Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

A mammalian cell display platform based on scFab transposition

A mammalian cell display platform based on scFab transposition Antibody Therapeutics, 2023, Vol. 6, No. 3 157–169 https://doi.org/10.1093/abt/tbad009 Advance Access Publication on 26 May 2023 Research Article A mammalian cell display platform based on scFab transposition * * Jing Chang, Christoph Rader and Haiyong Peng Department of Immunology and Microbiology, The Herbert Wertheim UF Scripps Institute for Biomedical Innovation & Technology, University of Florida, Jupiter, FL 33458, USA Received: December 27, 2022; Revised: May 3, 2023; Accepted: May 7, 2023 ABSTRACT In vitro display technologies have been successfully utilized for the discovery and evolution of monoclonal antibodies (mAbs) for diagnostic and therapeutic applications, with phage display and yeast display being the most commonly used platforms due to their simplicity and high efficiency. As their prokaryotic or lower eukaryotic host organisms typically have no or different post-translational modifications, several mammalian cell–based display and screening technologies for isolation and optimization of mAbs have emerged and are being developed. We report here a novel and useful mammalian cell display platform based on the PiggyBac transposon system to display mAbs in a single-chain Fab (scFab) format on the surface of HEK293F cells. Immune rabbit antibody libraries encompassing ∼7 × 10 independent clones were generated in an all-in-one transposon vector, stably delivered into HEK293F cells and displayed as an scFab with rabbit variable and human constant domains. After one round of magnetic activated cell sorting and two rounds of fluorescence activated cell sorting, mAbs with high affinity in the subnanomolar range and cross-reactivity to the corresponding human and mouse antigens were identified, demonstrating the power of this platform for antibody discovery. We developed a highly efficient mammalian cell display platform based on the PiggyBac transposon system for antibody discovery, which could be further utilized for humanization as well as affinity and specificity maturation. Statement of Significance: An efficient mammalian cell display platform for antibody discovery and development in an scFab format without requiring prior enrichment by microbial display technologies was developed based on PiggyBac transposition. KEYWORDS: in vitro display technologies; mammalian cell display; rabbit monoclonal antibodies; scFab; transposon been approved worldwide and hundreds more are currently INTRODUCTION under evaluation in various phases of clinical development Due to their high affinity and superb specificity, antibodies worldwide [4]. To date, a variety of techniques have been are widely used in basic research, as well as in diagnos- developed for the discovery, engineering and evolution of tic and therapeutic applications. Impressively, antibody- antibodies with desired biological properties from non- based therapeutics are the most rapidly growing drug class human, human and transgenic human antibody repertoires, over the last three decades and have demonstrated a strik- including hybridoma technology, single B cell sorting cou- ing impact on human health, particularly in cancer, infec- pled with antibody gene cloning, as well as library-based tious disease and autoimmune disease [1–3]. As of 30 June antibody display approaches [1, 5–7]. Taking advantage of 2022, 115 therapeutic monoclonal antibodies (mAbs) have the capacity of performing high throughput screening or To whom correspondence should be addressed. Christoph Rader, The Herbert Wertheim UF Scripps Institute for Biomedical Innovation & Technology, University of Florida, 130 Scripps Way #2C1, Jupiter, FL 33458, USA. Tel: +1-561-228-2053; Email: crader@scripps.edu; Haiyong Peng, The Herbert Wertheim UF Scripps Institute for Biomedical Innovation & Technology, University of Florida, 130 Scripps Way #2C1, Jupiter, FL 33458, USA, Tel: +1-561-228-2053; Email: haiyong.peng@gmail.com © The Author(s) 2023. Published by Oxford University Press on behalf of Antibody Therapeutics. All rights reserved. For permissions, please e-mail: jour- nals.permissions@oup.com. 158 Antibody Therapeutics, 2023 selection in vitro and the potential to avoid issues associ- 10 independent stable transfectants. An scFab format was ated with in vivo immunization, such as immune tolerance chosen for mammalian cell display in this study because it is to conserved antigens, toxicity and immunodominant epi- more stable than scFv and retains a structure and activity topes, a variety of different antibody display systems have more similar to the antigen-binding site of natural full- been exploited [8, 9]. For example, ribosome display and length IgG. Using this system, we made an immune library mRNA display are cell-free methods useful for antibody against complement protein C3d. Complement proteins affinity maturation due to the large size of libraries (10 – are important for both the innate and adaptive immune 10 ), yet the high background and instability of RNA systems, providing critical protection against infectious are inevitable drawbacks in these systems [8]. Prokaryotic pathogens, while also contributing to the pathogenesis of a display, especially phage display, is the most commonly number of autoimmune and inflammatory diseases, as well used display technology due to its simplicity, high efficiency as to the rejection reaction against transplanted organs. and low cost, but problems with codon usage, protein fold- Since C3d is the final proteolytic fragment generated from ing and post-translational modification limit the successful C3 protein upon activation of the complement cascade discovery and development of therapeutic mAbs [10–13]. and is covalently deposited on nearby pathogen surfaces, For these reasons, eukaryotic display, such as yeast display, pathogen-infected cell surfaces, transplanted organs and has been developed for antibody library selection [14–17]. tumor cell surfaces through an ester or an amide bond However, post-translational modification with significantly [31], it has been investigated as an attractive target for different N-glycosylated carbohydrate composition in yeast therapeutic and diagnostic antibodies [32–34]. compared to mammalian cells may still impact the physic- In this study, variable domains of antibody light and ochemical properties of mAbs, which are largely manufac- heavy chains were amplified from the bone marrow and tured in mammalian cells for therapeutic and diagnostic spleen of two b9 allotype rabbits immunized with human applications in humans and other mammals. To curtail C3d (hC3d), fused to human constant domains and then these limitations, substantial efforts have been devoted to cloned into PB2.0 to afford chimeric rabbit/human scFab better align antibody discovery and antibody manufactur- transposon libraries. After transfection into HEK293F ing by developing mammalian cell display systems [18–24]. cells, integration of the scFab genes into the genome was In contrast to prokaryotic or lower eukaryotic cells, mediated by PB2.0-encoded PiggyBac transposase at a mammalian cells are more difficult to engineer to stably high rate and stable cell clones displaying scFabs with display antibodies on the cell surface [19]. Thus far, subnanomolar affinity and cross-reactivity to both hC3d different approaches (transiently expressed plasmids, and mouse C3d (mC3d) were selected by one round of episomally replicating plasmids, Sindbis virus, vaccinia magnetic activated cell sorting (MACS) and two rounds of virus, retrovirus, stable expression using the Flp-In system, fluorescence activated cell sorting (FACS). transposon and CRISPR-Cas9) have been tried to deliver antibody genes into certain host mammalian cells (CHO cells, HEK293T cells and immortalized B cells) to display different formats of antibody fragments or full-length RESULTS IgG [18, 22, 23, 25–29]. These technologies have their Transposon-mediated antibody display on mammalian cells own advantages and disadvantages and need further improvements to rival phage and yeast display systems. For In order to stably display antibodies on mammalian cells example, Flp-In and CRISPR-Cas9 systems can control without virus handling, we used an all-in-one PiggyBac the genome integration site to ensure monoclonality, i.e. transposon vector PB2.0-DGFP (DNA2.0) in which a one antibody gene per host cell as in phage and yeast hyperactive PiggyBac transposase [35, 36] and a protein display systems. Yet, they are much less efficient than of interest, the latter flanked by two inverted terminal viral systems with respect to antibody gene delivery to repeat (ITR) sequences, are encoded on the same plasmid the genome. Viral systems, on the other hand, require [37–39](Fig. 1A). A puromycin resistance gene enabled time- and cost-consuming production of viral particles selection of cells harboring stably integrated transposons in and an advanced biosafety level infrastructure. An efficient their genome. After transfection and one week of selection non-viral system, PiggyBack transposition, was previously with puromycin (10 days post-transfection), the fluorescent employed to display full-length IgG on the surface of B cells protein Dasher GFP (DGFP), serving as protein of interest [23]. Here, we describe a highly robust antibody display encoded between the ITRs of PB2.0-DGFP, was stably platform that uses PiggyBac transposition to stably express expressed in HEK293F cells and no significant loss of a single-chain Fab (scFab) [30] on the surface of HEK293F fluorescence was observed when puromycin was removed cells. for3weeks(Fig. 1B). HEK293F cells are easy to transfect with polyethy- Considering that Fab is more stable than scFv and leneimine (PEI), which is of low cost and toxicity and more reliably converted to IgG without affinity and can be cultured either in suspension to high density in specificity loss, we chose a Fab format for antibody bulk without serum or with serum to support adherent display on HEK293F cells. However, we found that in culture for single colony growth. This human cell line, pilot experiments, which used small chimeric rabbit/human together with an all-in-one PiggyBac transposon vector Fab libraries in PB2.0 in which the two polypeptide (light- (PB2.0), which has a >20% stable integration rate into the chain and heavy- chain fragment)-encoding cassettes were HEK293F genome after transfection, allowed us to readily separated by IRES or T2A sequences, the Fab format could make a mammalian cell display library with a size close to not be displayed efficiently and its display level on stably Antibody Therapeutics, 2023 159 Figure 1. Transposon vectors and maintenance of gene of interest integrated in genome upon transposition. (A) All all-in-one PiggyBac transposon vectors were constructed based on PB2.0-DGFP from DNA 2.0, which combines in one vector a hyperactive transposase driven by a CMV promoter and the expression cassettes of the gene of interest and the resistance marker positioned between the inverted terminal repeat (ITR) elements. Genes of interest, here as Dasher GFP (DGFP), single-chain Fab (scFab) and secreted scFab (sscFab) are under the control of an EF1α promoter. The expression cassette of the puromycin-resistant gene (Puro ) enables selection of stable cells with transposon integrated into their genomes (PGK, 3-phosphoglycerate kinase promoter; SAR, scaffold-attached regions; WPRE, woodchuck hepatitis virus post-transcriptional regulatory element; BGH, bovine growth hormone;pA, polyadenylation). Displayed scFab with a 60-aa linker (Linker60) between light (rbV -huC ) and heavy chains (rbV -huC 1) (rb, rabbit; hu, human) are L L H H fused to a (G S) linker (GSL) and an HA tag, followed by the transmembrane domain of human PDGFRβ (TM). sscFab are tagged with an octahistidine 4 3 (8 × His) tag for purification. (B) Stability of transposed DGFP in cells in the presence or absence of 1.5 μg/ml puromycin (gray, unstained cells; green, GFP-stained cells). (C) Stability of transposed scFab in cells in the presence or absence of 1.5 μg/ml puromycin. Cell surface scFab (clone 3 N07) expression was analyzed by flow cytometry using biotinylated rat anti-HA mAb 3F10 followed by PE-conjugated streptavidin for staining (gray, unstained cells; red, PE-stained (scFab-positive) cells). transfected HEK293F cells decreased significantly over was highly expressed in HEK293F cells and removal of time even in the presence of puromycin (data not shown). puromycin after one week selection did not diminish the As scFabs of human antibodies have been shown to be positive cell population, indicating that the cells were stable well displayed on phage [40] and yeast surfaces [41], we once the transposons had integrated into their genome. next switched the expression format to scFabs with a 60 Furthermore, 8 out of 12 randomly picked clones from amino-acid linker connecting the light chain C-terminus to two small pilot chimeric rabbit/human scFab libraries the N-terminus of the heavy chain fragment [40](Fig. 1A). with κ and λ light chains, respectively, stably displayed In this vector, PB2.0-scFab, only one signal peptide was scFabs on HEK293F cells after transfection and selection, required for light chain and heavy chain fragment. A and the small pilot κ and λ libraries revealed 57.6% (G S) linker and a hemagglutinin (HA) tag followed by and 53.7% of stably scFab-displaying cells, respectively 4 3 a transmembrane domain derived from human PDGFRβ (Supplementary Fig. S1). were fused to the C-terminus of the heavy chain fragment. To make cloning convenient for library construction and Generation of immune chimeric rabbit/human scFab library compatible with our Fab-phage display vector pC3C [42], displayed on mammalian cells the signal peptide in PB2.0-scFab was modified to have the same upstream SfiI site as pC3C, enabling asymmetric The high rate of successful display of scFabs on HEK293F SfiI cloning of V -C -V cassettes with a downstream SfiI cells tested with the two small pilot libraries encouraged us L L H site that separates V and C 1(Fig. 1A). Flow cytometry to construct an scFab library in a large scale. Using a new H H data shown in Fig. 1C demonstrated that the scFab format set of oligonucleotides we used for generating a large naïve 160 Antibody Therapeutics, 2023 chimeric rabbit/human Fab library [43] and an additional libraries. After expansion, we found that 9.3 and 6.2% cells rbV reverse primer (rbIgG-C 1-R) annealing to the 5 of the two populations were positive for hC3d, and 48 single H H end of the rabbit IgG constant domain C 1, the rabbit cells from the top 1.9% κ cells and top 0.7% λ cells were light and heavy chain variable domains (rbV ,rbV and sorted separately by a second FACS in the presence of κ λ rbV ) were PCR-amplified from reverse transcribed RNA 10% pooled normal human complement serum (PNHCS), extracted from the bone marrow and spleen of two b9 allo- which was added to compete off cells displaying scFabs able type rabbits [44], which had been immunized with human to bind C3 in human serum (Fig. 3D). C3d (hC3d) and developed a strong polyclonal antibody Following 2-week adherent culture without puromycin, (pAb) response (Supplementary Fig. S2). Note that rabbits 44 out of 48 single cells from the κ library (N1–N48) and have only one IgG isotype and the additional primer rbIgG- 31 out of 48 single cells from the λ library (N49—N96) C 1-R was employed with the intention of biasing the survived and all of them expressed scFabs that recognized library with the secondary antibody repertoire generated hC3d. We then ranked the cell clones based on the ratio of by class switch recombination, somatic gene conversion the binding signal to the expression level and pursued eight and somatic hypermutation in response to the immuno- clones for each library, including several top clones and ran- gen [45]. The variable domains were then assembled to domly ranked clones (Fig. 4A). Using total RNA extracted chimeric rabbit/human scFab-encoding sequences with dif- from the cells, we amplified the scFab genes by RT-PCR ferent middle fragments (huC or huC ), followed by asym- with primers annealing to the signal peptide and HA tag κ λ metric SfiI-cloning into the mammalian cell display vec- sequences. After recloning into PiggyBac transposon vector tor PB2.0-scFab (Fig. 1A). Transformation of the ligation PB2.0-sscFab, which has no transmembrane domain but products into Escherichia coli strain ER2738 by electro- an octahistidine tag at the C-terminus of scFabs for secre- 7 7 poration yielded approximately 3.6 × 10 and 3.7 × 10 tion expression and Immobilized Metal Ion Affinity Chro- independent transformants for κ library and λ library, matography (IMAC) purification (Fig. 1A), we randomly respectively. picked three colonies after E. coli transformation and iden- In order to generate mammalian cell display libraries tified one to three (mode 2) copies of different scFab genes covering most of the clones in both κ and λ PB2.0-scFab by DNA fingerprinting (Fig. 4A–C). Transient expression libraries, pilot experiments were performed with PB2.0- of individual PB2.0-sscFabs enabled us to easily uncover the DGFP and PB2.0-scFab-A. The latter encodes an scFab right genes encoding and secreting responsible anti-hC3d with a κ light chain to determine the transfection efficiency scFabs for most single cell clones (Fig. 4B and C). However, of HEK293F cells cultured in suspension using PEI, which for cell clones N4 and N68, none of the two different has low toxicity to cells and the integration rate meditated scFabs alone revealed hC3d binding, yet cotransfection of by the hyperactive PiggyBac transposase in the vector. As the two PB2.0-scFab plasmids produced a binding signal shown in Fig 2A, 75%-80% transfection produced 34.4% (Fig. 4B and C). Considering that the linker between the cells stably expressing DGFP and 18.1% cells stably display- light chain and the heavy chain contains 60 amino acids, it is ing scFabs, indicating an integration rate of ∼45 and ∼23% possible that the light chains and heavy chains of two differ- of HEK293F cells, respectively. To retain the complexity of ent scFabs on the same cell cross-pair and reassemble into the transposon libraries, we transfected 3 × 10 HEK293F a functional Fab. To test this idea, we split the light chain cells for both κ and λ PB2.0-scFab libraries, with 18.1% of and heavy chain of anti-hC3d mAb clone 3 N07, previously 8 7 7 3 × 10 cells (= 5.4 × 10 cells) exceeding 3.6 × 10 (κ)and obtained through phage display, into two different vectors, 3.7 × 10 (λ) independent transformants. After selection PB2.0-scFab-M (3N07_HC + X_λC) and PB2.0-scFab-N with puromycin, 52.7% of κ library- and 63.6% λ library- (Y_HC + 3N07_κC). Co-transfection of the two plasmids, transfected cells displayed scFabs (Fig. 2B), consistent with but not transfection of either plasmid alone, showed that the small pilot libraries (Supplementary Fig. S1). the cells were indeed positively stained by hC3d, providing strong evidence for our cross-pairing hypothesis (Fig. 4D). Furthermore, sequence analysis revealed that the heavy Enrichment of mammalian cells displaying high-affinity chain of N4-1 and the light chain of N4-3 were similar to scFab that of the functional clone N5-2, prompting us to put them together in one vector to form a new potential functional To enrich and select scFab-displaying HEK293F cells bind- clone N4c. As shown in Fig. 4E, N4c indeed bound to ing to hC3d, one round of MACS and two rounds of FACS hC3d deposited on zymosan. Similarly, cloning of the heavy were conducted (Fig. 3A). Before enrichment, neither κ nor chain of N68-2 and the light chain of N68-1 into one λ libraries revealed detectable hC3d binders by flow cytom- vector also produced a functional clone, N68c (Fig. 4E). etry (Fig. 3B). To prepare the capturing antigen for MACS, Interestingly, for some of the positive cell clones, it was we deposited hC3d on the surface of magnetic streptavidin- difficult to rescue the responsible scFab genes; e.g. for cell coated beads through opsonization in the presence of nor- clone N93, 24 individual colonies that had been picked from mal human serum. After one round of selection by MACS, 7 7 the plates and confirmed to have the same DNA fingerprint 3.0 × 10 and 2.7 × 10 κ cells and λ cells, respectively, showed no binding to hC3d when tested by ELISA (data were recovered from 3 × 10 library-transfected HEK293F not shown). cells. As shown in Fig. 3C, 0.27% κ and 0.46% λ cells were Next, the kinetic and thermodynamic parameters of an positive after the first round of MACS. FACS was then assortment of clones binding to hC3d were determined used to further increase the abundance of positive clones, by surface plasmon resonance (SPR). Since clone N66 and 6 009 and 8 600 cells, respectively, were harvested and was ranked first based on the ratio of the binding signal pooled from the top 0.1% of positive clones of κ and λ Antibody Therapeutics, 2023 161 Figure 2. Transfection and integration efficiency of transposons into HEK293F cells. (A) Transfection and integration efficiency of DGFP (top, green) and scFab (bottom, red) were determined on day 3 and day 10 after transfection, respectively. Cells were maintained in culture without puromycin. (B) Cells displaying scFab after stable κ and λ library transposition were stained by a mouse anti-human C mAb conjugated to BV421 (left, blue) or a mouse anti-human C antibody conjugated to APC (right, purple) after 10-day culture in the presence of puromycin. Figure 3. Enrichment of HEK293F cells displaying high-affinity antibodies against hC3d by MACS and FACS. (A) Scheme illustration of the enrichment process of scFab-displaying cells against hC3d by one round of MACS and two rounds of FACS. (B) Libraries before enrichment were stained with hC3d conjugated to Alexa Fluor 488. (C) Sorting of the top 0.1% positive cells from MACS-enriched libraries by staining with hC3d conjugated to Alexa Fluor 488. (D) Sorting of the top 1.9% κ and top 0.7% λ single cells, respectively, from FACS-enriched pools by staining with hC3d conjugated to Alexa Fluor 647 in presence of 10% PNHCS. 162 Antibody Therapeutics, 2023 Figure 4. Recovery of antibody genes from positive cell clones. (A) Following the three enrichment steps, 44 (out of 48 κ cell colonies, N1–N48) and 31 (out of 48 λ cell colonies, N49–N96) single cells that were enriched from the κ and λ libraries and survived expansion were pursued based on the ratio of binding signal to expression level as analyzed by flow cytometry using an HA antibody conjugated to Alexa Fluor 488 (row HA-488 giving median fluorescence intensity values) and hC3d labeled with Alexa Fluor 647 (row c3d-647 giving median fluorescence intensity values). (B) Antibody genes recovered from positive κ cell clones were cloned into PB2.0-sscFab and transfected alone or in combination into HEK293F cells to identify the responsible scFab binding to hC3d by ELISA using supernatants harvested 48 h after transfection. (C) Antibody genes recovered from positive λ cell clones were cloned into PB2.0-sscFab and transfected alone or in combination into HEK293F cells to identify the responsible scFab binding to hC3d by ELISA using supernatants harvested 48 h after transfection. (D) The heavy and light chains of anti-hC3d mAb 3 N07 (a phage display–derived clone) were split into plasmid PB2.0-scFab-M (3 N07/HC + X/LC) and plasmid PB2.0-scFab-N (Y/HC + 3 N07/LC), which were cotransfected into HEK93F cells to get stable cells for flow cytometry analysis of binding activity using biotinylated hC3d followed by PE-conjugated streptavidin for staining. (E) Responsible scFabs, including the two reassembled clones N4c and N68c, were expressed in HEK293F cells and tested for binding to hC3d and mC3d by ELISA using supernatants harvested 48 h after transfection. to the expression level, it was hypothesized to have proteins hFc-hC3d and hFc-mC3d labeled with fluores- high affinity to hC3d. As shown in Fig. 5, scFab N66 cence Alexa Fluor 488 and Alexa Fluor 647, respectively, indeed revealed subnanomolar binding with a K of were used for dual staining of cells for sorting. From 1 × 10 0.311 nM. Furthermore, the affinity of the second ranked of the expanded 6 009 κ cells and 8 600 λ cells that were clone N5 was also high (K = 7.06 nM), validating the previously retrieved by tandem MACS and FACS (Fig. 4), capability of our mammalian cell display platform to yield 18 κ single cells among the top 0.196% and 24 λ single cells monovalent binders of high affinity. Note that N68c was among the top 0.658% were collected (Fig. 6A). After 3- ranked lower based on its binding/expression ratio but week culture without puromycin, five κ colonies and six had higher affinity (K = 2.04 nM) compared to N5. λ colonies were observed, two of each did not survive Its lower ranking is probably due to a diluted expression expansion. Two κ cell clones (κm2 and κm3) and three λ cell signal of the responsible cross-paired scFab (N68c) that is clones (λm1, λm2 and λm4) were confirmed to be reactive assembled from two non-binding scFabs, N68-1 and N68- to both hC3d and mC3d, while one κ cell clone (κm1) 2. The amino acid sequence of scFab N68c is shown in only reacted with mC3d and one λ cell clone (λm3) was Supplementary Fig. S3. negative for both hC3d and mC3d (Fig. 6B). Antibody gene recovery and sequencing results revealed that κm2 and κm3 cell clones had identical inserts of only one functional scFab Enrichment of cells displaying cross-reactive antibody clone. Similarly, cell clone κm1 also had only one scFab clone. Among the λ cell clones, λm1, λm2 and λm4 were In addition to identifying cells displaying scFabs with high identical to the previously identified cell clone N68 and the affinity, we next demonstrated that mammalian cell display responsible scFab was N68c. SPR showed that both N68c of scFabs could also be used to screen mAbs with cross- (K = 38.4 nM) and κm2 (K = 19.3 nM) had double-digit reactivity to both human and mouse C3d (hC3d and mC3d) d d nanomolar affinity for mC3d. Interestingly, N5, which was by FACS in real time. To achieve this, recombinant fusion Antibody Therapeutics, 2023 163 Figure 5. Analysis of purified scFabs by SPR. (A) Biacore X100 sensorgrams obtained for the binding of each IMAC-purified scFab to hFc-hC3d or hFc-mC3d captured by the anti-human Fcγ antibody immobilized on a CM5 chip after instantaneous background depletion. scFabs were injected at six different concentrations. The highest concentrations used (e.g. 100 nM) are given in the top row of the table below, and the other five concentrations were prepared by two-fold serial dilutions from the highest concentration (e.g. 100, 50, 25, 12.5 and 6.25 nM). (B) Table with SPR-measured kinetic and thermodynamic parameters. The equilibrium dissociation constant (K ) was calculated from k /k (k , association rate constant; k , dissociation on on d off off rate constant; chi indicates the closeness of fit). identified as a high-affinity clone to hC3d (K = 7.06 nM), demand, a variety of technologies that allow the discovery, bound to mC3d with a K of 26.4 nM but did not emerge evolution and engineering of mAbs of therapeutic utility as a hit in the cross-activity selection, probably due to the are being developed. Recent studies reported that mAbs small number of positive cell clones we pursued. Because discovered by phage display can have unfavorable biophys- of the bivalent binding of hFc-mC3d to cell surface scFabs, ical features diminishing their chance to advance to large- even cell clones with low affinity, such as cell clone κm1 scale manufacturing required for clinical trials when com- (K = 302 nM), were sorted. pared to mAbs derived from a mammalian cell source [10, Collectively, six (N4c; N5-2 = N25-2 = N36-1 = N45- 12, 46, 47]. Whereas mouse and rabbit hybridoma technolo- 2; N41-2; N44-1; κm1 and κm2 = κm3) and three (N66-3; gies, along with human antibody repertoires from trans- N68c = λm1 = λm2 = λm4 and N92) rabbit mAbs were res- genic animals, are highly valuable sources of mammalian cued from the κ and λ libraries, respectively. However, only cell-derived mAbs, they rely on immunization and are not N66-3 had a λ light chain, while N66-3, N68c and all six suitable for conserved antigens with low immunogenicity clones derived from the κ library had κ light chains. Of these or for toxic antigens. To address this shortcoming, in vitro nine clones total, three (N5-2; κm2 and N68c) recognized library-based mammalian cell display technologies have both human and mouse C3d. Sequence alignments showed been used to discover mAbs against numerous antigens of that six mAbs had identical heavy chain complementarity interest and shown to be versatile for incorporating the determining region 3 (HCDR3) sequences but harbored screening for certain desired properties in high-throughput numerous mutations in their germline sequences (i.e. frame- methods, such as MACS and FACS [48]. In addition, com- work regions (FR) 1 through 3) likely due to in vivo affinity pared to hybridoma cells, antibody genes are easier to maturation during immunization (Supplementary Fig. S4). recover from mammalian cell display libraries because of the tight coupling of the antibody phenotype and genotype and, as in our study, the confined nature of the intro- DISCUSSION duced antibody genes with defined flanking sequences for facile RT-PCR recovery. As such, mammalian cell dis- Antibody-based therapeutics are one of the most success- play–derived mAbs contribute to a great need of providing ful and rapidly growing classes of pharmaceuticals across reliable recombinant antibodies with defined amino acid numerous indications. To meet the rising public health 164 Antibody Therapeutics, 2023 Figure 6. Enrichment and screen of cells displaying antibodies with cross-reactivity. (A) The top 0.2% and top 0.7% double-positive cells from both sublibraries were sorted to obtain single cells after staining by hFc-hC3d conjugated to Alexa Fluor 488 and hFc-mC3d conjugated to Alexa Fluor 647 in presence of 10% PNHCS. (B) Single-cell clones with binding activity to both hC3d and mC3d were verified by dual staining with hFc-hC3d conjugated to Alexa Fluor 488 and hFc-mC3d conjugated to Alexa Fluor 647 in presence of 10% PNHCS. sequences for basic research, diagnostic and therapeutic <10 to ∼55%. The underlying mechanism for the remain- applications [49, 50]. ing ∼45% stable cells not displaying scFabs is unknown Here, we describe a new and highly efficient mammalian and needs to be further investigated. It is possible that cell display platform that employs a PiggyBac transposon the random combination of rbV and rbV we used to L H system for antibody discovery, evolution and engineering. build the κ and λ libraries generates incompatible light- Using this platform, we were able to generate mAbs of high and heavy-chain pairs that are misfolded and prevented affinity and desired cross-reactivity from an immune rabbit from reaching the cell surface through, e.g. the action of antibody repertoire. GRP78/BiP [51, 52]. In this study, we initially tried displaying conventional The stable introduction of genes of interest into mam- Fab on mammalian cells. However, with low efficiency of malian cells can be achieved through viral and non-viral display of Fab with IRES or T2A to co-transcribe or co- approaches [24]. While virus-based approaches are costly, translate, respectively, the light- and heavy-chain polypep- tedious and time-consuming, a variety of non-viral tools tides in the constructs made us switch to scFabs [30, 40]. for gene integration, such as zinc fingers, TALENs, Flp-In There were several reasons to choose this format. First, and CRISPR-Cas9 systems, have been developed [22, 53]. scFabs have been successfully displayed on phage. Second, However, due to the ability to mediate gene integration with to display scFabs on a mammalian cell surface, only one site-specific precision, such non-viral systems usually have signal peptide, compared to two for conventional Fab, low efficiency for stable gene transfer into mammalian cells is needed to export the antibody. Third, light and heavy and are therefore not suitable for the generation of large chains are expressed at the same level without interruption libraries required for antibody discovery. In contrast, trans- of translation. Fourth, combined in a single polypeptide, poson systems are more efficient and have emerged as gene light and heavy chains can pair with each other more effi- delivery and mutagenesis tools [38, 54, 55]. Among these, ciently. Collectively, our results show that the change from the PiggyBac transposon system showed higher efficiency Fab to scFab greatly improved the display efficiency from of stable gene transfer compared to Sleeping Beauty, Tol2 Antibody Therapeutics, 2023 165 and Mos1 systems [56]. Our study shows that using an all- dual staining in FACS, we successfully screened for mAbs in-one PiggyBac transposon vector in a single transfection with cross-reactivity for hC3d and mC3d. It is conceivable step, integration rates can reach >20% of scFab-displaying that this strategy can be applied to generating cross-reactive HEK293F cells, which is considerably higher than the 6% mAbs to other ortholog antigen pairs and panels as part of reported for full-length IgG using a PiggyBac system for antibody discovery, evolution or engineering. cotransfection of heavy chain, light chain and transposase Finally, since the variable domains of the mAbs we split into three different vectors [23]. Combining the all-in- retrieved by mammalian cell display are derived from one PiggyBac transposon vector with the HEK293F cell rabbits, they may require humanization for further devel- culture system, which is easy to transfect and culture in opment as pharmaceuticals. Notably, the same mammalian suspension to high density, we readily got mammalian- cell display platform could be readily used to make small cell display libraries encompassing close to 10 clones hav- libraries displaying scFabs with rabbit CDR sequences ing cell surface scFabs. While still two to three orders of grafted onto different human germline sequences with magnitude smaller than large naïve and synthetic libraries tailored FR diversification [58–60], followed by selection displayed on phage, we show that this library size is suf- with MACS and FACS. Using similar specialized libraries, ficient for successfully selecting an immune library and it the platform can also be used for affinity maturation. should also be sufficient to evolve antibody affinity, speci- However, it should be cautioned that a loss of affinity is ficity and manufacturability. Because of the hyperactive possible when converting scFabs to IgG [61]. In summary, PiggyBac transposase in the vector [35, 36], we found that we developed an efficient and highly versatile platform most cell clones harbored more than one scFab gene, which based on an all-in-one transposon vector to display scFabs increased the complexity of the libraries on the one hand on HEK293F cells for antibody discovery and adaptable but somewhat complicated the recovery of the responsible for humanization and affinity maturation. Although the scFab gene on the other hand. To overcome this issue, the platform does not require prior enrichment by microbial all-in-one vector could be split into two vectors, one to display technologies, it is compatible with our Fab-phage express the gene-of-interest and the other to express the display platform based on phagemid pC3C, which also uses transposase, allowing for cotransfection at optimal ratios a VL-CL-VH cassette flanked by asymmetric SfiI sites [43]. that promote single-copy scFab gene integration into the As such, it facilitates high-throughput screening of pre- host cell genome. Interestingly, the 60-aa linker we used selected Fab or scFab pools from large naïve or synthetic allowed the light chain (or heavy chain) from one scFab to antibody libraries. cross-pair with the heavy chain (or light chain) of another scFab displayed on the same cell, probably due to preferen- tial pairing of certain rbV and rbV . Reducing the linker MATERIALS AND METHODS L H length may decrease the chance of scFab cross-pairing on Cell lines the HEK293F cell surface. A significant advantage of mammalian cell display over HEK293F cells (Thermo Fisher Scientific) were main- tained in chemically defined, protein-free FreeStyle 293 phage display is the use of FACS to screen antibodies Expression Medium supplemented with 1% (v/v) heat- with desired properties in real time by defined gating and inactivated FBS to support adherent culture or without quantitative analysis. For instance, in our studies, we were FBS for suspension culture and 1 × penicillin–streptomycin able to identify clones with high affinity and cross-reactivity by dual staining. After normalization of the binding signal (all from Thermo Fisher Scientific). to the expression level, mAb clone N66 ranked first with a subnanomolar K (0.311 nM). In addition, the mammalian C3d proteins cell surface display level has been suggested to be indicative of the downstream developability of antibodies produced Human C3d protein. Human complement protein C3d (hC3d) derived from C3 after a series of proteolytic in mammalian cells [57]. Cross-reactivity of antibodies to cleavages was purchased from Complement Technology. ortholog antigens of different species is critical for preclin- Biotinylation of hC3d was performed using the Biotin-Tag ical studies in animal models for an early detection of on- Micro Biotinylation kit (Sigma-Aldrich). Labeling of hC3d target toxicities. C3d is highly conserved among different with Alexa Fluor 488 and 647 was achieved following the species. The amino acid sequence identity between human instructions of the labeling kits (ThermoFisherScientific). and cynomolgus C3d is 95.7%, while mouse and rabbit C3d are 84.1 and 81.8% identical to human C3d, respectively. Due to immunotolerance, it has been difficult to generate hFc-hC3d and hFc-mC3d proteins. DNA encoding hC3d mouse mAbs to hC3d that cross-react with mC3d. Thur- (aa1002-1303 of hC3) with a mutation at position 1010 man et al. used C3 knock-out mice to generate mouse mAbs from cysteine to alanine to avoid thioester bond formation that recognize both hC3d and mC3d and demonstrated with glutamine at position 1013 was custom-synthesized as their therapeutic utility in mouse models of renal and ocu- gBlock and cloned into pCEP4-hFc via HindIII/XhoI as lar disease [33]. Considering the relative dissimilarity of described [62]. Analogously, mouse C3d (mC3d, aa1002- rabbit C3d to mC3d (82.1% amino acid sequence identity) 1303) with the same mutation was cloned into pCEP4- and hC3d (81.8%), we used rabbits for immunization with hFc. The resulting pCEP4-hFc-hC3d and pCEP4-hFc- hC3d and generated an immune rabbit antibody library dis- mC3d plasmids were confirmed by DNA sequencing and playing chimeric rabbit/human scFabs on HEK293F cells. transiently transfected into HEK293F cells using PEI Using this mammalian cell display library coupled with (919012, Sigma-Aldrich). Transfected cells were cultured in 166 Antibody Therapeutics, 2023 FreeStyle 293 Expression medium, and hFc-hC3d and hFc- 1 week. Both libraries were kept in puromycin-containing mC3d proteins were purified from supernatants by Protein medium until selection. A affinity chromatography as described [43]. The quality and quantity of purified proteins were analyzed by SDS- Library sorting by MACS and FACS PAGE and A absorbance, respectively. Subsequently, MACS. 3 × 10 magnetic streptavidin-coated Dyn- hFc-hC3d and hFc-mC3d were labeled with Alexa Fluor abeads from the CELLection Biotin Binder Kit (Thermo 488 and 647 as described above. Fisher Scientific) were washed and resuspended in 3 ml PBS, followed by incubation with 3 ml pooled normal human complement serum (PNHCS, Innovative Research) Transposon vectors at 37 C for 1 h. After washing with 1% (w/v) BSA/DPBS, All-in-one PiggyBac transposon vectors were constructed opsonized beads with freshly deposited natural hC3d were based on PB2.0-DGFP (DNA 2.0), which combines in added to 300 ml suspension cultures of the mammalian cell one vector a hyperactive transposase driven by a CMV display libraries. After 1 h, 6 × 50 ml cells were placed on promoter and the expression cassettes of the gene of inter- a magnetic stand for 2 min. Magnetically separated cells est and the resistance marker positioned between the two bound by the beads were resuspended in fresh FreeStyle inverted terminal repeat (ITR) elements. Genes of interest, 293 Expression Medium and cultured without puromycin i.e. Dasher GFP (DGFP), single-chain Fab (scFab) and for 1 week before FACS. secreted scFab (sscFab), are under the control of an EF1α promoter. The expression cassette of a puromycin-resistant FACS. 1 × 10 MACS enriched sub-library cells gene enables selection of stable cells with transposon inte- were washed and resuspended in 10 ml ice-cold FACS grated into their genomes. The displayed scFab has a 60-aa buffer (DPBS containing 1% (w/v) BSA, 1 × penicillin– linker [40] between light and heavy chain. As its C-terminus, streptomycin and 1 mM EDTA), followed by staining with the scFab is fused to a (G S) linker followed by an HA 4 3 10 μg Alexa Fluor 488 labeled C3d for 1 h in a cold room at tag (YPYDVPDYAS) and a human PDGFRβ segment (aa 4 C and rotating at 10 rpm/min. After washing three times 513-561) that includes the transmembrane domain (aa 533- with ice-cold FACS buffer, cells were resuspended in DPBS 553). sscFabs are tagged with an octahistidine (HHHHH- containing 1% (w/v) BSA, 1 × penicillin–streptomycin HHH) tag for purification. For cloning, two asymmetric 2+ 2+ and 2.5 mM Mg ,1mM Ca ,20 μl DNaseI from the BsaI sites flanking DGFP in PB2.0-DGFP were used to CELLection Biotin Binder Kit (Thermo Fisher Scientific) replace DGFP with scFabs, while two asymmetric SfiI and 100 ng/ml 4 ,6-diamidino-2-phenylindole (DAPI; Cell sites were used to replace the rbV -hC -rbV segment of L L H Signaling) and then filtered through 40-μm cell strainers. different chimeric rabbit/human scFabs. The cells were then sorted on a BD FACSAria™ Fusion instrument and pooled into a 6-well plate containing 2 ml FreeStyle 293 Expression Medium supplemented with 1% Library generation (v/v) heat-inactivated FBS to support adherent culture. All rabbit handling was carried out by veterinary personnel After expansion, 1 × 10 pooled cells were stained with at R&RResearch(Stanwood, WA). Two b9 allotype either 10 μg Alexa Fluor 647 labeled hC3d alone or with rabbits [44, 45] were immunized with 100 μghC3dand a mixture of 5 μg Alexa Fluor 488 labeled hFc-hC3d and Freund’s complete adjuvant, followed by three boosts with 5 μg Alexa Fluor 647 labeled hFc-mC3d, in the presence of 50 μg hC3d and Freund’s incomplete adjuvant in 3-week 10% PNHCS, for sorting of single cells with high affinity intervals. The serum antibody response to the immunogen to hC3d or hC3d/mC3d cross-reactivity. was monitored during the vaccination process by ELISA. Spleen and bone marrow from the two b9 allotype rabbits Antibody gene recovery were collected 5 days after the last boost and separately processed for total RNA preparation and RT-PCR ampli- Single cells after sorting were cultured for 2–3 weeks fication of rbV ,rbV and rbV encoding cDNA using for colony formation before expansion, and 1 × 10 κ λ H established protocols [43]. A degenerate reverse primer cells were then used to extract RNA following the rbIgG-C 1-R (5’gaagactgaYggagccttaggttg3’, Y = t or c) instructions of the RNeasy Mini Kit (Qiagen). After reverse that anneals to the 5 end of the rabbit IgG constant domain transcription using the SuperScript III First-Strand Syn- C 1 was used to amplify IgG-derived rbV encoding thesis System (Thermo Fisher Scientific), scFab-encoding H H sequences enriched in the immune antibody repertoire. DNA was PCR-amplified with forward primer Sig-SfiI- Subsequently, rbV /hC /rbV and rbV /hC /rbV seg- F (5’tagctgctgcaactggggcccag3’) and reverse primer HA-R κ κ H λ λ H ments were assembled by overlap extension PCR and (5’agcgtaatctggaacatcgtatgggta3’) annealing to the signal cloned into PB2.0-scFab via SfiI. Transformation of E. peptide and HA tag encoding sequences, respectively, in the coli strain ER2738 (Lucigen) by electroporation yielded PB2.0-scFab vector. PCR products were purified, digested 7 7 approximately 3.6 × 10 and 3.7 × 10 independent by SfiI and cloned into PB2.0-sscFab. To identify the right transformants for library κ and library λ, respectively. clones producing responsible scFabs, three transformants To generate the stable mammalian cell display libraries, were picked for each cell colony and unique scFab-encoding 300 μg maxi-prepped plasmids and 900 μlPEI were used sequences were Sanger-sequenced after DNA fingerprint- to transfect 3 × 10 HEK293F cells in 100 ml culture and ing with AluI, for which DNA sequences encoding the selected by 1.5 μg/ml puromycin 72 h after transfection for rbV -huC -rbV cassette were PCR-amplified, digested L L H Antibody Therapeutics, 2023 167 with AluI (frequent recognition site AG CT) and analyzed κ or λ mAb conjugated to BV 421 or APC (BioLegend), by electrophoresis on a 4% (w/v) agarose gel. Subsequently, or a 1:500 dilution of the biotinylated rat anti-HA mAb unique clones were transiently transfected into HEK293F 3F10 (Roche) in conjunction with 2 μg/ml PE-conjugated adherent cells and the supernatants were harvested 48 h streptavidin (BD Biosciences) to detect the light chains or later. Clones revealing a positive signal in ELISA were then the heavy chains displayed on cell surface. Binding activity sequenced and pursued further. was detected by 100 ng/100 μl C3d labeled with Alexa Fluor 488 or 647. All staining was performed on ice in dark, and DAPI (Cell Signaling) was added to a final concentration of scFab expression and purification 100 ng/ml to exclude dead cells. Cells were analyzed using PB2.0-sscFab vectors were transiently transfected into sus- a FACSCalibur instrument (BD Biosciences) and FlowJo pension HEK293F cells using PEI and purified by Immo- analytical software (Tree Star). bilized Metal Ion Affinity Chromatography (IMAC) using a 1-ml HisTrap column (Cytiva) as described [43]. The SPR quality and quantity of purified scFabs were analyzed by SDS-PAGE and A absorbance, respectively. 280 SPR for the measurement of kinetic and thermodynamic parameters of the binding of purified scFabs to hC3d or mC3d proteins was performed on a Biacore X100 ELISA instrument using Biacore reagents and software (Cytiva). Rabbit antibody response to hC3d. Each well of a 96- A mouse anti-human IgG C 2 mAb was immobilized on a well Costar 3690 plate (Corning) was coated with 100 ng CM5 sensor chip using reagents and instructions supplied hC3d protein in 30 μl coating buffer (0.1 M Na CO , 2 3 with the Human Antibody Capture Kit (Cytiva). hFc-hC3d 0.1 M NaHCO , pH 9.6) for 1 h at 37 C. After block- and hFc-mC3d fusion proteins were captured at a density ing with 150 μl 5% (w/v) milk/PBS for 1 h at 37 Cand not exceeding 400 RU. Each sensor chip included an empty washing three times with 150 μlPBS,50 μl of 1:500 or flow cell for instantaneous background depletion. All 1:2 000 dilution of rabbit serum in 1% (w/v) milk/PBS binding assays used 1× HBS-EP+ running buffer (10 mM was applied to each well. Following incubation for 2 h HEPES, 150 mM NaCl, 3 mM EDTA (pH 7.4) and 0.05% at 37 C and washing as before, 50 μl of a 1:1 000 dilu- (v/v) Surfactant P20) and a flow rate of 30 μl/min. All tion of donkey anti-rabbit IgG (H + L) pAb conjugated scFabs were injected at five different concentrations. The to horse radish peroxidase (HRP) (Jackson ImmunoRe- sensor chips were regenerated with 3 M MgCl from the search) in 1% (w/v) BSA/TBS was added and incubated Human Antibody Capture Kit without any loss of binding for 1 h at 37 C. The wells were washed four times, and capacity. Calculation of association (k ) and dissociation on colorimetric detection was performed using 2,2 -azino-bis (k ) rate constants was based on a 1:1 Langmuir binding off (3-ethylbenzothiazoline)-6-sulfonic acid (ABTS; Roche) as model. The equilibrium dissociation constant (K )was a substrate according to the manufacturer’s directions. The calculated from k /k . off on absorbance was measured at 405 nm using a SpectraMax M5 microplate reader (Molecular Devices) and SoftMax Pro software (Molecular Devices). SUPPLEMENTARY DATA Supplementary Data are available at ABT Online. scFab binding assay to hC3d and mC3d. Each well of a 96-well Costar 3690 plate (Corning) was coated with 100 ng streptavidin (Sigma-Aldrich) in 30 μl coating buffer (see above) for 1 h at 37 C. After blocking with 150 μl3% FUNDING (w/v) BSA/PBS for 1 h at 37 C, 100 ng biotinylated hC3d We gratefully acknowledge support of this study by or mC3d in 50 μl 1% (w/v) BSA/PBS was captured by National Institutes of Health (NIH) grants R01 CA174844, incubation for 1 h at 37 C. The wells were washed three R01 CA181258, R01 CA204484, R21 CA229961 and R21 times with 150 μlPBS.Next, 50 μl supernatants harvested CA263240 and by the Klorfine Foundation. after 48 h transfection of HEK293F cells were applied to each well. Following incubation for 2 h at 37 C and washing as before, 50 μl of a 1:1 000 dilution of a mouse anti- CONFLICT OF INTEREST STATEMENT His tag mAb conjugated to HRP (R&D Systems) in 1% (w/v) BSA/TBS was added and incubated for 1 h at 37 C. C.R. holds the position of Editorial Board Member for The wells were then washed four times, and detection with Antibody Therapeutics and is blinded from reviewing or ABTS was carried out as described above. making decisions for the manuscript. All authors declare no conflict of interest. Flow cytometry Cells were stained using standard flow cytometry method- AUTHORS’ CONTRIBUTIONS ology. Briefly, 0.1–1 × 10 cells in 100 μl flow cytometry buffer (PBS containing 1% (w/v) BSA, 0.1% (w/v) sodium H.P. and C.R. conceived and designed the study. J.C. and azide and 1 mM EDTA) were stained in a V-shaped 96-well H.P. conducted and analyzed all experiments. J.C, H.P. and plate (BrandTech) with 5 μl mouse anti human light chain C.R. wrote the manuscript. 168 Antibody Therapeutics, 2023 CRediT AUTHOR STATEMENT 14. Boder, ET, Wittrup, KD. Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 1997; 15: Jing Chang (Data curation-Lead, Investigation-Lead, 553–7. Methodology-Lead, Resources-Lead, Validation-Lead, 15. Sivelle, C, Sierocki, R, Ferreira-Pinto, K et al. Fab is the most efficient format to express functional antibodies by yeast surface Visualization-Lead, Writing—original draft-Lead, Writ- display. MAbs 2018; 10: 720–9. ing—review & editing-Lead), Christoph Rader 16. Oh, EJ, Liu, R, Liang, L et al. Multiplex evolution of antibody (Conceptualization-Lead, Funding acquisition-Lead, fragments utilizing a yeast surface display platform. ACS Synth Biol Investigation-Lead, Project administration-Lead, 2020; 9: 2197–202. 17. Krohl, PJ, Spangler, JB. A hybrid adherent/suspension cell-based Resources-Lead, Supervision-Lead, Writing—original selection strategy for discovery of antibodies targeting membrane draft-Lead, Writing—review & editing-Lead), Haiyong proteins. Methods Mol Biol 2022; 2491: 195–216. Peng (Conceptualization-Lead, Data curation-Lead, For- 18. Bowers, PM, Horlick, RA, Kehry, MR et al. Mammalian cell mal analysis-Lead, Investigation-Lead, Methodology- display for the discovery and optimization of antibody therapeutics. Lead, Project administration-Lead, Resources-Lead, Methods 2014; 65: 44–56. 19. Dangi, AK, Sinha, R, Dwivedi, S et al. Cell line techniques and gene Supervision-Lead, Validation-Lead, Visualization-Lead, editing tools for antibody production: a review. Front Pharmacol Writing—original draft-Lead, Writing—review & editing- 2018; 9: 630. Lead). 20. Robertson, N, Lopez-Anton, N, Gurjar, SA et al. Development of a novel mammalian display system for selection of antibodies against membrane proteins. J Biol Chem 2020; 295: 18436–48. 21. Luo, R, Zhao, Y, Fan, Y et al. High efficiency CHO cell DATA AVAILABILITY display-based antibody maturation. Sci Rep 2020; 10: 8102. 22. Mason, DM, Weber, CR, Parola, C et al. High-throughput antibody Four supplementary figures are provided. The data under- engineering in mammalian cells by CRISPR/Cas9-mediated lying this article will be shared on reasonable request to the homology-directed mutagenesis. Nucleic Acids Res 2018; 46: corresponding authors. 7436–49. 23. Waldmeier, L, Hellmann, I, Gutknecht, CK et al. Transpo-mAb display: transposition-mediated B cell display and functional screening of full-length IgG antibody libraries. MAbs 2016; 8: ETHICS AND CONSENT STATEMENT 726–40. 24. Breous-Nystrom, E, Schultze, K, Meier, M et al. Retrocyte display Consent was not required in this work. technology: generation and screening of a high diversity cellular antibody library. Methods 2014; 65: 57–67. 25. Doerner, A, Rhiel, L, Zielonka, S et al. Therapeutic antibody ANIMAL RESEARCH STATEMENT engineering by high efficiency cell screening. FEBS Lett 2014; 588: 278–87. All rabbit handling was carried out by veterinary personnel 26. Smith, ES, Zauderer, M. Antibody library display on a mammalian at R & R Research (Stanwood, WA) in compliance with the virus vector: combining the advantages of both phage and yeast NIH Guide for the Care and Use of Laboratory Animals. display into one technology. Curr Drug Discov Technol 2014; 11: 48–55. 27. Bowers, PM, Horlick, RA, Neben, TY et al. Coupling mammalian cell surface display with somatic hypermutation for the discovery REFERENCES and maturation of human antibodies. Proc Natl Acad Sci U S A 1. Mullard, A. FDA approves 100th monoclonal antibody product. 2011; 108: 20455–60. Nat Rev Drug Discov 2021; 20: 491–5. 28. Taube, R, Zhu, Q, Xu, C et al. Lentivirus display: stable expression of human antibodies on the surface of human cells and virus 2. Goydel, RS, Rader, C. Antibody-based cancer therapy. Oncogene particles. PloS One 2008; 3: e3181. 2021; 40: 3655–64. 29. Beerli, RR, Bauer, M, Buser, RB et al. Isolation of human 3. Kaplon, H, Chenoweth, A, Crescioli, S et al. Antibodies to watch in monoclonal antibodies by mammalian cell display. Proc Natl Acad 2022. MAbs 2022; 14: 2014296. Sci U S A 2008; 105: 14336–41. 4. Lyu, X, Zhao, Q, Hui, J et al. The global landscape of approved 30. Hust, M, Jostock, T, Menzel, C et al. Single chain fab (scFab) antibody therapies. Antib Ther 2022; 5: 233–57. fragment. BMC Biotechnol 2007; 7: 14. 5. Carter, PJ, Lazar, GA. Next generation antibody drugs: pursuit of 31. Toapanta, FR, Ross, TM. Complement-mediated activation of the the ’high-hanging fruit’. Nat Rev Drug Discov 2018; 17: 197–223. adaptive immune responses: role of C3d in linking the innate and 6. Chen, WC, Murawsky, CM. Strategies for generating diverse adaptive immunity. Immunol Res 2006; 36: 197–210. antibody repertoires using transgenic animals expressing human 32. Rogers, LM, Veeramani, S, Weiner, GJ. Complement in antibodies. Front Immunol 2018; 9: 460. monoclonal antibody therapy of cancer. Immunol Res 2014; 59: 7. Carter, PJ, Rajpal, A. Designing antibodies as therapeutics. Cell 203–10. 2022; 185: 2789–805. 33. Thurman, JM, Kulik, L, Orth, H et al. Detection of complement 8. Valldorf, B, Hinz, SC, Russo, G et al. Antibody display technologies: activation using monoclonal antibodies against C3d. J Clin Invest selecting the cream of the crop. Biol Chem 2022; 403: 455–77. 9. Laustsen, AH, Greiff, V, Karatt-Vellatt, A et al. Animal 2013; 123: 2218–30. immunization, in vitro display technologies, and machine learning 34. Paek, JH, Kwon, J, Lim, J et al. Clinical significance of C3d assay in for antibody discovery. Trends Biotechnol 2021; 39: 1263–73. kidney transplant recipients with donor-specific anti-human 10. Kaleli, NE, Karadag, M, Kalyoncu, S. Phage display derived leukocyte antigen antibodies. Transplant Proc 2022; 54: 341–5. therapeutic antibodies have enriched aliphatic content: insights for 35. Yusa, K, Zhou, L, Li, MA et al. A hyperactive piggyBac transposase developability issues. Proteins 2019; 87: 607–18. for mammalian applications. Proc Natl Acad Sci U S A 2011; 108: 11. Alfaleh, MA et al. Phage display derived monoclonal antibodies: 1531–6. from bench to bedside. Front Immunol 2020; 11: 1986. 36. Burnight, ER, Staber, JM, Korsakov, P et al. A hyperactive 12. Almagro, JC, Pedraza-Escalona, M, Arrieta, HI et al. Phage display transposase promotes persistent gene transfer of a piggyBac DNA libraries for antibody therapeutic discovery and development. transposon. Mol Ther Nucleic Acids 2012; 1: e50. Antibodies (Basel) 2019; 8: 44–65. 37. Chen, Q, Luo, W, Veach, RA et al. Structural basis of seamless 13. Ledsgaard, L, Ljungars, A, Rimbault, C et al. Advances in antibody excision and specific targeting by piggyBac transposase. Nat phage display technology. Drug Discov Today 2022; 27: 2151–69. Commun 2020; 11: 3446. Antibody Therapeutics, 2023 169 38. Sandoval-Villegas, N, Nurieva, W, Amberger, M et al. 51. Feige, MJ, Groscurth, S, Marcinowski, M et al. An unfolded CH1 Contemporary transposon tools: a review and guide through domain controls the assembly and secretion of IgG antibodies. Mol mechanisms and applications of Sleeping Beauty, piggyBac and Tol2 Cell 2009; 34: 569–79. for Genome Engineering. Int J Mol Sci 2021; 22: 5084–5113. 52. Stoyle, CL, Stephens, PE, Humphreys, DP et al. IgG light 39. Li, X, Burnight, ER, Cooney, AL et al. piggyBac transposase tools chain-independent secretion of heavy chain dimers: consequence for for genome engineering. Proc Natl Acad Sci U S A 2013; 110: therapeutic antibody production and design. Biochem J 2017; 474: E2279–87. 3179–88. 40. Koerber, JT, Hornsby, MJ, Wells, JA. An improved single-chain fab 53. Bak, RO, Gomez-Ospina, N, Porteus, MH. Gene editing on Center platform for efficient display and recombinant expression. JMol stage. Trends Genet 2018; 34: 600–11. Biol 2015; 427: 576–86. 54. Tipanee, J, VandenDriessche, T, Chuah, MK. Transposons: moving 41. Walker, LM, Bowley, DR, Burton, DR. Efficient recovery of forward from preclinical studies to clinical trials. Hum Gene Ther high-affinity antibodies from a single-chain fab yeast display library. 2017; 28: 1087–104. J Mol Biol 2009; 389: 365–75. 55. Wei, M, Mi, CL, Jing, CQ et al. Progress of transposon vector 42. Hofer, T, Tangkeangsirisin, W, Kennedy, MG et al. Chimeric system for production of recombinant therapeutic proteins in rabbit/human fab and IgG specific for members of the Nogo-66 mammalian cells. Front Bioeng Biotechnol 2022; 10: 879222. receptor family selected for species cross-reactivity with an improved 56. Wu, SC, Meir, YJJ, Coates, CJ et al. piggyBac is a flexible and highly phage display vector. J Immunol Methods 2007; 318: 75–87. active transposon as compared to sleeping beauty, Tol2, and Mos1 in 43. Peng, H, Nerreter, T, Chang, J et al. Mining naive rabbit antibody mammalian cells. Proc Natl Acad Sci U S A 2006; 103: 15008–13. repertoires by phage display for monoclonal antibodies of 57. Jin, YJ, Yu, D, Tian, XL et al. A novel and effective approach to therapeutic utility. J Mol Biol 2017; 429: 2954–73. generate germline-like monoclonal antibodies by integration of 44. Popkov, M, Mage, RG, Alexander, CB et al. Rabbit immune phage and mammalian cell display platforms. Acta Pharmacol Sin repertoires as sources for therapeutic monoclonal antibodies: the 2022; 43: 954–62. impact of kappa allotype-correlated variation in cysteine content on 58. Goydel, RS, Weber, J, Peng, H et al. Affinity maturation, antibody libraries selected by phage display. J Mol Biol 2003; 325: humanization, and co-crystallization of a rabbit anti-human ROR2 325–35. monoclonal antibody for therapeutic applications. J Biol Chem 2020; 45. Weber, J, Peng, H, Rader, C. From rabbit antibody repertoires to 295: 5995–6006. rabbit monoclonal antibodies. Exp Mol Med 2017; 49: e305. 59. Zhang, YF, Ho, M. Humanization of rabbit monoclonal antibodies 46. Jain, T, Sun, T, Durand, S et al. Biophysical properties of the via grafting combined Kabat/IMGT/Paratome clinical-stage antibody landscape. Proc Natl Acad Sci U S A 2017; complementarity-determining regions: rationale and examples. 114: 944–9. MAbs 2017; 9: 419–29. 47. Tiller, KE, Tessier, PM. Advances in antibody design. Annu Rev 60. Rader, C, Ritter, G, Nathan, S et al. The rabbit antibody repertoire Biomed Eng 2015; 17: 191–216. as a novel source for the generation of therapeutic human 48. Lerner, RA. Combinatorial antibody libraries: new advances, antibodies. J Biol Chem 2000; 275: 13668–76. new immunological insights. Nat Rev Immunol 2016; 16: 61. Steinwand, M, Droste, P, Frenzel, A et al. The influence of antibody 498–508. fragment format on phage display based affinity maturation of IgG. 49. Bradbury, A, Pluckthun, A. Reproducibility: standardize antibodies MAbs 2014; 6: 204–18. used in research. Nature 2015; 518: 27–9. 62. Yang, J, Baskar, S, Kwong, KY et al. Therapeutic potential and 50. Bradbury, AR, Pluckthun, A. Getting to reproducible antibodies: challenges of targeting receptor tyrosine kinase ROR1 with the rationale for sequenced recombinant characterized reagents. monoclonal antibodies in B-cell malignancies. PloS One 2011; 6: Protein Eng Des Sel 2015; 28: 303–5. e21018. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Antibody Therapeutics Oxford University Press

A mammalian cell display platform based on scFab transposition

Antibody Therapeutics , Volume 6 (3): 13 – May 26, 2023

Loading next page...
 
/lp/oxford-university-press/a-mammalian-cell-display-platform-based-on-scfab-transposition-Kt358zgqbQ

References (62)

Publisher
Oxford University Press
Copyright
© The Author(s) 2023. Published by Oxford University Press on behalf of Antibody Therapeutics. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
eISSN
2516-4236
DOI
10.1093/abt/tbad009
Publisher site
See Article on Publisher Site

Abstract

Antibody Therapeutics, 2023, Vol. 6, No. 3 157–169 https://doi.org/10.1093/abt/tbad009 Advance Access Publication on 26 May 2023 Research Article A mammalian cell display platform based on scFab transposition * * Jing Chang, Christoph Rader and Haiyong Peng Department of Immunology and Microbiology, The Herbert Wertheim UF Scripps Institute for Biomedical Innovation & Technology, University of Florida, Jupiter, FL 33458, USA Received: December 27, 2022; Revised: May 3, 2023; Accepted: May 7, 2023 ABSTRACT In vitro display technologies have been successfully utilized for the discovery and evolution of monoclonal antibodies (mAbs) for diagnostic and therapeutic applications, with phage display and yeast display being the most commonly used platforms due to their simplicity and high efficiency. As their prokaryotic or lower eukaryotic host organisms typically have no or different post-translational modifications, several mammalian cell–based display and screening technologies for isolation and optimization of mAbs have emerged and are being developed. We report here a novel and useful mammalian cell display platform based on the PiggyBac transposon system to display mAbs in a single-chain Fab (scFab) format on the surface of HEK293F cells. Immune rabbit antibody libraries encompassing ∼7 × 10 independent clones were generated in an all-in-one transposon vector, stably delivered into HEK293F cells and displayed as an scFab with rabbit variable and human constant domains. After one round of magnetic activated cell sorting and two rounds of fluorescence activated cell sorting, mAbs with high affinity in the subnanomolar range and cross-reactivity to the corresponding human and mouse antigens were identified, demonstrating the power of this platform for antibody discovery. We developed a highly efficient mammalian cell display platform based on the PiggyBac transposon system for antibody discovery, which could be further utilized for humanization as well as affinity and specificity maturation. Statement of Significance: An efficient mammalian cell display platform for antibody discovery and development in an scFab format without requiring prior enrichment by microbial display technologies was developed based on PiggyBac transposition. KEYWORDS: in vitro display technologies; mammalian cell display; rabbit monoclonal antibodies; scFab; transposon been approved worldwide and hundreds more are currently INTRODUCTION under evaluation in various phases of clinical development Due to their high affinity and superb specificity, antibodies worldwide [4]. To date, a variety of techniques have been are widely used in basic research, as well as in diagnos- developed for the discovery, engineering and evolution of tic and therapeutic applications. Impressively, antibody- antibodies with desired biological properties from non- based therapeutics are the most rapidly growing drug class human, human and transgenic human antibody repertoires, over the last three decades and have demonstrated a strik- including hybridoma technology, single B cell sorting cou- ing impact on human health, particularly in cancer, infec- pled with antibody gene cloning, as well as library-based tious disease and autoimmune disease [1–3]. As of 30 June antibody display approaches [1, 5–7]. Taking advantage of 2022, 115 therapeutic monoclonal antibodies (mAbs) have the capacity of performing high throughput screening or To whom correspondence should be addressed. Christoph Rader, The Herbert Wertheim UF Scripps Institute for Biomedical Innovation & Technology, University of Florida, 130 Scripps Way #2C1, Jupiter, FL 33458, USA. Tel: +1-561-228-2053; Email: crader@scripps.edu; Haiyong Peng, The Herbert Wertheim UF Scripps Institute for Biomedical Innovation & Technology, University of Florida, 130 Scripps Way #2C1, Jupiter, FL 33458, USA, Tel: +1-561-228-2053; Email: haiyong.peng@gmail.com © The Author(s) 2023. Published by Oxford University Press on behalf of Antibody Therapeutics. All rights reserved. For permissions, please e-mail: jour- nals.permissions@oup.com. 158 Antibody Therapeutics, 2023 selection in vitro and the potential to avoid issues associ- 10 independent stable transfectants. An scFab format was ated with in vivo immunization, such as immune tolerance chosen for mammalian cell display in this study because it is to conserved antigens, toxicity and immunodominant epi- more stable than scFv and retains a structure and activity topes, a variety of different antibody display systems have more similar to the antigen-binding site of natural full- been exploited [8, 9]. For example, ribosome display and length IgG. Using this system, we made an immune library mRNA display are cell-free methods useful for antibody against complement protein C3d. Complement proteins affinity maturation due to the large size of libraries (10 – are important for both the innate and adaptive immune 10 ), yet the high background and instability of RNA systems, providing critical protection against infectious are inevitable drawbacks in these systems [8]. Prokaryotic pathogens, while also contributing to the pathogenesis of a display, especially phage display, is the most commonly number of autoimmune and inflammatory diseases, as well used display technology due to its simplicity, high efficiency as to the rejection reaction against transplanted organs. and low cost, but problems with codon usage, protein fold- Since C3d is the final proteolytic fragment generated from ing and post-translational modification limit the successful C3 protein upon activation of the complement cascade discovery and development of therapeutic mAbs [10–13]. and is covalently deposited on nearby pathogen surfaces, For these reasons, eukaryotic display, such as yeast display, pathogen-infected cell surfaces, transplanted organs and has been developed for antibody library selection [14–17]. tumor cell surfaces through an ester or an amide bond However, post-translational modification with significantly [31], it has been investigated as an attractive target for different N-glycosylated carbohydrate composition in yeast therapeutic and diagnostic antibodies [32–34]. compared to mammalian cells may still impact the physic- In this study, variable domains of antibody light and ochemical properties of mAbs, which are largely manufac- heavy chains were amplified from the bone marrow and tured in mammalian cells for therapeutic and diagnostic spleen of two b9 allotype rabbits immunized with human applications in humans and other mammals. To curtail C3d (hC3d), fused to human constant domains and then these limitations, substantial efforts have been devoted to cloned into PB2.0 to afford chimeric rabbit/human scFab better align antibody discovery and antibody manufactur- transposon libraries. After transfection into HEK293F ing by developing mammalian cell display systems [18–24]. cells, integration of the scFab genes into the genome was In contrast to prokaryotic or lower eukaryotic cells, mediated by PB2.0-encoded PiggyBac transposase at a mammalian cells are more difficult to engineer to stably high rate and stable cell clones displaying scFabs with display antibodies on the cell surface [19]. Thus far, subnanomolar affinity and cross-reactivity to both hC3d different approaches (transiently expressed plasmids, and mouse C3d (mC3d) were selected by one round of episomally replicating plasmids, Sindbis virus, vaccinia magnetic activated cell sorting (MACS) and two rounds of virus, retrovirus, stable expression using the Flp-In system, fluorescence activated cell sorting (FACS). transposon and CRISPR-Cas9) have been tried to deliver antibody genes into certain host mammalian cells (CHO cells, HEK293T cells and immortalized B cells) to display different formats of antibody fragments or full-length RESULTS IgG [18, 22, 23, 25–29]. These technologies have their Transposon-mediated antibody display on mammalian cells own advantages and disadvantages and need further improvements to rival phage and yeast display systems. For In order to stably display antibodies on mammalian cells example, Flp-In and CRISPR-Cas9 systems can control without virus handling, we used an all-in-one PiggyBac the genome integration site to ensure monoclonality, i.e. transposon vector PB2.0-DGFP (DNA2.0) in which a one antibody gene per host cell as in phage and yeast hyperactive PiggyBac transposase [35, 36] and a protein display systems. Yet, they are much less efficient than of interest, the latter flanked by two inverted terminal viral systems with respect to antibody gene delivery to repeat (ITR) sequences, are encoded on the same plasmid the genome. Viral systems, on the other hand, require [37–39](Fig. 1A). A puromycin resistance gene enabled time- and cost-consuming production of viral particles selection of cells harboring stably integrated transposons in and an advanced biosafety level infrastructure. An efficient their genome. After transfection and one week of selection non-viral system, PiggyBack transposition, was previously with puromycin (10 days post-transfection), the fluorescent employed to display full-length IgG on the surface of B cells protein Dasher GFP (DGFP), serving as protein of interest [23]. Here, we describe a highly robust antibody display encoded between the ITRs of PB2.0-DGFP, was stably platform that uses PiggyBac transposition to stably express expressed in HEK293F cells and no significant loss of a single-chain Fab (scFab) [30] on the surface of HEK293F fluorescence was observed when puromycin was removed cells. for3weeks(Fig. 1B). HEK293F cells are easy to transfect with polyethy- Considering that Fab is more stable than scFv and leneimine (PEI), which is of low cost and toxicity and more reliably converted to IgG without affinity and can be cultured either in suspension to high density in specificity loss, we chose a Fab format for antibody bulk without serum or with serum to support adherent display on HEK293F cells. However, we found that in culture for single colony growth. This human cell line, pilot experiments, which used small chimeric rabbit/human together with an all-in-one PiggyBac transposon vector Fab libraries in PB2.0 in which the two polypeptide (light- (PB2.0), which has a >20% stable integration rate into the chain and heavy- chain fragment)-encoding cassettes were HEK293F genome after transfection, allowed us to readily separated by IRES or T2A sequences, the Fab format could make a mammalian cell display library with a size close to not be displayed efficiently and its display level on stably Antibody Therapeutics, 2023 159 Figure 1. Transposon vectors and maintenance of gene of interest integrated in genome upon transposition. (A) All all-in-one PiggyBac transposon vectors were constructed based on PB2.0-DGFP from DNA 2.0, which combines in one vector a hyperactive transposase driven by a CMV promoter and the expression cassettes of the gene of interest and the resistance marker positioned between the inverted terminal repeat (ITR) elements. Genes of interest, here as Dasher GFP (DGFP), single-chain Fab (scFab) and secreted scFab (sscFab) are under the control of an EF1α promoter. The expression cassette of the puromycin-resistant gene (Puro ) enables selection of stable cells with transposon integrated into their genomes (PGK, 3-phosphoglycerate kinase promoter; SAR, scaffold-attached regions; WPRE, woodchuck hepatitis virus post-transcriptional regulatory element; BGH, bovine growth hormone;pA, polyadenylation). Displayed scFab with a 60-aa linker (Linker60) between light (rbV -huC ) and heavy chains (rbV -huC 1) (rb, rabbit; hu, human) are L L H H fused to a (G S) linker (GSL) and an HA tag, followed by the transmembrane domain of human PDGFRβ (TM). sscFab are tagged with an octahistidine 4 3 (8 × His) tag for purification. (B) Stability of transposed DGFP in cells in the presence or absence of 1.5 μg/ml puromycin (gray, unstained cells; green, GFP-stained cells). (C) Stability of transposed scFab in cells in the presence or absence of 1.5 μg/ml puromycin. Cell surface scFab (clone 3 N07) expression was analyzed by flow cytometry using biotinylated rat anti-HA mAb 3F10 followed by PE-conjugated streptavidin for staining (gray, unstained cells; red, PE-stained (scFab-positive) cells). transfected HEK293F cells decreased significantly over was highly expressed in HEK293F cells and removal of time even in the presence of puromycin (data not shown). puromycin after one week selection did not diminish the As scFabs of human antibodies have been shown to be positive cell population, indicating that the cells were stable well displayed on phage [40] and yeast surfaces [41], we once the transposons had integrated into their genome. next switched the expression format to scFabs with a 60 Furthermore, 8 out of 12 randomly picked clones from amino-acid linker connecting the light chain C-terminus to two small pilot chimeric rabbit/human scFab libraries the N-terminus of the heavy chain fragment [40](Fig. 1A). with κ and λ light chains, respectively, stably displayed In this vector, PB2.0-scFab, only one signal peptide was scFabs on HEK293F cells after transfection and selection, required for light chain and heavy chain fragment. A and the small pilot κ and λ libraries revealed 57.6% (G S) linker and a hemagglutinin (HA) tag followed by and 53.7% of stably scFab-displaying cells, respectively 4 3 a transmembrane domain derived from human PDGFRβ (Supplementary Fig. S1). were fused to the C-terminus of the heavy chain fragment. To make cloning convenient for library construction and Generation of immune chimeric rabbit/human scFab library compatible with our Fab-phage display vector pC3C [42], displayed on mammalian cells the signal peptide in PB2.0-scFab was modified to have the same upstream SfiI site as pC3C, enabling asymmetric The high rate of successful display of scFabs on HEK293F SfiI cloning of V -C -V cassettes with a downstream SfiI cells tested with the two small pilot libraries encouraged us L L H site that separates V and C 1(Fig. 1A). Flow cytometry to construct an scFab library in a large scale. Using a new H H data shown in Fig. 1C demonstrated that the scFab format set of oligonucleotides we used for generating a large naïve 160 Antibody Therapeutics, 2023 chimeric rabbit/human Fab library [43] and an additional libraries. After expansion, we found that 9.3 and 6.2% cells rbV reverse primer (rbIgG-C 1-R) annealing to the 5 of the two populations were positive for hC3d, and 48 single H H end of the rabbit IgG constant domain C 1, the rabbit cells from the top 1.9% κ cells and top 0.7% λ cells were light and heavy chain variable domains (rbV ,rbV and sorted separately by a second FACS in the presence of κ λ rbV ) were PCR-amplified from reverse transcribed RNA 10% pooled normal human complement serum (PNHCS), extracted from the bone marrow and spleen of two b9 allo- which was added to compete off cells displaying scFabs able type rabbits [44], which had been immunized with human to bind C3 in human serum (Fig. 3D). C3d (hC3d) and developed a strong polyclonal antibody Following 2-week adherent culture without puromycin, (pAb) response (Supplementary Fig. S2). Note that rabbits 44 out of 48 single cells from the κ library (N1–N48) and have only one IgG isotype and the additional primer rbIgG- 31 out of 48 single cells from the λ library (N49—N96) C 1-R was employed with the intention of biasing the survived and all of them expressed scFabs that recognized library with the secondary antibody repertoire generated hC3d. We then ranked the cell clones based on the ratio of by class switch recombination, somatic gene conversion the binding signal to the expression level and pursued eight and somatic hypermutation in response to the immuno- clones for each library, including several top clones and ran- gen [45]. The variable domains were then assembled to domly ranked clones (Fig. 4A). Using total RNA extracted chimeric rabbit/human scFab-encoding sequences with dif- from the cells, we amplified the scFab genes by RT-PCR ferent middle fragments (huC or huC ), followed by asym- with primers annealing to the signal peptide and HA tag κ λ metric SfiI-cloning into the mammalian cell display vec- sequences. After recloning into PiggyBac transposon vector tor PB2.0-scFab (Fig. 1A). Transformation of the ligation PB2.0-sscFab, which has no transmembrane domain but products into Escherichia coli strain ER2738 by electro- an octahistidine tag at the C-terminus of scFabs for secre- 7 7 poration yielded approximately 3.6 × 10 and 3.7 × 10 tion expression and Immobilized Metal Ion Affinity Chro- independent transformants for κ library and λ library, matography (IMAC) purification (Fig. 1A), we randomly respectively. picked three colonies after E. coli transformation and iden- In order to generate mammalian cell display libraries tified one to three (mode 2) copies of different scFab genes covering most of the clones in both κ and λ PB2.0-scFab by DNA fingerprinting (Fig. 4A–C). Transient expression libraries, pilot experiments were performed with PB2.0- of individual PB2.0-sscFabs enabled us to easily uncover the DGFP and PB2.0-scFab-A. The latter encodes an scFab right genes encoding and secreting responsible anti-hC3d with a κ light chain to determine the transfection efficiency scFabs for most single cell clones (Fig. 4B and C). However, of HEK293F cells cultured in suspension using PEI, which for cell clones N4 and N68, none of the two different has low toxicity to cells and the integration rate meditated scFabs alone revealed hC3d binding, yet cotransfection of by the hyperactive PiggyBac transposase in the vector. As the two PB2.0-scFab plasmids produced a binding signal shown in Fig 2A, 75%-80% transfection produced 34.4% (Fig. 4B and C). Considering that the linker between the cells stably expressing DGFP and 18.1% cells stably display- light chain and the heavy chain contains 60 amino acids, it is ing scFabs, indicating an integration rate of ∼45 and ∼23% possible that the light chains and heavy chains of two differ- of HEK293F cells, respectively. To retain the complexity of ent scFabs on the same cell cross-pair and reassemble into the transposon libraries, we transfected 3 × 10 HEK293F a functional Fab. To test this idea, we split the light chain cells for both κ and λ PB2.0-scFab libraries, with 18.1% of and heavy chain of anti-hC3d mAb clone 3 N07, previously 8 7 7 3 × 10 cells (= 5.4 × 10 cells) exceeding 3.6 × 10 (κ)and obtained through phage display, into two different vectors, 3.7 × 10 (λ) independent transformants. After selection PB2.0-scFab-M (3N07_HC + X_λC) and PB2.0-scFab-N with puromycin, 52.7% of κ library- and 63.6% λ library- (Y_HC + 3N07_κC). Co-transfection of the two plasmids, transfected cells displayed scFabs (Fig. 2B), consistent with but not transfection of either plasmid alone, showed that the small pilot libraries (Supplementary Fig. S1). the cells were indeed positively stained by hC3d, providing strong evidence for our cross-pairing hypothesis (Fig. 4D). Furthermore, sequence analysis revealed that the heavy Enrichment of mammalian cells displaying high-affinity chain of N4-1 and the light chain of N4-3 were similar to scFab that of the functional clone N5-2, prompting us to put them together in one vector to form a new potential functional To enrich and select scFab-displaying HEK293F cells bind- clone N4c. As shown in Fig. 4E, N4c indeed bound to ing to hC3d, one round of MACS and two rounds of FACS hC3d deposited on zymosan. Similarly, cloning of the heavy were conducted (Fig. 3A). Before enrichment, neither κ nor chain of N68-2 and the light chain of N68-1 into one λ libraries revealed detectable hC3d binders by flow cytom- vector also produced a functional clone, N68c (Fig. 4E). etry (Fig. 3B). To prepare the capturing antigen for MACS, Interestingly, for some of the positive cell clones, it was we deposited hC3d on the surface of magnetic streptavidin- difficult to rescue the responsible scFab genes; e.g. for cell coated beads through opsonization in the presence of nor- clone N93, 24 individual colonies that had been picked from mal human serum. After one round of selection by MACS, 7 7 the plates and confirmed to have the same DNA fingerprint 3.0 × 10 and 2.7 × 10 κ cells and λ cells, respectively, showed no binding to hC3d when tested by ELISA (data were recovered from 3 × 10 library-transfected HEK293F not shown). cells. As shown in Fig. 3C, 0.27% κ and 0.46% λ cells were Next, the kinetic and thermodynamic parameters of an positive after the first round of MACS. FACS was then assortment of clones binding to hC3d were determined used to further increase the abundance of positive clones, by surface plasmon resonance (SPR). Since clone N66 and 6 009 and 8 600 cells, respectively, were harvested and was ranked first based on the ratio of the binding signal pooled from the top 0.1% of positive clones of κ and λ Antibody Therapeutics, 2023 161 Figure 2. Transfection and integration efficiency of transposons into HEK293F cells. (A) Transfection and integration efficiency of DGFP (top, green) and scFab (bottom, red) were determined on day 3 and day 10 after transfection, respectively. Cells were maintained in culture without puromycin. (B) Cells displaying scFab after stable κ and λ library transposition were stained by a mouse anti-human C mAb conjugated to BV421 (left, blue) or a mouse anti-human C antibody conjugated to APC (right, purple) after 10-day culture in the presence of puromycin. Figure 3. Enrichment of HEK293F cells displaying high-affinity antibodies against hC3d by MACS and FACS. (A) Scheme illustration of the enrichment process of scFab-displaying cells against hC3d by one round of MACS and two rounds of FACS. (B) Libraries before enrichment were stained with hC3d conjugated to Alexa Fluor 488. (C) Sorting of the top 0.1% positive cells from MACS-enriched libraries by staining with hC3d conjugated to Alexa Fluor 488. (D) Sorting of the top 1.9% κ and top 0.7% λ single cells, respectively, from FACS-enriched pools by staining with hC3d conjugated to Alexa Fluor 647 in presence of 10% PNHCS. 162 Antibody Therapeutics, 2023 Figure 4. Recovery of antibody genes from positive cell clones. (A) Following the three enrichment steps, 44 (out of 48 κ cell colonies, N1–N48) and 31 (out of 48 λ cell colonies, N49–N96) single cells that were enriched from the κ and λ libraries and survived expansion were pursued based on the ratio of binding signal to expression level as analyzed by flow cytometry using an HA antibody conjugated to Alexa Fluor 488 (row HA-488 giving median fluorescence intensity values) and hC3d labeled with Alexa Fluor 647 (row c3d-647 giving median fluorescence intensity values). (B) Antibody genes recovered from positive κ cell clones were cloned into PB2.0-sscFab and transfected alone or in combination into HEK293F cells to identify the responsible scFab binding to hC3d by ELISA using supernatants harvested 48 h after transfection. (C) Antibody genes recovered from positive λ cell clones were cloned into PB2.0-sscFab and transfected alone or in combination into HEK293F cells to identify the responsible scFab binding to hC3d by ELISA using supernatants harvested 48 h after transfection. (D) The heavy and light chains of anti-hC3d mAb 3 N07 (a phage display–derived clone) were split into plasmid PB2.0-scFab-M (3 N07/HC + X/LC) and plasmid PB2.0-scFab-N (Y/HC + 3 N07/LC), which were cotransfected into HEK93F cells to get stable cells for flow cytometry analysis of binding activity using biotinylated hC3d followed by PE-conjugated streptavidin for staining. (E) Responsible scFabs, including the two reassembled clones N4c and N68c, were expressed in HEK293F cells and tested for binding to hC3d and mC3d by ELISA using supernatants harvested 48 h after transfection. to the expression level, it was hypothesized to have proteins hFc-hC3d and hFc-mC3d labeled with fluores- high affinity to hC3d. As shown in Fig. 5, scFab N66 cence Alexa Fluor 488 and Alexa Fluor 647, respectively, indeed revealed subnanomolar binding with a K of were used for dual staining of cells for sorting. From 1 × 10 0.311 nM. Furthermore, the affinity of the second ranked of the expanded 6 009 κ cells and 8 600 λ cells that were clone N5 was also high (K = 7.06 nM), validating the previously retrieved by tandem MACS and FACS (Fig. 4), capability of our mammalian cell display platform to yield 18 κ single cells among the top 0.196% and 24 λ single cells monovalent binders of high affinity. Note that N68c was among the top 0.658% were collected (Fig. 6A). After 3- ranked lower based on its binding/expression ratio but week culture without puromycin, five κ colonies and six had higher affinity (K = 2.04 nM) compared to N5. λ colonies were observed, two of each did not survive Its lower ranking is probably due to a diluted expression expansion. Two κ cell clones (κm2 and κm3) and three λ cell signal of the responsible cross-paired scFab (N68c) that is clones (λm1, λm2 and λm4) were confirmed to be reactive assembled from two non-binding scFabs, N68-1 and N68- to both hC3d and mC3d, while one κ cell clone (κm1) 2. The amino acid sequence of scFab N68c is shown in only reacted with mC3d and one λ cell clone (λm3) was Supplementary Fig. S3. negative for both hC3d and mC3d (Fig. 6B). Antibody gene recovery and sequencing results revealed that κm2 and κm3 cell clones had identical inserts of only one functional scFab Enrichment of cells displaying cross-reactive antibody clone. Similarly, cell clone κm1 also had only one scFab clone. Among the λ cell clones, λm1, λm2 and λm4 were In addition to identifying cells displaying scFabs with high identical to the previously identified cell clone N68 and the affinity, we next demonstrated that mammalian cell display responsible scFab was N68c. SPR showed that both N68c of scFabs could also be used to screen mAbs with cross- (K = 38.4 nM) and κm2 (K = 19.3 nM) had double-digit reactivity to both human and mouse C3d (hC3d and mC3d) d d nanomolar affinity for mC3d. Interestingly, N5, which was by FACS in real time. To achieve this, recombinant fusion Antibody Therapeutics, 2023 163 Figure 5. Analysis of purified scFabs by SPR. (A) Biacore X100 sensorgrams obtained for the binding of each IMAC-purified scFab to hFc-hC3d or hFc-mC3d captured by the anti-human Fcγ antibody immobilized on a CM5 chip after instantaneous background depletion. scFabs were injected at six different concentrations. The highest concentrations used (e.g. 100 nM) are given in the top row of the table below, and the other five concentrations were prepared by two-fold serial dilutions from the highest concentration (e.g. 100, 50, 25, 12.5 and 6.25 nM). (B) Table with SPR-measured kinetic and thermodynamic parameters. The equilibrium dissociation constant (K ) was calculated from k /k (k , association rate constant; k , dissociation on on d off off rate constant; chi indicates the closeness of fit). identified as a high-affinity clone to hC3d (K = 7.06 nM), demand, a variety of technologies that allow the discovery, bound to mC3d with a K of 26.4 nM but did not emerge evolution and engineering of mAbs of therapeutic utility as a hit in the cross-activity selection, probably due to the are being developed. Recent studies reported that mAbs small number of positive cell clones we pursued. Because discovered by phage display can have unfavorable biophys- of the bivalent binding of hFc-mC3d to cell surface scFabs, ical features diminishing their chance to advance to large- even cell clones with low affinity, such as cell clone κm1 scale manufacturing required for clinical trials when com- (K = 302 nM), were sorted. pared to mAbs derived from a mammalian cell source [10, Collectively, six (N4c; N5-2 = N25-2 = N36-1 = N45- 12, 46, 47]. Whereas mouse and rabbit hybridoma technolo- 2; N41-2; N44-1; κm1 and κm2 = κm3) and three (N66-3; gies, along with human antibody repertoires from trans- N68c = λm1 = λm2 = λm4 and N92) rabbit mAbs were res- genic animals, are highly valuable sources of mammalian cued from the κ and λ libraries, respectively. However, only cell-derived mAbs, they rely on immunization and are not N66-3 had a λ light chain, while N66-3, N68c and all six suitable for conserved antigens with low immunogenicity clones derived from the κ library had κ light chains. Of these or for toxic antigens. To address this shortcoming, in vitro nine clones total, three (N5-2; κm2 and N68c) recognized library-based mammalian cell display technologies have both human and mouse C3d. Sequence alignments showed been used to discover mAbs against numerous antigens of that six mAbs had identical heavy chain complementarity interest and shown to be versatile for incorporating the determining region 3 (HCDR3) sequences but harbored screening for certain desired properties in high-throughput numerous mutations in their germline sequences (i.e. frame- methods, such as MACS and FACS [48]. In addition, com- work regions (FR) 1 through 3) likely due to in vivo affinity pared to hybridoma cells, antibody genes are easier to maturation during immunization (Supplementary Fig. S4). recover from mammalian cell display libraries because of the tight coupling of the antibody phenotype and genotype and, as in our study, the confined nature of the intro- DISCUSSION duced antibody genes with defined flanking sequences for facile RT-PCR recovery. As such, mammalian cell dis- Antibody-based therapeutics are one of the most success- play–derived mAbs contribute to a great need of providing ful and rapidly growing classes of pharmaceuticals across reliable recombinant antibodies with defined amino acid numerous indications. To meet the rising public health 164 Antibody Therapeutics, 2023 Figure 6. Enrichment and screen of cells displaying antibodies with cross-reactivity. (A) The top 0.2% and top 0.7% double-positive cells from both sublibraries were sorted to obtain single cells after staining by hFc-hC3d conjugated to Alexa Fluor 488 and hFc-mC3d conjugated to Alexa Fluor 647 in presence of 10% PNHCS. (B) Single-cell clones with binding activity to both hC3d and mC3d were verified by dual staining with hFc-hC3d conjugated to Alexa Fluor 488 and hFc-mC3d conjugated to Alexa Fluor 647 in presence of 10% PNHCS. sequences for basic research, diagnostic and therapeutic <10 to ∼55%. The underlying mechanism for the remain- applications [49, 50]. ing ∼45% stable cells not displaying scFabs is unknown Here, we describe a new and highly efficient mammalian and needs to be further investigated. It is possible that cell display platform that employs a PiggyBac transposon the random combination of rbV and rbV we used to L H system for antibody discovery, evolution and engineering. build the κ and λ libraries generates incompatible light- Using this platform, we were able to generate mAbs of high and heavy-chain pairs that are misfolded and prevented affinity and desired cross-reactivity from an immune rabbit from reaching the cell surface through, e.g. the action of antibody repertoire. GRP78/BiP [51, 52]. In this study, we initially tried displaying conventional The stable introduction of genes of interest into mam- Fab on mammalian cells. However, with low efficiency of malian cells can be achieved through viral and non-viral display of Fab with IRES or T2A to co-transcribe or co- approaches [24]. While virus-based approaches are costly, translate, respectively, the light- and heavy-chain polypep- tedious and time-consuming, a variety of non-viral tools tides in the constructs made us switch to scFabs [30, 40]. for gene integration, such as zinc fingers, TALENs, Flp-In There were several reasons to choose this format. First, and CRISPR-Cas9 systems, have been developed [22, 53]. scFabs have been successfully displayed on phage. Second, However, due to the ability to mediate gene integration with to display scFabs on a mammalian cell surface, only one site-specific precision, such non-viral systems usually have signal peptide, compared to two for conventional Fab, low efficiency for stable gene transfer into mammalian cells is needed to export the antibody. Third, light and heavy and are therefore not suitable for the generation of large chains are expressed at the same level without interruption libraries required for antibody discovery. In contrast, trans- of translation. Fourth, combined in a single polypeptide, poson systems are more efficient and have emerged as gene light and heavy chains can pair with each other more effi- delivery and mutagenesis tools [38, 54, 55]. Among these, ciently. Collectively, our results show that the change from the PiggyBac transposon system showed higher efficiency Fab to scFab greatly improved the display efficiency from of stable gene transfer compared to Sleeping Beauty, Tol2 Antibody Therapeutics, 2023 165 and Mos1 systems [56]. Our study shows that using an all- dual staining in FACS, we successfully screened for mAbs in-one PiggyBac transposon vector in a single transfection with cross-reactivity for hC3d and mC3d. It is conceivable step, integration rates can reach >20% of scFab-displaying that this strategy can be applied to generating cross-reactive HEK293F cells, which is considerably higher than the 6% mAbs to other ortholog antigen pairs and panels as part of reported for full-length IgG using a PiggyBac system for antibody discovery, evolution or engineering. cotransfection of heavy chain, light chain and transposase Finally, since the variable domains of the mAbs we split into three different vectors [23]. Combining the all-in- retrieved by mammalian cell display are derived from one PiggyBac transposon vector with the HEK293F cell rabbits, they may require humanization for further devel- culture system, which is easy to transfect and culture in opment as pharmaceuticals. Notably, the same mammalian suspension to high density, we readily got mammalian- cell display platform could be readily used to make small cell display libraries encompassing close to 10 clones hav- libraries displaying scFabs with rabbit CDR sequences ing cell surface scFabs. While still two to three orders of grafted onto different human germline sequences with magnitude smaller than large naïve and synthetic libraries tailored FR diversification [58–60], followed by selection displayed on phage, we show that this library size is suf- with MACS and FACS. Using similar specialized libraries, ficient for successfully selecting an immune library and it the platform can also be used for affinity maturation. should also be sufficient to evolve antibody affinity, speci- However, it should be cautioned that a loss of affinity is ficity and manufacturability. Because of the hyperactive possible when converting scFabs to IgG [61]. In summary, PiggyBac transposase in the vector [35, 36], we found that we developed an efficient and highly versatile platform most cell clones harbored more than one scFab gene, which based on an all-in-one transposon vector to display scFabs increased the complexity of the libraries on the one hand on HEK293F cells for antibody discovery and adaptable but somewhat complicated the recovery of the responsible for humanization and affinity maturation. Although the scFab gene on the other hand. To overcome this issue, the platform does not require prior enrichment by microbial all-in-one vector could be split into two vectors, one to display technologies, it is compatible with our Fab-phage express the gene-of-interest and the other to express the display platform based on phagemid pC3C, which also uses transposase, allowing for cotransfection at optimal ratios a VL-CL-VH cassette flanked by asymmetric SfiI sites [43]. that promote single-copy scFab gene integration into the As such, it facilitates high-throughput screening of pre- host cell genome. Interestingly, the 60-aa linker we used selected Fab or scFab pools from large naïve or synthetic allowed the light chain (or heavy chain) from one scFab to antibody libraries. cross-pair with the heavy chain (or light chain) of another scFab displayed on the same cell, probably due to preferen- tial pairing of certain rbV and rbV . Reducing the linker MATERIALS AND METHODS L H length may decrease the chance of scFab cross-pairing on Cell lines the HEK293F cell surface. A significant advantage of mammalian cell display over HEK293F cells (Thermo Fisher Scientific) were main- tained in chemically defined, protein-free FreeStyle 293 phage display is the use of FACS to screen antibodies Expression Medium supplemented with 1% (v/v) heat- with desired properties in real time by defined gating and inactivated FBS to support adherent culture or without quantitative analysis. For instance, in our studies, we were FBS for suspension culture and 1 × penicillin–streptomycin able to identify clones with high affinity and cross-reactivity by dual staining. After normalization of the binding signal (all from Thermo Fisher Scientific). to the expression level, mAb clone N66 ranked first with a subnanomolar K (0.311 nM). In addition, the mammalian C3d proteins cell surface display level has been suggested to be indicative of the downstream developability of antibodies produced Human C3d protein. Human complement protein C3d (hC3d) derived from C3 after a series of proteolytic in mammalian cells [57]. Cross-reactivity of antibodies to cleavages was purchased from Complement Technology. ortholog antigens of different species is critical for preclin- Biotinylation of hC3d was performed using the Biotin-Tag ical studies in animal models for an early detection of on- Micro Biotinylation kit (Sigma-Aldrich). Labeling of hC3d target toxicities. C3d is highly conserved among different with Alexa Fluor 488 and 647 was achieved following the species. The amino acid sequence identity between human instructions of the labeling kits (ThermoFisherScientific). and cynomolgus C3d is 95.7%, while mouse and rabbit C3d are 84.1 and 81.8% identical to human C3d, respectively. Due to immunotolerance, it has been difficult to generate hFc-hC3d and hFc-mC3d proteins. DNA encoding hC3d mouse mAbs to hC3d that cross-react with mC3d. Thur- (aa1002-1303 of hC3) with a mutation at position 1010 man et al. used C3 knock-out mice to generate mouse mAbs from cysteine to alanine to avoid thioester bond formation that recognize both hC3d and mC3d and demonstrated with glutamine at position 1013 was custom-synthesized as their therapeutic utility in mouse models of renal and ocu- gBlock and cloned into pCEP4-hFc via HindIII/XhoI as lar disease [33]. Considering the relative dissimilarity of described [62]. Analogously, mouse C3d (mC3d, aa1002- rabbit C3d to mC3d (82.1% amino acid sequence identity) 1303) with the same mutation was cloned into pCEP4- and hC3d (81.8%), we used rabbits for immunization with hFc. The resulting pCEP4-hFc-hC3d and pCEP4-hFc- hC3d and generated an immune rabbit antibody library dis- mC3d plasmids were confirmed by DNA sequencing and playing chimeric rabbit/human scFabs on HEK293F cells. transiently transfected into HEK293F cells using PEI Using this mammalian cell display library coupled with (919012, Sigma-Aldrich). Transfected cells were cultured in 166 Antibody Therapeutics, 2023 FreeStyle 293 Expression medium, and hFc-hC3d and hFc- 1 week. Both libraries were kept in puromycin-containing mC3d proteins were purified from supernatants by Protein medium until selection. A affinity chromatography as described [43]. The quality and quantity of purified proteins were analyzed by SDS- Library sorting by MACS and FACS PAGE and A absorbance, respectively. Subsequently, MACS. 3 × 10 magnetic streptavidin-coated Dyn- hFc-hC3d and hFc-mC3d were labeled with Alexa Fluor abeads from the CELLection Biotin Binder Kit (Thermo 488 and 647 as described above. Fisher Scientific) were washed and resuspended in 3 ml PBS, followed by incubation with 3 ml pooled normal human complement serum (PNHCS, Innovative Research) Transposon vectors at 37 C for 1 h. After washing with 1% (w/v) BSA/DPBS, All-in-one PiggyBac transposon vectors were constructed opsonized beads with freshly deposited natural hC3d were based on PB2.0-DGFP (DNA 2.0), which combines in added to 300 ml suspension cultures of the mammalian cell one vector a hyperactive transposase driven by a CMV display libraries. After 1 h, 6 × 50 ml cells were placed on promoter and the expression cassettes of the gene of inter- a magnetic stand for 2 min. Magnetically separated cells est and the resistance marker positioned between the two bound by the beads were resuspended in fresh FreeStyle inverted terminal repeat (ITR) elements. Genes of interest, 293 Expression Medium and cultured without puromycin i.e. Dasher GFP (DGFP), single-chain Fab (scFab) and for 1 week before FACS. secreted scFab (sscFab), are under the control of an EF1α promoter. The expression cassette of a puromycin-resistant FACS. 1 × 10 MACS enriched sub-library cells gene enables selection of stable cells with transposon inte- were washed and resuspended in 10 ml ice-cold FACS grated into their genomes. The displayed scFab has a 60-aa buffer (DPBS containing 1% (w/v) BSA, 1 × penicillin– linker [40] between light and heavy chain. As its C-terminus, streptomycin and 1 mM EDTA), followed by staining with the scFab is fused to a (G S) linker followed by an HA 4 3 10 μg Alexa Fluor 488 labeled C3d for 1 h in a cold room at tag (YPYDVPDYAS) and a human PDGFRβ segment (aa 4 C and rotating at 10 rpm/min. After washing three times 513-561) that includes the transmembrane domain (aa 533- with ice-cold FACS buffer, cells were resuspended in DPBS 553). sscFabs are tagged with an octahistidine (HHHHH- containing 1% (w/v) BSA, 1 × penicillin–streptomycin HHH) tag for purification. For cloning, two asymmetric 2+ 2+ and 2.5 mM Mg ,1mM Ca ,20 μl DNaseI from the BsaI sites flanking DGFP in PB2.0-DGFP were used to CELLection Biotin Binder Kit (Thermo Fisher Scientific) replace DGFP with scFabs, while two asymmetric SfiI and 100 ng/ml 4 ,6-diamidino-2-phenylindole (DAPI; Cell sites were used to replace the rbV -hC -rbV segment of L L H Signaling) and then filtered through 40-μm cell strainers. different chimeric rabbit/human scFabs. The cells were then sorted on a BD FACSAria™ Fusion instrument and pooled into a 6-well plate containing 2 ml FreeStyle 293 Expression Medium supplemented with 1% Library generation (v/v) heat-inactivated FBS to support adherent culture. All rabbit handling was carried out by veterinary personnel After expansion, 1 × 10 pooled cells were stained with at R&RResearch(Stanwood, WA). Two b9 allotype either 10 μg Alexa Fluor 647 labeled hC3d alone or with rabbits [44, 45] were immunized with 100 μghC3dand a mixture of 5 μg Alexa Fluor 488 labeled hFc-hC3d and Freund’s complete adjuvant, followed by three boosts with 5 μg Alexa Fluor 647 labeled hFc-mC3d, in the presence of 50 μg hC3d and Freund’s incomplete adjuvant in 3-week 10% PNHCS, for sorting of single cells with high affinity intervals. The serum antibody response to the immunogen to hC3d or hC3d/mC3d cross-reactivity. was monitored during the vaccination process by ELISA. Spleen and bone marrow from the two b9 allotype rabbits Antibody gene recovery were collected 5 days after the last boost and separately processed for total RNA preparation and RT-PCR ampli- Single cells after sorting were cultured for 2–3 weeks fication of rbV ,rbV and rbV encoding cDNA using for colony formation before expansion, and 1 × 10 κ λ H established protocols [43]. A degenerate reverse primer cells were then used to extract RNA following the rbIgG-C 1-R (5’gaagactgaYggagccttaggttg3’, Y = t or c) instructions of the RNeasy Mini Kit (Qiagen). After reverse that anneals to the 5 end of the rabbit IgG constant domain transcription using the SuperScript III First-Strand Syn- C 1 was used to amplify IgG-derived rbV encoding thesis System (Thermo Fisher Scientific), scFab-encoding H H sequences enriched in the immune antibody repertoire. DNA was PCR-amplified with forward primer Sig-SfiI- Subsequently, rbV /hC /rbV and rbV /hC /rbV seg- F (5’tagctgctgcaactggggcccag3’) and reverse primer HA-R κ κ H λ λ H ments were assembled by overlap extension PCR and (5’agcgtaatctggaacatcgtatgggta3’) annealing to the signal cloned into PB2.0-scFab via SfiI. Transformation of E. peptide and HA tag encoding sequences, respectively, in the coli strain ER2738 (Lucigen) by electroporation yielded PB2.0-scFab vector. PCR products were purified, digested 7 7 approximately 3.6 × 10 and 3.7 × 10 independent by SfiI and cloned into PB2.0-sscFab. To identify the right transformants for library κ and library λ, respectively. clones producing responsible scFabs, three transformants To generate the stable mammalian cell display libraries, were picked for each cell colony and unique scFab-encoding 300 μg maxi-prepped plasmids and 900 μlPEI were used sequences were Sanger-sequenced after DNA fingerprint- to transfect 3 × 10 HEK293F cells in 100 ml culture and ing with AluI, for which DNA sequences encoding the selected by 1.5 μg/ml puromycin 72 h after transfection for rbV -huC -rbV cassette were PCR-amplified, digested L L H Antibody Therapeutics, 2023 167 with AluI (frequent recognition site AG CT) and analyzed κ or λ mAb conjugated to BV 421 or APC (BioLegend), by electrophoresis on a 4% (w/v) agarose gel. Subsequently, or a 1:500 dilution of the biotinylated rat anti-HA mAb unique clones were transiently transfected into HEK293F 3F10 (Roche) in conjunction with 2 μg/ml PE-conjugated adherent cells and the supernatants were harvested 48 h streptavidin (BD Biosciences) to detect the light chains or later. Clones revealing a positive signal in ELISA were then the heavy chains displayed on cell surface. Binding activity sequenced and pursued further. was detected by 100 ng/100 μl C3d labeled with Alexa Fluor 488 or 647. All staining was performed on ice in dark, and DAPI (Cell Signaling) was added to a final concentration of scFab expression and purification 100 ng/ml to exclude dead cells. Cells were analyzed using PB2.0-sscFab vectors were transiently transfected into sus- a FACSCalibur instrument (BD Biosciences) and FlowJo pension HEK293F cells using PEI and purified by Immo- analytical software (Tree Star). bilized Metal Ion Affinity Chromatography (IMAC) using a 1-ml HisTrap column (Cytiva) as described [43]. The SPR quality and quantity of purified scFabs were analyzed by SDS-PAGE and A absorbance, respectively. 280 SPR for the measurement of kinetic and thermodynamic parameters of the binding of purified scFabs to hC3d or mC3d proteins was performed on a Biacore X100 ELISA instrument using Biacore reagents and software (Cytiva). Rabbit antibody response to hC3d. Each well of a 96- A mouse anti-human IgG C 2 mAb was immobilized on a well Costar 3690 plate (Corning) was coated with 100 ng CM5 sensor chip using reagents and instructions supplied hC3d protein in 30 μl coating buffer (0.1 M Na CO , 2 3 with the Human Antibody Capture Kit (Cytiva). hFc-hC3d 0.1 M NaHCO , pH 9.6) for 1 h at 37 C. After block- and hFc-mC3d fusion proteins were captured at a density ing with 150 μl 5% (w/v) milk/PBS for 1 h at 37 Cand not exceeding 400 RU. Each sensor chip included an empty washing three times with 150 μlPBS,50 μl of 1:500 or flow cell for instantaneous background depletion. All 1:2 000 dilution of rabbit serum in 1% (w/v) milk/PBS binding assays used 1× HBS-EP+ running buffer (10 mM was applied to each well. Following incubation for 2 h HEPES, 150 mM NaCl, 3 mM EDTA (pH 7.4) and 0.05% at 37 C and washing as before, 50 μl of a 1:1 000 dilu- (v/v) Surfactant P20) and a flow rate of 30 μl/min. All tion of donkey anti-rabbit IgG (H + L) pAb conjugated scFabs were injected at five different concentrations. The to horse radish peroxidase (HRP) (Jackson ImmunoRe- sensor chips were regenerated with 3 M MgCl from the search) in 1% (w/v) BSA/TBS was added and incubated Human Antibody Capture Kit without any loss of binding for 1 h at 37 C. The wells were washed four times, and capacity. Calculation of association (k ) and dissociation on colorimetric detection was performed using 2,2 -azino-bis (k ) rate constants was based on a 1:1 Langmuir binding off (3-ethylbenzothiazoline)-6-sulfonic acid (ABTS; Roche) as model. The equilibrium dissociation constant (K )was a substrate according to the manufacturer’s directions. The calculated from k /k . off on absorbance was measured at 405 nm using a SpectraMax M5 microplate reader (Molecular Devices) and SoftMax Pro software (Molecular Devices). SUPPLEMENTARY DATA Supplementary Data are available at ABT Online. scFab binding assay to hC3d and mC3d. Each well of a 96-well Costar 3690 plate (Corning) was coated with 100 ng streptavidin (Sigma-Aldrich) in 30 μl coating buffer (see above) for 1 h at 37 C. After blocking with 150 μl3% FUNDING (w/v) BSA/PBS for 1 h at 37 C, 100 ng biotinylated hC3d We gratefully acknowledge support of this study by or mC3d in 50 μl 1% (w/v) BSA/PBS was captured by National Institutes of Health (NIH) grants R01 CA174844, incubation for 1 h at 37 C. The wells were washed three R01 CA181258, R01 CA204484, R21 CA229961 and R21 times with 150 μlPBS.Next, 50 μl supernatants harvested CA263240 and by the Klorfine Foundation. after 48 h transfection of HEK293F cells were applied to each well. Following incubation for 2 h at 37 C and washing as before, 50 μl of a 1:1 000 dilution of a mouse anti- CONFLICT OF INTEREST STATEMENT His tag mAb conjugated to HRP (R&D Systems) in 1% (w/v) BSA/TBS was added and incubated for 1 h at 37 C. C.R. holds the position of Editorial Board Member for The wells were then washed four times, and detection with Antibody Therapeutics and is blinded from reviewing or ABTS was carried out as described above. making decisions for the manuscript. All authors declare no conflict of interest. Flow cytometry Cells were stained using standard flow cytometry method- AUTHORS’ CONTRIBUTIONS ology. Briefly, 0.1–1 × 10 cells in 100 μl flow cytometry buffer (PBS containing 1% (w/v) BSA, 0.1% (w/v) sodium H.P. and C.R. conceived and designed the study. J.C. and azide and 1 mM EDTA) were stained in a V-shaped 96-well H.P. conducted and analyzed all experiments. J.C, H.P. and plate (BrandTech) with 5 μl mouse anti human light chain C.R. wrote the manuscript. 168 Antibody Therapeutics, 2023 CRediT AUTHOR STATEMENT 14. Boder, ET, Wittrup, KD. Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 1997; 15: Jing Chang (Data curation-Lead, Investigation-Lead, 553–7. Methodology-Lead, Resources-Lead, Validation-Lead, 15. Sivelle, C, Sierocki, R, Ferreira-Pinto, K et al. Fab is the most efficient format to express functional antibodies by yeast surface Visualization-Lead, Writing—original draft-Lead, Writ- display. MAbs 2018; 10: 720–9. ing—review & editing-Lead), Christoph Rader 16. Oh, EJ, Liu, R, Liang, L et al. Multiplex evolution of antibody (Conceptualization-Lead, Funding acquisition-Lead, fragments utilizing a yeast surface display platform. ACS Synth Biol Investigation-Lead, Project administration-Lead, 2020; 9: 2197–202. 17. Krohl, PJ, Spangler, JB. A hybrid adherent/suspension cell-based Resources-Lead, Supervision-Lead, Writing—original selection strategy for discovery of antibodies targeting membrane draft-Lead, Writing—review & editing-Lead), Haiyong proteins. Methods Mol Biol 2022; 2491: 195–216. Peng (Conceptualization-Lead, Data curation-Lead, For- 18. Bowers, PM, Horlick, RA, Kehry, MR et al. Mammalian cell mal analysis-Lead, Investigation-Lead, Methodology- display for the discovery and optimization of antibody therapeutics. Lead, Project administration-Lead, Resources-Lead, Methods 2014; 65: 44–56. 19. Dangi, AK, Sinha, R, Dwivedi, S et al. Cell line techniques and gene Supervision-Lead, Validation-Lead, Visualization-Lead, editing tools for antibody production: a review. Front Pharmacol Writing—original draft-Lead, Writing—review & editing- 2018; 9: 630. Lead). 20. Robertson, N, Lopez-Anton, N, Gurjar, SA et al. Development of a novel mammalian display system for selection of antibodies against membrane proteins. J Biol Chem 2020; 295: 18436–48. 21. Luo, R, Zhao, Y, Fan, Y et al. High efficiency CHO cell DATA AVAILABILITY display-based antibody maturation. Sci Rep 2020; 10: 8102. 22. Mason, DM, Weber, CR, Parola, C et al. High-throughput antibody Four supplementary figures are provided. The data under- engineering in mammalian cells by CRISPR/Cas9-mediated lying this article will be shared on reasonable request to the homology-directed mutagenesis. Nucleic Acids Res 2018; 46: corresponding authors. 7436–49. 23. Waldmeier, L, Hellmann, I, Gutknecht, CK et al. Transpo-mAb display: transposition-mediated B cell display and functional screening of full-length IgG antibody libraries. MAbs 2016; 8: ETHICS AND CONSENT STATEMENT 726–40. 24. Breous-Nystrom, E, Schultze, K, Meier, M et al. Retrocyte display Consent was not required in this work. technology: generation and screening of a high diversity cellular antibody library. Methods 2014; 65: 57–67. 25. Doerner, A, Rhiel, L, Zielonka, S et al. Therapeutic antibody ANIMAL RESEARCH STATEMENT engineering by high efficiency cell screening. FEBS Lett 2014; 588: 278–87. All rabbit handling was carried out by veterinary personnel 26. Smith, ES, Zauderer, M. Antibody library display on a mammalian at R & R Research (Stanwood, WA) in compliance with the virus vector: combining the advantages of both phage and yeast NIH Guide for the Care and Use of Laboratory Animals. display into one technology. Curr Drug Discov Technol 2014; 11: 48–55. 27. Bowers, PM, Horlick, RA, Neben, TY et al. Coupling mammalian cell surface display with somatic hypermutation for the discovery REFERENCES and maturation of human antibodies. Proc Natl Acad Sci U S A 1. Mullard, A. FDA approves 100th monoclonal antibody product. 2011; 108: 20455–60. Nat Rev Drug Discov 2021; 20: 491–5. 28. Taube, R, Zhu, Q, Xu, C et al. Lentivirus display: stable expression of human antibodies on the surface of human cells and virus 2. Goydel, RS, Rader, C. Antibody-based cancer therapy. Oncogene particles. PloS One 2008; 3: e3181. 2021; 40: 3655–64. 29. Beerli, RR, Bauer, M, Buser, RB et al. Isolation of human 3. Kaplon, H, Chenoweth, A, Crescioli, S et al. Antibodies to watch in monoclonal antibodies by mammalian cell display. Proc Natl Acad 2022. MAbs 2022; 14: 2014296. Sci U S A 2008; 105: 14336–41. 4. Lyu, X, Zhao, Q, Hui, J et al. The global landscape of approved 30. Hust, M, Jostock, T, Menzel, C et al. Single chain fab (scFab) antibody therapies. Antib Ther 2022; 5: 233–57. fragment. BMC Biotechnol 2007; 7: 14. 5. Carter, PJ, Lazar, GA. Next generation antibody drugs: pursuit of 31. Toapanta, FR, Ross, TM. Complement-mediated activation of the the ’high-hanging fruit’. Nat Rev Drug Discov 2018; 17: 197–223. adaptive immune responses: role of C3d in linking the innate and 6. Chen, WC, Murawsky, CM. Strategies for generating diverse adaptive immunity. Immunol Res 2006; 36: 197–210. antibody repertoires using transgenic animals expressing human 32. Rogers, LM, Veeramani, S, Weiner, GJ. Complement in antibodies. Front Immunol 2018; 9: 460. monoclonal antibody therapy of cancer. Immunol Res 2014; 59: 7. Carter, PJ, Rajpal, A. Designing antibodies as therapeutics. Cell 203–10. 2022; 185: 2789–805. 33. Thurman, JM, Kulik, L, Orth, H et al. Detection of complement 8. Valldorf, B, Hinz, SC, Russo, G et al. Antibody display technologies: activation using monoclonal antibodies against C3d. J Clin Invest selecting the cream of the crop. Biol Chem 2022; 403: 455–77. 9. Laustsen, AH, Greiff, V, Karatt-Vellatt, A et al. Animal 2013; 123: 2218–30. immunization, in vitro display technologies, and machine learning 34. Paek, JH, Kwon, J, Lim, J et al. Clinical significance of C3d assay in for antibody discovery. Trends Biotechnol 2021; 39: 1263–73. kidney transplant recipients with donor-specific anti-human 10. Kaleli, NE, Karadag, M, Kalyoncu, S. Phage display derived leukocyte antigen antibodies. Transplant Proc 2022; 54: 341–5. therapeutic antibodies have enriched aliphatic content: insights for 35. Yusa, K, Zhou, L, Li, MA et al. A hyperactive piggyBac transposase developability issues. Proteins 2019; 87: 607–18. for mammalian applications. Proc Natl Acad Sci U S A 2011; 108: 11. Alfaleh, MA et al. Phage display derived monoclonal antibodies: 1531–6. from bench to bedside. Front Immunol 2020; 11: 1986. 36. Burnight, ER, Staber, JM, Korsakov, P et al. A hyperactive 12. Almagro, JC, Pedraza-Escalona, M, Arrieta, HI et al. Phage display transposase promotes persistent gene transfer of a piggyBac DNA libraries for antibody therapeutic discovery and development. transposon. Mol Ther Nucleic Acids 2012; 1: e50. Antibodies (Basel) 2019; 8: 44–65. 37. Chen, Q, Luo, W, Veach, RA et al. Structural basis of seamless 13. Ledsgaard, L, Ljungars, A, Rimbault, C et al. Advances in antibody excision and specific targeting by piggyBac transposase. Nat phage display technology. Drug Discov Today 2022; 27: 2151–69. Commun 2020; 11: 3446. Antibody Therapeutics, 2023 169 38. Sandoval-Villegas, N, Nurieva, W, Amberger, M et al. 51. Feige, MJ, Groscurth, S, Marcinowski, M et al. An unfolded CH1 Contemporary transposon tools: a review and guide through domain controls the assembly and secretion of IgG antibodies. Mol mechanisms and applications of Sleeping Beauty, piggyBac and Tol2 Cell 2009; 34: 569–79. for Genome Engineering. Int J Mol Sci 2021; 22: 5084–5113. 52. Stoyle, CL, Stephens, PE, Humphreys, DP et al. IgG light 39. Li, X, Burnight, ER, Cooney, AL et al. piggyBac transposase tools chain-independent secretion of heavy chain dimers: consequence for for genome engineering. Proc Natl Acad Sci U S A 2013; 110: therapeutic antibody production and design. Biochem J 2017; 474: E2279–87. 3179–88. 40. Koerber, JT, Hornsby, MJ, Wells, JA. An improved single-chain fab 53. Bak, RO, Gomez-Ospina, N, Porteus, MH. Gene editing on Center platform for efficient display and recombinant expression. JMol stage. Trends Genet 2018; 34: 600–11. Biol 2015; 427: 576–86. 54. Tipanee, J, VandenDriessche, T, Chuah, MK. Transposons: moving 41. Walker, LM, Bowley, DR, Burton, DR. Efficient recovery of forward from preclinical studies to clinical trials. Hum Gene Ther high-affinity antibodies from a single-chain fab yeast display library. 2017; 28: 1087–104. J Mol Biol 2009; 389: 365–75. 55. Wei, M, Mi, CL, Jing, CQ et al. Progress of transposon vector 42. Hofer, T, Tangkeangsirisin, W, Kennedy, MG et al. Chimeric system for production of recombinant therapeutic proteins in rabbit/human fab and IgG specific for members of the Nogo-66 mammalian cells. Front Bioeng Biotechnol 2022; 10: 879222. receptor family selected for species cross-reactivity with an improved 56. Wu, SC, Meir, YJJ, Coates, CJ et al. piggyBac is a flexible and highly phage display vector. J Immunol Methods 2007; 318: 75–87. active transposon as compared to sleeping beauty, Tol2, and Mos1 in 43. Peng, H, Nerreter, T, Chang, J et al. Mining naive rabbit antibody mammalian cells. Proc Natl Acad Sci U S A 2006; 103: 15008–13. repertoires by phage display for monoclonal antibodies of 57. Jin, YJ, Yu, D, Tian, XL et al. A novel and effective approach to therapeutic utility. J Mol Biol 2017; 429: 2954–73. generate germline-like monoclonal antibodies by integration of 44. Popkov, M, Mage, RG, Alexander, CB et al. Rabbit immune phage and mammalian cell display platforms. Acta Pharmacol Sin repertoires as sources for therapeutic monoclonal antibodies: the 2022; 43: 954–62. impact of kappa allotype-correlated variation in cysteine content on 58. Goydel, RS, Weber, J, Peng, H et al. Affinity maturation, antibody libraries selected by phage display. J Mol Biol 2003; 325: humanization, and co-crystallization of a rabbit anti-human ROR2 325–35. monoclonal antibody for therapeutic applications. J Biol Chem 2020; 45. Weber, J, Peng, H, Rader, C. From rabbit antibody repertoires to 295: 5995–6006. rabbit monoclonal antibodies. Exp Mol Med 2017; 49: e305. 59. Zhang, YF, Ho, M. Humanization of rabbit monoclonal antibodies 46. Jain, T, Sun, T, Durand, S et al. Biophysical properties of the via grafting combined Kabat/IMGT/Paratome clinical-stage antibody landscape. Proc Natl Acad Sci U S A 2017; complementarity-determining regions: rationale and examples. 114: 944–9. MAbs 2017; 9: 419–29. 47. Tiller, KE, Tessier, PM. Advances in antibody design. Annu Rev 60. Rader, C, Ritter, G, Nathan, S et al. The rabbit antibody repertoire Biomed Eng 2015; 17: 191–216. as a novel source for the generation of therapeutic human 48. Lerner, RA. Combinatorial antibody libraries: new advances, antibodies. J Biol Chem 2000; 275: 13668–76. new immunological insights. Nat Rev Immunol 2016; 16: 61. Steinwand, M, Droste, P, Frenzel, A et al. The influence of antibody 498–508. fragment format on phage display based affinity maturation of IgG. 49. Bradbury, A, Pluckthun, A. Reproducibility: standardize antibodies MAbs 2014; 6: 204–18. used in research. Nature 2015; 518: 27–9. 62. Yang, J, Baskar, S, Kwong, KY et al. Therapeutic potential and 50. Bradbury, AR, Pluckthun, A. Getting to reproducible antibodies: challenges of targeting receptor tyrosine kinase ROR1 with the rationale for sequenced recombinant characterized reagents. monoclonal antibodies in B-cell malignancies. PloS One 2011; 6: Protein Eng Des Sel 2015; 28: 303–5. e21018.

Journal

Antibody TherapeuticsOxford University Press

Published: May 26, 2023

Keywords: in vitro display technologies; mammalian cell display; rabbit monoclonal antibodies; scFab; transposon

There are no references for this article.