Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/hindawi-publishing-corporation/role-of-the-exosome-secretion-machinery-in-ovarian-carcinoma-in-vitro-DoUVqzPUDv
References
References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.
- Publisher
- Hindawi Publishing Corporation
- Copyright
- Copyright © 2020 Esther Channah Broner et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
- ISSN
- 1687-8450
- eISSN
- 1687-8469
- DOI
- 10.1155/2020/4291827
- Publisher site
- See Article on Publisher Site
Abstract
Hindawi Journal of Oncology Volume 2020, Article ID 4291827, 11 pages https://doi.org/10.1155/2020/4291827 Research Article Role of the Exosome Secretion Machinery in Ovarian Carcinoma: In Vitro and In Vivo Models 1 1 2 3,4 Esther Channah Broner, Hadil Onallah, Tali Tavor Re’em, Ben Davidson , and Reuven Reich Institute of Drug Research, School of Pharmacy, Faculty of Medicine, e Hebrew University of Jerusalem, Jerusalem 91120, Israel Department of Pharmaceutical Engineering, Azrieli College of Engineering, Jerusalem, Israel Department of Pathology, Oslo University Hospital, Norwegian Radium Hospital, Oslo N-0310, Norway University of Oslo, Faculty of Medicine, Institute of Clinical Medicine, Oslo N-0316, Norway Correspondence should be addressed to Ben Davidson; bend@medisin.uio.no and Reuven Reich; reuvenr@ekmd.huji.ac.il Received 6 October 2019; Revised 3 March 2020; Accepted 15 April 2020; Published 30 May 2020 Academic Editor: Vincenzo Coppola Copyright © 2020 Esther Channah Broner et al. ,is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Objective. We recently reported on the expression and clinical role of molecules that mediate exosome secretion in high-grade serous carcinoma. In the present study, the biological role of these molecules was analyzed. Methods. OVCAR8 and ES-2 ovarian carcinoma cells were studied using a combination of CRISPR/Cas9 technology and two 3D in vitro models—spheroids emulating effusions and alginate scaffolds representing solid lesions. Isolation of exosomes was validated by electron microscopy. TSAP6, NSMASE2, RAB27A, and RAB27B mRNA and protein levels were analyzed using qRT-PCR and Western blotting, respectively. Tumor aggressiveness was studied in vitro using scratch assay, invasion assay, and matrix metalloproteinase (MMP) activity assay and in vivo using a mouse model. Results. In OVCAR8 cells, mRNA expression of TSAP6 and RAB27A was significantly higher in spheroids compared to scaffolds, whereas the opposite was true for NSMASE2 mRNA. In ES-2 cells, TSAP6 and RAB27B mRNA expression was significantly higher in spheroids versus scaffolds. In addition, nSMase2 and TSAP6 protein expression was significantly higher in scaffolds compared to spheroids. CRISPR-edited cells with silencing of NSMASE2, TSAP6, and RAB27A/B had reduced migration, invasion, and MMP activity. Additionally, knockout (KO) of these molecules resulted in significantly diminished exosome secretion. In vivo assay showed that when injected to mice, OVCAR8 RAB27A/B KO cells, as opposed to control OVCAR8 cells, did not form ascites or visible tumor lesions and had reduced MMP expression. Conclusion. ,e present study provides evidence that different models for culturing ovarian carcinoma cells affect the expression of molecules mediating exosome secretion and that these molecules have a tumor-promoting role. Silencing these molecules may consequently have therapeutic relevance in this cancer. dismal for the majority of patients, particularly when the 1. Introduction disease is diagnosed at advanced stage [3]. Ovarian cancer, the most aggressive gynecologic cancer, was Exosomes are endogenous nanovesicles, 30–120 nm in predicted to be diagnosed in 22,530 women and led to 13,980 diameter, that are secreted from cells and are found in bodily fatalities in the USA in 2019 [1]. Global figures for 2018 are fluids including plasma [4], urine [5], saliva [6], breast milk 295,414 new cases and 184,799 deaths, making this cancer [7], semen [8], and effusions [9, 10]. ,ese nanovesicles th th the 8 most common and 8 most lethal cancer in women contain bioactive molecules including lipids, proteins, DNA, [2]. While novel targeted therapies, such as PARP inhibitors, mRNA, miRs, and long noncoding RNA [11, 12]. have extended the survival of patients carrying mutations in Exosomes derived from tumor cells have been shown to BRCA and related DNA repair genes, prognosis remains have cancer-promoting effects, including increased motility 2 Journal of Oncology through extracellular matrix (ECM) [13], increased degra- 2.2. Exosome Extraction and Quantitation. 4 ×10 cells were dation of ECM [14], and invasiveness [15]. Cancer-derived seeded in 100 mm dishes and incubated overnight with exosomes can also coerce surrounding cells to contribute to supplemented medium of RPMI 5% FCS. On the next day, their cancer microenvironment: tumor exosomes can the medium was replaced with serum-free medium transform surrounding fibroblasts into cancer-associated (EXCELL advanced CHO; Sigma-Aldrich, St. Louis MO) fibroblasts. Exosomes can also cause increased vascular and cells were incubated for further 48 hours. ,e medium permeability [16], contributing to the metastatic capability of was collected and filtered with Amicon Ultra-15 Centrifugal the tumor, as well as condition premetastatic tumor niches at 0.1μM PVDF Filter Units (Merck Millipore Ltd). Next, the various distant anatomic sites [17, 18]. medium was concentrated with 3000 MWCO vivaspin 20 A previous study by our group reported on anatomic (Sartorius, Gottingen, ¨ Germany). Exosomes were extracted site-dependent expression of components of exosomes se- from the supernatant according to the user’s manual of cretion machinery, i.e. neutral sphingomyelinase2 ExoQuick-TC (System Biosciences, Mountain View CA). (nSMase2), Tumor suppressor-activated pathway 6 ,e resulting pellet containing exosomes was resuspended in (TSAP6), Ras-related protein 27A/B (Rab27a/b) and ADP- 100μl of PBS and quantified for protein concentration by ribosylation factor 6 (ARF6) in high-grade serous carcinoma Bradford assay. Exosomes were detected and quantified (HGSC), the most common and clinically aggressive his- using the qNano Gold analyzer (IZON Science Ltd., tologic type of ovarian carcinoma (OC). TSAP6 and RAB27a Christchurch, New Zealand). levels in effusion specimens were additionally significantly related to overall survival [19]. 2.3. Electron Microscopy (EM). Exosomes extracted from all Another previous study by our group, focusing on Ezrin genotypes examined were negatively stained with Sodium expression in OC, suggested that tumor growth in a spheroid phosphotungstate (PTA) and imaged by a transmission model closely resembles tumor growth in ascites and pleural electron microscope, JEM-1400 plus, available in the Inter- effusion, whereas cells cultured on macroporous scaffold are Departmental Equipment Department at the Ein Karem a model for solid tumor growth, thereby creating an in- campus of the Hebrew University. ,is procedure was clusive three-dimensional (3D) in vitro model that emulates performed by the staff of the department according to the different anatomic sites affected by OC [20]. In the standard protocol. OVCAR8 control-derived exosomes were present study, we utilized this model together with CRISPR- diluted 1 :1000 in PBS. Cas9 Knockouts (KO) in OC cell lines. Our objective was to demonstrate that NSMASE2, TSAP6, and RAB27A/B-re- lated pathways are essential for exosome secretion in OC cell 2.4.qRT-PCR. RNA was extracted with Tri-Reagent (Sigma- lines and may consequently constitute a potential thera- Aldrich) and converted to cDNA with qScript cDNA syn- peutic target in OC. thesis kit (Quanta Biosciences, Gaithersburg MD). qPCR was performed with KAPA SYBERFAST Universal qPCR kit 2. Methods and Materials (Kapa Biosystems, Wilmington MA) on the CFX Connect Real-Time system (Bio-Rad Laboratories, Hercules CA). ,e 2.1. Cell Culture. ,e OVCAR8 and ES-2 OC cell lines were final concentrations of template and primers were deter- purchased from ATCC (Manassas VA) and cultured at 37 C, mined individually for every assay, calibrated based on a 5% CO in their appropriate medium (RPMI + 5% FCS and standard curve. Specific primer sequences were designed DMEM + 10% FCS, resp.), supplemented with 1% nones- utilizing the NCBI Primer Blast tool (Table 1). Analysis was sential amino acids, 1% L-glutamine, 1% BME vitamins, 1% performed with BioRad CFX Manager Software. ,e ΔCT of sodium pyruvate and 1% penicillin, streptomycin, and genes of interest was calculated relative to the RPLP0 amphotericin. All reagents were purchased from Biological -ΔΔCT housekeeping gene and expressed as 2 versus average Industries (Beit HaEmek, Israel). OVCAR8 and ES-2 OC primary as a control, except for TSAP6 which was analyzed spheroids were formed by constant shaking of 400,000 cells as TSAP6/RPLP0. per well in 6-well plates for 48 hours on a vertical shaker. When necessary, standard PCR was run using the above Alginate scaffolds with a diameter of 5 mm and thickness of equipment and primers with 2G FAST KAPA master mix 2 mm were prepared as high guluronic acid (LVG) alginate (Kapa Biosystems). ,e products were run with electro- (NovaMatrix FMC Biopolymers, Drammen, Norway). ,e phoresis on 1.5% agarose gel stained with ethidium bromide, macroporous structure was obtained by employing a freeze- imaged, and then analyzed by ImageJ. drying technique: alginate was dissolved in DDW (1.2% w/v solution), homogenized and cross-linked with a solution of calcium gluconate (1.2% w/v) by homogenizer apparatus. 2.5. Immunoblotting. Samples were lysed with 1% NP-40, ,e final concentration of cross-linked solution was 1.0% 20 mM Tris-HCl (pH 7.5), 137 mM NaCl, 0.5 mM EDTA, and 0.2% w/v for the polymer and cross-linker, respectively. 10% glycerol, 1% protease inhibitor cocktail (Sigma- ,e cross-linked solution was doled out into 96-well plates Aldrich), and 0.1% SDS and quantified using the Bradford (100μL/well) and then transferred to +4 C for 1 hour, assay. Twenty-five micrograms of protein was loaded on 10% subsequently to −20 C for 24 hours, and then lyophilized. SDS polyacrylamide gels, separated by electrophoresis, and 400,000 cells were seeded on each alginate scaffold and were transferred to PVDF membranes (Millipore, Billerica MA) cultured for 1-2 weeks. and blocked with 5% nonfat milk in TBST. Primary Journal of Oncology 3 Table 1: qPCR primers. ml, 10% SDS polyacrylamide gels, and separated by elec- trophoresis. ,e gels were incubated overnight at 37 C and Forward 5′-AGGACTGGCTGGCTGATTTC-3′ NSMASE2 Reverse 5′-TGTCGTCAGAGGAGCAGTTATC-3′ then washed in 2.5% triton, developed, dried, and analyzed with the ImageJ software. Forward 5′-GGGAGTTCAGCTTCGTTCAG-3′ TSAP6 Reverse 5′-TGGGAGGCAGGTAGAACTTG-3′ Forward 5′-GCTTTGGGAGACTCTGGTGTA-3′ RAB27A 2.9. Invasion Assay. Cells of all genotypes (n � 50,000) were Reverse 5′-TCAATGCCCACTGTTGTGATAA-3′ seeded on Matrigel-coated filters in Boyden chambers and 5′-TAGACTTTCGGGAAAAACGTGTG- Forward ° incubated for 6 hours at 37 C with conditioned medium RAB27B 3′ from the 3T3 fibroblast cell line, used as chemoattractant. Reverse 5′-AGAAGCTCTGTTGACTGGTGA -3′ Invading cells were stained and quantified under an invert microscope. antibodies were as follows: nSMase2 (H00055512-D01; Abnova, Taipei City, Taiwan), TSAP6 (sc-20531; Santa Cruz Biotechnology, Santa Cruz CA), Rab27A (ab55667, Abcam, 2.10. In Vivo Tumor Aggressiveness Assay. OVCAR8, Cambridge, UK), and GAPDH (14C10, Cell Signaling, RAB27A-KO, and RAB27B-KO cells (2 ×10 ) were injected Danvers MA). Band density was measured using the Image J IP into female SCID mice (n � 12; 5 controls, 4 RAB27A-KO, software, divided by the loading control (GAPDH), and 3 RAB27B-KO). Mice were monitored for 21 days, until compared to control. symptoms of OC appeared. ,e tumors were removed, fixed in formalin, and embedded in paraffin. H&E sections were assessed by an experienced surgical pathologist (BD). ,e 2.6. CRISPR-Cas9 Knockouts (KO). Clustered Regularly presence of ascites fluid was noted. All experiments were Interspaced Short Palindromic Repeats- (CRISPR-) associ- authorized by the Animal Ethics Committee of the Hebrew ated 9 (Cas-9) KOs were generated in OVCAR8 cells using University of Jerusalem. the pSpCas9 (BB)-2A-Puro (PX459) plasmid obtained from Addgene (Watertown MA) according to the manufacturer’s protocol. Briefly, specific single guide RNA (sgRNA) inserts 2.11.Immunohistochemistry(IHC). Formalin-fixed, paraffin- were designed to target the beginning of the 5′ sequence of embedded sections from the in vivo mouse model were an- every gene (Table 2). alyzed for Ki-67, p53, MMP2, and MMP9 protein expression ,e inserts were 5′ phosphorylated and annealed on a using the Dako EnVision System (Dako, Glostrup, Denmark). ° ° ramp between 95 C and 25 C. ,e vector was digested by the ,e Ki-67 antibody was a rabbit polyclonal antibody pur- BBSI restriction enzyme. Ligation of the insert to the plasmid chased from Abcam (cat no. 15580; Cambridge, UK), applied was performed with T4 ligase. ,e plasmids were then at 1 :1000 dilution with antigen retrieval in HpH (pH 9.0) transformed to DHα5 E. coli cells. Plasmids were extracted solution (Dako). ,e p53 antibody was a rabbit polyclonal from the DHα5 E. coli cells with GeneJet Plasmid Miniprep antibody purchased from Novocastra (part of Leica Bio- (Fermentas Life Sciences) and were sent to the Center for systems; cat no. NCL-p53-CM1; Wetzlar, Germany), applied Genomic Technologies at the Hebrew University, Givat Ram, at 1 : 3000 dilution with antigen retrieval in citrate buffer (pH Jerusalem, for sequencing, in order to confirm the insertion of 6.0). ,e MMP2 antibody was a rabbit polyclonal antibody the sgRNA insert. Plasmids were subsequently transfected purchased from LabVision (cat no. RB-9233-P1; Fremont into OVCAR8 cells with Lipofectamine 2000 (Invitrogen, CA), applied at 1 : 400 dilution with antigen retrieval in Tris- Carlsbad CA). Selection by Puromycin (A.G. Scientific Inc. EDTA buffer. ,e MMP9 antibody was a rabbit polyclonal San Diego CA) was performed, and the surviving resistant antibody purchased from NeoMarkers (part of LabVision; cat cells were seeded as single cell colonies, resulting in formation no. RB-1539-P1; Fremont CA), applied at 1 : 200 dilution with of single cell clones of-KO cells, which were then analyzed for no antigen retrieval. Positive controls consisted of normal KO with PCR or qPCR as described above. spleen (Ki-67), colon carcinoma (p53), placenta (MMP2), and lung carcinoma (MMP9). 2.7. Migration—Scratch Assay. OVCAR8 cells with NSMASE, TSAP6, and RAB27A/B KOs and OVCAR8 2.11.1. IHC Scoring. Nuclear staining was scored as positive control cells were seeded to confluence in 6-well plates. Each for Ki-67 and p53 and cytoplasmic staining for MMP2 and well was scratched twice with a sterile tip. ,e scratch in MMP9. Scoring was performed by an experienced surgical NSMASE2 and TSAP6 KO cells was imaged at t � 0 and pathologist (BD), using a 0–4 scale as follows: 0 � no t � 18 hrs. RAB27A/B KOs were imaged at t � 0 and staining, 1 � 1–5%, 2 � 6–25%, 3 � 26–75%, 4 � 76–100% of t � 24 hrs. Wound closure was analyzed by T-scratch soft- tumor cells. ware [21]. 2.8. Matrix Metalloproteinases (MMP) Activity Assay. KO 2.12. Statistical Analysis. Student’s t-test was employed, cells and OVCAR8 control cells (n = 500,000) were incu- significance was determined as p< 0.05. High and low bated overnight in DMEM medium supplemented with 0.1% mRNA and protein expression was defined relative to ex- BSA. ,e conditioned medium was loaded on 1 mg gelatin/ pression in control cells in each experiment. 4 Journal of Oncology Table 2: CRISPR-Cas9 sgRNA insert sequences. Sense CACCGTTCACCTCGGTGGGCCATG NSMASE2 Antisense AAACCATGGCCCACCGAGGTGAAC Sense CACCGCCATTGCAAACTCGCTCAAC TSAP6 Antisense AAACCGTTGAGCGAGTTTGCAATGG Sense CACCCAGTATTCATACCCACTCCG RAB27A Antisense AAACCGGAGTGGGTATGAATACTG Sense CACCGCACTCGCAGTCCTGACGGGGCAGGG RAB27B Antisense AAACCCCCTGCCCGTCAGGACTGCGAGTG significantly less in the scratch assay (Figure 4(a)). After 24 3. Results hours, the wounds in OVCAR8 cells with KO mutation of 3.1. Growth Form in 3D Models Influences Gene and Protein NSMASE2 and TSAP6 were 73% and 55% open, respectively, Expression in OC. Our aim was to develop a 3D model that versus 27% of the OVCAR8 control (p< 0.001 and p< 0.03, emulates OC. To this end, we successfully introduced two resp.). separate 3D in vitro models utilizing the OVCAR8 and ES-2 RAB27A/B KO wounds analyzed after 18 hours were OC cell lines—a spheroid model and a scaffold model. 81% and 71% open versus 43% of the control (p< 0.0001 and Analysis of the genes involved in exosome secretion in p< 0.0005, respectively). OVCAR8 cells showed different NSMASE2, TSAP6, and In MMP activity tests, MMP9 activity was significantly RAB27A levels as function of the culture method reduced in OVCAR8 NSMASE2, TSAP6, and RAB27A KO (Figures 1(a)–1(d)). mRNA expression of TSAP6 and cells compared to OVCAR8 control cells (p< 0.05; RAB27A was higher in spheroids compared to scaffolds Figure 4(b)). (p< 0.01 and p< 0.001, respectively), whereas the opposite In the Boyden chamber invasion assay, OVCAR8 was true for NSMASE2 mRNA (p � 0.0001). No change was RAB27A/B KO cells infiltrated significantly less than control observed in RAB27B mRNA levels. In ES-2 cells, TSAP6 and OVCAR8 cells: an average of 32 and 44 cells succeeded in RAB27B mRNA expression was higher in spheroids versus infiltrating, respectively, versus an average of 73 cells in the scaffolds (p< 0.03, p< 0.02, respectively) (Supplementary control (p< 0.0005 and p< 0.05, respectively). A trend was Figures 1(a) and 1(b)). noted for NSMASE2-KO cells where only 52 cells infiltrated nSMase2 and TSAP6 protein expression was higher in (p � 0.087; Figure 4(c)). scaffolds compared to spheroids (p< 0.006 and p< 0.0004, respectively). ,e growth form did not affect RAB27A protein expression (Figures 2(a)–2(c), Supplementary 3.5. Suppression of Exosome Secretion Pathways Leads to Figure S2). RAB27B protein expression was not analyzed Absence of Ascites Fluid and Reduced Tumor Size In Vivo. due to lack of adequate antibody. Seven weeks following the injection of 2 ×10 cells of OVCAR8 control, RAB27A-KO and RAB27B-KO to SCID mice, only the mice injected with OVCAR8 control cells 3.2. CRISPR Cas9 KO in OC Cell Lines. In order to evaluate the distinct role of the genes putatively involved in exosome developed ascites, with a volume ranging from 0.75 to 1.5 ml. No ascites ascites was observed in the mice injected secretion, OVCAR8 cells were subjected to KO with the with KOs. ,e entire group of RAB27A-KO and RAB27B- CRISPR Cas9 protocol for the various genes in this study. KO mice exhibited no visible tumors by gross examina- KOs were validated by qPCR showing the absence of mRNA tion, whereas tumor nodules were detected in the and by Western Blot, proving that this gene was silenced and OVCAR8 control group. Microscopic assessment of the not expressed in this cell line. ,e percentages of KO abdominal organs from the 12 mice showed that in achieved and protein levels are detailed in Table 3. RAB27A-KO and RAB27B-KO mice, the majority of or- gans were tumor-free, with isolated tumor nodules 3.3. Exosome Secretion Pathway KO Leads to Decreased ranging from 0.5 mm to 4 mm and 0.5 to 2 mm, respec- Exosome Secretion in OC Cell Lines. EM visualization tively, whereas the OVCAR8 control group had multiple showed that under normal culture conditions, OVCAR8 lesions with a diameter of up to 7 mm (Figure 5, Sup- cells secrete exosomes (Figure 3(a)). However, when mea- plementary Table S1). ,e average diameter of metastasis, sured by the qNano Gold analyzer, exosome secretion was including tumor-negative organs, was 0.59 mm for the significantly reduced in OVCAR8 KO cells compared to RAB27A-KO group (total diameter of all metastases control OVCAR8 cells (TSAP6 KO: p< 0.05; RAB27A KO: 13.5 mm in 23 organs), 0.35 mm for the RAB27B-KO p< 0.05; RAB27B KO: p< 0.01; Figure 3(b)). group (total diameter of all metastases 5.5 mm in 16 or- gans), and 1.53 mm for the control group (total diameter of all metastases 44.5 mm in 29 organs; p< 0.05). 3.4. Suppression of Exosome Secretion Pathways Leads to IHC analysis showed comparable expression of Ki-67 and Reduced Migration, MMP Activity, and Invasion in OC Cells. p53 in tumors from the RAB27A-KO and RAB27B-KO mice OVCAR8 cells with KO of any of the four genes, that is, compared to controls. However, MMP2 and MMP9 expression NSMASE2, TSAP6, RAB27A, and RAB27B, migrated Journal of Oncology 5 10 6 ∗∗ 0 0 OVCAR8 spheroid OVCAR8 scaffold OVCAR8 spheroid OVCAR8 scaffold (a) (b) 2.5 3 ∗∗ ns 2.0 1.5 1.0 0.5 0.0 0 OVCAR8 spheroid OVCAR8 scaffold OVCAR8 spheroid OVCAR8 scaffold (c) (d) Figure 1: (a–d) Gene expression dependent on 3D cell culture form: differential expression of mRNA expression in spheroids and scaffolds is seen for the following genes: (a) NSMASE2 (p � 0.0001), (b) TSAP6 (p< 0.01), (c) RAB27A (p< 0.001), (d) RAB27B (p< 0.55) in OVCAR8 cells. 0.8 6 ns ∗ ∗∗∗ 1.5 0.6 1.0 0.4 0.5 0.2 0.0 0.0 OVCAR8 OVCAR8 OVCAR8 OVCAR8 OVCAR8 OVCAR8 spheroid scaffold spheroid scaffold spheroid scaffold Spheroids Scaffolds Spheroids Scaffolds Spheroids Scaffolds nSMASE2 TSAP6 RAB27A GAPDH GAPDH GAPDH (a) (b) (c) Figure 2: (a–c) Differential protein expression depending on 3D growth form in OVCAR8 cell line: (a) nSMase2 and (b) TSAP6 protein expression is higher in scaffolds compared to spheroids (p< 0.006 and p< 0.0004, respectively). (c) RAB27A protein expression is not affected by growth form; error bars indicate SEM. was significantly lower in tumors from RAB27A-KO and exosome secretion machinery in HGSC cells and tumor- RAB27B-KO mice (Figure 6; Supplementary Table S1). derived exosomes [19]. In the present study, we analyzed whether a novel 3D OC model representing OC progression can be relevant for studying exosome secretion pathways in 4. Discussion this cancer. We previously reported on the frequent expression and We propose that alginate scaffolds emulate solid tumors, clinical relevance of several molecules belonging to the while spheroids mimic tumor growth in effusions. In the NSMASE2/GAPDH Fold change Fold change TSAP6/GAPDH Fold change Fold change RAB27A/GAPDH 6 Journal of Oncology Table 3: Percentage of KO generated by CRISPR Cas9 in OVCAR8 cells. KO A. qPCR NSMASE2 90% TSAP6 90% RAB27A 85% RAB27B 99% B. Western blot KO OV8 CONTROL NSMASE2 GAPDH TSAP6 GAPDH RAB27A GAPDH (A) OVCAR8 TSAP6 KO (B) OVCAR8 RAB27A KO 100 100 80 80 60 60 40 40 20 20 0 0 050 100 150 200 0 100 200 300 400 Particle diameter (nm) Particle diameter (nm) (C) OVCAR8 RAB27B KO (D) OVCAR8 100 100 80 80 60 60 40 40 20 20 OVACAR8-derived exosomes 0 0 0 50 100 150 200 250 0 50 100 150 200 250 Particle diameter (nm) Particle diameter (nm) (a) (b) Figure 3: (a) OVCAR8-derived exosomes, diameter 40–120 nm, as visualized by EM; PTA staining, X10K magnification (top), and X5K magnification (bottom). Scale bar indicates the size of the field shown. (b) Exosome secretion in OVCAR8 KO cell lines: exosome secretion is reduced in (A) TSAP6 KO, (B) RAB27A KO, and (C) RAB27B KO compared to (D) OVCAR8 control cell lines. Frequency Frequency Frequency Frequency Journal of Oncology 7 Migration assay, KO cells ∗∗ ∗∗ ∗∗ OVCAR8 OVCAR8 OVCAR8 OVCAR8 OVCAR8 NSMASE2 KO TSAP6 KO RAB27A KO RAB27B KO ab c d e (a) MMP 9 activity ns MMP-9 ∗∗ (b) Figure 4: Continued. % MMP 9 activity % open wound OVCAR8 OVCAR8 NSMASE2 KO OVCAR8 TSAP6 KO OVCAR8 RAB27A KO OVCAR8 RAB27B KO OVCAR8 NSMASE2 KO TSAP6 KO RAB27A KO RAB27B KO 8 Journal of Oncology Invasion assay ∗∗ OVCAR8 NSMASE2 KO TSAP6 KO RAB27A KO RAB27B KO (c) Figure 4: (a) Migration assay. Below: extent of the wound open after 18 or 24 hours, respectively: (a) OVCAR8 control, (b) NSMASE2-KO (p< 0.001, n � 4), (c) TSAP6-KO (p< 0.03, n � 4), (d) RAB27A-KO (p< 0.0001, n � 8), (e) RAB27B-KO (p< 0.001, n � 8). Above: quantification of experiment. Error bars represent SEM. (b) MMP activity assay. ,e width of the MMP9 gelatin consumed band is reduced in OVCAR8 NSMASE2 (p< 0.05), TSAP6 (p< 0.01), and RAB27A (p< 0.03) KO cells, but not in RAB27B KO cells. Error bars represent SEM. (c) Invasion assay: cells infiltrating through matrigel filters were quantified in this assay. RAB27A/B-KO cells infiltrated less than the OVCAR8 control cells. p< 0.0005 and p< 0.05, respectively. Error bars represent SEM. present study we show that the 3D form of growth influences Of note, there were notable differences between the both the mRNA and protein expression of the exosome mRNA and protein expression levels of Rab27A and TSAP6. secretion pathway in OC cell lines, as reflected by changes in We hypothesize this discrepancy to result from the action of NSMASE2, TSAP6, RAB27A, and RAB27B mRNA, as well as molecules regulating mRNA levels or due to epigenetic NSMASE2 and TSAP6 protein expression depending on the regulation of protein expression. 3D form applied. We utilized the CRISPR-Cas9 system and produced In OVCAR8 cells, TSAP6 and RAB27A mRNA levels NSMASE2, TSAP6, RAB27A, and RAB27B KOs in the were higher in spheroids than in scaffolds and RAB27B OVCAR8 cell line. EM showed that OVCAR8 cells produce mRNA expression was not influenced by the growth form. exosomes. ,e secretion of these exosomes was significantly diminished in RAB27A-KO, RAB27B-KO, and TSAP6-KO ,is profile partly concurs with our findings in our pre- vious study [19], where TSAP6 mRNA expression levels cells, well in agreement with the study of Bobrie et al., in were higher in HGSC effusions compared to surgical which Rab27a mediated exosome secretion in breast car- specimens, while those of RAB27B expression did not differ cinoma cells [22]. Of note, in another study by the same between these anatomic locations. Data are discordant with group, Rab27a silencing reduced docking of multivesicular respect to RAB27A mRNA, which had comparable ex- endosomes (MVEs) and increased their size in Hela cells, pression levels in solid lesions and effusions, despite the use whereas MVEs were redistributed towards the perinuclear of the same assay, presumably due to inherent differences region upon Rab27b silencing, documenting that these two between cell lines and clinical specimens. NSMASE2 and proteins have different roles [23]. TSAP6 protein levels were higher in scaffolds compared to Functional assays in the present study showed that spheroids, in agreement with the higher NSAMSE2 and molecules involved in the exosome machinery also regulate critical cancer-related processes. In migration assays, all KO TSAP6 expression in solid tumors versus effusions in our previous study. ,ese data suggest that the different culture cells migrated significantly less, indicating that these genes, models faithfully emulate 3D growth in solid lesions and perhaps via exosome secretion, are needed for this metastatic effusions in HGSC. feature. In the zymography assay that assesses the ability of Number of cells infiltrated OVCAR8 OVCAR8 NSMASE2 KO OVCAR8 TSAP6 KO OVCAR8 RAB27A KO OVCAR8 RAB27B KO Journal of Oncology 9 Intestine, RAB27A KO Liver, RAB27A KO Intestine, RAB27A KO (a) (b) (c) Kidney, RAB27B KO Liver, RAB27B KO Spleen, RAB27B KO (d) (e) (f) Skeletal muscle, control Pancreas, control Muscle, control (g) (h) (i) Fat, control Intestine, control (j) (k) Figure 5: Six sections from the liver, kidney, spleen, and intestine of mice in the RAB27A-KO and RAB27B-KO groups. No tumor nodules are seen. (g–k) Five sections of tumor nodules (marked with blue arrows) in the pancreas, intestine, muscle, and fat tissue in the OVACR control group (all figures at ×100 magnification). Differences in average tumor diameter between the KO groups and controls were significant (p< 0.05; see text). cancer cells to degrade gelatin via MMPs, NSMASE2-KO, growth of the primary tumor, and reduced lung dissemi- RAB27A-KO, and TSAP6-KO cells showed reduced MMP9 nation following the injection of 4T1 metastatic carcinoma activity. In the Boyden Chamber invasion assay that mea- cells to mice. Overall, exosome pathway KO cells appear to sures another metastatic characteristic, that is, the ability to possess less malignant and less metastatic characteristics, degrade matrigel, RAB27A-KO and RAB27B- KO cells suggesting that the exosome machinery pathway is impor- infiltrated significantly less. ,is finding is well in agreement tant for tumor progression. with the study of Geback ¨ et al. [21], in which Rab27A si- ,e development of a malignant effusion in the peri- lencing resulted in decreased MMP9 activity, suppressed toneal and/or pleural cavities represents metastatic disease 10 Journal of Oncology MMP9, RAB27B KO Ki-67, RAB27A KO p53, RAB27A KO MMP2, RAB27B KO (a) (b) (c) (d) MMP9, control Ki-67, control p53, control MMP2, control (e) (f) (g) (h) Figure 6: Protein expression of Ki-67, p53, MMP2, and MMP9 by IHC. Ki-67 and p53 expression is comparable in RAB27A-KO cells and controls. In contrast, a RAB27B-KO shows no expression of MMP2 and MMP9, whereas control cells are diffusely positive for both proteins. Tumor areas are marked with blue arrows (all figures at ×100 magnification). that is not amenable to surgical removal, where tumor cells Conflicts of Interest are chemoresistant and possess cancer stem cell charac- ,e authors have no conflicts of interest. teristics [24, 25]. ,is form of tumor progression is therefore a highly lethal stage of OC, in addition to its detrimental effect on the quality of life of OC patients. In Authors’ Contributions contrast to OVCAR8 controls, no development of ascites was observed following injection of RAB27A and RAB27B Esther Channah Broner performed the experiments and KO cells to mice, and solid tumor nodules were signifi- wrote the manuscript. Hadil Onallah performed the ex- cantly smaller, indicating that these molecules may have periments and critically read the manuscript. Tali Tavor direct clinical relevance in HGSC. Tumors from mice in- Re’em prepared the 3D constructs and critically read the jected with RAB27A and RAB27B KO cells additionally had manuscript. Ben Davidson designed the study, microscop- lower MMP expression. Overall, the experimental data, ically assessed the tumors in the mice experiments, per- combined with the association between TSAP and poor formed and scored the immunostains, and co-wrote the outcome in our previous study [19], support a role as manuscript. Reuven Reich designed the study, supervised oncogenes rather than tumor suppressors for the exosome the experiments, and cowrote the manuscript. Esther machinery components. An association between Rab27a Channah Broner and Hadil Onallah contributed equally to protein and favorable outcome was nevertheless observed this work. for exosomal levels of this protein in our previous study [19], raising the possibility that extracellular Rab27a has Supplementary Materials other functions than its intracellular counterpart. In conclusion, this study presents a 3D in vitro model Figure 1: (a) RAB27B (p< 0.02) and (b) TSAP6 (p< 0.03) that may allow exploration of the molecular drivers of the mRNA expression in the ES-2 cell line. Figure 2: images of different growth forms of OC. Our in vivo model shows that the actual Western blots of Figures 2(a)–2(c). Table S1: interfering with the exosome secretion pathway contributes Isolated tumor nodules ranges in mm in the various organs. to attenuating the aggressiveness of OC, a finding that may (Supplementary Materials) have therapeutic relevance. Analysis of the content of exosomes derived from the scaffold and spheroid model, References including proteins, mRNA, and noncoding RNA, may be of interest in future research. [1] R. L. Siegel, K. D. Miller, and A. Jemal, “Cancer statistics, 2019,” CA: A Cancer Journal for Clinicians, vol. 69, no. 1, Data Availability pp. 7–34, 2019. [2] F. Bray, J. Ferlay, I. Soerjomataram, R. L. Siegel, L. A. Torre, ,e experimental data used to support the findings of this and A. Jemal, “Global cancer statistics 2018: GLOBOCAN study are included within the article. Additional information estimates of incidence and mortality worldwide for 36 cancers regarding this study is available from the corresponding in 185 countries,” CA: A Cancer Journal for Clinicians, vol. 68, no. 6, pp. 394–424, 2018. author upon request. Journal of Oncology 11 [3] S. Lheureux, C. Gourley, I. Vergote, and A. M. Oza, “Epithelial high-grade serous carcinoma,” Human Pathology, vol. 60, ovarian cancer,” e Lancet, vol. 393, no. 10177, pp. 180–187, 2017. pp. 1240–1253, 2019. [20] V. Horwitz, B. Davidson, D. Stern, C. G. Trope, ´ T. Tavor Re’em, and R. Reich, “Ezrin is associated with disease pro- [4] M.-P. Caby, D. Lankar, C. Vincendeau-Scherrer, G. Raposo, and C. Bonnerot, “Exosomal-like vesicles are present in hu- gression in ovarian carcinoma,” PLoS One, vol. 11, Article ID man blood plasma,” International Immunology, vol. 17, no. 7, e0162502, 2016. pp. 879–887, 2005. [21] T. Geback, ¨ M. M. P. Schulz, P. Koumoutsakos, and [5] T. Pisitkun, R.-F. Shen, and M. A. Knepper, “Identification M. Detmar, “TScratch: a novel and simple software tool for and proteomic profiling of exosomes in human urine,” automated analysis of monolayer wound healing assays,” Proceedings of the National Academy of Sciences, vol. 101, Biotechniques, vol. 46, no. 4, pp. 265–274, 2009. no. 36, pp. 13368–13373, 2004. [22] A. Bobrie, S. Krumeich, F. Reyal et al., “Rab27a supports [6] M. Gonzalez-Begne, B. Lu, X. Han et al., “Proteomic analysis exosome-dependent and -independent mechanisms that of human parotid gland exosomes by multidimensional modify the tumor microenvironment and can promote tumor protein identification technology (mudpit),” Journal of Pro- progression,” Cancer Research, vol. 72, no. 19, pp. 4920–4930, teome Research, vol. 8, no. 3, pp. 1304–1314, 2009. 2012. [7] C. Admyre, S. M. Johansson, K. R. Qazi et al., “Exosomes with [23] M. Ostrowski, N. B. Carmo, S. Krumeich et al., “Rab27a and Rab27b control different steps of the exosome secretion immune modulatory features are present in human breast milk,” e Journal of Immunology, vol. 179, no. 3, pathway,” Nature Cell Biology, vol. 12, no. 1, pp. 19–30, 2010. pp. 1969–1978, 2007. [24] B. Davidson, “Recently identified drug resistance biomarkers [8] A. Poliakov, M. Spilman, T. Dokland, C. L. Amling, and in ovarian cancer,” Expert Review of Molecular Diagnostics, J. A. Mobley, “Structural heterogeneity and protein compo- vol. 16, no. 5, pp. 569–578, 2016. sition of exosome-like vesicles (prostasomes) in human se- [25] B. Davidson, “Biomarkers of drug resistance in ovarian men,” e Prostate, vol. 69, no. 2, pp. 159–167, 2009. cancer—an update,” Expert Review of Molecular Diagnostics, [9] M. P. Bard, J. P. Hegmans, A. Hemmes et al., “Proteomic vol. 19, no. 6, pp. 469–476, 2019. analysis of exosomes isolated from human malignant pleural effusions,” American Journal of Respiratory Cell and Molec- ular Biology, vol. 31, no. 1, pp. 114–121, 2004. [10] B. P. Foster, T. Balassa, T. D. Benen et al., “Extracellular vesicles in blood, milk and body fluids of the female and male urogenital tract and with special regard to reproduction,” Critical Reviews in Clinical Laboratory Sciences, vol. 53, no. 6, pp. 379–395, 2016. [11] B. K. ,akur, H. Zhang, A. Becker et al., “Double-stranded DNA in exosomes: a novel biomarker in cancer detection,” Cell Research, vol. 24, no. 6, pp. 766–769, 2014. [12] E. R. Abels and X. O. Breakefield, “Introduction to extra- cellular vesicles: biogenesis, rna cargo selection, content, re- lease, and uptake,” Cellular and Molecular Neurobiology, vol. 36, no. 3, pp. 301–312, 2016. [13] B. H. Sung, T. Ketova, D. Hoshino, A. Zijlstra, and A. M. Weaver, “Directional cell movement through tissues is controlled by exosome secretion,” Nature Communications, vol. 6, p. 7164, 2015. [14] S. Yue, W. Mu, U. Erb, and M. Zoller, ¨ “,e tetraspanins CD151 and tspan8 are essential exosome components for the crosstalk between cancer initiating cells and their sur- rounding,” Oncotarget, vol. 6, no. 4, pp. 2366–2384, 2015. [15] J. W. Clancy, A. Sedgwick, C. Rosse et al., “Regulated delivery of molecular cargo to invasive tumour-derived microvesicles,” Nature Communications, vol. 6, no. 1, 2015. [16] H. Peinado, M. Aleckovi ˇ c, ´ S. Lavotshkin et al., “Melanoma exosomes educate bone marrow progenitor cells toward a pro-metastatic phenotype through MET,” Nature Medicine, vol. 18, no. 6, pp. 883–891, 2012. [17] B. Costa-Silva, N. M. Aiello, A. J. Ocean et al., “Pancreatic cancer exosomes initiate pre-metastatic niche formation in the liver,” Nature Cell Biology, vol. 17, no. 6, pp. 816–826, [18] M. Tkach and C. , ery, ´ “Communication by extracellular vesicles: where we are and where we need to go,” Cell, vol. 164, no. 6, pp. 1226–1232, 2016. [19] E. C. Broner, C. G. Trop´e, R. Reich, and B. Davidson, “TSAP6 is a novel candidate marker of poor survival in metastatic
Journal
Journal of Oncology – Hindawi Publishing Corporation
Published: May 30, 2020