol. 91, no. 11, based tumour subtypes of canine mammary carcinomas pp. 943–949, 1999. assessed by immunohistochemistry,” BMC Veterinary Research, [5] L.Sun,J.Liu,S. Wang,Y. Chen,andZ.Li,“Prevalenceof BRCA1 vol. 6, p. 5, 2010. gene mutation in breast cancer patients in Guangxi, China,” [19] R. Simon, A. Nocito, T. Hubs ¨ cher et al., “Patterns of HER-2/neu International Journal of Clinical and Experimental Pathology, amplification and overexpression in primary and metastatic vol.7,no.9,pp. 6262–6269, 2014. breast cancer,” Journal of the National Cancer Institute,vol. 93, [6] F.C.F.Calboli, J. Sampson, N.Fretwell, and D.J. Balding, no. 15, pp.1141–1146,2001. “Population structure and inbreeding from pedigree analysis of [20] D. J.Slamon,G.M. Clark,S.G.Wong,W.J. Levin, A. purebred dogs,” Genetics,vol.179,no. 1, pp.593–601, 2008. Ullrich, and W. L. McGuire, “Human breast cancer: correlation [7] R.Klopfleisch,H.vonEuler,G. Sarli, S.S.Pinho,F. G¨artner, and of relapse and survival with amplification of the HER-2/neu A. D. Gruber, “Molecular carcinogenesis of canine mammary oncogene,” Science,vol.235, no. 4785,pp.182–191, 1987. tumors: news from an old disease,” Veterinary Pathology,vol. [21] I. L. Andrulis, S. B. Bull, M. E. Blackstein et al., “Neu/erbB- 48, no. 1, pp. 98–116, 2011. 2 amplification identifies a poor-prognosis group of women [8] D. Kanojia, M. Garg, S. Gupta, A. Gupta, and A. Suri, “Sperm- with node-negative breast cancer. Toronto breast cancer study associated antigen 9, a novel biomarker for early detection of group,” Journal of Clinical Oncology,vol.16,no.4,pp.1340–1349, breast cancer,” Cancer Epidemiology, Biomarkers & Prevention, 1998. vol. 18,no. 2, pp. 630–639,2009. [22] R. E. Roses, E. C. Paulson, A. Sharma et al., “HER-2/neu overexpression as a predictor for the transition from in situ [9] J.S. Ross, E. A.Slodkowska, W.F.Symmans, L. Pusztai, P. to invasive breast cancer,” Cancer Epidemiology Biomarkers & M. Ravdin, and G. N. Hortobagyi, “The HER-2 receptor and Prevention,vol. 18,no. 5,pp. 1386–1389, 2009. breast cancer: Ten years of targeted anti-HER-2 therapy and personalized medicine,” e Oncologist, vol. 14, no.4,pp. 320– [23] S. Chia, B. Norris, C. Speers et al., “Human epidermal growth 368, 2009. factor receptor 2 overexpression as a prognostic factor in a large tissue microarray series of node-negative breast cancers,” [10] P. Prihantono,M.Hatta,C.Binekadaetal.,“Ki-67expression by Journal of Clinical Oncology,vol.26,no.35,pp.5697–5704,2008. immunohistochemistry and quantitative real-time polymerase [24] F. R´evillion, J. Bonneterre, and J. P. Peyrat, “ERBB2 oncogene chain reaction as predictor of clinical response to neoadjuvant in human breast cancer and its clinical significance,” European chemotherapy in locally advanced breast cancer,” Journal of Journal of Cancer, vol.34, no.6,pp.791–808, 1998. Oncology,vol. 2017, Article ID 6209849,8 pages, 2017. [25] R.Seshadri,F. A.Firgaira, D.J. Horsfall,K.McCaul, V. Setlur, [11] L.K.Dunnwald,M.A.Rossing,andC.I. Li,“Hormonereceptor and P. Kitchen, “Clinical significance of HER-2/neu oncogene status, tumor characteristics, and prognosis: a prospective amplification in primary breast cancer. the south australian cohort of breast cancer patients,” Breast Cancer Research,vol. breast cancer study group,” Journal of Clinical Oncology, vol. 11, 9, no. 1,article R6,2007. no. 10, pp. 1936–1942, 1993. [12] J. Mart´ın De Las Mulas, Y. Milla´n,and R.Dios,“A prospective [26] H. Tsuda, S. Hirohashi, Y. Shimosato et al., “Correlation analysis of immunohistochemically determined estrogen recep- between histologic grade of malignancy and copy number of c- tor𝛼 and progesterone receptor expression and host and tumor erbb-2 gene in breast carcinoma. a retrospective analysis of 176 factors as predictors of disease-free period in mammary tumors cases,” Cancer,vol.65, no. 8, pp.1794–1800,1990. of the dog,” Veterinary Pathology, vol. 42, no. 2, pp. 200–212, [27] A. P. Dutra, N. V. M. Granja, F. C. Schmitt, and G. D. Cassali, “c-erbB-2 expression and nuclear pleomorphism in canine [13] A. Nieto, L. Pen˜a,M.D.Per´ ez-Alenza, M. A. S´anchez,J.M. mammary tumors,” Brazilian Journal of Medical and Biological Flores, and M. Castano ˜ , “Immunohistologic detection of estro- Research, vol. 37, no. 11, pp. 1673–1681, 2004. gen receptor alpha in canine mammary tumors: clinical and [28] A. Gama,A.Alves,and F. Schmitt,“Identification of molecu- pathologic associations and prognostic significance,” Veterinary lar phenotypes in canine mammary carcinomas with clinical Pathology, vol.37,no. 3,pp.239–247,2000. implications: application of the human classification,” Virchows [14] C.-C. Chang, M.-H. Tsai, J.-W. Liao, J. P.-W. Chan, M.-L. Wong, Archiv, vol.453,no. 2,pp. 123–132, 2008. and S.-C. Chang, “Evaluation of hormone receptor expression [29] W.-L. Hsu, H.-M. Huang, J.-W. Liao, M.-L. Wong, and S.-C. for use in predicting survival of female dogs with malignant Chang, “Increased survival in dogs with malignant mammary mammary gland tumors,” Journal of the American Veterinary tumours overexpressing HER-2 protein and detection of a silent Medical Association,vol.235, no. 4, pp.391–396, 2009. single nucleotide polymorphism in the canine HER-2 gene,” [15] E. A.Sartin, S.Barnes,R.P.Kwapien,andL.G.Wolfe,“Estrogen Veterinary Journal, vol. 180, no. 1, pp. 116–123, 2009. and progesterone receptor status of mammary carcinomas and [30] S. Mukaratirwa, “Prognostic and predictive markers in canine correlation with clinical outcome in dogs,” American Journal of tumours: rationale and relevance. a review,” Veterinary Quar- Veterinary Research, vol.53,no.11,pp.2196–2200, 1992. terly,vol.27,no.2, pp. 52–64, 2005. [31] T.Tanaka,T. Shimada,H. Akiyoshi etal.,“Relationship between [16] A. Bergamaschi, E. Tagliabue, T. Sørlie et al., “Extracellular matrix signature identifies breast cancer subgroups with differ- major histocompatibility complex class I expression and prog- nosis in canine mammary gland tumors,” Journal of Veterinary ent clinical outcome,” e Journal of Pathology, vol.214,no. 3, pp. 357–367, 2008. Medical Science,vol.75,no. 10,pp.1393–1398, 2013. 10 Journal of Oncology [32] M. Furuya, M. Funasaki, H. Tani, and K. Sasai, “Identification on life-span observations in Beagles,” Veterinary Pathology,vol. of novel tumour-associated antigens in canine mammary gland 36, no. 5, pp. 423–436, 1999. tumour,” Veterinary and Comparative Oncology,vol.13,no.3, ¨ [48] A. Egenvall, B. N. Bonnett, P. Ohagen, P. Olson, A. Hedhammar, pp. 194–202, 2015. and H. Von Euler, “Incidence of and survival after mammary [33] M.F. Beal, R.J.Ferrante, K.J.Swartz,and N.W.Kowall, tumors in a population of over 80,000 insured female dogs in “Chronic quinolinic acid lesions in rats closely resemble Hunt- Sweden from 1995 to 2002,” Preventive Veterinary Medicine,vol. ington’s disease,” e Journal of Neuroscience, vol.11, no.6,pp. 69,no.1-2,pp.109–127,2005. 1649–1659, 1991. [49] E. G. MacEwen, “Spontaneous tumors in dogs and cats: models [34] N.Braidy,R.Grant,S.Adams, B. J. Brew, and G.J. Guillemin, for the study of cancer biology and treatment,” Cancer and Metastasis Reviews,vol.9, no. 2,pp.125–136,1990. “Mechanism for quinolinic acid cytotoxicity in human astro- cytes and neurons,” Neurotoxicity Research,vol. 16, no.1, pp. 77– [50] N. Stratmann, K. Failing, A. Richter, and A. Wehrend, “Mam- 86, 2009. mary tumor recurrence in bitches aer ft regional mastectomy,” [35] P. Guidetti, G. P. Bates, R. K. Graham et al., “Elevated brain Veterinary Surgery, vol.37, no. 1,pp. 82–86, 2008. 3-hydroxykynurenine and quinolinate levels in Huntington [51] S.-C. Chang, C.-C. Chang, T.-J. Chang, and M.-L. Wong, “Prog- disease mice,” Neurobiology of Disease,vol.23, no. 1,pp.190– nostic factors associated with survival two years aeft r surgery in 197, 2006. dogs with malignant mammary tumors: 79 cases (1998-2002),” [36] S. J. Pearson and G. P. Reynolds, “Increased brain concentra- Journal of the American Veterinary Medical Association, vol. 227, no.10, pp. 1625–1629,2005. tions of a neurotoxin, 3-hydroxykynurenine, in Huntington’s disease,” Neuroscience Letters, vol.144,no.1-2,pp. 199–201,1992. [52] D.A.P.C.Zuccari,A.E. Santana, P.M.Cury,and J.A.Cordeiro, “Immunocytochemicalstudy of Ki-67 as a prognostic marker in [37] M. A. eTh vandavakkam, R. Schwarcz, P. J. Muchowski, and F. Giorgini, “Targeting kynurenine 3-monooxygenase (kmo): canine mammary neoplasia,” Veterinary Clinical Pathology,vol. 33, no.1,pp.23–28,2004. Implications for therapy in huntington’s disease,” CNS and Neurological Disorders - Drug Targets, vol.9, no. 6, pp.791–800, [53] K. K. Ting, B. Brew, and G. Guillemin, “eTh involvement of astrocytes and kynurenine pathway in Alzheimer’s disease,” [38] H. Jin, Y. Zhang, H. You et al., “Prognostic significance Neurotoxicity Research, vol. 12, no. 4, pp. 247–262, 2007. of kynurenine 3-monooxygenase and effects on prolifera- [54] K. R. Crozier-Reabe, R. S. Phillips, and G. R. Moran, “Kyn- tion,migration, and invasion of human hepatocellular carci- urenine 3-monooxygenase from Pseudomonas uo fl rescens: noma,” Scientific Reports,vol. 5,ArticleID 10466, pp.1–12,2015. substrate-like inhibitors both stimulate flavin reduction and stabilize the flavin-peroxo intermediate yet result in the pro- [39] P. Terness, T. M. Bauer, L. Ros ¨ e et al., “Inhibition of allogeneic T duction of hydrogen peroxide,” Biochemistry, vol.47,no.47,pp. cell proliferation by indoleamine 2,3-dioxygenase–expressing 12420–12433, 2008. dendritic cells: mediation of suppression by tryptophan metabolites,” e Journal of Experimental Medicine,vol. 196, [55] S. Lob ¨ , A. Konigs ¨ rainer, H.-G. Rammensee, G. Opelz, and P. no.4,pp.447–457, 2002. Terness, “Inhibitors of indoleamine-2,3-dioxygenase for cancer therapy: can we see the wood for the trees?” Nature Reviews [40] Y. Mand ´ i and L. Vecsei, ´ “eTh kynurenine system and Cancer,vol.9, no. 6,pp.445–452, 2009. immunoregulation,” Journal of Neural Transmission,vol. 119, no. 2,pp.197–209,2012. [56] J. Urenjak and T. P. Obrenovitch, “Kynurenine 3-hydroxylase inhibition in rats: Eeff cts on extracellular kynurenic acid con- [41] L. N. Owen, TNM Classification of Tumours in Domestic centration and N-methyl-D-aspartate-induced depolarisation Animals, World Health Organization, Geneva, Switzerland, 1st in the striatum,” Journal of Neurochemistry, vol.75,no. 6,pp. edition, 1980. 2427–2433, 2000. [42] B. Etschmann, B. Wilcken, K. Stoevesand, A. Von Der Schu- [57] J. A. Kemp and R. M. McKernan, “NMDA receptor pathways as lenburg, and A. Sterner-Kock, “Selection of reference genes for drug targets,” Nature Neuroscience, vol.5,pp.1039–1042, 2002. quantitative real-time PCR analysis in canine mammary tumors using the GeNorm algorithm,” Veterinary Pathology,vol. 43, no. [58] W. G.North,G.Gao,V. A. Memoli,R.H.Pang, and L.Lynch, 6, pp. 934–942, 2006. “Breast cancer expresses functional NMDA receptors,” Breast Cancer Research and Treatment,vol.122,no.2,pp.307–314,2010. [43] H.-C. Chiang, A. T.-C. Liao, T.-R. Jan et al., “Gene-expression profiling to identify genes related to spontaneous tumor regres- [59] F. Fallarino, U. Grohmann, C. Vacca et al., “T cell apoptosis by sion in a canine cancer model,” Veterinary Immunology and tryptophan catabolism,” Cell Death & Differentiation, vol.9,no. Immunopathology, vol.151,no. 3-4,pp.207–216, 2013. 10, pp. 1069–1077, 2002. [44] W. Remmele and H. E. Stegner, “Recommendation for uniform [60] T. Hayashi, J.-H. Mo, X. Gong et al., “3-Hydroxyanthranilic definition of an immunoreactive score (IRS) for immunohisto- acid inhibits PDK1 activation and suppresses experimental chemical estrogen receptor detection (ER-ICA) in breast cancer asthma by inducing T cell apoptosis,” Proceedings of the National tissue,” Der Pathologe,vol. 8,no. 3, pp.138–140, 1987. Acadamy of Sciences of the United States of America, vol.104,no. 47, pp. 18619–18624, 2007. [45] C.-C. Wu, R.-Y. Shyu, J.-M. Chou et al., “RARRES1 expression is significantly related to tumour differentiation and staging in colorectal adenocarcinoma,” European Journal of Cancer,vol. 42, no. 4, pp. 557–565, 2006. [46] J.R. Moeff tt and M.A.Namboodiri,“Tryptophan and the immune response,” Immunology & Cell Biology, vol.81, no.4, pp. 247–265, 2003. [47] S. A. Benjamin,A. C.Lee,and W.J.Saunders,“Classification and behavior of canine mammary epithelial neoplasms based MEDIATORS of INFLAMMATION The Scientific Gastroenterology Journal of World Journal Research and Practice Diabetes Research Disease Markers Hindawi Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 International Journal of Journal of Immunology Research Endocrinology Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com BioMed PPAR Research Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Journal of Obesity Evidence-Based Journal of Journal of Stem Cells Complementary and Ophthalmology International Alternative Medicine Oncology Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2013 Parkinson’s Disease Computational and Behavioural Mathematical Methods AIDS Oxidative Medicine and in Medicine Neurology Research and Treatment Cellular Longevity Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Oncology Hindawi Publishing Corporation

Overexpression of Kynurenine 3-Monooxygenase Correlates with Cancer Malignancy and Predicts Poor Prognosis in Canine Mammary Gland Tumors

Download PDF
11 pages

Loading next page...
 
/lp/hindawi-publishing-corporation/overexpression-of-kynurenine-3-monooxygenase-correlates-with-cancer-FqsKi3xe8V

References (68)

Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2019 Yi-Han Chiu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
1687-8450
eISSN
1687-8469
DOI
10.1155/2019/6201764
Publisher site
See Article on Publisher Site

Abstract

Hindawi Journal of Oncology Volume 2019, Article ID 6201764, 10 pages https://doi.org/10.1155/2019/6201764 Research Article Overexpression of Kynurenine 3-Monooxygenase Correlates with Cancer Malignancy and Predicts Poor Prognosis in Canine Mammary Gland Tumors 1,2 3 4 3 3,5 Yi-Han Chiu, Han-Jung Lei, Kuo-Chin Huang, Yi-Lin Chiang, and Chen-Si Lin Department of Nursing, St. Mary's Junior College of Medicine, Nursing and Management, Yilan , Taiwan Institute of Long-Term Care, Mackay Medical College, New Taipei City , Taiwan Graduate Institute of Veterinary Clinical Science, School of Veterinary Medicine, National Taiwan University, Taipei  , Taiwan Holistic Education Center, Mackay Medical College, New Taipei City , Taiwan Animal Cancer Center, College of Bioresources and Agriculture, National Taiwan University, No. , Sec. , Roosevelt Road, Taipei  , Taiwan Correspondence should be addressed to Chen-Si Lin; cslin100@ntu.edu.tw Received 20 February 2019; Accepted 8 April 2019; Published 2 May 2019 Guest Editor: Chia-Jung Li Copyright © 2019 Yi-Han Chiu et al. is Th is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Tumor biomarkers are developed to indicate tumor status, clinical outcome, or prognosis. Since currently there are no eeff ctive biomarkers for canine mammary tumor (CMT), this study intended to verify whether kynurenine 3-monooxygenase (KMO), one of the key enzymes involved in tryptophan catabolism, is competent for predicting prognosis in patients with CMT. By investigating a series of 86 CMT clinical cases, we found that both gene and protein expression of KMO discriminated malignant from benign CMTs and was significantly higher in stage IV and V tumors than in lower-stage CMTs. About 73.7% of malignant CMTs showed strong expression of KMO which correlated with lower overall survival rates in patients. Further, downregulation of KMO activity significantly inhibited cell proliferation of CMT cells. Taken together, the findings indicated that KMO is a potential biomarker for tumor diagnosis, and this might open up new perspectives for clinical applications of CMT. BRCA 1/2 made approximately equal contributions to early- 1. Introduction onset human breast cancer, and higher prevalence of BRCA Dogs are viewed as a desirable animal model for human gene mutation was found in breast cancer patients from cancer research, as they share a living environment closely China and England to show its relevance in the development related to humans, with similar development patterns of of breast cancer [4, 5]. Moreover, inbreeding traits within particular breeds of dogs result in low genetic variation spontaneous tumors and cancer epidemiology [1]. In addi- tion, the genes associated with cancer are much more closely [6], which may also aid the identification of potential risk related between dogs and humans than between mice and factors or biomarkers for both human and canine cancer malignancy. humans [2]. Recently, many studies have highlighted the similar risk factors are associated with breast cancer among Biomarkers are useful tools in cancer diagnosis, tumor dogs and humans. For example, the outbred nature of dogs monitoring, and prognosis. Most biomarkers are involved compared with mice provides a similar level of genetic in tumor development and therefore can be applied in diversity among dogs as that found among humans [1]. The cancer therapies [7–10]. Estrogen receptor (ER), progesterone BRCA gene acts as the tumor suppressor and is significant receptor (PR), and human epidermal growth factor receptor for the development of canine mammary tumors (CMTs) 2 (HER2) are biomarkers measured in routine examinations and human breast cancer [3]. Studies demonstrated that for human breast cancer. The progression of breast cancer 2 Journal of Oncology and canine mammary tumors is mainly stimulated by hor- KMO is a potential biomarker for the diagnosis of CMT mones. In human breast cancer, patients with tumors that and whether KMO can be a useful molecule in prognostic are ER-positive and/or PR-positive have a better response prediction and therapeutic development for mammary tumors in the future. to hormonal treatment and there is a lower risk of mor- tality after diagnosis as compared with patients with ER- negative and/or PR-negative tumors [11]. In canine mammary 2. Materials and Methods tumors, studies have demonstrated that the expression of ER-𝛼 or PR is related to the histological subtype of canine .. Canine Tissue Specimens. Canine mammary tumor tissue mammary tumors [12], the occurrence of metastases [13], specimens were collected in accordance with regulations of and the survival rate [14–16], but some studies showed the Institutional Animal Care and Use Committee (IACUC) no correlations between these factors [17, 18]. HER-2 is at National Taiwan University Veterinary Hospital and con- a cell membrane surface-bound receptor tyrosine kinase formed to the guidelines of the protocol IACUC-NTU-101- that is involved in several signal transduction pathways EL-106. The patients were diagnosed and underwent surgery and promotes cell growth. Protein overexpression or gene to remove tumors from 2012 to 2016. All of the patients amplicfi ation of HER-2 in breast cancer often correlates with underwent surgical removal of CMT without other therapy. poorer clinical outcomes [19–22], and therefore HER-2 is The clinical histories of the patients were recorded in depth, used as an indicator for prognosis [20, 23–25]. The role of and follow-up information was continually documented until HER-2 overexpression in canine mammary tumors is still May 2018. The histological classification and stage of CMT controversial. Some studies have demonstrated that a high were determined according to the guidelines of the World level of HER-2 protein is related to poorer outcomes, such Health Organization [41]. All tumor pathological diagnoses as a highertumor grade ora greatermitotic count [26, 27], in this study weredonebeforeanalyzing the roleofKMO in while other studies have demonstrated opposite results [28, CMT malignancy, but the blind tests were performed by our 29]. Although other molecular markers have shown potential operators to investigate the KMO gene and protein expression for diagnosis and prognosis, there is no sufficient evidence of the tumor cases. proving their efficacy for routine examination and treatment [30–32]. Therefore, it is important to discover new potential .. Real-Time RT-PCR. Total RNA was extracted from col- biomarkers for clinical application for canine mammary lected CMT specimens using TRIzol (Invitrogen) and treated tumor therapy. with DNase I (Fermentas) to remove contaminated genomic Kynurenine 3-monooxygenase (KMO) is a key enzyme DNA for real-time RT-PCR analysis. Reverse transcription in the kynurenine pathway. KMO catalyzes the hydroly- was carried out using a Mastercycler Personal thermal sis of kynurenine (KYN) to form 3-hydroxy kynurenine cycler (Eppendorf) with SuperScript II RT (Invitrogen) to (3-HK) and further generates the downstream metabolite synthesize complementary DNA. Primers that specifically quinolinic acid. Both 3-HK and quinolinic acid may lead bind to canine indoleamine 2,3-dioxygenase (IDO)and to excitotoxicity in the CNS and act as important factors KMO genes were designed using Primer Express sowa ft re in neurodegenerative diseases [33–36]. As KMO is located (Applied Biosystems). The housekeeping genes used were 𝛽 - at the critical branching point in the kynurenine pathway, actin and hypoxanthine-phosphoribosyl transferase (HPRT), elevation of KMO protein shifts the pathway towards the which represents one of the best reference genes for canine formation of 3-HK instead of kynurenine acid, which is an mammary gland [42] (Table 1). Real-time RT-PCR was per- antagonist of NMDA receptors to protect neuronal cells from formed on a Bio-Rad real-time PCR machine with the use the excitotoxicity. KMO plays a role in balancing NMDA of SYBR Green PCR Master Mix according to the procedure receptor agonists and antagonists; therefore, KMO inhibitors describedpreviously [43].Data were presentedas foldchange can be applied in therapy for neurodegenerative diseases in gene expression level in the sample normalized to the [37]. Presently little is known about KMO for its significance -ΔCt housekeeping genes using2 method. on tumor development. Jin et al. found that high KMO expression is correlated with aggressive malignant phenotype of human hepatocellular carcinoma (HCC) cells and poor .. Immunohistochemistry and Protein Scoring System. Sec- prognosis and thus concluded that KMO can be served as a tions (5-𝜇 m-thick) of formalin-xfi ed, paraffin-embedded promising biomarker of HCC prognosis [38]. A high level of tumor specimens were deparaffinized by submerging slides in KMO promotes the synthesis of downstream metabolites of two changes of xylene for 20 min each time. Fresh xylene was the kynurenine pathway, such as 3-HK, 3-hydroxyanthranilic used for the second tank. The sections were then rehydrated acid, and quinolinic acid, which participate in the regulation in graded ethanol for 5 min each. After rehydration, the of theimmuneresponseand tumor tolerance [39, 40]. On the sections were rinsed with distilled water and antigen retrieval other hand, a high level of quinolinic acid might stimulate was performed with citrate buffer (10.2 mM Trisodium citrate more NMDA receptors, which promotes tumor proliferation dihydrate, 1.9 mM Citric acid hydrate, pH 6.0) in a decloaking through the ERK pathway. chamber (BIOCARE MEDICAL) at 121 Cfor 3 min and No other study has investigated the role of KMO in then at 90 C for 30 s. Endogenous peroxidase activity was canine tumor development. In this study we disclose the quenched using 3% hydrogen peroxide in PBS for 30 min at association between KMO expression and the malignancy of room temperature, and then the slides were rinsed with Tris- canine mammary tumors. This study aimed to verify whether buffered saline (TBS, 24.7 mM Tris-base, 136.9 mM Sodium Journal of Oncology 3 Table 1: Primers for canine IDO, KMO,actin, and HPRT. Gene Forward Reverse IDO CAGCTCACCGGGACTTTCTT TCCATGGCATTAGTGCCTCC KMO ATGGAGTCATCAGACGTTCA GTGACCCCATGGAGTTTGCA Actin CGACCTGACCGACTACCTCA TTTGATGTCACGCACGATTT HPRT TGCTCGAGATGTGATGAAGG TCCCCTGTTGACTGGTCATT Table 2: Classification of KMO expression as determined by immunoreactive score (IRS). Intensity of immunoreactivity Score Proportion reactive Score No staining 0 No staining 0 Weak cytoplasmic staining 1 < 10% 1 Moderate cytoplasmic staining 2 10%-50% 2 Strong cytoplasmic staining 3 > 50% 3 chloride, pH 7.6) and were blocked with 3% bovine serum Lin CT of the School of Veterinary Medicine, National albumin (BSA) in TBS for 1 h at room temperature. After Taiwan University (Taipei, Taiwan). Both were cultured in blocking, the slides were incubated with rabbit anti-human Dulbecco’s modified Eagle’s Medium (DMEM, Gibco) sup- KMO polyclonal antibody (Proteintech) at a 1:50 dilution plemented with 10% fetal bovine serum (FBS, Caisson) and in blocking buffer. The rabbit anti-human KMO polyclonal 1% penicillin/streptomycin (Caisson) at 37 Cinahumidiefi d antibody was pretested on human and dog’s kidneys as a pos- atmosphere of 5% CO .Toverify the role of KMOin itive control. Rabbit normal serum (Biogenex) replaced the cell growth, 3000 cells/well of CMT-1 or MPG cells were primary antibody in the same protocol as a negative control. seeded in a 96-well plate and treated with KMO inhibitor, All of the slides were incubated with the primary antibodies Ro 61-8048 (Sigma-Aldrich), at the indicated concentrations overnight at 4 C. On the next day, the slides were rinsed for 24, 48, and 72 h. Aeft r the treatment, quanticfi ation with TBS buffer and the signals of proteins were detected by of cell proliferation was performed using WST-1 reagent BioGenex Super Sensitive Detection Systems (BioGenex). according to the manufacturer’s protocol (Roche). For KMO Briefly, the slides were incubated with Super enhancer  and knockdown, small interfering RNAs (siRNAs), including Polymer-HRP (BioGenex) for 1 h each at room temperature. control and KMO, were used, and the reagents were all TBS buffer was used to wash the slides following each purchased from Santa Cruz Biotech Inc. CMT-1 and MPG staining step. The slides were treated with Diaminobenzidine cells were transfected for 48 h with siRNAs against KMO 󸀠 󸀠 tetrahydrochloride (DAB) (BioGenex), which was used as (Forward 5 -CCAAGGUAUUCCCAUGAGATT-3 ,reverse 󸀠 󸀠 a substrate to visualize protein signals for 1 min and then 5 -UCUCAUGGGAAUACCUUGGTT-3 ;scramble siRNA 󸀠 󸀠 stained with Mayer’s hematoxylin (Sigma-Aldrich) for 30 s. duplex:forward:5 -UUCUCCGAACGUGUCACGUTT-3 ; 󸀠 󸀠 The sections were washed with distilled water for 10 min reverse: 5 -ACGUGACACGUUCGGAGAATT-3 ). The cell and then dried at room temperature. After dehydration, the viability of the cells was quantiefi d using WST-1 and cell slides were mounted by water-soluble glycerol gelation and extracts were analyzed by KMO immunoblotting. examined under a bright-eld fi microscope (Olympus). All of the immunohistochemical slides were examined by .. Western Immunoblotting. The sample (30 𝜇 gofpro- a veterinary pathologist who did not have the patients’ clinical information. A total of 5 random efi lds were chosen from tein/lane) was subjected to SDS-PAGE and blotted from 12% (w/v) polyacrylamide gel to a hydrophobic polyvinyli- tumor regions to evaluate the expression of each protein. The dene difluoride (PVDF) membrane for WB analysis. Aeft r IHC staining of the samples was evaluated by a gynecological blocking the PVDF membrane in PBS, 0.05% Tween 20 histopathologist using the immunoreactive scoring (IRS) (PBST) plus 5% skim milk for 2h, themembranewas then system as described previously [44]; the system is used to rank the protein expressions and the value that equals the sequentially incubated with the anti-human KMO polyclonal antibody (1:2000) (Proteintech) for 2h, and horseradish per- staining intensity multiplied by the percentage of positive oxidase conjugated anti-rabbit IgG (A9169, Sigma-Aldrich) cells [45]. Grading was performed in a blinded fashion. Samples were interpreted as COX-2-positive if the IRS was for 1 h at room temperature. Finally, the membrane was washed extensively with PBST and developed with a chemi- ≥4. The standard IRS scores are shown in Table 2. The level of luminescent peroxidase substrate (Sigma-Aldrich). KMO protein was examined under high-power microscopic fields (HPFs, 400 ×) and scored by the IRS system. The standard for staining intensity is shown in Figure 3. .. Statistical Analysis. Comparisons of mean values were performed using independent two-sample t tests with SPSS .. Assays for Verifying KMO Biofunctions. Canine CMT 16.0 statistics software. The associations between the variables cell lines CMT-1 and MPG were kindly provided by Dr. of the categorical factors, including clinical outcomes and the 4 Journal of Oncology ∗∗∗ ∗∗∗ 0.25 0.25 0.20 0.20 0.15 0.15 0.10 0.10 0.05 0.05 0.00 0.00 (a) (b) Figure 1: Comparison of the KMO gene expression in CMTs. (a) KMO gene expression in benign (n = 30) and malignant CMT tissues (n = 54). (b) KMO gene expression in canine malignant CMTs at stages I/II/III (n =37) andstagesIV/V(n =17).(∗∗∗P< 0.0001). 0.45 0.6 0.40 0.5 0.35 0.30 0.4 0.25 0.3 0.20 0.15 0.2 0.10 0.1 0.05 0.00 0.0 (a) (b) Figure 2: Expression level of the IDO gene in CMTs. (a) IDO gene expression in benign and malignant CMT tissues. (b) IDO gene expression in canine malignant CMTs at stages I/II/III and stages IV/V. expression of proteins, were calculated by Spearman’s corre- KMO gene expression discriminated dogs with malignant lation coefficient. The significance of the difference between CMTs from dogs with benign CMTs and indicated that the the variables of the categorical factors was determined using expression level of the KMO gene may provide valuable information for the diagnosis of malignancy and metastasis atwo-tailed 𝜒 test. The Kaplan–Meier method was used in canine CMTs. to estimate the survival durations through the follow-up period. .. e Correlation between the Expressions of KMO and Indoleamine-,-Dioxygenase Genes in CMTs. Indoleamine- 3. Results 2,3-dioxygenase (IDO) is located upstream of KMO in the .. KMO Gene Expression and Tumor Malignancy. KMO kynurenine pathway [46]. We therefore sought to clarify gene expression in clinical CMT specimens was rfi st iden- whether the overexpression of KMO was related to the IDO expression. The results showed that there was no significant tified in 84 cases using real-time PCR. Interestingly, signifi- cantly higher expressions of KMO (p< 0.0001) were observed difference in IDO expression between malignant and benign in malignant CMTs than in benign CMTs (Figure 1(a)). In CMTs or between CMTs with or without metastasis (Figures addition, the KMO gene (p < 0.0001) was overexpressed 2(a) and 2(b)). These findings indicated that KMO overex- in stage VI/V CMTs (Figure 1(b)). The data showed that pression was not IDO-dependent in CMTs. Benign Malignant Benign Stage I/II/III Stage IV/V Malignant Stage I/II/III Stage IV/V Relative fold change of IDO Relative fold change of KMO Relative fold change of KMO Relative fold change of IDO Journal of Oncology 5 (a) (b) (c) (d) Figure 3: Immunohistochemical analysis of KMO protein expression in CMTs. (a) CMT stained without antibody against KMO as a negative control, which did not show immunoreactivity in the cytoplasm. (b) CMT with weak KMO cytoplasmic staining (1+). (c) CMT with moderate KMO cytoplasmic staining (2+). (d) CMT with strong KMO cytoplasmic staining (3+). Scale bar = 50.00𝜇 m. .. e Correlation between KMO Protein Expression and ∗∗∗ CMT Malignancy. To further determine the association between KMO and tumor progression, KMO expression in CMTs was analyzed by immunohistochemistry and scored by immunoreactive scoring (IRS) under the conditions listed in Table 1: Primers for canine IDO, KMO,actin, and HPRT. Table 2 shows that the standards for scoring KMO pro- tein are shown in Figure 3. According to the IRS, KMO expression could be classified into three groups. us, Th tumors were identified as KMO negative (IRS 0-3), weak (IRS 4- 2 6), and strong (IRS 7-9). Further analysis showed that the level of KMO expression was significantly associated with N=44 ovariohysterectomy (OHE) status; 21/39 (53%) patients with a strong KMO expression had OHE prior to the surgery to remove tumors (p< 0.05). The level of KMO expression was also significantly associated with tumor malignancy, tumor size, and tumor recurrence. In total, of 39 CMTs with a strong KMO expression, 27/39 (69%) tumors were malignant Figure 4: Correlation between KMO IRS and pathologic malignancy (p < 0.001). The correlations between the level of KMO in CMTs. The expression of the KMO protein was analyzed by expression and the characteristics of the patients with CMTs immunohistochemistry and scored by immunoreactive score (IRS). are summarized in Table 3. Moreover, as shown in Figure 4, KMO IRS showed a statistically significant association with tumor KMO IRS in malignant CMTs was significantly higher than malignancy (P< 0.05). KMO IRS in malignant CMTs was signifi- that in benign CMTs (p< 0.001). These results suggested that cantly higher than that in benign CMTs (∗∗∗P< 0.001). Benign cMGT Malignant cMGT KMO IRS Score 6 Journal of Oncology Table 3: Characteristics of the patients correlated with expression of KMO protein. Characteristics KMO P value Negative 0-3 Weak 4-6 Strong 7-9 All patients 6/ 86 (7%) 41/86 (48%) 39/86 (45%) Age <9 years 4/6 (67%) 12/41 (29%) 6/39 (15%) ≥ 9 years 2/6 (33%) 29/41 (71%) 33/39 (85%) 0.271 Tumor size ≤ 5 cm maximum diameter 4/6 (67%) 31/41 (76%) 25/39 (64%) > 5 cm maximum diameter 2/6 (33%) 10/41 (24%) 14/39 (36%) .  ∗ Ovariohysterectomy status No 5/6 (100%) 37/41 (90%) 18/39 (47%) . ∗ Yes 1/6 (0%) 4/41 (10%) 21/39 (53%) Malignancy Benign 6/6 (100%) 31/41 (76%) 12/39 (31%) Malignant 0/6 (0%) 10/41 (24%) 27/39 (69%) . ∗∗ Tumor stage (N=) I, II and III --- 3/10 (30%) 11/27 (41%) IV and V --- 7/10 (70%) 16/27 (59%) . ∗ Lymph node metastasis No --- 7/10 (70%) 16/27 (59%) 0.208 Yes --- 3/10 (30%) 11/27 (41%) Distant metastasis No --- 8/10 (80%) 24/27 (89%) 0.951 Yes --- 2/10 (20%) 3/27 (11%) Recurrence No 6/6 (100%) 19/41 (46%) 9/27 (33%) Yes 0/6 (0%) 22/41 (54%) 18/27 (67%) . ∗ ∗P< 0.05;∗∗P< 0.01. ∗∗∗ P= 0.0001 the KMO level can be used to discriminate malignant CMTs from benign tumors. .. e Association between KMO Expression and the Sur- vival Time in CMT Patients. Because tumor malignancy determines the survival outcome of cancer patients, we next evaluated the association between KMO expression and the overall survival rate of dogs with CMTs. The KMO expression could be classified into three groups according to the IRS. 0 20 40 60 80 The Kaplan–Meier survival curves showed that patients with Months aer sur ft gery strong KMO-expressing tumors had a significantly shorter KMO negative or weak (N=24) survival time and a remarkably lower survival rate than those with negative or weak KMO-expressing tumors (p< KMO strong (N=19) 0.001) (Figure 5). Taken together, the results shown here were Figure 5: Association between KMO expression and survival time similar to the prole fi of the kmo gene, demonstrating that of CMT patients. Patients with KMO strong staining tumors had a KMO is a potential biomarker for predicting the prognosis significantly shorter survival time and a remarkably lower survival of CMT dogs. rate than those with KMO negative or weak tumors (∗∗∗P< 0.001). .. e Role of KMO in the Proliferation of CMT Cells. High KMO expression was proved to be associated with the malignancy of CMT and indicated a poor outcome of the identifiable KMO protein amounts (Figure 6(a)). Incubation patients. The role of KMO in CMT development was next of CMT-1 and MPG cells with a KMO inhibitor (Ro 61- verified. We first examined the KMO expression in CMT 8048) for 1∼3 days significantly inhibited cell proliferation cell lines (CMT-1 and MPG cells) and found that both had (Figure 6(b)), and similar results were also observed when Overall survival rates Journal of Oncology 7 CMT-1 MPG KMO -actin (a) 120 120 CMT-1 MPG 100 100 80 80 60 60 40 40 20 20 0 0 0 M 5 M 10 M 20 M 50 M 0 M 5 M 10 M 20 M 50 M Ro 61-8048 Concentration Ro 61-8048 Concentration 24 hr 24 hr 48 hr 48 hr 72 hr 72 hr (b) 80 ∗∗ ∗∗ CMT-1 MPG Negative siRNA KMO siRNA Negative KMO Negative KMO siRNA siRNA siRNA siRNA KMO KMO -actin -actin (c) Figure 6: Downregulated KMO activities with KMO inhibitor or siRNA inhibited cell proliferation in CMT cells. (a) KMO expression in CMT-1 and MPG cells. (b) Cells treated with Ro 61-8048 for 24, 48, and 72 hrs were found to exhibit significantly suppressed cell proliferation of CMT-1 and MPG cells. (c) Knockdown of KMO with siRNA reduced cell proliferation in comparison to cells with control siRNA treatment. Columns,mean; bars,SD (n =3).∗∗P< 0.01. Cell Viability (%) Cell Viability (%) Cell Viability (%) 8 Journal of Oncology silencing KMO expression with specific siRNAs against KMO mammary gland tumor. The different cell origins of CMT- (Figure 6(c)). The data suggested that KMO might play an 1 and MPG may have relied on differently growth signal important role in CMT cell growth. pathways and therefore have different sensitivities to KMO knockdown. KMO has been reported to play a role as an agonist for the N-methyl-D-aspartic acid (NMDA) receptor [56]. NMDA receptors are known to initiate gene activa- 4. Discussion tion and cell proliferation and promote cell survival via CMT is the most frequently diagnosed type of cancer in the extracellular signal-regulated kinase (ERK1/2) pathways [57]. Recently, a report showed that NMDA receptors were female dogs [47, 48], and approximately halfofCMTs are malignant [49]. Surgical excision is the most effective overexpressed in human breast cancer cell lines [58]. Another treatment for CMT, but dogs with CMT have around a 30- metabolite of kynurenine produced by the action of KMO, 3-hydroxyanthranilic acid, causes apoptosis of Th1 cells 58% recurrence or metastasis rate within 2 years following surgical removal [49, 50], and about 40-60% die from cancer- by activating caspase-8 [59] and induces apoptosis of T- related diseases within the first 2 years [51]. The low survival cells through the inhibition of NF-𝜅 B[60]. Taken together, rate of patients implies a low rate of specific diagnoses although the detailed mechanisms still need to be fully and ineffective therapies in CMT treatment. Challenges of elucidated, our results have offered significant evidences of involvement of KMO in CMT progression and provided CMT treatment include complex histological classification as well as unpredictable tumor behavior and prognosis [52]. precious advice for further study on human breast cancer Therefore, it is necessary to improve the accuracy of diagnosis therapy. to facilitate the determination of appropriate therapies. Herein, we identified KMO as a novel and potential 5. Conclusions biomarker in CMT, which can help to improve diagnosis and predict the prognosis of CMTs. Our results showed that 31.8% A significant parallel increase of KMO mRNA and protein of the total CMTs and 73.7% of the malignant CMTs had expression in malignant CMT was revealed and correlated strong expressions of KMO protein (Table 3). This indicated with shorter survival time in CMT patients. Our results that the expression of KMO protein issignificantly associated also showed that KMO plays a role in controlling cell with tumor malignancy and demonstrated the potential of growth and malignancy in canine mammary tumors. These KMO in discriminating malignant tumors from benign ones. findings indicate the potential applications of KMO in cancer Furthermore, the survival rate of patients with a strong prognosis and therapeutic developments. KMO protein expression was lower than that of those with weak or negative KMO expression. This result suggested that Data Availability KMO could be a promising biomarker not only for tumor malignancy but also for predicting the prognosis of CMT The data used to support the findings of this study are patients. available from the corresponding author upon request. KMO is involved in the metabolism of tryptophan and catalyzes the conversion of kynurenine into 3-HK and 3- hydroxyanthranilic acid, which are further converted into Disclosure quinolinic acid, generating NAD for essential cell survival [53]. The kynurenine pathway involves physiological and The results shown here have been patented in the United pathological processes in the nervous and immune systems. States with the Patent no. US204110275081 A1. KMO is notable because it has been proven to be a potential therapeutic target for stroke, seizures, and Huntington’s Conflicts of Interest disease [54]. IDO is located upstream of KMO in the kynurenine pathway [43]. The potential association between The authors declare that they have no conflicts of interest. IDO expression and cancer has been intensively studied [55]; however, their relationship is still ambiguous and sometimes controversial. Reports have shown that IDO overexpression Acknowledgments in human tumors is related to tumor growth, but other This study was supported by the National Science Council of reports have suggested that IDO expression in tumor cells Taiwan (NSC 102-2313-B-002-031-MY3). and antigen-presenting cells inhibits tumor proliferation [55]. In our results, KMO overexpression was independent of IDO expression in CMTs, suggesting that KMO might induce References tumor malignancy via a novel mechanism not involving IDO. We also demonstrated that knockdown of KMO expres- [1] M. Paoloni and C. Khanna, “Translation of new cancer treat- sion or blocking of its activity could suppress proliferation of ments from pet dogs to humans,” Nature Reviews Cancer,vol.8, no. 2, pp. 147–156, 2008. CMT cells. Herein, we found that though CMT-1 and MPG are both cell lines of canine mammary gland tumors, CMT- [2] M. M. Hoffman and E. Birney, “Estimating the neutral rate of 1 is developed from canine mammary carcinoma (epithelial nucleotide substitution using introns,” Molecular Biology and cell origin) while MPG is derived from the canine mixed Evolution,vol.24,no.2, pp. 522–531, 2007. Journal of Oncology 9 [3] P. J.Rivera, M.Melin,T.Biagi et al.,“Mammary tumor [17] W. Toniti, S. Buranasinsup, A. Kongcharoen, P. Charoonrut, P. development in dogs is associated with BRCA1 and BRCA2,” Puchadapirom, and C. Kasorndorkbua, “Immunohistochemi- Cancer Research,vol. 69, no.22, pp. 8770–8774,2009. cal determination of estrogen and progesterone receptors in canine mammary tumors,” Asian Pacific Journal of Cancer [4] J. Peto, N. Collins, R. Barfoot et al., “Prevalence of BRCA1 Prevention,vol. 10, no.5,pp.907–912, 2009. and BRCA2 gene mutations in patients with early-onset breast [18] F. Sassi,C.Benazzi,G. Castellani, and G. Sarli,“Molecular- cancer,” Journal of the National Cancer Institute, vol. 91, no. 11, based tumour subtypes of canine mammary carcinomas pp. 943–949, 1999. assessed by immunohistochemistry,” BMC Veterinary Research, [5] L.Sun,J.Liu,S. Wang,Y. Chen,andZ.Li,“Prevalenceof BRCA1 vol. 6, p. 5, 2010. gene mutation in breast cancer patients in Guangxi, China,” [19] R. Simon, A. Nocito, T. Hubs ¨ cher et al., “Patterns of HER-2/neu International Journal of Clinical and Experimental Pathology, amplification and overexpression in primary and metastatic vol.7,no.9,pp. 6262–6269, 2014. breast cancer,” Journal of the National Cancer Institute,vol. 93, [6] F.C.F.Calboli, J. Sampson, N.Fretwell, and D.J. Balding, no. 15, pp.1141–1146,2001. “Population structure and inbreeding from pedigree analysis of [20] D. J.Slamon,G.M. Clark,S.G.Wong,W.J. Levin, A. purebred dogs,” Genetics,vol.179,no. 1, pp.593–601, 2008. Ullrich, and W. L. McGuire, “Human breast cancer: correlation [7] R.Klopfleisch,H.vonEuler,G. Sarli, S.S.Pinho,F. G¨artner, and of relapse and survival with amplification of the HER-2/neu A. D. Gruber, “Molecular carcinogenesis of canine mammary oncogene,” Science,vol.235, no. 4785,pp.182–191, 1987. tumors: news from an old disease,” Veterinary Pathology,vol. [21] I. L. Andrulis, S. B. Bull, M. E. Blackstein et al., “Neu/erbB- 48, no. 1, pp. 98–116, 2011. 2 amplification identifies a poor-prognosis group of women [8] D. Kanojia, M. Garg, S. Gupta, A. Gupta, and A. Suri, “Sperm- with node-negative breast cancer. Toronto breast cancer study associated antigen 9, a novel biomarker for early detection of group,” Journal of Clinical Oncology,vol.16,no.4,pp.1340–1349, breast cancer,” Cancer Epidemiology, Biomarkers & Prevention, 1998. vol. 18,no. 2, pp. 630–639,2009. [22] R. E. Roses, E. C. Paulson, A. Sharma et al., “HER-2/neu overexpression as a predictor for the transition from in situ [9] J.S. Ross, E. A.Slodkowska, W.F.Symmans, L. Pusztai, P. to invasive breast cancer,” Cancer Epidemiology Biomarkers & M. Ravdin, and G. N. Hortobagyi, “The HER-2 receptor and Prevention,vol. 18,no. 5,pp. 1386–1389, 2009. breast cancer: Ten years of targeted anti-HER-2 therapy and personalized medicine,” e Oncologist, vol. 14, no.4,pp. 320– [23] S. Chia, B. Norris, C. Speers et al., “Human epidermal growth 368, 2009. factor receptor 2 overexpression as a prognostic factor in a large tissue microarray series of node-negative breast cancers,” [10] P. Prihantono,M.Hatta,C.Binekadaetal.,“Ki-67expression by Journal of Clinical Oncology,vol.26,no.35,pp.5697–5704,2008. immunohistochemistry and quantitative real-time polymerase [24] F. R´evillion, J. Bonneterre, and J. P. Peyrat, “ERBB2 oncogene chain reaction as predictor of clinical response to neoadjuvant in human breast cancer and its clinical significance,” European chemotherapy in locally advanced breast cancer,” Journal of Journal of Cancer, vol.34, no.6,pp.791–808, 1998. Oncology,vol. 2017, Article ID 6209849,8 pages, 2017. [25] R.Seshadri,F. A.Firgaira, D.J. Horsfall,K.McCaul, V. Setlur, [11] L.K.Dunnwald,M.A.Rossing,andC.I. Li,“Hormonereceptor and P. Kitchen, “Clinical significance of HER-2/neu oncogene status, tumor characteristics, and prognosis: a prospective amplification in primary breast cancer. the south australian cohort of breast cancer patients,” Breast Cancer Research,vol. breast cancer study group,” Journal of Clinical Oncology, vol. 11, 9, no. 1,article R6,2007. no. 10, pp. 1936–1942, 1993. [12] J. Mart´ın De Las Mulas, Y. Milla´n,and R.Dios,“A prospective [26] H. Tsuda, S. Hirohashi, Y. Shimosato et al., “Correlation analysis of immunohistochemically determined estrogen recep- between histologic grade of malignancy and copy number of c- tor𝛼 and progesterone receptor expression and host and tumor erbb-2 gene in breast carcinoma. a retrospective analysis of 176 factors as predictors of disease-free period in mammary tumors cases,” Cancer,vol.65, no. 8, pp.1794–1800,1990. of the dog,” Veterinary Pathology, vol. 42, no. 2, pp. 200–212, [27] A. P. Dutra, N. V. M. Granja, F. C. Schmitt, and G. D. Cassali, “c-erbB-2 expression and nuclear pleomorphism in canine [13] A. Nieto, L. Pen˜a,M.D.Per´ ez-Alenza, M. A. S´anchez,J.M. mammary tumors,” Brazilian Journal of Medical and Biological Flores, and M. Castano ˜ , “Immunohistologic detection of estro- Research, vol. 37, no. 11, pp. 1673–1681, 2004. gen receptor alpha in canine mammary tumors: clinical and [28] A. Gama,A.Alves,and F. Schmitt,“Identification of molecu- pathologic associations and prognostic significance,” Veterinary lar phenotypes in canine mammary carcinomas with clinical Pathology, vol.37,no. 3,pp.239–247,2000. implications: application of the human classification,” Virchows [14] C.-C. Chang, M.-H. Tsai, J.-W. Liao, J. P.-W. Chan, M.-L. Wong, Archiv, vol.453,no. 2,pp. 123–132, 2008. and S.-C. Chang, “Evaluation of hormone receptor expression [29] W.-L. Hsu, H.-M. Huang, J.-W. Liao, M.-L. Wong, and S.-C. for use in predicting survival of female dogs with malignant Chang, “Increased survival in dogs with malignant mammary mammary gland tumors,” Journal of the American Veterinary tumours overexpressing HER-2 protein and detection of a silent Medical Association,vol.235, no. 4, pp.391–396, 2009. single nucleotide polymorphism in the canine HER-2 gene,” [15] E. A.Sartin, S.Barnes,R.P.Kwapien,andL.G.Wolfe,“Estrogen Veterinary Journal, vol. 180, no. 1, pp. 116–123, 2009. and progesterone receptor status of mammary carcinomas and [30] S. Mukaratirwa, “Prognostic and predictive markers in canine correlation with clinical outcome in dogs,” American Journal of tumours: rationale and relevance. a review,” Veterinary Quar- Veterinary Research, vol.53,no.11,pp.2196–2200, 1992. terly,vol.27,no.2, pp. 52–64, 2005. [31] T.Tanaka,T. Shimada,H. Akiyoshi etal.,“Relationship between [16] A. Bergamaschi, E. Tagliabue, T. Sørlie et al., “Extracellular matrix signature identifies breast cancer subgroups with differ- major histocompatibility complex class I expression and prog- nosis in canine mammary gland tumors,” Journal of Veterinary ent clinical outcome,” e Journal of Pathology, vol.214,no. 3, pp. 357–367, 2008. Medical Science,vol.75,no. 10,pp.1393–1398, 2013. 10 Journal of Oncology [32] M. Furuya, M. Funasaki, H. Tani, and K. Sasai, “Identification on life-span observations in Beagles,” Veterinary Pathology,vol. of novel tumour-associated antigens in canine mammary gland 36, no. 5, pp. 423–436, 1999. tumour,” Veterinary and Comparative Oncology,vol.13,no.3, ¨ [48] A. Egenvall, B. N. Bonnett, P. Ohagen, P. Olson, A. Hedhammar, pp. 194–202, 2015. and H. Von Euler, “Incidence of and survival after mammary [33] M.F. Beal, R.J.Ferrante, K.J.Swartz,and N.W.Kowall, tumors in a population of over 80,000 insured female dogs in “Chronic quinolinic acid lesions in rats closely resemble Hunt- Sweden from 1995 to 2002,” Preventive Veterinary Medicine,vol. ington’s disease,” e Journal of Neuroscience, vol.11, no.6,pp. 69,no.1-2,pp.109–127,2005. 1649–1659, 1991. [49] E. G. MacEwen, “Spontaneous tumors in dogs and cats: models [34] N.Braidy,R.Grant,S.Adams, B. J. Brew, and G.J. Guillemin, for the study of cancer biology and treatment,” Cancer and Metastasis Reviews,vol.9, no. 2,pp.125–136,1990. “Mechanism for quinolinic acid cytotoxicity in human astro- cytes and neurons,” Neurotoxicity Research,vol. 16, no.1, pp. 77– [50] N. Stratmann, K. Failing, A. Richter, and A. Wehrend, “Mam- 86, 2009. mary tumor recurrence in bitches aer ft regional mastectomy,” [35] P. Guidetti, G. P. Bates, R. K. Graham et al., “Elevated brain Veterinary Surgery, vol.37, no. 1,pp. 82–86, 2008. 3-hydroxykynurenine and quinolinate levels in Huntington [51] S.-C. Chang, C.-C. Chang, T.-J. Chang, and M.-L. Wong, “Prog- disease mice,” Neurobiology of Disease,vol.23, no. 1,pp.190– nostic factors associated with survival two years aeft r surgery in 197, 2006. dogs with malignant mammary tumors: 79 cases (1998-2002),” [36] S. J. Pearson and G. P. Reynolds, “Increased brain concentra- Journal of the American Veterinary Medical Association, vol. 227, no.10, pp. 1625–1629,2005. tions of a neurotoxin, 3-hydroxykynurenine, in Huntington’s disease,” Neuroscience Letters, vol.144,no.1-2,pp. 199–201,1992. [52] D.A.P.C.Zuccari,A.E. Santana, P.M.Cury,and J.A.Cordeiro, “Immunocytochemicalstudy of Ki-67 as a prognostic marker in [37] M. A. eTh vandavakkam, R. Schwarcz, P. J. Muchowski, and F. Giorgini, “Targeting kynurenine 3-monooxygenase (kmo): canine mammary neoplasia,” Veterinary Clinical Pathology,vol. 33, no.1,pp.23–28,2004. Implications for therapy in huntington’s disease,” CNS and Neurological Disorders - Drug Targets, vol.9, no. 6, pp.791–800, [53] K. K. Ting, B. Brew, and G. Guillemin, “eTh involvement of astrocytes and kynurenine pathway in Alzheimer’s disease,” [38] H. Jin, Y. Zhang, H. You et al., “Prognostic significance Neurotoxicity Research, vol. 12, no. 4, pp. 247–262, 2007. of kynurenine 3-monooxygenase and effects on prolifera- [54] K. R. Crozier-Reabe, R. S. Phillips, and G. R. Moran, “Kyn- tion,migration, and invasion of human hepatocellular carci- urenine 3-monooxygenase from Pseudomonas uo fl rescens: noma,” Scientific Reports,vol. 5,ArticleID 10466, pp.1–12,2015. substrate-like inhibitors both stimulate flavin reduction and stabilize the flavin-peroxo intermediate yet result in the pro- [39] P. Terness, T. M. Bauer, L. Ros ¨ e et al., “Inhibition of allogeneic T duction of hydrogen peroxide,” Biochemistry, vol.47,no.47,pp. cell proliferation by indoleamine 2,3-dioxygenase–expressing 12420–12433, 2008. dendritic cells: mediation of suppression by tryptophan metabolites,” e Journal of Experimental Medicine,vol. 196, [55] S. Lob ¨ , A. Konigs ¨ rainer, H.-G. Rammensee, G. Opelz, and P. no.4,pp.447–457, 2002. Terness, “Inhibitors of indoleamine-2,3-dioxygenase for cancer therapy: can we see the wood for the trees?” Nature Reviews [40] Y. Mand ´ i and L. Vecsei, ´ “eTh kynurenine system and Cancer,vol.9, no. 6,pp.445–452, 2009. immunoregulation,” Journal of Neural Transmission,vol. 119, no. 2,pp.197–209,2012. [56] J. Urenjak and T. P. Obrenovitch, “Kynurenine 3-hydroxylase inhibition in rats: Eeff cts on extracellular kynurenic acid con- [41] L. N. Owen, TNM Classification of Tumours in Domestic centration and N-methyl-D-aspartate-induced depolarisation Animals, World Health Organization, Geneva, Switzerland, 1st in the striatum,” Journal of Neurochemistry, vol.75,no. 6,pp. edition, 1980. 2427–2433, 2000. [42] B. Etschmann, B. Wilcken, K. Stoevesand, A. Von Der Schu- [57] J. A. Kemp and R. M. McKernan, “NMDA receptor pathways as lenburg, and A. Sterner-Kock, “Selection of reference genes for drug targets,” Nature Neuroscience, vol.5,pp.1039–1042, 2002. quantitative real-time PCR analysis in canine mammary tumors using the GeNorm algorithm,” Veterinary Pathology,vol. 43, no. [58] W. G.North,G.Gao,V. A. Memoli,R.H.Pang, and L.Lynch, 6, pp. 934–942, 2006. “Breast cancer expresses functional NMDA receptors,” Breast Cancer Research and Treatment,vol.122,no.2,pp.307–314,2010. [43] H.-C. Chiang, A. T.-C. Liao, T.-R. Jan et al., “Gene-expression profiling to identify genes related to spontaneous tumor regres- [59] F. Fallarino, U. Grohmann, C. Vacca et al., “T cell apoptosis by sion in a canine cancer model,” Veterinary Immunology and tryptophan catabolism,” Cell Death & Differentiation, vol.9,no. Immunopathology, vol.151,no. 3-4,pp.207–216, 2013. 10, pp. 1069–1077, 2002. [44] W. Remmele and H. E. Stegner, “Recommendation for uniform [60] T. Hayashi, J.-H. Mo, X. Gong et al., “3-Hydroxyanthranilic definition of an immunoreactive score (IRS) for immunohisto- acid inhibits PDK1 activation and suppresses experimental chemical estrogen receptor detection (ER-ICA) in breast cancer asthma by inducing T cell apoptosis,” Proceedings of the National tissue,” Der Pathologe,vol. 8,no. 3, pp.138–140, 1987. Acadamy of Sciences of the United States of America, vol.104,no. 47, pp. 18619–18624, 2007. [45] C.-C. Wu, R.-Y. Shyu, J.-M. Chou et al., “RARRES1 expression is significantly related to tumour differentiation and staging in colorectal adenocarcinoma,” European Journal of Cancer,vol. 42, no. 4, pp. 557–565, 2006. [46] J.R. Moeff tt and M.A.Namboodiri,“Tryptophan and the immune response,” Immunology & Cell Biology, vol.81, no.4, pp. 247–265, 2003. [47] S. A. Benjamin,A. C.Lee,and W.J.Saunders,“Classification and behavior of canine mammary epithelial neoplasms based MEDIATORS of INFLAMMATION The Scientific Gastroenterology Journal of World Journal Research and Practice Diabetes Research Disease Markers Hindawi Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 International Journal of Journal of Immunology Research Endocrinology Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com BioMed PPAR Research Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Journal of Obesity Evidence-Based Journal of Journal of Stem Cells Complementary and Ophthalmology International Alternative Medicine Oncology Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2013 Parkinson’s Disease Computational and Behavioural Mathematical Methods AIDS Oxidative Medicine and in Medicine Neurology Research and Treatment Cellular Longevity Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Journal

Journal of Oncology – Hindawi Publishing Corporation

Published: May 2, 2019

There are no references for this article.