Get 20M+ Full-Text Papers For Less Than $1.50/day. Subscribe now for You or Your Team.

Learn More →

The Alcohol Extract of Coreopsis tinctoria Nutt Ameliorates Diabetes and Diabetic Nephropathy in db/db Mice through miR-192/miR-200b and PTEN/AKT and ZEB2/ECM Pathways

The Alcohol Extract of Coreopsis tinctoria Nutt Ameliorates Diabetes and Diabetic Nephropathy in... Hindawi BioMed Research International Volume 2019, Article ID 5280514, 12 pages https://doi.org/10.1155/2019/5280514 Research Article The Alcohol Extract of Coreopsis tinctoria Nutt Ameliorates Diabetes and Diabetic Nephropathy in db/db Mice through miR-192/miR-200b and PTEN/AKT and ZEB2/ECM Pathways 1 1 1 1 1 Shunjie Yu, Haoran Zhao, Wenjing Yang, Ramila Amat, Jun Peng, 1 1 2 1 Yike Li, Kai Deng, Xinmin Mao , and Yi Jiao Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Xinjiang Medical University, Urumqi 830011, China Traditional Chinese Medicinal College, Xinjiang Medical University, Urumqi 830011, China Correspondence should be addressed to Xinmin Mao; mxm3277@139.com and Yi Jiao; miranda812@163.com Received 20 December 2018; Accepted 3 March 2019; Published 28 March 2019 Academic Editor:Pankaj K.Bhavsar Copyright © 2019 Shunjie Yu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The study aims to investigate the eeff cts of the alcohol extract of Coreopsis tinctoria Nutt (AC) on diabetic nephropathy (DN) mice. A total of 30 db/db (DN) mice were divided into 3 groups, which were treated with AC (300 mg/kg/day), metformin (180 mg/kg/day), or saline by gavage for 10 weeks. Ten db/m mice treated with saline were used as normal control (NC group). Body weight (BW) and fasting blood glucose (FBG), HbA1c, 24 h urinary albumin excretion (UAE), and renal pathological fibrosis were analyzed. Expression of miR-192, miR-200b, and proteins in the PTEN/PI3K/AKT pathway was analyzed by qPCR or western blot. The DN mice had significantly higher BW, FBG, and 24 h UAE, as well as more severe pathological fibrosis when compared with NC. Treatment of AC could decrease BW, FBG, and 24 h UAE and alleviated kidney damage. Compared with the NC group, expressions of miR-192 and miR-200b were increased, whereas their target proteins (ZEB2 and PTEN) were reduced in the kidneys of DN mice, which further modulated the expression of their downstream proteins PI3K p85𝛼 ,P-AKT, P-smad3, and COL4𝛼 1; these proteins were increased in the kidneys of DN mice. In contrast, AC treatment reversed the expression changes of these proteins. ese Th findings demonstrate that AC may protect the kidneys of DN mice by decreasing miR-192 and miR-200b, which could further regulate their target gene expression and modulate the activity of the PTEN/PI3K/AKT pathway to reduce the degree of renal fibrosis. 1. Introduction of collagen fibers is the main characteristic of renal b fi rosis. During this process, the kidneys undergo excessive deposi- Diabetes has become one of the major public health prob- tion of collagen, which causes gradual sclerosis and scarring lems. In China, the prevalence of diabetes in adults reached of the renal parenchyma and eventually results in complete loss of kidney function [7]. 10.9% in 2013 [1–3]. Diabetic nephropathy (DN) is a common chronic microvascular complication of diabetes and is also The db/db mouse is a spontaneous diabetic model that an important cause of end-stage renal disease. Approximately exhibits many of the same characteristics as human diabetes. It has the typical clinical manifestations of diabetes such 40% of patients with diabetes have DN [4, 5]. Glomeru- lar structure hypertrophy, glomerular basement membrane as hyperglycemia, hyperlipidemia, polyphagia, and polyuria. thickening, mesangial cell proliferation, tubulointerstitial With age increasing, these mice can present early manifes- expansion, and the abnormal accumulation of extracellular tations of DN, such as microalbuminuria. As the disease matrix (ECM) components (such as collagen and b fi ronectin) progresses, large amounts of proteinuria gradually develop, are the main pathological features of DN [6]. The increase and the kidneys become diseased; eventually these effects 2 BioMed Research International develop into glomerulosclerosis and interstitial fibrosis 2.2. Analysis of AC by High Performance Liquid Chromatog- [8, 9]. raphy (HPLC). The compounds in AC were analyzed by The occurrence and development of DN may be caused HPLC (Shimadzu, Japan). AC was separated by a Shim-pack by oxidative stress, inflammatory reactions, glucose and lipid VP-ODS column (150 mm× 4.6 mm, 5𝜇 m). The mobile metabolism disorders, and other factors [10, 11]. These factors phase contained 0.5% solution A (formic acid) and solution activate multiple signaling pathways in the kidney [12–14], B (acetonitrile), with a detection wavelength of 280 nm, which may contribute to the pathogenesis of DN. Among column temperature of 35 C, and o fl w rate of 1.0 mL/min. them, the PI3K/AKT signaling pathway is closely related The elution program wasasfollows: 0 ∼ 60 min, 95∼ 80% to renal b fi rosis [15]. Activation of the PI3K/AKT signaling solution A and 5 ∼ 20% solution B; 60 ∼ 75 min, 80 ∼ pathway can phosphorylate smad3, promote the development 10% solution A and 20 ∼ 90% solution B; 75 ∼ 80 min, of collagen b fi ers in mesangial cells, and increase the degree 10∼ 95% solution A and 90∼5% solution B. According to of renal br fi osis [16]. the Chinese Pharmacopoeia on HPLC(General Rule0512), Moreover, some studies have found that the abnormal the chlorogenic acid concentration (C) was plotted on the expression of microRNA (miRNA) is closely related to the abscissa and the peak area (A) was plotted on the ordinate occurrence and development of DN [17, 18]. One study found to obtain the standard curve. The regression equation was as that the expression of miR-192 in the kidneys of DN mice follows: A = 13038C - 19022, r = 0.9991. Then, 10 𝜇 Lof the can inhibit the autophagy process of mesangial cells and chlorogenic acid reference solution (400𝜇 g/mL) or the AC lead to glomerular hypertrophy [19]. In addition, increased solution was added to a liquid chromatograph, respectively. expression of miR-200b activates the downstream PI3K/AKT The peak area of chlorogenic acid was used as a control signaling pathway, resulting in glomerular hypertrophy and to calculate the content of av fl anomarein, marein, and 3,5- collagendeposition[20]. dicaeff oylquinic acid in AC. Pharmacological studies [21–23] have shown that the alcohol extract of Coreopsis tinctoria Nutt has antihyperten- 2.3. Animals. Ten db/m mice (4 weeks old) and 30 db/db sion, antihyperlipidemia, and hypoglycemic eeff cts, as well mice (4 weeks old) were obtained from Caveven's Laboratory as anti-inflammatory and antifibrosis effects in DN [24]. Animal Co., Ltd., (Changzhou, China). The animals were However, the underlying mechanism is unclear. kept in a specific pathogen-free environment in a 12 h In this study, the role and mechanism of AC in DN light/dark cycle at 21±2 Cand 45±5% humidity for 1 week was investigated. The db/db mice were used as research of acclimatization. All mice were allowed free access to subjects. After daily administration of AC for 10 weeks, normal food and water. The study was approved by the the eeff cts of AC on body weight (BW) and biochemical Institutional Animal Care and Use Committee of the First indexes were observed to monitor the therapeutic effect Alffi iated Hospital of Xinjiang Medical University (Approval of AC on DN. Furthermore, expression of miR-192, miR- No. IACUC-20140304-158). 200b, and their target genes that belong to the phos- phatase and tensin homolog deleted on the chromosome ten 2.4. Animal Treatment and Grouping. The db/m mice (n=10) (PTEN)/phosphatidylinositol 3-kinase (PI3K)/protein kinase were used as normal control (NC). The db/db mice were B (AKT) signaling pathway in the kidney tissues of DN randomly divided into three groups, the DN group, DN+M mice was analyzed to investigate the possible mechanism group, and DN+AC group, with 10 mice in each group. underlying the eeff ct of AC. Mice in the NC group and DN group were given saline by gavage each day for 10 weeks. Mice in the DN+M group received 180 mg/kg metformin (Squibb Pharmaceutical Co., 2. Materials and Methods Ltd., Shanghai, China) by gavage each day for 10 weeks. 300 mg/kg purified AC was administrated to the DN+AC group 2.1. Preparation of AC. Dried o fl wers of Coreopsis tinctoria by gavage each day for 10 weeks. Nutt (the species was identified by Professor Junping Hu, Col- lege of Pharmacy, Xinjiang Medical University) were crushed and placed in 55% ethanol for reflux extraction. The extracted 2.5. Specimen Collection. The BW of all mice was obtained liquid was lfi tered and merged. The filtrate was concentrated every two weeks. Caudal blood was collected from all mice in a concentration tank under reduced pressure and then every two weeks, and fasting blood glucose (FBG) levels were concentrated by a multistage ash fl evaporator (DC-NSG; measured. Once every two weeks, urine was collected for 24 Jinding Technology, Henan, China). The concentrate was h, and urine volume was recorded. After 10 weeks of gavage, evaporated to approximately 600 ml in a rotary evaporator themice werefasted for 8h and then blood wascollected (R-210; Buchi, Essen, Germany) and then vacuum-dried to from the eyeballs after anesthesia by intraperitoneal injection obtain AC. AC was passed through HPD-100 macroporous of 2% pentobarbital sodium (40 mg/kg). Blood samples were resin and then eluted with 75% ethanol. The ethanol elute was used for detection of HbA1c by HPLC. After that mice were vacuum-dried to obtain the purified AC. The purified AC was sacrificed by cervical dislocation. The kidneys were dissected. accurately weighed at 0.5 g. 10 ml 60% ethanol was added to The right kidneys were kept immediately in liquid nitrogen dissolve the puriefi d AC. The solution was passed through for subsequent extraction of total RNA and protein. The left a 0.22𝜇 m microporous membrane, and the resulting filtrate kidneys were weighed to calculate kidney/weight ratio and was used as the AC solution (0.05 g/ml). then fixed in 10% formaldehyde. BioMed Research International 3 2.6. Glucose Oxidase Assay. Fasting blood glucose was mea- CTGACCTATGAATTGACAGCC, and TAATACTGCCTG- sured by a glucose assay kit (the glucose oxidase method) GTAATGATGA, respectively. qPCR was carried out in 20 (BioVision, Mountain View, CA, USA). Briefly, the blank 𝜇 L final volumes with 2 𝜇 LcDNA, 3𝜇 LRNase-free H O, wells with 20𝜇 L 0.1% NaF, standard wells with 0.28 mmol/L, 10 𝜇 L2× miRNA qPCR Master Mix (Sangon, Shanghai, 0.56 mmol/L, and 1.11 mmol/L of glucose standard, and wells China), 2𝜇 L universal PCR primer, 1𝜇 LROX ReferenceDye with plasma were set up on a 96-well plate. The volume of (Sangon, Shanghai, China), and 2𝜇 Lspecicfi primers. qPCR each well was 20𝜇 L. Then, 180 𝜇 L of glucose oxidase was was performed with a real-time PCR thermocycler (Applied added to each well and incubated at 37 Cfor 45 minat 200 Biosystems, Foster City, CA, USA) under the following con- rpm. The optical density of each well was measured at a ditions: predenaturation at 95 C for 5 s and then 40 cycles of ∘ ∘ wavelength of 505 nm with a microplate reader (xMark, Bio- denaturation at 95 C for 30 s and annealing/extension at 60 C Rad, Hercules, CA, USA). A standard curve was generated for30s.miR-192andmiR-200brelativeexpressionlevelswere −ΔΔCt and the fasting blood glucose concentration was calculated. calculated using the2 method and normalized to the expression of U6. 2.7. ELISA. The content of urinary albumin was determined 2.10. Western Blotting. The right kidneys were lysed with by a mouse urinary albumin ELISA kit (Chenglin Biological the RIPA lysis buffer (Thermo Fisher Scientific, Waltham, Technology Co., Ltd., Beijing, China). Briefly, blank wells, MA, USA) containing a protease and phosphatase inhibitor standard wells (360𝜇 g/L, 240𝜇 g/L, 120𝜇 g/L, 60𝜇 g/L, and cocktail (Abcam, Cambridge, MA, USA). The supernatant 30𝜇 g/L), and sample wells were set on the ELISA plate. Then, was collected by centrifugation at 12000 rpm for 10 min, 10𝜇 L of mouse urine was added to each sample well, and the and the total protein concentration was measured by the plate was incubated at 37 Cfor 30 min. Aeft r washing, 50 𝜇 L BCA method. Proteins were separated by electrophoresis and reagent A and 50𝜇 L reagent B were added to each well and transferred onto PVDF membranes (Millipore, USA). After incubated at 37 Cfor 15 minin the dark.Thereaction was blocking in 5% nonfat milk at room temperature for 1 h, stopped by adding a 50𝜇 L stop solution. The absorbance of the membranes were incubated at 4 C overnight with diluted each well was measured by a microplate reader (Bio-Rad) at primary antibodies to ZEB2, PTEN, PI3K p85𝛼 ,AKT, P- 450 nm wavelength. smad3, smad3, and COL4𝛼 1 (all with 1:1000 dilution; Abcam, Cambridge, MA, USA),𝛽 -actin (1:2000; ZSGB-BIO, Beijing, 2.8. H&E and Masson’s Staining. The left kidney tissues were China),and P-AKT (1:5000; Abcam,USA). Aeft r rinsing, xfi ed in a 10% formaldehyde solution for 24 h, and then, tissue the membranes were incubated with an HRP-labeled anti- sections were prepared and subjected to hematoxylin and mouse or anti-rabbit secondary antibody (1:5000; ZSGB-BIO, eosin (H&E) and Masson’s staining as follows. First, the tissue Beijing, China) for 1 h at room temperature. After rinsing, was dehydrated with graded ethanol and transparentized the membranes were developed with enhanced chemilu- with xylene.Then,the tissue was embedded in paranffi and minescence (Thermo Fisher Scientific, USA). Images were cut into 3∼4𝜇 m sections. The tissue sections were stained acquired by an image acquisition system (Gel Doc XR+; Bio- with H&E and Masson’s according to routine procedure. Rad, USA), and the grey values were determined by ImageJ The morphological changes of the kidneys were observed sow ft are. under a light microscope (SZX7-1093; Olympus, Japan). Histological evaluation was performed in a blinded manner. 2.11. Statistical Analysis. SPSS 19.0 statistical sowa ft re (Chica- The mesangial expansion index from 30 glomeruli of each go, IL, USA) was used for analysis. The data were expressed as mouse was graded in four levels from 0 to 3 [24]: grade 0, the means± standard error. The differences among multiple normal glomerulus; grade 1, matrix expansion occurring in groups were analyzed by one-way analysis of variance. P<0.05 up to 50% of a glomerulus; grade 2, 50%–75% expansion; and was considered statistically significant. grade 3, 75%–100% expansion. For Masson’s staining, four levels of fibrosis from 30 glomeruli of each mouse were scored 3. Results by measuring the percentage area of blue-purple staining as follows: grade 0, absent or< 25%; grade 1, 25%–50%; grade 3.1. HPLC Analysis of AC. AC contains amino acids, polysac- 2, 50%–75%; and grade 3, 75%–100%, and the mean score of charides, volatile oils, flavono ids, and organic phenolic acids. each mouse was calculated and compared. A total of 5 mice Among them, flavonoids (flavanomarein, marein) and phe- in each group were analyzed. nolic acids (chlorogenic acid, 3,5-dicaeo ff ylquinic acid) are the main active components of AC and are closely related 2.9. Real-Time Quantitative PCR (qPCR). Total RNAs of the renal to the pharmacological action of Coreopsis tinctoria Nutt tissues were extracted with the miRNA extraction kit (Sangon [25–27]. By HPLC analysis, we found that chlorogenic acid, Biotech Co., Ltd., Shanghai, China). Reverse transcription flavanomarein, marein, and 3,5-dicaeo ff ylquinic acid were was performed using a miRNA rs fi t-strand cDNA (synthe- the main avon fl oids and phenolic compounds of AC. The sis tail method) kit (Sangon Biotech Co., Ltd., Shanghai, content of these bioactive components in AC was determined China). Specific primers for U6, miR-192, and miR-200b were by a quantitative assay of multiple components with chloro- designed by Qiagen (Valencia, CA, USA), and the primer genic acid as a single marker, as shown in Figure 1 and 󸀠 󸀠 sequences (5 󳨀→ 3 ) were AACGCTTCACGAATTTGCGT, Table 1. 4 BioMed Research International uV 120000 P2 80000 P3 P1 30000 P4 min 0 10 20 30 40 50 60 70 Figure 1: HPLC analysis of AC. HPLC analysis of AC at 280 nm wavelength. eTh four main compounds were chlorogenic acid (P1), flavanomarein (P2), marein (P3), and 3,5-dicaeo ff ylquinic acid (P4). Table 1: Contents of the main flavonoids and phenolic acids in AC (P<0.05) (Table 3). These results suggest that AC can reduce (mg/g). HbA1c level and K/W in DN mice. Peak no. Compounds Content 3.4. Change in 24 h Urine Volume (24 h UV) and 24 h Urinary Chlorogenic P1 26.27 Albumin Excretion (24 h UAE) aer ft Treatment with AC. To acid observe the effects of AC on 24 h UV and 24 h UAE in DN P2 Flavanomarein 138.5 mice, we collected the24 h urineof miceand detected the24 P3 Marein 268.56 h UAE every 2 weeks. Compared with those of the NC group, 3,5- the 24h UV and 24h UAEof mice in each DN group were P4 Dicaeff oylquinic 16.39 significantly higher at 2, 4, 6, and 8 weeks ( P<0.05) (Table 4). acid Compared with that of the DN group, the 24 h UV in the DN+M group decreased at 4 and 8 weeks, and the 24 h UAE in the DN+M group decreased at 8 weeks (P<0.05) (Table 4). At both 6 and 8 weeks, the 24 h UV and UAE decreased in the 3.2. Change in BW and FBG after Treatment with AC. To DN+AC group (P<0.05) (Table 4). These results suggest that observe the effect of AC on the weight of the DN mice, BW AC canreduce24 hUV and 24 h UAE inDN mice. was monitored. We found that mice from the DN, DN+M, and DN+AC groups were significantly heavier than those of 3.5. Eec ff t of AC on Renal Histology. At the end of treatment, the NC group from 0-10 weeks (P<0.05) (Table 2). Compared renal tissues were examined by H&E staining and Masson’s with that of the DN group, the BW of mice in the DN+M staining. As shown in Figure 2(a), the glomeruli of the mice group was lower at 8 and 10 weeks (P<0.05), and the BW in the NC group had a clear structure, normal volume, of the DN+AC group mice was also signicfi antly lower at normal mesangial matrix, and clear and patent tubular 10 weeks (P<0.05) (Table 2). To observe the effect of AC lumen. In the DN group, the glomerular volume of most on the FBG levels of the DN mice, we tested FBG every 2 mice was obviously increased, the mesangium was enlarged, weeks and found that the FBG in all the DN groups increased the basement membrane was thickened, and there were significantly compared with that of the NC group from 0 to vacuole-like changes in the renal tubules. In the DN+M 10 weeks (P<0.05). Compared with that of the DN group, and DN+AC groups, the pathological changes of DN were themiceinthe DN+M grouphad lower FBG (P<0.05) at 8 alleviated (P<0.05) (Figure 2(c)). The glomerular volume was weeks, whereas the FBG of the mice in the DN+AC group smaller than that of mice in the DN group; in addition, the was lower at 4, 6, 8, and 10 weeks (P<0.05) (Table 2). These mesangium showed mild widening, the basement membrane results suggest that AC can reduce the elevated BW and FBG was mildly thickened, and the tubular vacuole-like changes levels in DN mice. were reduced. By Masson’s staining, no obvious blue-purple collagen fibers in the glomerular, tubular, or renal interstitials 3.3. Effects of AC on HbA1c and Kidney/Weight Ratio (K/W). were observed in the NC group mice. In the DN group, the To observe the eeff cts of AC on blood glucose control and staining of the blue-purple collagen b fi ers was obvious, and kidney damage in DN mice, we measured the level of HbA1c the deposition of renal interstitial collagen b fi ers was obvious. and the K/W value at 10 weeks. Compared with the NC The blue-purple collagen b fi ers in the glomerular, tubular, group, the HbA1c level and K/W of the mice in the DN group and renal interstitials of the DN+M and DN+AC groups were were significantly increased ( P<0.05) (Table 3). The DN+M fewer than those in the DN group (P<0.05) (Figures 2(b) and 2(c)). These results suggest that AC and metformin can group had lower K/W (P<0.05) than the DN group, while the DN+AC group had both lower HbA1c and lower K/W alleviate DN mouse kidney mesangial widening, basement BioMed Research International 5 Table 2: Effect of AC on body weight and fasting blood glucose in each group ( x±SE, g, mmol/L). NC DN DN+M DN+AC Weeks BW (g) FBG (mM) BW (g) FBG (mM) BW (g) FBG (mM) BW (g) FBG (mM) 0W 16.87±0.46 4.26±0.22 30.46±1.63∗ 9.34±0.98∗ 30.61±0.83∗ 8.39±0.33∗ 30.64±1.42∗ 8.18±0.78∗ 2W 20.89±0.39 4.85±0.13 35.33±2.24∗ 12.77±1.15∗ 33.02±1.06∗ 10.91±0.99∗ 33.53±1.60∗ 10.04±1.04∗ 4W 21.28±0.31 5.24±0.42 38.56±2.02∗ 14.02±1.94∗ 34.67±1.52∗ 12.15±1.48∗ 35.35±1.66∗ 9.92±1.15∗# 6W 23.45±0.45 5.34±0.15 41.50±2.24∗ 15.26±1.78∗ 37.39±1.49∗ 12.27±1.54∗ 38.16±1.44∗ 10.53±1.28∗# 8W 23.83±0.50 7.13±0.42 44.57±1.24∗ 17.16±1.96∗ 38.10±1.72∗#12.82±1.64∗#40.45±1.64∗ 11.13±1.31# 10 W 24.55±0.40 7.20±0.50 46.38±1.85∗ 19.02±2.00∗ 39.73±1.95∗#14.59±2.00∗ 41.06±1.85∗#13.88±1.60∗# Note: NC: normal control mice, DN: diabetic nephropathy mice, DN+M: DN mice given 180 mg/kg metformin, and DN+AC: DN mice given 300 mg/kg AC. BW: body weight and FBG: basting blood glucose.∗: P<0.05 compared with the NC group; #: P<0.05 compared with the DN group. 6 BioMed Research International NC group DN group DN+M group DN+AC group (a) NC group DN group DN+M group DN+AC group (b) 1.8 ∗ 1.8 1.6 1.6 ∗# ∗# 1.4 1.4 ∗# ∗# 1.2 1.2 0.8 0.8 0.6 0.6 0.4 0.4 0.2 0.2 NC DN DN+M DN+AC NC DN DN+M DN+AC (c) Figure 2: Renal tissue morphology in four groups of mice. Mice were divided into the NC group, DN group, DN+M group, and DN+AC group. (a) H&E staining of renal tissue morphology in four groups of mice. (b) Masson’s staining of renal tissue morphology in four groups of mice. Large figures (200 x), scale bar, 100 𝜇 m, and small figures (400 x), scale bar, 5 𝜇 m. (c) Matrix expansion and area of fibrosis were semiquantitatively analyzed from 30 glomeruli per mouse with 5 mice in each group.∗: P<0.05 compared with the NC group; #: P<0.05 compared with the DN group, one-way analysis of variance. Matrix expansion score Fibrosis area score BioMed Research International 7 2.0 1.5 ∗ # # 1.0 0.5 0.0 NC DN DN+M DN+AC miR-192 miR-200b Figure 3: Effects of AC on the expression of miR-192 and miR-200b in mouse kidneys. Expression of miR-192 and miR-200b in mouse kidneys was detected by qPCR. U6 snRNA was used as internal control.∗: P<0.05 compared with the NC group; #: P<0.05 compared with the DN group, one-way analysis of variance. Table 3: Effect of AC on HbA1c and kidney/weight ratio in each ZEB2 and PTEN protein in the kidneys of the DN group was group (x±SE). significantly decreased, which could be further rescued by the addition of metformin or AC (Figures 4(a)-4(d)). Next Group HbA1c (%) K/W we examined the expression of proteins in the PI3K/AKT NC 4.12±0.11 5.88±0.15 signaling pathway, since this pathway is thought to play an DN 7.61±0.31∗ 7.47±0.70∗ important role in renal fibrosis. Compared with the NC group, the expression of PI3K p85𝛼 ,P-AKT (Ser473),P- DN+M 7.20±0.42∗ 5.14±0.41# smad3 (Ser425), and COL4𝛼 1inDN mousekidneyswas DN+AC 6.53±0.41∗#5.20±0.43# significantly increased ( P<0.05). In addition, the expression Note:NC:normal control mice,DN:diabeticnephropathymice,DN+M:DN of PI3K p85𝛼 and P-AKT (Ser473) in the DN+M group was mice given 180 mg/kg metformin, and DN+AC: DN mice given 300 mg/kg decreased significantly, and the expression of PI3K p85 𝛼 , AC. K/W: Kidney/weight ratio.∗: P<0.05 compared with the NC group; #: P<0.05 compared with the DN group. P-AKT (Ser473), P-smad3 (Ser425), and COL4 𝛼 1inthe DN+AC group was decreased signicfi antly ( P<0.05) when compared with the DN group (Figures 4(a)-4(d)). These membrane thickening, and tubular vacuolar changes, as well results suggest that the anti-renal-fibrosis activity of AC may as thedepositionofcollagenfibers, therefore playing a be related to increased expression of ZEB2 and inhibited protective role in DN mouse kidneys. activation of the PTEN/PI3K/AKT signaling pathway. 3.6. Effects of AC on the Expression of miR-192 and miR- 200b in Mouse Kidneys. To investigate the expression of 4. Discussion miR-192 and miR-200b in the kidneys of DN mice and to observe the eeff cts of AC on the expression of these miRNAs, DN is a chronic complication secondary to diabetes. It is qPCR was performed. The expression of miR-192 and miR- reported that DN has a 5-year survival rate of only 20% in 200b was significantly increased in the DN group compared patients with kidney failure [28]. Although understanding of with NC (P<0.05); however, treatment with metformin or the molecular mechanism of DN has progressed in recent AC significantly decreased the expression of these miRNAs years [29, 30], therapies to prevent or reverse the progression (P<0.05) (Figure 3). These results suggest that AC can reduce of DN are still lacking. the overexpression of miR-192 and miR-200b in the kidneys Coreopsis tinctoria Nutt, also known as Kunlun snow of DN mice. chrysanthemum, is a natural plant in Xinjiang [31]. Studies have shown that AC has a variety of biological and phar- 3.7. Effects of AC on Target Gene Expression and the PI3K/AKT macological activities [21–23]. Our previous study showed Signaling Pathway. To explore the mechanisms underlying that both AC and the main flavonoid, marein, suppressed rat the protective effects of AC on the kidneys of DN mice, glomerular mesangial cell (HBZY-1) hyperplasia and signif- the expression of the miR-192 target gene ZEB2 and the icantly attenuated the expression of high glucose-disrupted miR-200b target gene PTEN was determined by western fibrotic and inflammatory proteins in HBZY-1 cells. In addi- blotting. Compared with the NC group, the expression of tion, we also found that AC and marein may decrease renal Relative expression of miRNA 8 BioMed Research International ff Table 4: Eect of AC on 24 h urine volume and 24 h urinary albumin excretion in each group ( x±SE). NC DN DN+M DN+AC Weeks 24 h UV (ml/24 h) 24 h UAE ( g/24 h) 24 h UV (ml/24 h) 24 h UAE ( g/24 h) 24 h UV (ml/24 h) 24 h UAE ( g/24 h) 24 h UV (ml/24 h) 24 h UAE ( g/24 h) 2W 4.07±0.51 1.48±0.14 14.06±1.76∗ 4.60±0.56∗ 12.25±2.14∗ 3.97±0.66∗ 12.35±1.42∗ 4.67±0.68∗ 4W 4.85±0.21 1.94±0.10 20.57±3.06∗ 5.25±0.55∗ 13.57±1.98∗#4.49±0.58∗ 15.64±2.03∗ 4.57±0.36∗ 6W 5.14±0.30 1.54±0.11 23.50±3.18∗ 5.80±0.81∗ 18.35±2.17∗ 4.61±0.37∗ 17.56±1.17∗#4.31±0.21∗# 8W 4.93±0.43 1.34±0.07 26.00±2.92∗ 6.39±0.63∗ 18.28±2.27∗#4.28±0.48∗#17.06±1.50∗#3.78±0.41∗# Note: NC: normal control mice, DN: diabetic nephropathy mice, DN+M: DN mice given 180 mg/kg metformin, and DN+AC: DN mice given 300 mg/kg AC. 24 h UV: 24 h urine volume and 24 h UAE: 24 h urinary albumin excretion.∗: P<0.05 compared with the NC group; #: P<0.05 compared with the DN group. BioMed Research International 9 3.0 ∗# 2.5 ∗# 2.0 1.5 ∗# 1.0 0.5 0.0 ZEB2 ZEB2 COL4 1 COL4 1 NC DN DN+M -actin DN+AC (a) (b) 3.5 3.0 ∗ PTEN ∗# 2.5 ∗# ∗# 2.0 PI3K p85 1.5 ∗# P-AKT 1.0 ∗#∗# 0.5 AKT 0.0 PTEN PI3K p85 P-AKT/AKT P-smad3/smad3 P-Smad3 NC Smad3 DN DN+M -actin DN+AC (c) (d) Figure 4: Eeff cts of AC on target gene expression and the PI3K/AKT signaling pathway . Western blotting was used to detect protein expression. (a) Effect of AC on the protein expression levels of ZEB2 and COL4 𝛼 1 in mouse kidneys. (b) Grey level analysis of ZEB2 and COL4𝛼 1bands. (c) Effect of AC on the protein expression levels of PTEN, PI3K p85 𝛼 , P-AKT/AKT, and P-smad3/smad3 in mouse kidneys. (d) Grey level analysis of PTEN, PI3K p85𝛼 , P-AKT/AKT, and P-smad3/smad3 bands.∗: P<0.05 compared with the NC group; #: P<0.05 compared with the DN group, one-way analysis of variance. inflammation and b fi rosis via transforming growth factor- improved, indicating that AC has a protective effect on the 𝛽 1(TGF-𝛽 1)/Smads, AMP-activated kinase protein (AMPK) kidneys of DN mice. signaling [32]. However, the effect of AC treatment on DN Many studies have shown that miRNAs play an important was not completely elucidated and needs more exploration. role in the pathogenesis of DN, and the abnormal expression Therefore, in this study, we showed the protective effect of of some miRNAs is closely related to the occurrence and AC on DN renal b fi rosis and found the possible underlying development of DN [33–35]. The expression of miR-192 and mechanisms. miR-200b is known to be increased in the kidneys of DN We used db/db mice as the research subjects and success- mice [17]. ZEB2 can bind to the miR-200b and collagen gene fully established the DN model. Here we observed that, aer ft promoter E-boxes and inhibit the transcription of the miR- AC intervention, the FBG and HbA1c level, 24 h UV, 24 h 200b and collagen genes [36–38]. Reduction of ZEB2 by UAE,andK/WweredecreasedinDNmice,andthestructural miR-192 results in increased expression of miR-200b and the abnormalities and fibrosis in the kidneys were significantly collagen gene [17]. Consistent with the results of these studies, NC DN DN+M DN+AC NC DN DN+M DN+AC Relative expression Relative expression of protein of protein 10 BioMed Research International we found a significant increase in the expression of miR-192, Data Availability miR-200b, and COL4𝛼 1 and a decrease in ZEB2 expression The data used to support the findings of this study are in the kidneys of DN mice. In contrast, AC intervention available from the corresponding author upon request. reduced miR-192 and miR-200b expression, increased ZEB2 expression, and decreased COL4𝛼 1 expression. These results suggest that the protective effect of AC on DN may be Conflicts of Interest achieved by regulating the expression level of miRNAs. The authors declare that there are no conflicts of interest Studies have shown that PTEN is the target gene of miR- regarding the publication of this paper. 200b by luciferase reporter assay [39]. PTEN, or phosphati- dylinositol-3,4,5-triphosphate (PIP3) phosphatase, can de- phosphorylate PIP3 to phosphatidylinositol-4,5-bisphos- Acknowledgments phate (PIP2), thereby antagonizing the action of PI3K, to achieve negative regulation of the PI3K/AKT pathway [40]. This work was supported by the National Natural Science Many studies have shown that PI3K/AKT signaling pathway Foundation of China (grant no. 81460162), Doctor Research activation is closely related to ECM increase in the kidney Start Fund of Xinjiang Medical University, and the eleventh [41, 42]. The decreased expression of PTEN and the activation and twelfth student innovation project of Xinjiang Medical of the PI3K/AKT pathway in DN rat kidneys may result University (grant nos. 201610760001 and 201710760019). We in increased 24 h UAE, renal b fi rosis, and mesangial cell gratefully acknowledge the purely technical help provided hypertrophy in rats [43,44].Aeft rAKT is activated by by Yujie Zhang (Medical Testing Center, Xinjiang Medical phosphorylation, the 3'C serine site of smad3 can be phos- University) and Zhicheng Lin (Department of Biochemistry phorylated [16]. Phosphorylated smad3 enters the nucleus and Molecular Biology, School of Basic Medical Sciences, and binds to the promoter of the collagen gene, increasing Xinjiang Medical University). the synthesis of collagen b fi ers, which results in increased ECM in the kidneys, a widened mesangium, and increased References basement membrane thickness [45]. Our results showed decreased expression of PTEN, [1] X. Chen and W. Yang, “Epidemic trend of diabetes in China: for increased expression of PI3K p85𝛼 ,P-AKT (Ser473), P- the xiaoren pan distinguished research award in AASD,” Journal smad3 (Ser425), and COL4𝛼 1, with an expanded mesangial of Diabetes Investigation, vol.5,no.5,pp.478–481,2014. matrix, a thickened basement membrane, and severe collagen [2] L. Wang, P. Gao, M. Zhang, Z. Huang, D. Zhang, Q. Deng et al., deposition in DN mice when compared with normal mice. “Prevalence and Ethnic Pattern of Diabetes and Prediabetes in These results are consistent with previous findings [15, 16], China in 2013,” JAMA,vol.317,no. 24,pp. 2515–2523, 2017. indicating that activation of the PI3K/AKT pathway is closely [3] Z. Wang, L. S. Adair, J. Cai et al., “Diet quality is linked to insulin resistance among adults in China,” Journal of Nutrition,vol. 147, related to renal morphological changes and b fi rosis. In article jn256180, no. 11, 2017. contrast, AC treatment significantly increased the expression [4] L.Zhang, J.Long, W. Jiangetal.,“Trends in chronic kidney of PTEN in DN mice. The expression of PI3K p85 𝛼 ,P-AKT disease in China,” eTh New England Journal of Medicine ,vol.375, (Ser473), P-smad3 (Ser425), and COL4 𝛼 1 was decreased, no. 9, pp. 905-906, 2016. and the renal pathological changes were alleviated upon AC [5] R.Z.Alicic, M.T. Rooney,and K.R. Tuttle, “Diabetic kidney treatment. These data collectively indicated that AC alleviates disease: challenges, progress, and possibilities,” Clinical Journal the production of collagen and the degree of b fi rosis possibly of the American Society of Nephrology, vol. 12, no. 12, pp. 2032– through the PI3K/AKT pathway. Although we previously 2045, 2017. showed that marein may be one of the bioactive compounds [6] S.O. Kolset,F. P.Reinholt,and T. Jenssen,“Diabetic nephropa- in AC [32], the activity of other components in AC still needs thy and extracellular matrix,” Journal of Histochemistry & to be determined in order to identify which component is the Cytochemistry, vol.60, no.12,pp.976–986, 2012. most effective one. We will continue to study other possible [7] F. C. Brosius III, “New insights into the mechanisms of fibrosis mechanisms by which AC alleviates DN and whether the and sclerosis in diabetic nephropathy,” Reviews in Endocrine and components of AC have a synergistic effect on mitigating DN. Metabolic Disorders,vol.9, no. 4, pp.245–254, 2008. [8] H. Makino, Y. Miyamoto, K. Sawai et al., “Altered gene expres- sion related to glomerulogenesis and podocyte structure in 5. Conclusions early diabetic nephropathy of db/db mice and its restoration by pioglitazone,” Diabetes, vol.55, no.10,pp.2747–2756, 2006. AC can reduce the BW, FBG,HbA1c,and 24 hUAE of DN [9] K. Sharma, P. McCue, and S. R. Dunn, “Diabetic kidney disease mice and play a protective role in DN mouse kidneys. This in the db/db mouse,” American Journal of Physiology-Renal protective effect may be achieved by the indirect modulation Physiology,vol.284, no. 6,pp. F1138–F1144,2003. of the activity of the PTEN/PI3K/AKT pathway through miR- [10] E. Aghadavod, S. Khodadadi, A. Baradaran, P. Nasri, M. 192 and itstarget gene ZEB2. These resultsmay provide Bahmani, and M. Rafieian-Kopaei, “Role of oxidative stress the theoretical basis and treatment scheme for the clinical and inflammatory factors in diabetic kidney disease,” Iranian treatment of DN. However, we will further investigate the Journal of Kidney Diseases,vol.10, no. 6, pp. 337–343, 2016. specific mechanism by which AC inhibits miR-192 expression [11] S. A. Sharaf,N.A.Kantoush, D. F. Ayoubetal.,“Altered expres- in the future. sion of WFS1 and NOTCH2 genes associated with diabetic BioMed Research International 11 nephropathy in T2DM patients,” Diabetes Research and Clinical [25] D. Du, L.Yao,R.Zhang et al., “Protective eeff cts of flavonoids Practice, vol.140,pp.304–313, 2018. from Coreopsis tinctoria Nutt. on experimental acute pancre- atitis via Nrf-2/ARE-mediated antioxidant pathways,” Journal of [12] M.Kato,H.Yuan, Z.G. Xu et al.,“Role ofthe Akt/FoxO3a Ethnopharmacology, vol. 224, pp. 261–272, 2018. pathway in TGF-beta1-mediated mesangial cell dysfunction: a [26] B. Jiang, L. Le, H. Liu et al., “Marein protects against novel mechanism related to diabetic kidney disease,” Journal of methylglyoxal-induced apoptosis by activating the AMPK path- the American Society of Nephrology,vol.17,no.12,pp.3325–3335, way in PC12 cells,” Free Radical Research, vol. 50, no. 11, pp. 1173– 1187, 2016. [13] Y. Chen, Y.Liang, T.Hu et al.,“Endogenous Namptupregu- [27] X.Yao,C.Gu,L.Tian, X.Wang,and H.Tang, “Comparative lation is associated with diabetic nephropathy inflammatory- study on the antioxidant activities of extracts of Coreopsis fibrosis through the NF-kappaB p65 and Sirt1 pathway; tinctoria flowering tops from Kunlun Mountains, Xinjiang, NMN alleviates diabetic nephropathy inflammatory-fibrosis by north-western China,” Natural Product Research,vol. 30, no.4, inhibiting endogenous Nampt,” Experimental and eTh rapeutic pp.429–432,2016. Medicine,vol.14,no.5,pp.4181–4193, 2017. [28] D. Choudhury, M. Tuncel, and M. Levi, “Diabetic nephropa- [14] D. Li, Z. Lu, Z. Xu et al., “Spironolactone promotes autophagy thy–a multifaceted target of new therapies,” Discovery Medicine, via inhibiting PI3K/AKT/mTOR signalling pathway and reduce vol. 10, no. 54, pp. 406–415, 2010. adhesive capacity damage in podocytes under mechanical [29] K. Reidy, H. M. Kang, T. Hostetter, and K. Susztak, “Molecular stress,” Bioscience Reports,vol.36,no.4,ArticleID e00355,2016. mechanisms of diabetic kidney disease,” eTh Journal of Clinical [15] D. F.Higgins, L. M.Ewart,E. Mastersonet al.,“BMP7-induced- Investigation, vol.124, no. 6,pp.2333–2340, 2014. Pten inhibits Akt and prevents renal fibrosis,” Biochimica et [30] C. Zoja, C. Zanchi, and A. Benigni, “Key pathways in renal dis- Biophysica Acta (BBA) - Molecular Basis of Disease,vol.1863, ease progression of experimental diabetes,” Nephrology Dialysis no.12,pp.3095–3104, 2017. Transplantation,vol.30, no.4,pp.iv54–iv59,2015. [16] C.E. Runyan, H.W.Schnaper, and A.-C. Poncelet, “eTh [31] A. Zx, Flora Xinjiangensis, Xinjiang Science and Health Press, Phosphatidylinositol 3-Kinase/Akt Pathway Enhances Smad3- stimulated Mesangial Cell Collagen I Expression in Response [32] L. Yao, J. Li, L. Li et al., “Coreopsis tinctoria Nutt ameliorates to Transforming Growth Factor-𝛽 1,” The Journal of Biological high glucose-induced renal fibrosis and inflammation via the Chemistry, vol.279,no.4,pp.2632–2639,2004. TGF-𝛽 1/SMADS/AMPK/NF-𝜅 B pathways,” BMC Complemen- [17] M. Kato and R. Natarajan, “MicroRNAs in diabetic nephropa- tary and Alternative Medicine,vol.19, no.1,p.14,2019. thy: functions, biomarkers, and therapeutic targets,” Annals of [33] J. Guo,J. Li,J. Zhao,S.Yang, L.Wang, and G. Cheng,“MiRNA- the New York Academy of Sciences, vol.1353, no.1,pp.72–88, 29c regulates the expression of inflammatory cytokines in diabetic nephropathy by targeting tristetraprolin,” Scientific [18] M. Kato, S.Putta,M.Wang etal.,“TGF-𝛽 activates Akt kinase Reports,vol.7,no.1,p.2314, 2017. through a microRNA-dependent amplifying circuit targeting [34] B. Wang,P.Koh, C.Winbanks et al.,“MiR-200a prevents PTEN,” Nature Cell Biology,vol.11, no. 7,pp.881–889, 2009. renal fibrogenesis through repression of TGF- 𝛽 2expression,” [19] S. Deshpande, M. Abdollahi, M. Wang, L. Lanting, M. Kato, and Diabetes, vol.60, no.1,pp. 280–287, 2011. R. Natarajan, “Reduced autophagy by a microRNA-mediated [35] Z.Zhou, J. Wan, X.Hou,J. Geng, X.Li,and X.Bai, “MicroRNA- signaling cascade in diabetes-induced renal glomerular hyper- 27a promotes podocyte injury via PPARgamma-mediated beta- trophy,” Scientific Reports ,vol.8, no. 1,p.6954, 2018. catenin activationindiabetic nephropathy,” Cell Death & [20] J. T. Park,M.Kato, H. Yuan et al., “FOG2protein down- Disease,vol.8, no. 3,p.e2658, 2017. regulation by transforming growth factor-𝛽 1-induced Mic- [36] R. Sekido, K. Murai, J. Funahashi et al., “eTh delta-crystallin roRNA-200b/c leads to akt kinase activation and glomerular enhancer-binding protein delta EF1 is a repressor of E2-box- mesangial hypertrophy related to diabetic nephropathy,” The mediated gene activation,” Molecular and Cellular Biology,vol. Journalof BiologicalChemistry, vol.288, no. 31, pp.22469– 14,no. 9, pp.5692–5700, 1994. 22480, 2013. [37] M. Kato, J.Zhang, M.Wangetal.,“MicroRNA-192 in diabetic [21] W. Wang,W.Chen,Y. Yang, T.Liu,H. Yang, and Z. Xin,“New kidney glomeruli and its function in TGF-beta-induced colla- phenolic compounds from Coreopsis tinctoria Nutt. and their gen expression via inhibition of E-box repressors,” Proceedings antioxidant and angiotensin I-converting enzyme inhibitory of the National Academy of Sciences of the United States of activities,” Journal of Agricultural and Food Chemistry,vol. 63, America, vol.104,no. 9,pp. 3432–3437,2007. no. 1, pp. 200–207, 2015. [38] M. Kato, L.Arce, M. Wang,S.Putta, L.Lanting,and R. [22] Y. Li, X.Chen, J.Xue, J.Liu,and M.Wulasihan,“Flavonoids Natarajan, “A microRNA circuit mediates transforming growth furom Coreopsis tinctoria adjust lipid metabolism in hyper- factor-𝛽 1 autoregulation in renal glomerular mesangial cells,” lipidemia animals by down-regulating adipose dieff rentiation- Kidney International, vol.80,no.4,pp.358–368,2011. related protein,” Lipids in Health and Disease,vol.13,p.193,2014. [39] Q.Wu,R.Lu,J.Li,andL.Rong,“MiR-200aandmiR-200btarget [23] W. Cai, L. Yu, Y. Zhang et al., “Extracts of Coreopsis tinctoria PTEN to regulate the endometrial cancer cell growth in vitro,” Asian Pacific Journal of Tropical Medicine ,vol.10,no.5,pp.498– Nutt. Flower Exhibit Antidiabetic Eec ff ts via the Inhibition of alpha-Glucosidase Activity,” Journal of Diabetes Research,vol. 502, 2017. 2016, Article ID 2340276, 2016. [40] F. Molinari and M. Frattini, “Functions and regulation of the PTEN gene in colorectal cancer,” Frontiers in Oncology,vol.3, [24] L. Yao, L. Li, X. Li et al., “The anti-inflammatory and antifibrotic p. .326, 2013. eeff cts of Coreopsis tinctoria Nutt on high-glucose-fat diet and streptozotocin-induced diabetic renal damage in rats,” BMC [41] J. Zhou, J. Zhong, S. Lin et al., “Inhibition of PTEN activ- Complementary and Alternative Medicine,vol.15,p.314,2015. ity aggravates post renal fibrosis in mice with ischemia 12 BioMed Research International reperfusion-induced acute kidney injury,” Cellular Physiology and Biochemistry, vol.43,no.5,pp.1841–1854,2017. [42] L. Zhu,S. Zhao,S. Liu,Q. Liu,F.Li, and J.Hao, “PTEN Regulates Renal Extracellular Matrix Deposit via Increased CTGF in Diabetes Mellitus,” Journal of Cellular Biochemistry, vol. 117, no. 5, pp. 1187–1198, 2016. [43] Y. Y. Wang,R. X. Liu,B.Guo et al.,“Down-regulation of PTEN expression in kidney and its role in development of diabetic nephropathy in rats,” Sheng Li Xue Bao: (Acta Physiologica Sinica), vol. 63, no. 4, pp. 325–332, 2011. [44] L. Mahimainathan, F. Das, B. Venkatesan, and G. G. Choud- hury, “Mesangial cell hypertrophy by high glucose is mediated by downregulation of the tumor suppressor PTEN,” Diabetes, vol. 55, no. 7, pp. 2115–2125, 2006. [45] A.Wang,F. N. Ziyadeh, Y.L.Eun et al.,“Interference with TGF-𝛽 signaling by Smad3-knockout in mice limits diabetic glomerulosclerosis without aeff cting albuminuria,” American Journal of Physiology-Renal Physiology, vol.293,no. 5,pp. F1657–F1665, 2007. International Journal of Journal of Nucleic Acids Peptides The Scientific International Journal of International Journal of World Journal Cell Biology Microbiology Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi Hindawi http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Anatomy Biochemistry Research International Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com Advances in Genetics Bioinformatics Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Advances in International Journal of International Journal of Stem Cells BioMed Zoology Virolog y Genomics International Research International Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Neuroscience Journal Enzyme Journal of Journal of Research Parasitology Research Marine Biology Archaea Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png BioMed Research International Hindawi Publishing Corporation

The Alcohol Extract of Coreopsis tinctoria Nutt Ameliorates Diabetes and Diabetic Nephropathy in db/db Mice through miR-192/miR-200b and PTEN/AKT and ZEB2/ECM Pathways

Loading next page...
 
/lp/hindawi-publishing-corporation/the-alcohol-extract-of-coreopsis-tinctoria-nutt-ameliorates-diabetes-SIqYzhqIyG

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Hindawi Publishing Corporation
Copyright
Copyright © 2019 Shunjie Yu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ISSN
2314-6133
eISSN
2314-6141
DOI
10.1155/2019/5280514
Publisher site
See Article on Publisher Site

Abstract

Hindawi BioMed Research International Volume 2019, Article ID 5280514, 12 pages https://doi.org/10.1155/2019/5280514 Research Article The Alcohol Extract of Coreopsis tinctoria Nutt Ameliorates Diabetes and Diabetic Nephropathy in db/db Mice through miR-192/miR-200b and PTEN/AKT and ZEB2/ECM Pathways 1 1 1 1 1 Shunjie Yu, Haoran Zhao, Wenjing Yang, Ramila Amat, Jun Peng, 1 1 2 1 Yike Li, Kai Deng, Xinmin Mao , and Yi Jiao Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Xinjiang Medical University, Urumqi 830011, China Traditional Chinese Medicinal College, Xinjiang Medical University, Urumqi 830011, China Correspondence should be addressed to Xinmin Mao; mxm3277@139.com and Yi Jiao; miranda812@163.com Received 20 December 2018; Accepted 3 March 2019; Published 28 March 2019 Academic Editor:Pankaj K.Bhavsar Copyright © 2019 Shunjie Yu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The study aims to investigate the eeff cts of the alcohol extract of Coreopsis tinctoria Nutt (AC) on diabetic nephropathy (DN) mice. A total of 30 db/db (DN) mice were divided into 3 groups, which were treated with AC (300 mg/kg/day), metformin (180 mg/kg/day), or saline by gavage for 10 weeks. Ten db/m mice treated with saline were used as normal control (NC group). Body weight (BW) and fasting blood glucose (FBG), HbA1c, 24 h urinary albumin excretion (UAE), and renal pathological fibrosis were analyzed. Expression of miR-192, miR-200b, and proteins in the PTEN/PI3K/AKT pathway was analyzed by qPCR or western blot. The DN mice had significantly higher BW, FBG, and 24 h UAE, as well as more severe pathological fibrosis when compared with NC. Treatment of AC could decrease BW, FBG, and 24 h UAE and alleviated kidney damage. Compared with the NC group, expressions of miR-192 and miR-200b were increased, whereas their target proteins (ZEB2 and PTEN) were reduced in the kidneys of DN mice, which further modulated the expression of their downstream proteins PI3K p85𝛼 ,P-AKT, P-smad3, and COL4𝛼 1; these proteins were increased in the kidneys of DN mice. In contrast, AC treatment reversed the expression changes of these proteins. ese Th findings demonstrate that AC may protect the kidneys of DN mice by decreasing miR-192 and miR-200b, which could further regulate their target gene expression and modulate the activity of the PTEN/PI3K/AKT pathway to reduce the degree of renal fibrosis. 1. Introduction of collagen fibers is the main characteristic of renal b fi rosis. During this process, the kidneys undergo excessive deposi- Diabetes has become one of the major public health prob- tion of collagen, which causes gradual sclerosis and scarring lems. In China, the prevalence of diabetes in adults reached of the renal parenchyma and eventually results in complete loss of kidney function [7]. 10.9% in 2013 [1–3]. Diabetic nephropathy (DN) is a common chronic microvascular complication of diabetes and is also The db/db mouse is a spontaneous diabetic model that an important cause of end-stage renal disease. Approximately exhibits many of the same characteristics as human diabetes. It has the typical clinical manifestations of diabetes such 40% of patients with diabetes have DN [4, 5]. Glomeru- lar structure hypertrophy, glomerular basement membrane as hyperglycemia, hyperlipidemia, polyphagia, and polyuria. thickening, mesangial cell proliferation, tubulointerstitial With age increasing, these mice can present early manifes- expansion, and the abnormal accumulation of extracellular tations of DN, such as microalbuminuria. As the disease matrix (ECM) components (such as collagen and b fi ronectin) progresses, large amounts of proteinuria gradually develop, are the main pathological features of DN [6]. The increase and the kidneys become diseased; eventually these effects 2 BioMed Research International develop into glomerulosclerosis and interstitial fibrosis 2.2. Analysis of AC by High Performance Liquid Chromatog- [8, 9]. raphy (HPLC). The compounds in AC were analyzed by The occurrence and development of DN may be caused HPLC (Shimadzu, Japan). AC was separated by a Shim-pack by oxidative stress, inflammatory reactions, glucose and lipid VP-ODS column (150 mm× 4.6 mm, 5𝜇 m). The mobile metabolism disorders, and other factors [10, 11]. These factors phase contained 0.5% solution A (formic acid) and solution activate multiple signaling pathways in the kidney [12–14], B (acetonitrile), with a detection wavelength of 280 nm, which may contribute to the pathogenesis of DN. Among column temperature of 35 C, and o fl w rate of 1.0 mL/min. them, the PI3K/AKT signaling pathway is closely related The elution program wasasfollows: 0 ∼ 60 min, 95∼ 80% to renal b fi rosis [15]. Activation of the PI3K/AKT signaling solution A and 5 ∼ 20% solution B; 60 ∼ 75 min, 80 ∼ pathway can phosphorylate smad3, promote the development 10% solution A and 20 ∼ 90% solution B; 75 ∼ 80 min, of collagen b fi ers in mesangial cells, and increase the degree 10∼ 95% solution A and 90∼5% solution B. According to of renal br fi osis [16]. the Chinese Pharmacopoeia on HPLC(General Rule0512), Moreover, some studies have found that the abnormal the chlorogenic acid concentration (C) was plotted on the expression of microRNA (miRNA) is closely related to the abscissa and the peak area (A) was plotted on the ordinate occurrence and development of DN [17, 18]. One study found to obtain the standard curve. The regression equation was as that the expression of miR-192 in the kidneys of DN mice follows: A = 13038C - 19022, r = 0.9991. Then, 10 𝜇 Lof the can inhibit the autophagy process of mesangial cells and chlorogenic acid reference solution (400𝜇 g/mL) or the AC lead to glomerular hypertrophy [19]. In addition, increased solution was added to a liquid chromatograph, respectively. expression of miR-200b activates the downstream PI3K/AKT The peak area of chlorogenic acid was used as a control signaling pathway, resulting in glomerular hypertrophy and to calculate the content of av fl anomarein, marein, and 3,5- collagendeposition[20]. dicaeff oylquinic acid in AC. Pharmacological studies [21–23] have shown that the alcohol extract of Coreopsis tinctoria Nutt has antihyperten- 2.3. Animals. Ten db/m mice (4 weeks old) and 30 db/db sion, antihyperlipidemia, and hypoglycemic eeff cts, as well mice (4 weeks old) were obtained from Caveven's Laboratory as anti-inflammatory and antifibrosis effects in DN [24]. Animal Co., Ltd., (Changzhou, China). The animals were However, the underlying mechanism is unclear. kept in a specific pathogen-free environment in a 12 h In this study, the role and mechanism of AC in DN light/dark cycle at 21±2 Cand 45±5% humidity for 1 week was investigated. The db/db mice were used as research of acclimatization. All mice were allowed free access to subjects. After daily administration of AC for 10 weeks, normal food and water. The study was approved by the the eeff cts of AC on body weight (BW) and biochemical Institutional Animal Care and Use Committee of the First indexes were observed to monitor the therapeutic effect Alffi iated Hospital of Xinjiang Medical University (Approval of AC on DN. Furthermore, expression of miR-192, miR- No. IACUC-20140304-158). 200b, and their target genes that belong to the phos- phatase and tensin homolog deleted on the chromosome ten 2.4. Animal Treatment and Grouping. The db/m mice (n=10) (PTEN)/phosphatidylinositol 3-kinase (PI3K)/protein kinase were used as normal control (NC). The db/db mice were B (AKT) signaling pathway in the kidney tissues of DN randomly divided into three groups, the DN group, DN+M mice was analyzed to investigate the possible mechanism group, and DN+AC group, with 10 mice in each group. underlying the eeff ct of AC. Mice in the NC group and DN group were given saline by gavage each day for 10 weeks. Mice in the DN+M group received 180 mg/kg metformin (Squibb Pharmaceutical Co., 2. Materials and Methods Ltd., Shanghai, China) by gavage each day for 10 weeks. 300 mg/kg purified AC was administrated to the DN+AC group 2.1. Preparation of AC. Dried o fl wers of Coreopsis tinctoria by gavage each day for 10 weeks. Nutt (the species was identified by Professor Junping Hu, Col- lege of Pharmacy, Xinjiang Medical University) were crushed and placed in 55% ethanol for reflux extraction. The extracted 2.5. Specimen Collection. The BW of all mice was obtained liquid was lfi tered and merged. The filtrate was concentrated every two weeks. Caudal blood was collected from all mice in a concentration tank under reduced pressure and then every two weeks, and fasting blood glucose (FBG) levels were concentrated by a multistage ash fl evaporator (DC-NSG; measured. Once every two weeks, urine was collected for 24 Jinding Technology, Henan, China). The concentrate was h, and urine volume was recorded. After 10 weeks of gavage, evaporated to approximately 600 ml in a rotary evaporator themice werefasted for 8h and then blood wascollected (R-210; Buchi, Essen, Germany) and then vacuum-dried to from the eyeballs after anesthesia by intraperitoneal injection obtain AC. AC was passed through HPD-100 macroporous of 2% pentobarbital sodium (40 mg/kg). Blood samples were resin and then eluted with 75% ethanol. The ethanol elute was used for detection of HbA1c by HPLC. After that mice were vacuum-dried to obtain the purified AC. The purified AC was sacrificed by cervical dislocation. The kidneys were dissected. accurately weighed at 0.5 g. 10 ml 60% ethanol was added to The right kidneys were kept immediately in liquid nitrogen dissolve the puriefi d AC. The solution was passed through for subsequent extraction of total RNA and protein. The left a 0.22𝜇 m microporous membrane, and the resulting filtrate kidneys were weighed to calculate kidney/weight ratio and was used as the AC solution (0.05 g/ml). then fixed in 10% formaldehyde. BioMed Research International 3 2.6. Glucose Oxidase Assay. Fasting blood glucose was mea- CTGACCTATGAATTGACAGCC, and TAATACTGCCTG- sured by a glucose assay kit (the glucose oxidase method) GTAATGATGA, respectively. qPCR was carried out in 20 (BioVision, Mountain View, CA, USA). Briefly, the blank 𝜇 L final volumes with 2 𝜇 LcDNA, 3𝜇 LRNase-free H O, wells with 20𝜇 L 0.1% NaF, standard wells with 0.28 mmol/L, 10 𝜇 L2× miRNA qPCR Master Mix (Sangon, Shanghai, 0.56 mmol/L, and 1.11 mmol/L of glucose standard, and wells China), 2𝜇 L universal PCR primer, 1𝜇 LROX ReferenceDye with plasma were set up on a 96-well plate. The volume of (Sangon, Shanghai, China), and 2𝜇 Lspecicfi primers. qPCR each well was 20𝜇 L. Then, 180 𝜇 L of glucose oxidase was was performed with a real-time PCR thermocycler (Applied added to each well and incubated at 37 Cfor 45 minat 200 Biosystems, Foster City, CA, USA) under the following con- rpm. The optical density of each well was measured at a ditions: predenaturation at 95 C for 5 s and then 40 cycles of ∘ ∘ wavelength of 505 nm with a microplate reader (xMark, Bio- denaturation at 95 C for 30 s and annealing/extension at 60 C Rad, Hercules, CA, USA). A standard curve was generated for30s.miR-192andmiR-200brelativeexpressionlevelswere −ΔΔCt and the fasting blood glucose concentration was calculated. calculated using the2 method and normalized to the expression of U6. 2.7. ELISA. The content of urinary albumin was determined 2.10. Western Blotting. The right kidneys were lysed with by a mouse urinary albumin ELISA kit (Chenglin Biological the RIPA lysis buffer (Thermo Fisher Scientific, Waltham, Technology Co., Ltd., Beijing, China). Briefly, blank wells, MA, USA) containing a protease and phosphatase inhibitor standard wells (360𝜇 g/L, 240𝜇 g/L, 120𝜇 g/L, 60𝜇 g/L, and cocktail (Abcam, Cambridge, MA, USA). The supernatant 30𝜇 g/L), and sample wells were set on the ELISA plate. Then, was collected by centrifugation at 12000 rpm for 10 min, 10𝜇 L of mouse urine was added to each sample well, and the and the total protein concentration was measured by the plate was incubated at 37 Cfor 30 min. Aeft r washing, 50 𝜇 L BCA method. Proteins were separated by electrophoresis and reagent A and 50𝜇 L reagent B were added to each well and transferred onto PVDF membranes (Millipore, USA). After incubated at 37 Cfor 15 minin the dark.Thereaction was blocking in 5% nonfat milk at room temperature for 1 h, stopped by adding a 50𝜇 L stop solution. The absorbance of the membranes were incubated at 4 C overnight with diluted each well was measured by a microplate reader (Bio-Rad) at primary antibodies to ZEB2, PTEN, PI3K p85𝛼 ,AKT, P- 450 nm wavelength. smad3, smad3, and COL4𝛼 1 (all with 1:1000 dilution; Abcam, Cambridge, MA, USA),𝛽 -actin (1:2000; ZSGB-BIO, Beijing, 2.8. H&E and Masson’s Staining. The left kidney tissues were China),and P-AKT (1:5000; Abcam,USA). Aeft r rinsing, xfi ed in a 10% formaldehyde solution for 24 h, and then, tissue the membranes were incubated with an HRP-labeled anti- sections were prepared and subjected to hematoxylin and mouse or anti-rabbit secondary antibody (1:5000; ZSGB-BIO, eosin (H&E) and Masson’s staining as follows. First, the tissue Beijing, China) for 1 h at room temperature. After rinsing, was dehydrated with graded ethanol and transparentized the membranes were developed with enhanced chemilu- with xylene.Then,the tissue was embedded in paranffi and minescence (Thermo Fisher Scientific, USA). Images were cut into 3∼4𝜇 m sections. The tissue sections were stained acquired by an image acquisition system (Gel Doc XR+; Bio- with H&E and Masson’s according to routine procedure. Rad, USA), and the grey values were determined by ImageJ The morphological changes of the kidneys were observed sow ft are. under a light microscope (SZX7-1093; Olympus, Japan). Histological evaluation was performed in a blinded manner. 2.11. Statistical Analysis. SPSS 19.0 statistical sowa ft re (Chica- The mesangial expansion index from 30 glomeruli of each go, IL, USA) was used for analysis. The data were expressed as mouse was graded in four levels from 0 to 3 [24]: grade 0, the means± standard error. The differences among multiple normal glomerulus; grade 1, matrix expansion occurring in groups were analyzed by one-way analysis of variance. P<0.05 up to 50% of a glomerulus; grade 2, 50%–75% expansion; and was considered statistically significant. grade 3, 75%–100% expansion. For Masson’s staining, four levels of fibrosis from 30 glomeruli of each mouse were scored 3. Results by measuring the percentage area of blue-purple staining as follows: grade 0, absent or< 25%; grade 1, 25%–50%; grade 3.1. HPLC Analysis of AC. AC contains amino acids, polysac- 2, 50%–75%; and grade 3, 75%–100%, and the mean score of charides, volatile oils, flavono ids, and organic phenolic acids. each mouse was calculated and compared. A total of 5 mice Among them, flavonoids (flavanomarein, marein) and phe- in each group were analyzed. nolic acids (chlorogenic acid, 3,5-dicaeo ff ylquinic acid) are the main active components of AC and are closely related 2.9. Real-Time Quantitative PCR (qPCR). Total RNAs of the renal to the pharmacological action of Coreopsis tinctoria Nutt tissues were extracted with the miRNA extraction kit (Sangon [25–27]. By HPLC analysis, we found that chlorogenic acid, Biotech Co., Ltd., Shanghai, China). Reverse transcription flavanomarein, marein, and 3,5-dicaeo ff ylquinic acid were was performed using a miRNA rs fi t-strand cDNA (synthe- the main avon fl oids and phenolic compounds of AC. The sis tail method) kit (Sangon Biotech Co., Ltd., Shanghai, content of these bioactive components in AC was determined China). Specific primers for U6, miR-192, and miR-200b were by a quantitative assay of multiple components with chloro- designed by Qiagen (Valencia, CA, USA), and the primer genic acid as a single marker, as shown in Figure 1 and 󸀠 󸀠 sequences (5 󳨀→ 3 ) were AACGCTTCACGAATTTGCGT, Table 1. 4 BioMed Research International uV 120000 P2 80000 P3 P1 30000 P4 min 0 10 20 30 40 50 60 70 Figure 1: HPLC analysis of AC. HPLC analysis of AC at 280 nm wavelength. eTh four main compounds were chlorogenic acid (P1), flavanomarein (P2), marein (P3), and 3,5-dicaeo ff ylquinic acid (P4). Table 1: Contents of the main flavonoids and phenolic acids in AC (P<0.05) (Table 3). These results suggest that AC can reduce (mg/g). HbA1c level and K/W in DN mice. Peak no. Compounds Content 3.4. Change in 24 h Urine Volume (24 h UV) and 24 h Urinary Chlorogenic P1 26.27 Albumin Excretion (24 h UAE) aer ft Treatment with AC. To acid observe the effects of AC on 24 h UV and 24 h UAE in DN P2 Flavanomarein 138.5 mice, we collected the24 h urineof miceand detected the24 P3 Marein 268.56 h UAE every 2 weeks. Compared with those of the NC group, 3,5- the 24h UV and 24h UAEof mice in each DN group were P4 Dicaeff oylquinic 16.39 significantly higher at 2, 4, 6, and 8 weeks ( P<0.05) (Table 4). acid Compared with that of the DN group, the 24 h UV in the DN+M group decreased at 4 and 8 weeks, and the 24 h UAE in the DN+M group decreased at 8 weeks (P<0.05) (Table 4). At both 6 and 8 weeks, the 24 h UV and UAE decreased in the 3.2. Change in BW and FBG after Treatment with AC. To DN+AC group (P<0.05) (Table 4). These results suggest that observe the effect of AC on the weight of the DN mice, BW AC canreduce24 hUV and 24 h UAE inDN mice. was monitored. We found that mice from the DN, DN+M, and DN+AC groups were significantly heavier than those of 3.5. Eec ff t of AC on Renal Histology. At the end of treatment, the NC group from 0-10 weeks (P<0.05) (Table 2). Compared renal tissues were examined by H&E staining and Masson’s with that of the DN group, the BW of mice in the DN+M staining. As shown in Figure 2(a), the glomeruli of the mice group was lower at 8 and 10 weeks (P<0.05), and the BW in the NC group had a clear structure, normal volume, of the DN+AC group mice was also signicfi antly lower at normal mesangial matrix, and clear and patent tubular 10 weeks (P<0.05) (Table 2). To observe the effect of AC lumen. In the DN group, the glomerular volume of most on the FBG levels of the DN mice, we tested FBG every 2 mice was obviously increased, the mesangium was enlarged, weeks and found that the FBG in all the DN groups increased the basement membrane was thickened, and there were significantly compared with that of the NC group from 0 to vacuole-like changes in the renal tubules. In the DN+M 10 weeks (P<0.05). Compared with that of the DN group, and DN+AC groups, the pathological changes of DN were themiceinthe DN+M grouphad lower FBG (P<0.05) at 8 alleviated (P<0.05) (Figure 2(c)). The glomerular volume was weeks, whereas the FBG of the mice in the DN+AC group smaller than that of mice in the DN group; in addition, the was lower at 4, 6, 8, and 10 weeks (P<0.05) (Table 2). These mesangium showed mild widening, the basement membrane results suggest that AC can reduce the elevated BW and FBG was mildly thickened, and the tubular vacuole-like changes levels in DN mice. were reduced. By Masson’s staining, no obvious blue-purple collagen fibers in the glomerular, tubular, or renal interstitials 3.3. Effects of AC on HbA1c and Kidney/Weight Ratio (K/W). were observed in the NC group mice. In the DN group, the To observe the eeff cts of AC on blood glucose control and staining of the blue-purple collagen b fi ers was obvious, and kidney damage in DN mice, we measured the level of HbA1c the deposition of renal interstitial collagen b fi ers was obvious. and the K/W value at 10 weeks. Compared with the NC The blue-purple collagen b fi ers in the glomerular, tubular, group, the HbA1c level and K/W of the mice in the DN group and renal interstitials of the DN+M and DN+AC groups were were significantly increased ( P<0.05) (Table 3). The DN+M fewer than those in the DN group (P<0.05) (Figures 2(b) and 2(c)). These results suggest that AC and metformin can group had lower K/W (P<0.05) than the DN group, while the DN+AC group had both lower HbA1c and lower K/W alleviate DN mouse kidney mesangial widening, basement BioMed Research International 5 Table 2: Effect of AC on body weight and fasting blood glucose in each group ( x±SE, g, mmol/L). NC DN DN+M DN+AC Weeks BW (g) FBG (mM) BW (g) FBG (mM) BW (g) FBG (mM) BW (g) FBG (mM) 0W 16.87±0.46 4.26±0.22 30.46±1.63∗ 9.34±0.98∗ 30.61±0.83∗ 8.39±0.33∗ 30.64±1.42∗ 8.18±0.78∗ 2W 20.89±0.39 4.85±0.13 35.33±2.24∗ 12.77±1.15∗ 33.02±1.06∗ 10.91±0.99∗ 33.53±1.60∗ 10.04±1.04∗ 4W 21.28±0.31 5.24±0.42 38.56±2.02∗ 14.02±1.94∗ 34.67±1.52∗ 12.15±1.48∗ 35.35±1.66∗ 9.92±1.15∗# 6W 23.45±0.45 5.34±0.15 41.50±2.24∗ 15.26±1.78∗ 37.39±1.49∗ 12.27±1.54∗ 38.16±1.44∗ 10.53±1.28∗# 8W 23.83±0.50 7.13±0.42 44.57±1.24∗ 17.16±1.96∗ 38.10±1.72∗#12.82±1.64∗#40.45±1.64∗ 11.13±1.31# 10 W 24.55±0.40 7.20±0.50 46.38±1.85∗ 19.02±2.00∗ 39.73±1.95∗#14.59±2.00∗ 41.06±1.85∗#13.88±1.60∗# Note: NC: normal control mice, DN: diabetic nephropathy mice, DN+M: DN mice given 180 mg/kg metformin, and DN+AC: DN mice given 300 mg/kg AC. BW: body weight and FBG: basting blood glucose.∗: P<0.05 compared with the NC group; #: P<0.05 compared with the DN group. 6 BioMed Research International NC group DN group DN+M group DN+AC group (a) NC group DN group DN+M group DN+AC group (b) 1.8 ∗ 1.8 1.6 1.6 ∗# ∗# 1.4 1.4 ∗# ∗# 1.2 1.2 0.8 0.8 0.6 0.6 0.4 0.4 0.2 0.2 NC DN DN+M DN+AC NC DN DN+M DN+AC (c) Figure 2: Renal tissue morphology in four groups of mice. Mice were divided into the NC group, DN group, DN+M group, and DN+AC group. (a) H&E staining of renal tissue morphology in four groups of mice. (b) Masson’s staining of renal tissue morphology in four groups of mice. Large figures (200 x), scale bar, 100 𝜇 m, and small figures (400 x), scale bar, 5 𝜇 m. (c) Matrix expansion and area of fibrosis were semiquantitatively analyzed from 30 glomeruli per mouse with 5 mice in each group.∗: P<0.05 compared with the NC group; #: P<0.05 compared with the DN group, one-way analysis of variance. Matrix expansion score Fibrosis area score BioMed Research International 7 2.0 1.5 ∗ # # 1.0 0.5 0.0 NC DN DN+M DN+AC miR-192 miR-200b Figure 3: Effects of AC on the expression of miR-192 and miR-200b in mouse kidneys. Expression of miR-192 and miR-200b in mouse kidneys was detected by qPCR. U6 snRNA was used as internal control.∗: P<0.05 compared with the NC group; #: P<0.05 compared with the DN group, one-way analysis of variance. Table 3: Effect of AC on HbA1c and kidney/weight ratio in each ZEB2 and PTEN protein in the kidneys of the DN group was group (x±SE). significantly decreased, which could be further rescued by the addition of metformin or AC (Figures 4(a)-4(d)). Next Group HbA1c (%) K/W we examined the expression of proteins in the PI3K/AKT NC 4.12±0.11 5.88±0.15 signaling pathway, since this pathway is thought to play an DN 7.61±0.31∗ 7.47±0.70∗ important role in renal fibrosis. Compared with the NC group, the expression of PI3K p85𝛼 ,P-AKT (Ser473),P- DN+M 7.20±0.42∗ 5.14±0.41# smad3 (Ser425), and COL4𝛼 1inDN mousekidneyswas DN+AC 6.53±0.41∗#5.20±0.43# significantly increased ( P<0.05). In addition, the expression Note:NC:normal control mice,DN:diabeticnephropathymice,DN+M:DN of PI3K p85𝛼 and P-AKT (Ser473) in the DN+M group was mice given 180 mg/kg metformin, and DN+AC: DN mice given 300 mg/kg decreased significantly, and the expression of PI3K p85 𝛼 , AC. K/W: Kidney/weight ratio.∗: P<0.05 compared with the NC group; #: P<0.05 compared with the DN group. P-AKT (Ser473), P-smad3 (Ser425), and COL4 𝛼 1inthe DN+AC group was decreased signicfi antly ( P<0.05) when compared with the DN group (Figures 4(a)-4(d)). These membrane thickening, and tubular vacuolar changes, as well results suggest that the anti-renal-fibrosis activity of AC may as thedepositionofcollagenfibers, therefore playing a be related to increased expression of ZEB2 and inhibited protective role in DN mouse kidneys. activation of the PTEN/PI3K/AKT signaling pathway. 3.6. Effects of AC on the Expression of miR-192 and miR- 200b in Mouse Kidneys. To investigate the expression of 4. Discussion miR-192 and miR-200b in the kidneys of DN mice and to observe the eeff cts of AC on the expression of these miRNAs, DN is a chronic complication secondary to diabetes. It is qPCR was performed. The expression of miR-192 and miR- reported that DN has a 5-year survival rate of only 20% in 200b was significantly increased in the DN group compared patients with kidney failure [28]. Although understanding of with NC (P<0.05); however, treatment with metformin or the molecular mechanism of DN has progressed in recent AC significantly decreased the expression of these miRNAs years [29, 30], therapies to prevent or reverse the progression (P<0.05) (Figure 3). These results suggest that AC can reduce of DN are still lacking. the overexpression of miR-192 and miR-200b in the kidneys Coreopsis tinctoria Nutt, also known as Kunlun snow of DN mice. chrysanthemum, is a natural plant in Xinjiang [31]. Studies have shown that AC has a variety of biological and phar- 3.7. Effects of AC on Target Gene Expression and the PI3K/AKT macological activities [21–23]. Our previous study showed Signaling Pathway. To explore the mechanisms underlying that both AC and the main flavonoid, marein, suppressed rat the protective effects of AC on the kidneys of DN mice, glomerular mesangial cell (HBZY-1) hyperplasia and signif- the expression of the miR-192 target gene ZEB2 and the icantly attenuated the expression of high glucose-disrupted miR-200b target gene PTEN was determined by western fibrotic and inflammatory proteins in HBZY-1 cells. In addi- blotting. Compared with the NC group, the expression of tion, we also found that AC and marein may decrease renal Relative expression of miRNA 8 BioMed Research International ff Table 4: Eect of AC on 24 h urine volume and 24 h urinary albumin excretion in each group ( x±SE). NC DN DN+M DN+AC Weeks 24 h UV (ml/24 h) 24 h UAE ( g/24 h) 24 h UV (ml/24 h) 24 h UAE ( g/24 h) 24 h UV (ml/24 h) 24 h UAE ( g/24 h) 24 h UV (ml/24 h) 24 h UAE ( g/24 h) 2W 4.07±0.51 1.48±0.14 14.06±1.76∗ 4.60±0.56∗ 12.25±2.14∗ 3.97±0.66∗ 12.35±1.42∗ 4.67±0.68∗ 4W 4.85±0.21 1.94±0.10 20.57±3.06∗ 5.25±0.55∗ 13.57±1.98∗#4.49±0.58∗ 15.64±2.03∗ 4.57±0.36∗ 6W 5.14±0.30 1.54±0.11 23.50±3.18∗ 5.80±0.81∗ 18.35±2.17∗ 4.61±0.37∗ 17.56±1.17∗#4.31±0.21∗# 8W 4.93±0.43 1.34±0.07 26.00±2.92∗ 6.39±0.63∗ 18.28±2.27∗#4.28±0.48∗#17.06±1.50∗#3.78±0.41∗# Note: NC: normal control mice, DN: diabetic nephropathy mice, DN+M: DN mice given 180 mg/kg metformin, and DN+AC: DN mice given 300 mg/kg AC. 24 h UV: 24 h urine volume and 24 h UAE: 24 h urinary albumin excretion.∗: P<0.05 compared with the NC group; #: P<0.05 compared with the DN group. BioMed Research International 9 3.0 ∗# 2.5 ∗# 2.0 1.5 ∗# 1.0 0.5 0.0 ZEB2 ZEB2 COL4 1 COL4 1 NC DN DN+M -actin DN+AC (a) (b) 3.5 3.0 ∗ PTEN ∗# 2.5 ∗# ∗# 2.0 PI3K p85 1.5 ∗# P-AKT 1.0 ∗#∗# 0.5 AKT 0.0 PTEN PI3K p85 P-AKT/AKT P-smad3/smad3 P-Smad3 NC Smad3 DN DN+M -actin DN+AC (c) (d) Figure 4: Eeff cts of AC on target gene expression and the PI3K/AKT signaling pathway . Western blotting was used to detect protein expression. (a) Effect of AC on the protein expression levels of ZEB2 and COL4 𝛼 1 in mouse kidneys. (b) Grey level analysis of ZEB2 and COL4𝛼 1bands. (c) Effect of AC on the protein expression levels of PTEN, PI3K p85 𝛼 , P-AKT/AKT, and P-smad3/smad3 in mouse kidneys. (d) Grey level analysis of PTEN, PI3K p85𝛼 , P-AKT/AKT, and P-smad3/smad3 bands.∗: P<0.05 compared with the NC group; #: P<0.05 compared with the DN group, one-way analysis of variance. inflammation and b fi rosis via transforming growth factor- improved, indicating that AC has a protective effect on the 𝛽 1(TGF-𝛽 1)/Smads, AMP-activated kinase protein (AMPK) kidneys of DN mice. signaling [32]. However, the effect of AC treatment on DN Many studies have shown that miRNAs play an important was not completely elucidated and needs more exploration. role in the pathogenesis of DN, and the abnormal expression Therefore, in this study, we showed the protective effect of of some miRNAs is closely related to the occurrence and AC on DN renal b fi rosis and found the possible underlying development of DN [33–35]. The expression of miR-192 and mechanisms. miR-200b is known to be increased in the kidneys of DN We used db/db mice as the research subjects and success- mice [17]. ZEB2 can bind to the miR-200b and collagen gene fully established the DN model. Here we observed that, aer ft promoter E-boxes and inhibit the transcription of the miR- AC intervention, the FBG and HbA1c level, 24 h UV, 24 h 200b and collagen genes [36–38]. Reduction of ZEB2 by UAE,andK/WweredecreasedinDNmice,andthestructural miR-192 results in increased expression of miR-200b and the abnormalities and fibrosis in the kidneys were significantly collagen gene [17]. Consistent with the results of these studies, NC DN DN+M DN+AC NC DN DN+M DN+AC Relative expression Relative expression of protein of protein 10 BioMed Research International we found a significant increase in the expression of miR-192, Data Availability miR-200b, and COL4𝛼 1 and a decrease in ZEB2 expression The data used to support the findings of this study are in the kidneys of DN mice. In contrast, AC intervention available from the corresponding author upon request. reduced miR-192 and miR-200b expression, increased ZEB2 expression, and decreased COL4𝛼 1 expression. These results suggest that the protective effect of AC on DN may be Conflicts of Interest achieved by regulating the expression level of miRNAs. The authors declare that there are no conflicts of interest Studies have shown that PTEN is the target gene of miR- regarding the publication of this paper. 200b by luciferase reporter assay [39]. PTEN, or phosphati- dylinositol-3,4,5-triphosphate (PIP3) phosphatase, can de- phosphorylate PIP3 to phosphatidylinositol-4,5-bisphos- Acknowledgments phate (PIP2), thereby antagonizing the action of PI3K, to achieve negative regulation of the PI3K/AKT pathway [40]. This work was supported by the National Natural Science Many studies have shown that PI3K/AKT signaling pathway Foundation of China (grant no. 81460162), Doctor Research activation is closely related to ECM increase in the kidney Start Fund of Xinjiang Medical University, and the eleventh [41, 42]. The decreased expression of PTEN and the activation and twelfth student innovation project of Xinjiang Medical of the PI3K/AKT pathway in DN rat kidneys may result University (grant nos. 201610760001 and 201710760019). We in increased 24 h UAE, renal b fi rosis, and mesangial cell gratefully acknowledge the purely technical help provided hypertrophy in rats [43,44].Aeft rAKT is activated by by Yujie Zhang (Medical Testing Center, Xinjiang Medical phosphorylation, the 3'C serine site of smad3 can be phos- University) and Zhicheng Lin (Department of Biochemistry phorylated [16]. Phosphorylated smad3 enters the nucleus and Molecular Biology, School of Basic Medical Sciences, and binds to the promoter of the collagen gene, increasing Xinjiang Medical University). the synthesis of collagen b fi ers, which results in increased ECM in the kidneys, a widened mesangium, and increased References basement membrane thickness [45]. Our results showed decreased expression of PTEN, [1] X. Chen and W. Yang, “Epidemic trend of diabetes in China: for increased expression of PI3K p85𝛼 ,P-AKT (Ser473), P- the xiaoren pan distinguished research award in AASD,” Journal smad3 (Ser425), and COL4𝛼 1, with an expanded mesangial of Diabetes Investigation, vol.5,no.5,pp.478–481,2014. matrix, a thickened basement membrane, and severe collagen [2] L. Wang, P. Gao, M. Zhang, Z. Huang, D. Zhang, Q. Deng et al., deposition in DN mice when compared with normal mice. “Prevalence and Ethnic Pattern of Diabetes and Prediabetes in These results are consistent with previous findings [15, 16], China in 2013,” JAMA,vol.317,no. 24,pp. 2515–2523, 2017. indicating that activation of the PI3K/AKT pathway is closely [3] Z. Wang, L. S. Adair, J. Cai et al., “Diet quality is linked to insulin resistance among adults in China,” Journal of Nutrition,vol. 147, related to renal morphological changes and b fi rosis. In article jn256180, no. 11, 2017. contrast, AC treatment significantly increased the expression [4] L.Zhang, J.Long, W. Jiangetal.,“Trends in chronic kidney of PTEN in DN mice. The expression of PI3K p85 𝛼 ,P-AKT disease in China,” eTh New England Journal of Medicine ,vol.375, (Ser473), P-smad3 (Ser425), and COL4 𝛼 1 was decreased, no. 9, pp. 905-906, 2016. and the renal pathological changes were alleviated upon AC [5] R.Z.Alicic, M.T. Rooney,and K.R. Tuttle, “Diabetic kidney treatment. These data collectively indicated that AC alleviates disease: challenges, progress, and possibilities,” Clinical Journal the production of collagen and the degree of b fi rosis possibly of the American Society of Nephrology, vol. 12, no. 12, pp. 2032– through the PI3K/AKT pathway. Although we previously 2045, 2017. showed that marein may be one of the bioactive compounds [6] S.O. Kolset,F. P.Reinholt,and T. Jenssen,“Diabetic nephropa- in AC [32], the activity of other components in AC still needs thy and extracellular matrix,” Journal of Histochemistry & to be determined in order to identify which component is the Cytochemistry, vol.60, no.12,pp.976–986, 2012. most effective one. We will continue to study other possible [7] F. C. Brosius III, “New insights into the mechanisms of fibrosis mechanisms by which AC alleviates DN and whether the and sclerosis in diabetic nephropathy,” Reviews in Endocrine and components of AC have a synergistic effect on mitigating DN. Metabolic Disorders,vol.9, no. 4, pp.245–254, 2008. [8] H. Makino, Y. Miyamoto, K. Sawai et al., “Altered gene expres- sion related to glomerulogenesis and podocyte structure in 5. Conclusions early diabetic nephropathy of db/db mice and its restoration by pioglitazone,” Diabetes, vol.55, no.10,pp.2747–2756, 2006. AC can reduce the BW, FBG,HbA1c,and 24 hUAE of DN [9] K. Sharma, P. McCue, and S. R. Dunn, “Diabetic kidney disease mice and play a protective role in DN mouse kidneys. This in the db/db mouse,” American Journal of Physiology-Renal protective effect may be achieved by the indirect modulation Physiology,vol.284, no. 6,pp. F1138–F1144,2003. of the activity of the PTEN/PI3K/AKT pathway through miR- [10] E. Aghadavod, S. Khodadadi, A. Baradaran, P. Nasri, M. 192 and itstarget gene ZEB2. These resultsmay provide Bahmani, and M. Rafieian-Kopaei, “Role of oxidative stress the theoretical basis and treatment scheme for the clinical and inflammatory factors in diabetic kidney disease,” Iranian treatment of DN. However, we will further investigate the Journal of Kidney Diseases,vol.10, no. 6, pp. 337–343, 2016. specific mechanism by which AC inhibits miR-192 expression [11] S. A. Sharaf,N.A.Kantoush, D. F. Ayoubetal.,“Altered expres- in the future. sion of WFS1 and NOTCH2 genes associated with diabetic BioMed Research International 11 nephropathy in T2DM patients,” Diabetes Research and Clinical [25] D. Du, L.Yao,R.Zhang et al., “Protective eeff cts of flavonoids Practice, vol.140,pp.304–313, 2018. from Coreopsis tinctoria Nutt. on experimental acute pancre- atitis via Nrf-2/ARE-mediated antioxidant pathways,” Journal of [12] M.Kato,H.Yuan, Z.G. Xu et al.,“Role ofthe Akt/FoxO3a Ethnopharmacology, vol. 224, pp. 261–272, 2018. pathway in TGF-beta1-mediated mesangial cell dysfunction: a [26] B. Jiang, L. Le, H. Liu et al., “Marein protects against novel mechanism related to diabetic kidney disease,” Journal of methylglyoxal-induced apoptosis by activating the AMPK path- the American Society of Nephrology,vol.17,no.12,pp.3325–3335, way in PC12 cells,” Free Radical Research, vol. 50, no. 11, pp. 1173– 1187, 2016. [13] Y. Chen, Y.Liang, T.Hu et al.,“Endogenous Namptupregu- [27] X.Yao,C.Gu,L.Tian, X.Wang,and H.Tang, “Comparative lation is associated with diabetic nephropathy inflammatory- study on the antioxidant activities of extracts of Coreopsis fibrosis through the NF-kappaB p65 and Sirt1 pathway; tinctoria flowering tops from Kunlun Mountains, Xinjiang, NMN alleviates diabetic nephropathy inflammatory-fibrosis by north-western China,” Natural Product Research,vol. 30, no.4, inhibiting endogenous Nampt,” Experimental and eTh rapeutic pp.429–432,2016. Medicine,vol.14,no.5,pp.4181–4193, 2017. [28] D. Choudhury, M. Tuncel, and M. Levi, “Diabetic nephropa- [14] D. Li, Z. Lu, Z. Xu et al., “Spironolactone promotes autophagy thy–a multifaceted target of new therapies,” Discovery Medicine, via inhibiting PI3K/AKT/mTOR signalling pathway and reduce vol. 10, no. 54, pp. 406–415, 2010. adhesive capacity damage in podocytes under mechanical [29] K. Reidy, H. M. Kang, T. Hostetter, and K. Susztak, “Molecular stress,” Bioscience Reports,vol.36,no.4,ArticleID e00355,2016. mechanisms of diabetic kidney disease,” eTh Journal of Clinical [15] D. F.Higgins, L. M.Ewart,E. Mastersonet al.,“BMP7-induced- Investigation, vol.124, no. 6,pp.2333–2340, 2014. Pten inhibits Akt and prevents renal fibrosis,” Biochimica et [30] C. Zoja, C. Zanchi, and A. Benigni, “Key pathways in renal dis- Biophysica Acta (BBA) - Molecular Basis of Disease,vol.1863, ease progression of experimental diabetes,” Nephrology Dialysis no.12,pp.3095–3104, 2017. Transplantation,vol.30, no.4,pp.iv54–iv59,2015. [16] C.E. Runyan, H.W.Schnaper, and A.-C. Poncelet, “eTh [31] A. Zx, Flora Xinjiangensis, Xinjiang Science and Health Press, Phosphatidylinositol 3-Kinase/Akt Pathway Enhances Smad3- stimulated Mesangial Cell Collagen I Expression in Response [32] L. Yao, J. Li, L. Li et al., “Coreopsis tinctoria Nutt ameliorates to Transforming Growth Factor-𝛽 1,” The Journal of Biological high glucose-induced renal fibrosis and inflammation via the Chemistry, vol.279,no.4,pp.2632–2639,2004. TGF-𝛽 1/SMADS/AMPK/NF-𝜅 B pathways,” BMC Complemen- [17] M. Kato and R. Natarajan, “MicroRNAs in diabetic nephropa- tary and Alternative Medicine,vol.19, no.1,p.14,2019. thy: functions, biomarkers, and therapeutic targets,” Annals of [33] J. Guo,J. Li,J. Zhao,S.Yang, L.Wang, and G. Cheng,“MiRNA- the New York Academy of Sciences, vol.1353, no.1,pp.72–88, 29c regulates the expression of inflammatory cytokines in diabetic nephropathy by targeting tristetraprolin,” Scientific [18] M. Kato, S.Putta,M.Wang etal.,“TGF-𝛽 activates Akt kinase Reports,vol.7,no.1,p.2314, 2017. through a microRNA-dependent amplifying circuit targeting [34] B. Wang,P.Koh, C.Winbanks et al.,“MiR-200a prevents PTEN,” Nature Cell Biology,vol.11, no. 7,pp.881–889, 2009. renal fibrogenesis through repression of TGF- 𝛽 2expression,” [19] S. Deshpande, M. Abdollahi, M. Wang, L. Lanting, M. Kato, and Diabetes, vol.60, no.1,pp. 280–287, 2011. R. Natarajan, “Reduced autophagy by a microRNA-mediated [35] Z.Zhou, J. Wan, X.Hou,J. Geng, X.Li,and X.Bai, “MicroRNA- signaling cascade in diabetes-induced renal glomerular hyper- 27a promotes podocyte injury via PPARgamma-mediated beta- trophy,” Scientific Reports ,vol.8, no. 1,p.6954, 2018. catenin activationindiabetic nephropathy,” Cell Death & [20] J. T. Park,M.Kato, H. Yuan et al., “FOG2protein down- Disease,vol.8, no. 3,p.e2658, 2017. regulation by transforming growth factor-𝛽 1-induced Mic- [36] R. Sekido, K. Murai, J. Funahashi et al., “eTh delta-crystallin roRNA-200b/c leads to akt kinase activation and glomerular enhancer-binding protein delta EF1 is a repressor of E2-box- mesangial hypertrophy related to diabetic nephropathy,” The mediated gene activation,” Molecular and Cellular Biology,vol. Journalof BiologicalChemistry, vol.288, no. 31, pp.22469– 14,no. 9, pp.5692–5700, 1994. 22480, 2013. [37] M. Kato, J.Zhang, M.Wangetal.,“MicroRNA-192 in diabetic [21] W. Wang,W.Chen,Y. Yang, T.Liu,H. Yang, and Z. Xin,“New kidney glomeruli and its function in TGF-beta-induced colla- phenolic compounds from Coreopsis tinctoria Nutt. and their gen expression via inhibition of E-box repressors,” Proceedings antioxidant and angiotensin I-converting enzyme inhibitory of the National Academy of Sciences of the United States of activities,” Journal of Agricultural and Food Chemistry,vol. 63, America, vol.104,no. 9,pp. 3432–3437,2007. no. 1, pp. 200–207, 2015. [38] M. Kato, L.Arce, M. Wang,S.Putta, L.Lanting,and R. [22] Y. Li, X.Chen, J.Xue, J.Liu,and M.Wulasihan,“Flavonoids Natarajan, “A microRNA circuit mediates transforming growth furom Coreopsis tinctoria adjust lipid metabolism in hyper- factor-𝛽 1 autoregulation in renal glomerular mesangial cells,” lipidemia animals by down-regulating adipose dieff rentiation- Kidney International, vol.80,no.4,pp.358–368,2011. related protein,” Lipids in Health and Disease,vol.13,p.193,2014. [39] Q.Wu,R.Lu,J.Li,andL.Rong,“MiR-200aandmiR-200btarget [23] W. Cai, L. Yu, Y. Zhang et al., “Extracts of Coreopsis tinctoria PTEN to regulate the endometrial cancer cell growth in vitro,” Asian Pacific Journal of Tropical Medicine ,vol.10,no.5,pp.498– Nutt. Flower Exhibit Antidiabetic Eec ff ts via the Inhibition of alpha-Glucosidase Activity,” Journal of Diabetes Research,vol. 502, 2017. 2016, Article ID 2340276, 2016. [40] F. Molinari and M. Frattini, “Functions and regulation of the PTEN gene in colorectal cancer,” Frontiers in Oncology,vol.3, [24] L. Yao, L. Li, X. Li et al., “The anti-inflammatory and antifibrotic p. .326, 2013. eeff cts of Coreopsis tinctoria Nutt on high-glucose-fat diet and streptozotocin-induced diabetic renal damage in rats,” BMC [41] J. Zhou, J. Zhong, S. Lin et al., “Inhibition of PTEN activ- Complementary and Alternative Medicine,vol.15,p.314,2015. ity aggravates post renal fibrosis in mice with ischemia 12 BioMed Research International reperfusion-induced acute kidney injury,” Cellular Physiology and Biochemistry, vol.43,no.5,pp.1841–1854,2017. [42] L. Zhu,S. Zhao,S. Liu,Q. Liu,F.Li, and J.Hao, “PTEN Regulates Renal Extracellular Matrix Deposit via Increased CTGF in Diabetes Mellitus,” Journal of Cellular Biochemistry, vol. 117, no. 5, pp. 1187–1198, 2016. [43] Y. Y. Wang,R. X. Liu,B.Guo et al.,“Down-regulation of PTEN expression in kidney and its role in development of diabetic nephropathy in rats,” Sheng Li Xue Bao: (Acta Physiologica Sinica), vol. 63, no. 4, pp. 325–332, 2011. [44] L. Mahimainathan, F. Das, B. Venkatesan, and G. G. Choud- hury, “Mesangial cell hypertrophy by high glucose is mediated by downregulation of the tumor suppressor PTEN,” Diabetes, vol. 55, no. 7, pp. 2115–2125, 2006. [45] A.Wang,F. N. Ziyadeh, Y.L.Eun et al.,“Interference with TGF-𝛽 signaling by Smad3-knockout in mice limits diabetic glomerulosclerosis without aeff cting albuminuria,” American Journal of Physiology-Renal Physiology, vol.293,no. 5,pp. F1657–F1665, 2007. International Journal of Journal of Nucleic Acids Peptides The Scientific International Journal of International Journal of World Journal Cell Biology Microbiology Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi Hindawi http://www www.hindawi.com .hindawi.com V Volume 2018 olume 2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Anatomy Biochemistry Research International Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Submit your manuscripts at www.hindawi.com Advances in Genetics Bioinformatics Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Advances in International Journal of International Journal of Stem Cells BioMed Zoology Virolog y Genomics International Research International Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 Neuroscience Journal Enzyme Journal of Journal of Research Parasitology Research Marine Biology Archaea Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Journal

BioMed Research InternationalHindawi Publishing Corporation

Published: Mar 28, 2019

References