Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Bovine milk–based formula leads to early maturation-like morphological, immunological, and functional changes in the jejunum of neonatal piglets

Bovine milk–based formula leads to early maturation-like morphological, immunological, and... Abstract Artificial rearing and formula feeding is coming more into the focus due to increasing litter sizes and limited nursing capacity of sows. The formula composition is important to effectively support the development of the gut and prevent intestinal dysfunction in neonatal piglets. In this study, newborn piglets (n = 8 per group) were fed a bovine milk–based formula (FO), containing skimmed milk and whey as the sole protein and carbohydrate sources, or were suckled by the sow (sow milk [SM]). After 2 wk, tissue from the jejunum was analyzed for structural (i.e., morphometry) and functional (i.e., disaccharidase activity, glucose transport, permeability toward macromolecules, and immune cell presence) changes and concomitant expression of related genes. Formula-fed piglets had more liquid feces (P < 0.05) over the entire experimental period. Although FO contained twice as much lactose (46% on a DM basis) as SM (21%) and no maltose or starch, the lactase activity was lower (P < 0.05) and glucose transport capacity was higher (P < 0.05) in FO-fed pigs. The relative proportion of intraepithelial natural killer cells and proinflammatory cytokine gene expression (IL-8, TNF-a, and IFN-y) was higher in FO-fed pigs (P < 0.05). Piglets fed FO had deeper crypts, larger villus area, and higher expression of caspase 3 and proliferating cell nuclear antigen (P < 0.05). Epithelial permeability toward fluorescein isothiocyanate–dextran was higher and expression of claudin-4 was lower in FO-fed piglets (P < 0.05). The data suggest an early response to bovine milk–based compounds in the FO accompanied with early onset of functional maturation and impaired barrier function. Whether lactose, absence of species-specific protective factors, or antigenicity of foreign proteins lead to to the observed intestinal reactions requires further clarification. INTRODUCTION The early postnatal period is a critical time for structural and functional development of the neonatal gastrointestinal tract (Buddington and Sangild, 2011), and diet plays an important role in the development of digestive and absorptive capacity (Jacobi and Odle, 2012). The gastrointestinal responses to different diets fed after birth have been investigated in both term and preterm piglets. It is well established that sow milk and formula differ in nutrient and bioactive compound composition and that formula feeding, compared with mothers' milk, may increase the risk for intestinal disorders (Buddington and Sangild, 2011; Jacobi and Odle, 2012; Sangild et al., 2013). In this context, formula feeding can modulate the activity of digestive enzymes, intestinal mass, and microbial activity compared with sow-reared pigs or piglets receiving bovine colostrum (Jensen et al., 2001; Thymann et al., 2009; Wang et al., 2013). Formula feeding may also provide a challenge for the immature immune system due to the presence of foreign proteins or the absence of functional compounds such as growth factors or immune stimulatory factors. In addition, differences in general nutrient composition (i.e., lactose and fat content) between sow milk and formula may shape frequently observed ontogenetic and functional changes. In pigs, genetic selection for hyperproliferation of sows during the past decades has increased the number of live-born pigs but also the number of low-birth-weight piglets per litter (Foxcroft, 2012). As the ability of sows to raise large litters with more than 14 piglets is limited, there is an increased need for alternative, artificial rearing systems for piglets using supplemental or exclusive formula feeding. To date, there is little information available about optimal formula composition and how this will affect the intestinal development. As indicated above, bovine milk–based formula contains foreign proteins, high amounts of lactose, and lower concentrations of fat compared with sow milk. It can be hypothesized that these differences stimulate ontogenetic changes during early life and may be accompanied by changes in immune response and barrier function, thereby predisposing the piglets toward intestinal disorders and inflammation. Therefore, the current study was conducted to study the complex nutrition–host interaction in formula-fed piglets compared with sow-reared piglets. MATERIAL AND METHODS All procedures involving pig handling and treatments were approved by the local state office of occupational health and technical safety “Landesamt für Gesundheit und Soziales Berlin” (regulation number 281/13). Animals, Housing, Diets, and Sampling Sixteen newborn piglets from a total of 4 litters were used in this study. Eight randomly selected piglets (4 male and 4 female) with a mean BW of 1.5 ± 0.2 kg were removed from their mothers 4 h after birth and placed (2 piglets each) in artificial acrylic glass rearing pens (60 by 60 by 100 cm). The choice of the time point allowed an initial colostrum uptake by all piglets to avoid bias based on insufficient early immunoglobulin uptake. The artificial rearing units were equipped with a heating lamp (allowing an ambient temperature of 32 ± 1°C), ventilation, and ad libitum water supply. Within the following 12 h, the 8 piglets were successfully trained to drink the formula (FO) from trays. From this time point on, piglets were offered the premixed and prewarmed FO (1:4 wt/wt; 37°C) every 2 h starting from 0600 until 1200 h. The FO composition was based on skimmed milk powder (630 g/kg), whey powder (150 g/kg), soy oil (199 g/kg), mineral and vitamin premix (10 g/kg), limestone (10 mg/kg), and methionine (1 g/kg). The composition of the FO was chosen according to previous studies (Thymann et al., 2009; Wang et al., 2013) and also from commercially available piglet FO. Another 8 piglets (4 male and 4 female; 1.4 ± 0.2 kg mean BW) were selected and suckled by their mothers together with the remaining littermates as a control group (sow milk [SM]). The chemical composition of FO and average chemical composition of SM from sow-reared litters is provided in Table 1. The BW and fecal score (based on a subjective scoring system from 1 = entirely liquid to 5 = hard pellets) was recorded daily. Table 1. Chemical composition of sow milk (SM) and formula (FO) in the study Item  SM  FO  Ash, g/kg DM  50  71  Protein, g/kg DM  302  226  Ether extract, g/kg DM  373  200  Lactose, g/kg DM  210  460  Lysine, g/kg DM  16  17  Methionine + cysteine, g/kg DM  14  11  Threonine, g/kg DM  11  10  Calcium, g/kg DM  13  14  Phosphorus, g/kg DM  8  7  Potassium, g/kg DM  4  12  Sodium, g/kg DM  3  4  Iron, mg/kg DM  13  70  Zinc, mg/kg DM  37  98  Manganese, mg/kg DM  1  7  Copper, mg/kg DM  5  7  Item  SM  FO  Ash, g/kg DM  50  71  Protein, g/kg DM  302  226  Ether extract, g/kg DM  373  200  Lactose, g/kg DM  210  460  Lysine, g/kg DM  16  17  Methionine + cysteine, g/kg DM  14  11  Threonine, g/kg DM  11  10  Calcium, g/kg DM  13  14  Phosphorus, g/kg DM  8  7  Potassium, g/kg DM  4  12  Sodium, g/kg DM  3  4  Iron, mg/kg DM  13  70  Zinc, mg/kg DM  37  98  Manganese, mg/kg DM  1  7  Copper, mg/kg DM  5  7  View Large Table 1. Chemical composition of sow milk (SM) and formula (FO) in the study Item  SM  FO  Ash, g/kg DM  50  71  Protein, g/kg DM  302  226  Ether extract, g/kg DM  373  200  Lactose, g/kg DM  210  460  Lysine, g/kg DM  16  17  Methionine + cysteine, g/kg DM  14  11  Threonine, g/kg DM  11  10  Calcium, g/kg DM  13  14  Phosphorus, g/kg DM  8  7  Potassium, g/kg DM  4  12  Sodium, g/kg DM  3  4  Iron, mg/kg DM  13  70  Zinc, mg/kg DM  37  98  Manganese, mg/kg DM  1  7  Copper, mg/kg DM  5  7  Item  SM  FO  Ash, g/kg DM  50  71  Protein, g/kg DM  302  226  Ether extract, g/kg DM  373  200  Lactose, g/kg DM  210  460  Lysine, g/kg DM  16  17  Methionine + cysteine, g/kg DM  14  11  Threonine, g/kg DM  11  10  Calcium, g/kg DM  13  14  Phosphorus, g/kg DM  8  7  Potassium, g/kg DM  4  12  Sodium, g/kg DM  3  4  Iron, mg/kg DM  13  70  Zinc, mg/kg DM  37  98  Manganese, mg/kg DM  1  7  Copper, mg/kg DM  5  7  View Large At 14 ± 1 d of age, piglets were killed for tissue and digesta sampling 4 h after the last meal. Pigs were sedated with 20 mg/kg BW of ketamine hydrochloride (Ursotamin; Serumwerk Bernburg AG, Bernburg, Germany) and 2 mg/kg BW of azaperone (Stresnil; Janssen-Cilag GmbH, Neuss, Germany), and 5 mL blood was collected by heart puncture in heparinized containers for immune cell analysis. Pigs were euthanized by intracardial injection of 10 mg/kg BW of T61 (Intervet Deutschland GmbH, Unterschleißheim, Germany). Jejunal contents from the mid jejunum (starting 2 m from the pylorus until 80 cm before the ileocecal valve) were collected and stored at –80°C. Sections from the mid jejunum (starting 2 m from the pylorus) were taken for subsequent analyses. Two 20-cm segments were used for phenotypic analysis of intraepithelial lymphocytes by flow cytometry and functional analysis in Ussing chambers, respectively. Three pieces (2 cm each) located between the 2 larger pieces were either immediately fixed in methyl Carnoy's solution for histological examinations (n = 2) or snap-frozen in liquid nitrogen and stored at –80°C until total RNA extraction and gene expression analysis (n = 1). Chemical Analyses Proximate nutrients (DM, ash, CP, ether extract, and minerals) in SM and FO were determined by classical Weende procedures (Naumann and Bassler, 2004), and lactose was determined enzymatically (ENZYTEC Lactose/D-galactose kit; R-Biopharm AG, Darmstadt, Germany). Trace elements were analyzed by atomic absorption spectrometry in an AAS vario 6 spectrometer (Analytik Jena AG, Jena, Germany) as previously described (Pieper et al., 2015). The AA analyses were performed on a Biochrom 20 Plus AA analyzer (Amersham Pharmacia Biotech Inc., Piscataway, NJ) after hydrolysis of lyophilized samples in 6 M aqueous HCl at 110°C for 24 h. Methionine and cysteine were measured after oxidation (H2O2/formic acid). Morphometry, Histopathology Score, and Functional Analyses For the morphometric analysis, jejunal sections were cut open longitudinally and subsequently fixed in methyl Carnoy's solution (60% methanol, 30% chloroform, and 10% glacial acetic acid, vol/vol/vol). After dehydration and infiltration with solidified paraffin wax, the tissue was embedded, cut at 5 μm with a sledge microtome (Typ 1400; Leitz, Wetzlar, Germany), and subsequently stained with hematoxylin and eosin. Villus height, crypt depth, villus height:crypt depth ratio, and villus area were determined in well-oriented villi and crypt units. Jejunal brush border membrane disaccharidase activity (maltase, lactase, and sucrase) was analyzed as previously described (Martin et al., 2012, 2013). For normalization of enzyme activity data, total protein concentration was determined using the Bradford assay in microtitration plates as previously described (Martin et al., 2012, 2013). Ussing chamber experiments were performed as previously described (Kröger et al., 2013; Richter et al., 2014; Villodre-Tudela et al., 2015) with some modifications. The jejunal epithelium (without serosal and muscle layers) was immediately mounted in Ussing chambers (n = 6 chambers per piglet) with an exposed area of 1.31 cm2 and bathed in 38°C modified Krebs–Ringer buffer solution (pH adjusted to 7.4, containing 115 mmol/L NaCl, 5 mmol/L KCl, 1.5 mmol/L CaCl2, 1.2 mmol/L MgCl2, 0.6 mmol/L NaH2PO4, 2.4 mmol/L Na2HPO4, 25 mmol/L NaHCO3, and 20 mmol/L mannitol). A microcomputer-controlled voltage/current clamp (K. Mussler Scientific Instruments, Aachen, Germany) was used to obtain electrical measurements. Glucose (10 mmol/L final concentration) was added to the mucosal side of 3 chambers. In parallel, mannitol (10 mmol/L final concentration) was added to the serosal compartment to maintain osmolarity. To determine the response toward secretagogues, histamine (100 μmol/L final concentration) was applied to the serosal compartment of 2 chambers. One chamber served as untreated control. The change of short-circuit current (Isc) was determined by subtracting the peak Isc after 3 min from basal Isc as an indirect measure of electrolyte transport. Basal values were obtained as average mean values of the last 3 min before the addition of glucose or histamine, respectively. Permeability to macromolecules was measured using horseradish peroxidase (HRP; 44,000 Da) and fluorescein isothiocyanate–dextran (FITC-D; 4,000 Da). Briefly, the tracer was added to the mucosal side of 3 chambers per piglet. Samples were taken from the serosal side immediately before addition and after 60 min. The HRP activity was measured using the QuantaBlu™ Fluorogenic Peroxidase Substrate Kit (ThermoFischer Scientific, Darmstadt, Germany). The FITC-D fluorescence was measured at 525 nm using a 2300 Multimode plate reader (PerkinElmer Inc., Waltham, MA). Measurements of serial dilutions of the tracer molecules were used to convert the results in nanograms per milliliter and micrograms per milliliter for HRP and FITC-D, respectively. Intraepithelial and Mesenteric Lymph Node Immune Cell Populations The isolation of intraepithelial lymphocytes and enterocytes from the jejunum was performed as previously described (Liu et al., 2014). Immune cells from mesenteric lymph nodes (MLN) were obtained according to a slightly modified protocol (Solano-Aguilar et al., 2000). Briefly, MLN were incubated with 10 mL of Roswell Park Memorial Institute (RPMI)–1640 medium and minced with scalpel blades into pieces of about 2 mm2 to release leukocytes. Cells were subsequently poured through a nylon mesh (200-μm pore size) using another 20 mL of RPMI-1640. The suspension was centrifuged (300 × g for 5 min at 4°C) and erythrolysis was subsequently performed using an ammonium–chloride–potassium buffer containing EDTA. The antibodies used for flow cytometry measurements are listed in Table 2. The resulting suspensions (containing leukocytes and epithelial cells) were subjected to flow cytometry using a FACSCalibur flow cytometer (Becton Dickinson GmbH, Heidelberg, Germany). To analyze the proportion of the stained cells, a lymphocyte gate was constituted following morphological criteria. Proportions of positive immune cells reflect the distribution of subpopulations within the relevant lymphocyte gate. Antibodies and their combinations were used to determine relative amounts of natural killer (NK) cells (CD2+/CD5–), T cells (CD2+/CD5+), α/beta cytotoxic T cells (CD8β+), γ/δ T cells (TcR1 γ+), mature B cells (CD21+), activated T cells (CD4+/CD25med), and T regulatory cells (CD4+/CD25high). Table 2. Primary and secondary antibodies used for flow cytometry staining Specificity  Clone/host species of secondary antibody  Isotype  Cytochrome1  Distributor2  CD2  MSA4  IgG2a  None  VMRD  CD4α  74-12-4  IgG2b  FITC  SouthernBiotech  CD5  9G12  IgG1  None  VMRD  CD8β  PG164A  IgG2a  None  VMRD  TcR1-N4 (δ)  PGLBL22A  IgG1  None  VMRD  CD21  BB6-11C9.6  IgG1κ  None  SouthernBiotech  CD25  K231.3B2  IgG1  None  Acris  IgG2a  Pooled antisera from goats    PE  SouthernBiotech  IgG1  Pooled antisera from goats    FITC  SouthernBiotech  Specificity  Clone/host species of secondary antibody  Isotype  Cytochrome1  Distributor2  CD2  MSA4  IgG2a  None  VMRD  CD4α  74-12-4  IgG2b  FITC  SouthernBiotech  CD5  9G12  IgG1  None  VMRD  CD8β  PG164A  IgG2a  None  VMRD  TcR1-N4 (δ)  PGLBL22A  IgG1  None  VMRD  CD21  BB6-11C9.6  IgG1κ  None  SouthernBiotech  CD25  K231.3B2  IgG1  None  Acris  IgG2a  Pooled antisera from goats    PE  SouthernBiotech  IgG1  Pooled antisera from goats    FITC  SouthernBiotech  1FITC = fluorescein isothiocyanate; PE = phycoerythrin. 2VMRD = VMRD, Inc., Pullman, WA; SouthernBiotech = SouthernBiotech, Birmingham, AL; Acris = Acris Antibodies, Inc., San Diego, CA. View Large Table 2. Primary and secondary antibodies used for flow cytometry staining Specificity  Clone/host species of secondary antibody  Isotype  Cytochrome1  Distributor2  CD2  MSA4  IgG2a  None  VMRD  CD4α  74-12-4  IgG2b  FITC  SouthernBiotech  CD5  9G12  IgG1  None  VMRD  CD8β  PG164A  IgG2a  None  VMRD  TcR1-N4 (δ)  PGLBL22A  IgG1  None  VMRD  CD21  BB6-11C9.6  IgG1κ  None  SouthernBiotech  CD25  K231.3B2  IgG1  None  Acris  IgG2a  Pooled antisera from goats    PE  SouthernBiotech  IgG1  Pooled antisera from goats    FITC  SouthernBiotech  Specificity  Clone/host species of secondary antibody  Isotype  Cytochrome1  Distributor2  CD2  MSA4  IgG2a  None  VMRD  CD4α  74-12-4  IgG2b  FITC  SouthernBiotech  CD5  9G12  IgG1  None  VMRD  CD8β  PG164A  IgG2a  None  VMRD  TcR1-N4 (δ)  PGLBL22A  IgG1  None  VMRD  CD21  BB6-11C9.6  IgG1κ  None  SouthernBiotech  CD25  K231.3B2  IgG1  None  Acris  IgG2a  Pooled antisera from goats    PE  SouthernBiotech  IgG1  Pooled antisera from goats    FITC  SouthernBiotech  1FITC = fluorescein isothiocyanate; PE = phycoerythrin. 2VMRD = VMRD, Inc., Pullman, WA; SouthernBiotech = SouthernBiotech, Birmingham, AL; Acris = Acris Antibodies, Inc., San Diego, CA. View Large Gene Expression Analysis Jejunal gene expression was studied as previously described (Villodre-Tudela et al., 2015). Briefly, total RNA was extracted using the NucleoSpin RNAII kit (Marchery-Nagel GmbH & Co. KG, Düren, Germany). The mRNA quality and quantity was determined on an Agilent 2100 Bioanalyzer (Agilent Technologies Deutschland GmbH & Co. KG, Waldbronn, Germany) followed by reverse transcription of 100 ng RNA into cDNA in a final volume of 20 μL using Super Script III Reverse Transcriptase First-Strand cDNA Synthesis System (Invitrogen, Carlsbad, CA). Primers for proliferating cell nuclear antigen (PCNA), caspase 3 (CASP3), lactase-phlorizin-hydrolase (LPH), sodium coupled glucose transporter 1 (SGLT1), diamine oxidase (DAO), histamine N-methyl transferase (HNMT), tumor necrosis factor α (TNF-α), interferon γ (IFN-γ), IL-8, zonula occludens-1 (ZO-1), occludin (OCLN), claudin-2 (CLDN-2), and claudin-4 (CLDN-4) were used (Table 3). The real-time quantitative PCR was performed on a Stratagene MX3000p (Stratagene, Amsterdam, The Netherlands). Gene expression data were normalized using 60S ribosomal protein L19 (RPL19), β2–microglobulin, and succinate dehydrogenase subunit A (SDHA) as housekeeping genes and times-fold expression was calculated based on mean cycle threshold values of the housekeeping genes using the real-time PCR efficiency (Pfaffl, 2001). Table 3. List of primers used in this study Target1  Sequences of primers (5′ to 3′)  AT2, °C  Reference  RPL19  GCTTGCCTCCAGTGTCCTC  60  Pieper et al., 2012  GCGTTGGCGATTTCATTAG  SDHA  CAAACTCGCTCCTGGACCTC  60  Martin et al., 2013  CCGGAGGATCTTCTCAAGC  Beta-2 microglobulin  CCCCGAAGGTTCAGGTTTAC  60  Martin et al., 2013  CGGCAGCTATACTGATCCAC  PCNA  TGCCGAGATCTCAGTCACATTGGA  60  Pieper et al., 2012  CCATTTCCGAGTTCTCCACTTGCA  Caspase 3  ATTCAGGCCTGCCGAGGCAC  60  Pieper et al., 2012  CCCACTGTCCGTCTCAATCCCA  SGLT1  AAAGGAGAGGTCTGGGATGGTAA  60  Martin et al., 2012  ATTTCCCTAGTGGCCTGAGATTG  LPH  CTTGCTATACGACCTGAGGGG  60  This study  TGGCTGGCGACACACATAA  DAO  GCCTGAAGCCGCCCCCTTTT  60  Kröger et al., 2015  TGTGGGGGAACCTCGGGCTT  HNMT  GGAGCTTGTTTTCTGACCACGGCA  60  Kröger et al., 2015  TCCTGCATGCACTGGTGTTCCG  TNF-α  CAAGCCACTCCAGGACCCCCT  60  Villodre Tudela et al., 2015  AGAGTCGTCCGGCTGCCTGT  IL-8  GGTCTGCCTGGACCCCAAGGAA  60  Villodre Tudela et al., 2015  TGGGAGCCACGGAGAATGGGTT  IFN-γ  TCCAGCGCAAAGCCATCAGTG  60  Villodre Tudela et al., 2015  ATGCTCTCTGGCCTTGGAACATAGT  ZO-1  ACAGTGCCCAGAGACCAAGA  60  This study  CATTTCCTCGGGGTAGGGGT  OCLN  CAGGTGCACCCTCCAGATTG  60  This study  CAGCGGGTCACCTGATCTTC  CLDN-2  TAGGCTACATCCTGGGCCTT  60  This study  ACGTAAGAACTCGTTCGCCA  CLDN-4  CTCTCTTCGGACGCTGACTG  60  This study  GGGTCTAGGAGCTGGAAGGA  Target1  Sequences of primers (5′ to 3′)  AT2, °C  Reference  RPL19  GCTTGCCTCCAGTGTCCTC  60  Pieper et al., 2012  GCGTTGGCGATTTCATTAG  SDHA  CAAACTCGCTCCTGGACCTC  60  Martin et al., 2013  CCGGAGGATCTTCTCAAGC  Beta-2 microglobulin  CCCCGAAGGTTCAGGTTTAC  60  Martin et al., 2013  CGGCAGCTATACTGATCCAC  PCNA  TGCCGAGATCTCAGTCACATTGGA  60  Pieper et al., 2012  CCATTTCCGAGTTCTCCACTTGCA  Caspase 3  ATTCAGGCCTGCCGAGGCAC  60  Pieper et al., 2012  CCCACTGTCCGTCTCAATCCCA  SGLT1  AAAGGAGAGGTCTGGGATGGTAA  60  Martin et al., 2012  ATTTCCCTAGTGGCCTGAGATTG  LPH  CTTGCTATACGACCTGAGGGG  60  This study  TGGCTGGCGACACACATAA  DAO  GCCTGAAGCCGCCCCCTTTT  60  Kröger et al., 2015  TGTGGGGGAACCTCGGGCTT  HNMT  GGAGCTTGTTTTCTGACCACGGCA  60  Kröger et al., 2015  TCCTGCATGCACTGGTGTTCCG  TNF-α  CAAGCCACTCCAGGACCCCCT  60  Villodre Tudela et al., 2015  AGAGTCGTCCGGCTGCCTGT  IL-8  GGTCTGCCTGGACCCCAAGGAA  60  Villodre Tudela et al., 2015  TGGGAGCCACGGAGAATGGGTT  IFN-γ  TCCAGCGCAAAGCCATCAGTG  60  Villodre Tudela et al., 2015  ATGCTCTCTGGCCTTGGAACATAGT  ZO-1  ACAGTGCCCAGAGACCAAGA  60  This study  CATTTCCTCGGGGTAGGGGT  OCLN  CAGGTGCACCCTCCAGATTG  60  This study  CAGCGGGTCACCTGATCTTC  CLDN-2  TAGGCTACATCCTGGGCCTT  60  This study  ACGTAAGAACTCGTTCGCCA  CLDN-4  CTCTCTTCGGACGCTGACTG  60  This study  GGGTCTAGGAGCTGGAAGGA  1RPL19 = 60S ribosomal protein L19; SDHA = succinate dehydrogenase subunit A; PCNA = proliferating cell nuclear antigen; SGLT1 = sodium-dependent glucose transporter 1; LPH = lactase-phlorizin hydrolase; DAO = diamine oxidase (ameloride binding protein); HNMT = histamine N-methyl transferase; ZO-1 = zonula occludens-1; OCLN = occludin; CLDN-2 = claudin-2; CLDN-4 = claudin-4. 2AT = annealing temperature. View Large Table 3. List of primers used in this study Target1  Sequences of primers (5′ to 3′)  AT2, °C  Reference  RPL19  GCTTGCCTCCAGTGTCCTC  60  Pieper et al., 2012  GCGTTGGCGATTTCATTAG  SDHA  CAAACTCGCTCCTGGACCTC  60  Martin et al., 2013  CCGGAGGATCTTCTCAAGC  Beta-2 microglobulin  CCCCGAAGGTTCAGGTTTAC  60  Martin et al., 2013  CGGCAGCTATACTGATCCAC  PCNA  TGCCGAGATCTCAGTCACATTGGA  60  Pieper et al., 2012  CCATTTCCGAGTTCTCCACTTGCA  Caspase 3  ATTCAGGCCTGCCGAGGCAC  60  Pieper et al., 2012  CCCACTGTCCGTCTCAATCCCA  SGLT1  AAAGGAGAGGTCTGGGATGGTAA  60  Martin et al., 2012  ATTTCCCTAGTGGCCTGAGATTG  LPH  CTTGCTATACGACCTGAGGGG  60  This study  TGGCTGGCGACACACATAA  DAO  GCCTGAAGCCGCCCCCTTTT  60  Kröger et al., 2015  TGTGGGGGAACCTCGGGCTT  HNMT  GGAGCTTGTTTTCTGACCACGGCA  60  Kröger et al., 2015  TCCTGCATGCACTGGTGTTCCG  TNF-α  CAAGCCACTCCAGGACCCCCT  60  Villodre Tudela et al., 2015  AGAGTCGTCCGGCTGCCTGT  IL-8  GGTCTGCCTGGACCCCAAGGAA  60  Villodre Tudela et al., 2015  TGGGAGCCACGGAGAATGGGTT  IFN-γ  TCCAGCGCAAAGCCATCAGTG  60  Villodre Tudela et al., 2015  ATGCTCTCTGGCCTTGGAACATAGT  ZO-1  ACAGTGCCCAGAGACCAAGA  60  This study  CATTTCCTCGGGGTAGGGGT  OCLN  CAGGTGCACCCTCCAGATTG  60  This study  CAGCGGGTCACCTGATCTTC  CLDN-2  TAGGCTACATCCTGGGCCTT  60  This study  ACGTAAGAACTCGTTCGCCA  CLDN-4  CTCTCTTCGGACGCTGACTG  60  This study  GGGTCTAGGAGCTGGAAGGA  Target1  Sequences of primers (5′ to 3′)  AT2, °C  Reference  RPL19  GCTTGCCTCCAGTGTCCTC  60  Pieper et al., 2012  GCGTTGGCGATTTCATTAG  SDHA  CAAACTCGCTCCTGGACCTC  60  Martin et al., 2013  CCGGAGGATCTTCTCAAGC  Beta-2 microglobulin  CCCCGAAGGTTCAGGTTTAC  60  Martin et al., 2013  CGGCAGCTATACTGATCCAC  PCNA  TGCCGAGATCTCAGTCACATTGGA  60  Pieper et al., 2012  CCATTTCCGAGTTCTCCACTTGCA  Caspase 3  ATTCAGGCCTGCCGAGGCAC  60  Pieper et al., 2012  CCCACTGTCCGTCTCAATCCCA  SGLT1  AAAGGAGAGGTCTGGGATGGTAA  60  Martin et al., 2012  ATTTCCCTAGTGGCCTGAGATTG  LPH  CTTGCTATACGACCTGAGGGG  60  This study  TGGCTGGCGACACACATAA  DAO  GCCTGAAGCCGCCCCCTTTT  60  Kröger et al., 2015  TGTGGGGGAACCTCGGGCTT  HNMT  GGAGCTTGTTTTCTGACCACGGCA  60  Kröger et al., 2015  TCCTGCATGCACTGGTGTTCCG  TNF-α  CAAGCCACTCCAGGACCCCCT  60  Villodre Tudela et al., 2015  AGAGTCGTCCGGCTGCCTGT  IL-8  GGTCTGCCTGGACCCCAAGGAA  60  Villodre Tudela et al., 2015  TGGGAGCCACGGAGAATGGGTT  IFN-γ  TCCAGCGCAAAGCCATCAGTG  60  Villodre Tudela et al., 2015  ATGCTCTCTGGCCTTGGAACATAGT  ZO-1  ACAGTGCCCAGAGACCAAGA  60  This study  CATTTCCTCGGGGTAGGGGT  OCLN  CAGGTGCACCCTCCAGATTG  60  This study  CAGCGGGTCACCTGATCTTC  CLDN-2  TAGGCTACATCCTGGGCCTT  60  This study  ACGTAAGAACTCGTTCGCCA  CLDN-4  CTCTCTTCGGACGCTGACTG  60  This study  GGGTCTAGGAGCTGGAAGGA  1RPL19 = 60S ribosomal protein L19; SDHA = succinate dehydrogenase subunit A; PCNA = proliferating cell nuclear antigen; SGLT1 = sodium-dependent glucose transporter 1; LPH = lactase-phlorizin hydrolase; DAO = diamine oxidase (ameloride binding protein); HNMT = histamine N-methyl transferase; ZO-1 = zonula occludens-1; OCLN = occludin; CLDN-2 = claudin-2; CLDN-4 = claudin-4. 2AT = annealing temperature. View Large Statistical Analysis Normally distributed data were analyzed by Students t test in SPSS (version 21.0; IBM, Chicago, IL). Not normally distributed data were analyzed using the Mann–Whitney test. No influence of gender or litter was determined on the analyzed parameters and therefore main effects of group (SM vs. FO) were analyzed. Differences at P < 0.05 were considered significant. Data were given as mean ± SE unless otherwise stated. RESULTS Growth and Fecal Scores Initial and final BW were not different between SM- and FO-fed piglets (Table 4). Mean ADG during the first and second samplings and over the entire period did not significantly differ. During the first experimental week, signs of diarrhea occurred in FO-fed piglets (P < 0.001). Also, fecal scores during the entire period were lower (P < 0.001) for FO-fed piglets compared with SM-fed piglets. No other clinical signs of impaired health were determined. Table 4. Zootechnical data (BW, ADG, and fecal scores) in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Item  SM  FO  P-value  BW, kg      Day 0  1.4 (0.2)  1.5 (0.2)  0.121      Day 7  2.5 (0.1)  2.5 (0.1)  0.659      Day 14  5.1 (0.2)  5.0 (0.1)  0.759  ADG, g/d      Day 0 to 7  162 (13)  137 (11)  0.166      Day 7 to 14  417 (40)  356 (11)  0.232      Day 0 to 14  223 (23)  187 (10)  0.145  Fecal scores1      Day 0 to 7  3.1 (0.1)  2.5 (0.1)  <0.001      Day 0 to 14  3.0 (0.1)  2.7 (0.1)  <0.001  Item  SM  FO  P-value  BW, kg      Day 0  1.4 (0.2)  1.5 (0.2)  0.121      Day 7  2.5 (0.1)  2.5 (0.1)  0.659      Day 14  5.1 (0.2)  5.0 (0.1)  0.759  ADG, g/d      Day 0 to 7  162 (13)  137 (11)  0.166      Day 7 to 14  417 (40)  356 (11)  0.232      Day 0 to 14  223 (23)  187 (10)  0.145  Fecal scores1      Day 0 to 7  3.1 (0.1)  2.5 (0.1)  <0.001      Day 0 to 14  3.0 (0.1)  2.7 (0.1)  <0.001  1Scoring system: 1 = entirely liquid to 5 = hard pellets. View Large Table 4. Zootechnical data (BW, ADG, and fecal scores) in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Item  SM  FO  P-value  BW, kg      Day 0  1.4 (0.2)  1.5 (0.2)  0.121      Day 7  2.5 (0.1)  2.5 (0.1)  0.659      Day 14  5.1 (0.2)  5.0 (0.1)  0.759  ADG, g/d      Day 0 to 7  162 (13)  137 (11)  0.166      Day 7 to 14  417 (40)  356 (11)  0.232      Day 0 to 14  223 (23)  187 (10)  0.145  Fecal scores1      Day 0 to 7  3.1 (0.1)  2.5 (0.1)  <0.001      Day 0 to 14  3.0 (0.1)  2.7 (0.1)  <0.001  Item  SM  FO  P-value  BW, kg      Day 0  1.4 (0.2)  1.5 (0.2)  0.121      Day 7  2.5 (0.1)  2.5 (0.1)  0.659      Day 14  5.1 (0.2)  5.0 (0.1)  0.759  ADG, g/d      Day 0 to 7  162 (13)  137 (11)  0.166      Day 7 to 14  417 (40)  356 (11)  0.232      Day 0 to 14  223 (23)  187 (10)  0.145  Fecal scores1      Day 0 to 7  3.1 (0.1)  2.5 (0.1)  <0.001      Day 0 to 14  3.0 (0.1)  2.7 (0.1)  <0.001  1Scoring system: 1 = entirely liquid to 5 = hard pellets. View Large Jejunal Morphometry, Cell Turnover, and Barrier Function Piglets fed FO had deeper crypts (P = 0.052) and greater villus area (P < 0.05) in the jejunum compared with SM-fed piglets (Table 5). Villus height and villus-to-crypt week ratio was not different between the 2 groups. Cross sections revealed mild signs of crypt and villus hyperplasia associated with immune cell infiltrations (Fig. 1A). In addition, gene expression for CASP3 and PCNA was greater (P < 0.05) in FO-fed piglets (Fig. 1B and 1C). Permeability toward HRP was not significantly different between groups whereas permeability toward FITC-D was greater (P < 0.05) in piglets fed FO compared with piglets fed SM (Fig. 2A and 2B). Finally, expression of CLDN-4 was lower in FO-fed piglets (P < 0.05) whereas OCLN, ZO-1, and CLDN-2 did not differ compared with SM-fed piglets (Fig. 2C–2F). Table 5. Jejunal morphometry measures in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Morphometry  SM  FO  P-value  Villus height, μm  764 (103)  742 (67)  0.738  Crypt depth, μm  147 (24)  174 (22)  0.052  Villus area, μm2 × 1,000  70 (8)  98 (14)  0.012  Villus height:crypt depth ratio  5.2 (0.8)  4.3 (0.6)  0.116  Morphometry  SM  FO  P-value  Villus height, μm  764 (103)  742 (67)  0.738  Crypt depth, μm  147 (24)  174 (22)  0.052  Villus area, μm2 × 1,000  70 (8)  98 (14)  0.012  Villus height:crypt depth ratio  5.2 (0.8)  4.3 (0.6)  0.116  View Large Table 5. Jejunal morphometry measures in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Morphometry  SM  FO  P-value  Villus height, μm  764 (103)  742 (67)  0.738  Crypt depth, μm  147 (24)  174 (22)  0.052  Villus area, μm2 × 1,000  70 (8)  98 (14)  0.012  Villus height:crypt depth ratio  5.2 (0.8)  4.3 (0.6)  0.116  Morphometry  SM  FO  P-value  Villus height, μm  764 (103)  742 (67)  0.738  Crypt depth, μm  147 (24)  174 (22)  0.052  Villus area, μm2 × 1,000  70 (8)  98 (14)  0.012  Villus height:crypt depth ratio  5.2 (0.8)  4.3 (0.6)  0.116  View Large Figure 1. View large Download slide Morphological characteristics and measures for cell turnover in jejunal tissue. (A) Representative hematoxylin and eosin-stained jejunal cross sections of piglets suckled by the sow (sow milk [SM]) or fed bovine milk–based formula (FO). (B) Expression of caspase 3 (CASP3) and (C) proliferating cell nuclear antigen (PCNA) in the jejunum of piglets fed with SM () or FO (). Values are given as mean ± SE. a,bSuperscripts indicate significant differences (P < 0.05). Figure 1. View large Download slide Morphological characteristics and measures for cell turnover in jejunal tissue. (A) Representative hematoxylin and eosin-stained jejunal cross sections of piglets suckled by the sow (sow milk [SM]) or fed bovine milk–based formula (FO). (B) Expression of caspase 3 (CASP3) and (C) proliferating cell nuclear antigen (PCNA) in the jejunum of piglets fed with SM () or FO (). Values are given as mean ± SE. a,bSuperscripts indicate significant differences (P < 0.05). Figure 2. View large Download slide Jejunal permeability toward (A) horseradish peroxidase (HRP; 44,000 Da), (B) fluorescein isothiocyanate (FITC)–dextran (400 Da), and expression of (C) occludin (OCLN), (D) zonula occludens-1 (ZO-1), (E) claudin-2 (CLDN-2), and (F) claudin-4 (CLDN-4) in piglets fed with sow milk () or formula (). Values are given as mean ± SE. a,bSuperscripts indicate significant differences (P < 0.05). Figure 2. View large Download slide Jejunal permeability toward (A) horseradish peroxidase (HRP; 44,000 Da), (B) fluorescein isothiocyanate (FITC)–dextran (400 Da), and expression of (C) occludin (OCLN), (D) zonula occludens-1 (ZO-1), (E) claudin-2 (CLDN-2), and (F) claudin-4 (CLDN-4) in piglets fed with sow milk () or formula (). Values are given as mean ± SE. a,bSuperscripts indicate significant differences (P < 0.05). Disaccharidase Activity, Glucose Absorption, and Secretory Response Activity of lactase was lower (P < 0.05) in FO-fed piglets, whereas activity of maltase and sucrase did not differ between treatments (Table 6). Gene expression of LPH was not different between the 2 groups (Table 6). Response in Isc toward glucose as indicator of glucose absorption capacity and expression of SGLT1 was greater in FO-fed piglets (P < 0.05). Secretory response toward histamine and gene expression of DAO and HNMT did not differ between treatments (Table 6). Table 6. Jejunal brush border enzyme activities, absorptive and secretory capacity, and expression of genes involved in glucose transport (SGLT1), digestive enzymes (LPH), and histamine metabolism (DAO and HNMT) in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Item  SM  FO  P-value  Enzyme activity      Lactase, units/g protein  338 (66)  156 (30)  0.024      Maltase, units/g protein  302 (86)  444 (78)  0.244      Sucrase, units/g protein  135 (41)  73 (26)  0.219  Electrophyiological response1      Absorption (glucose), μA/cm2  16 (3)  47 (11)  0.019      Secretion (histamine), μA/cm2  20 (2)  29 (7)  0.201  Gene expression2      SGLT1  1.1 (0.2)  2.1 (0.3)  0.012      LPH  1.0 (0.1)  1.1 (0.1)  0.661      DAO  1.1 (0.2)  1.0 (0.2)  0.836      HNMT  1.1 (0.1)  1.3 (0.1)  0.182  Item  SM  FO  P-value  Enzyme activity      Lactase, units/g protein  338 (66)  156 (30)  0.024      Maltase, units/g protein  302 (86)  444 (78)  0.244      Sucrase, units/g protein  135 (41)  73 (26)  0.219  Electrophyiological response1      Absorption (glucose), μA/cm2  16 (3)  47 (11)  0.019      Secretion (histamine), μA/cm2  20 (2)  29 (7)  0.201  Gene expression2      SGLT1  1.1 (0.2)  2.1 (0.3)  0.012      LPH  1.0 (0.1)  1.1 (0.1)  0.661      DAO  1.1 (0.2)  1.0 (0.2)  0.836      HNMT  1.1 (0.1)  1.3 (0.1)  0.182  1Response measured in Ussing chambers. 2Expressed as fold change. View Large Table 6. Jejunal brush border enzyme activities, absorptive and secretory capacity, and expression of genes involved in glucose transport (SGLT1), digestive enzymes (LPH), and histamine metabolism (DAO and HNMT) in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Item  SM  FO  P-value  Enzyme activity      Lactase, units/g protein  338 (66)  156 (30)  0.024      Maltase, units/g protein  302 (86)  444 (78)  0.244      Sucrase, units/g protein  135 (41)  73 (26)  0.219  Electrophyiological response1      Absorption (glucose), μA/cm2  16 (3)  47 (11)  0.019      Secretion (histamine), μA/cm2  20 (2)  29 (7)  0.201  Gene expression2      SGLT1  1.1 (0.2)  2.1 (0.3)  0.012      LPH  1.0 (0.1)  1.1 (0.1)  0.661      DAO  1.1 (0.2)  1.0 (0.2)  0.836      HNMT  1.1 (0.1)  1.3 (0.1)  0.182  Item  SM  FO  P-value  Enzyme activity      Lactase, units/g protein  338 (66)  156 (30)  0.024      Maltase, units/g protein  302 (86)  444 (78)  0.244      Sucrase, units/g protein  135 (41)  73 (26)  0.219  Electrophyiological response1      Absorption (glucose), μA/cm2  16 (3)  47 (11)  0.019      Secretion (histamine), μA/cm2  20 (2)  29 (7)  0.201  Gene expression2      SGLT1  1.1 (0.2)  2.1 (0.3)  0.012      LPH  1.0 (0.1)  1.1 (0.1)  0.661      DAO  1.1 (0.2)  1.0 (0.2)  0.836      HNMT  1.1 (0.1)  1.3 (0.1)  0.182  1Response measured in Ussing chambers. 2Expressed as fold change. View Large Immune Cells and Cytokine Expression The absolute numbers of lymphocytes in the jejunal epithelium were very low (data not shown). However, relative proportions of NK cells in the jejunal epithelium were greater (P < 0.05) and the number of IgM+ B cells in MLN was lower (P < 0.05) in FO-fed piglets (Table 7). The other measured lymphocyte subsets in the jejunal epithelium and MLN did not differ between treatments. Gene expression of TNF-α, IFN-γ, and IL-8 in jejunal tissue was greater (P < 0.05) in FO-fed piglets compared with SM-fed piglets (Table 7). Table 7. Relative proportion of lymphocyte populations in the jejunal epithelium (intraepithelial lymphocytes [IEL]) and in mesenteric lymph nodes (MLN) and jejunal gene expression (TNF-α, IFN-γ, and IL-8) in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Item  SM  FO  P-value  IEL, % of total lymphocytes      NK1 cells  21 (6)  46 (8)  0.001      T cells  23 (8)  33 (13)  0.134      Cytotoxic T cells  4 (18)  5 (1)  0.270      γδ T cells  15 (3)  16 (6)  0.729  MLN, % of total lymphocytes      B cells  37 (6)  23 (9)  0.008      Activated T cells  5 (1)  5 (1)  0.459      Regulatory T cells  2 (1)  2 (1)  0.635  Gene expression2      TNF-α  1.0 (0.2)  2.3 (0.2)  0.001      IFN-y  1.1 (0.2)  2.1 (0.2)  0.001      IL-8  1.1 (0.1)  2.6 (0.3)  0.001  Item  SM  FO  P-value  IEL, % of total lymphocytes      NK1 cells  21 (6)  46 (8)  0.001      T cells  23 (8)  33 (13)  0.134      Cytotoxic T cells  4 (18)  5 (1)  0.270      γδ T cells  15 (3)  16 (6)  0.729  MLN, % of total lymphocytes      B cells  37 (6)  23 (9)  0.008      Activated T cells  5 (1)  5 (1)  0.459      Regulatory T cells  2 (1)  2 (1)  0.635  Gene expression2      TNF-α  1.0 (0.2)  2.3 (0.2)  0.001      IFN-y  1.1 (0.2)  2.1 (0.2)  0.001      IL-8  1.1 (0.1)  2.6 (0.3)  0.001  1NK = natural killer. 2Expressed as fold change. View Large Table 7. Relative proportion of lymphocyte populations in the jejunal epithelium (intraepithelial lymphocytes [IEL]) and in mesenteric lymph nodes (MLN) and jejunal gene expression (TNF-α, IFN-γ, and IL-8) in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Item  SM  FO  P-value  IEL, % of total lymphocytes      NK1 cells  21 (6)  46 (8)  0.001      T cells  23 (8)  33 (13)  0.134      Cytotoxic T cells  4 (18)  5 (1)  0.270      γδ T cells  15 (3)  16 (6)  0.729  MLN, % of total lymphocytes      B cells  37 (6)  23 (9)  0.008      Activated T cells  5 (1)  5 (1)  0.459      Regulatory T cells  2 (1)  2 (1)  0.635  Gene expression2      TNF-α  1.0 (0.2)  2.3 (0.2)  0.001      IFN-y  1.1 (0.2)  2.1 (0.2)  0.001      IL-8  1.1 (0.1)  2.6 (0.3)  0.001  Item  SM  FO  P-value  IEL, % of total lymphocytes      NK1 cells  21 (6)  46 (8)  0.001      T cells  23 (8)  33 (13)  0.134      Cytotoxic T cells  4 (18)  5 (1)  0.270      γδ T cells  15 (3)  16 (6)  0.729  MLN, % of total lymphocytes      B cells  37 (6)  23 (9)  0.008      Activated T cells  5 (1)  5 (1)  0.459      Regulatory T cells  2 (1)  2 (1)  0.635  Gene expression2      TNF-α  1.0 (0.2)  2.3 (0.2)  0.001      IFN-y  1.1 (0.2)  2.1 (0.2)  0.001      IL-8  1.1 (0.1)  2.6 (0.3)  0.001  1NK = natural killer. 2Expressed as fold change. View Large DISCUSSION Feeding FO instead of SM may result in exposure to substantially changed nutrient profiles including lactose and fat content as well as foreign, bovine milk–based proteins. In the current study, the lactose content in the FO was twice as high compared with SM but had a level similar to those reported in previous studies (Thymann et al., 2009; Wang et al., 2013; Comstock et al., 2014). Interestingly, the activity of lactase in FO-fed piglets was lower whereas maltase activity was slightly higher compared with SM-fed piglets. Similar results regarding lactase and maltase activity have been previously reported in FO-fed piglets and may represent a subclinically compromised digestive function (Marion et al., 2005; Thymann et al., 2009). This seems to be contradictory to dietary nutrient profiles because no source of starch or maltodextrins was included in the FO diet. On the other hand, the decline of lactase activity accompanied with increased maltase activity is also often used as an indicator for gut maturation during early life when the piglets' diet changes from milk to cereal-based diets containing high levels of starch and other complex carbohydrates (Kelly et al., 1991; Montagne et al., 2007; Lallès et al., 2007). Besides a possible regulation by their substrates, lactase and maltase activity may also underlie hormonal control (Sangild et al., 1995). In the current experiment, changes in brush border membrane enzyme activity was accompanied by deeper crypts, increased CASP3 and PCNA expression, and hyperplasic appearance (e.g., greater villus area) of the jejunal epithelium of FO-fed piglets, which is in good agreement with previous reports in normal and early weaned piglets (Marion et al., 2005). Although speculative, it may be possible that morphological changes and cell renewal during early life or the postweaning period involve an ontogenetically programmed change in brush border membrane enzyme activity independent of dietary substrate supply. Therefore, lower lactase activity and slightly increased maltase activity could be addressed by inclusion of maltodextrins into piglet FO. However, studies with preterm piglets showed that inclusion of maltodextrins instead of lactose increased the incidence of necrotizing enterocolitis and was accompanied by carbohydrate maldigestion and absorption (Thymann et al., 2009). The FO-fed piglets had a greater capacity for glucose absorption and expression of SGLT1 compared with SM-fed piglets. This could be due to the increased carbohydrate-to-fat ratio in the FO-fed groups and a shift toward glucose as energy source. The SGLT1 is considered the primary route for glucose uptake in porcine enterocytes (Moran et al., 2010). A peak in glucose absorption capacity has been also shown during the early postweaning period in pigs (Lodemann et al., 2006; Klingspor et al., 2013). Interestingly, both expression and functional activity (i.e., response to glucose in Ussing chambers) of SGLT1 were greater in FO-fed piglets. Expression of the SGLT1 gene, protein translation, and activity on the apical membrane changes along the crypt–villus axis as a result of enterocyte differentiation (Moran et al., 2010; Yang et al., 2011). Besides a possible regulation through dietary sugars (Shirazi-Beechey et al., 2011), the increased SGLT1 expression and activity suggests an earlier shift from fetal to adult type enterocytes in the FO-fed piglets. Histamine was used to study epithelial secretory reactions in the current study. Analysis of SM samples in our institute revealed considerable histamine concentrations (approximately 200 μmol/L; unpublished data). We therefore hypothesized that epithelial reactions toward histamine might differ between FO-fed piglets and SM-fed piglets. Increased histamine release from mast cells or bacterial histidine decarboxylation may lead to adaptation of histamine metabolism including elevated tissue expression of DAO and HNMT (Kröger et al., 2013). However, there were no differences in secretory response or expression of enzymes involved in histamine metabolism in the current study. Although histamine might be involved in functional development of the mammary gland (Maslinski et al., 1997) and considerable concentrations appear also in the milk, its role on the development of the neonatal gut is yet not clear. With regard to the immunological differences between the groups, the lower relative frequencies of NK cells in the intestinal epithelium of the SM-fed piglets together with the lower expression levels of IFN-γ, a cytokine predominantly produced by NK cells and NK T cells, hint at an immune-regulating impact of the SM. This branch of the natural immune system may be suppressed by bioactive factors in porcine milk. Although porcine colostral immune cells show a relatively high NK cell activity in comparison with peripheral blood mononuclear cells from sows and piglets, this activity is not transferred to the neonatal pigs. Although the colostral cells translocate into the piglets' blood circulation, the NK activity is not increased after suckling (Bandrick et al., 2014). The observed lower relative frequencies of intraepithelial NK cells in the piglets suckled by their mothers in the current study may fit to this observation as well as the lower gene expression levels of proinflammatory cytokines. In turn, the higher NK cell frequencies in the FO-fed group may have led to an increased rate in Fas/Fas ligand apoptosis of intestinal epithelial cells. Sow milk seems to regulate this kind of natural immune response in the piglets. Bovine milk whey protein can enhance the innate immunity of suckling rats by increasing the NK cell proportion in both epithelial and lamina propria compartments (Pérez-Cano et al., 2007). Therefore, bovine milk whey protein may support the development of the mucosal immune system differently compared with porcine milk. The effect of the milk whey protein in a suckling neonate may also depend on another important aspect: assuming that immunological information is delivered via milk, the similarity of the microbiota between the donor and acceptor of the milk could be crucial. For example, it has been shown that bovine colostrum whey causes bacteria-dependent modulation of cytokine responses from stimulated dendritic cells in vitro (Møller et al., 2011). We have recently shown the expression of membranous CD14 (mCD14) on epithelial cells in the SM (Scharek-Tedin et al., 2015). Anchored to the cell membrane, CD14 acts as a coreceptor for the detection of bacterial lipopolysaccharide along with the Toll-like receptor (TLR) 4. The TLR play an import role in mediating intestinal inflammation and homeostasis. Bacterial signaling through TLR4 upregulates the expression of Fas and Fas ligand on intestinal epithelial cells and induces the expression of IL-8 (Fernandes et al., 2014). If mCD14 delivered with the SM acts as an additional lipopolysaccharide receptor, this could have a regulating effect on the expression of IL-8. In this previous study, the abundance of mCD14-expressing cells in the SM was correlated to some immunological changes in the offspring. It was positively correlated to the frequency of γδ T cells in the piglets' jejunal epithelium, to the percentages of activated T helper cells in the MLN, and to increased abundance of IgM+ B cells in the MLN after weaning (Scharek-Tedin et al., 2015). Moreover, mCD14 in SM was negatively correlated to IL-8 in the jejunal tissue of those piglets. Apparently, the development of the piglet's adaptive immune system was promoted in the piglets that had excess to high levels of mCD14, whereas inflammation seemed to be suppressed by this factor. The greater expression levels of IL-8 in the actual FO-fed piglets indicate epithelial stress, possibly mediated by stronger TLR signaling or perhaps induced by hyperosmotic stress (Németh et al., 2002). Whether the observed hyperplasia of the villi is an indication for a hyperosmotic situation is unclear. Although speculative, the lower abundance of B cells in the MLN and greater expression of IL-8 in FO-fed piglets of the current study may, therefore, reflect the absence of immunomodulating factors from SM including CD14. The concomitant epithelial stress apparently led to increased intestinal paracellular permeability. Permeability changes are frequently considered a result of mucosal inflammation because tight junction (TJ) proteins are responsive to the mucosal cytokine profiles or intestinal luminal environment (Günzel and Yu, 2013). The TJ proteins are composed of numerous structural and functional proteins including occludin and claudin family members differing in their functional role (Günzel and Yu, 2013). Previous study in pigs showed that changes in intestinal TJ protein composition (i.e., claudin-1, -2, -3, and -4; tricellulin; and occludin) were related to expression of proinflammatory cytokines in weaned pigs (Pieper et al., 2012; Richter et al., 2014). In the current study, CLDN-4 was less expressed in FO-fed piglets. Claudin-4 belongs to the barrier-forming and “tightening” TJ proteins and is regulated through several factors including cytokines (Hering et al., 2011; Günzel and Yu, 2013). In neonatal piglets, claudin-4 was not localized in the region of jejunal TJ, suggesting a key role of the TJ protein in “gut closure” and the uptake of macromolecules, antibodies, and milk cells during the first days of life (Pasternak et al., 2015). A regulatory influence of proinflammatory cytokines such as TNFα and IFNγ on other TJ proteins such as OCLN is also well established in humans and rodent models (Mankertz et al., 2000). Interestingly, the onset of apoptosis and CASP3 activation has been shown to induce disruption of epithelial barrier function and fragmentation of TJ proteins such as OCLN and ZO-1 (Bojarski et al., 2004). This may indicate a link between epithelial cell turnover and epithelial barrier function. In this context, it is interesting to note that CLDN-2 expression is usually high at birth and declines afterward (Günzel and Yu, 2013). However, because only TJ mRNA but not protein expression was measured in the present study, the abovementioned statements related to TJ composition are still speculative and require further elucidation in future studies. Finally, the early environment is an important factor shaping the establishment of the intestinal microbial ecosystem (Thompson et al., 2008). Artificial rearing and FO feeding also involves removal of the neonatal piglets from the sow into new environments, which may therefore alter the intestinal ecosystem and influence the development of the gut-associated immune system and physiology (Mulder et al., 2009; Inman et al., 2010; Schokker et al., 2014). In the current study, we cannot exclude such effects because piglets were moved into artificial rearing units 1 d after birth. However, preliminary analyses of microbial ecology measures (bacterial profiles and metabolites) rather indicates changes according to dietary supply of fermentable substrates such as lactose in FO-fed piglets (R. Pieper, W. Vahjen, and J. Zentek, unpublished data) and requires further analysis. In conclusion, the current study reveals considerable physiological, immunological, and morphological changes associated with feeding of bovine milk–based FO to neonatal piglets compared with sow-reared counterparts. Although some of these aspects have been previously reported, the current data suggest that these changes reflect an early maturation–type reaction of the neonatal gut leading to lower digestive capacity and greater gut permeability. To develop piglet FO that help to maintain or improve gut functionality, further studies would be required to determine whether this is mainly due to the presence of high lactose concentrations or foreign immunostimulatory proteins (e.g., bovine whey proteins), the absence of porcine immune and growth factors in the FO, or altered microbial colonization patterns in artificially reared piglets. Footnotes 1 This study was financially supported by the German Research Foundation (DFG) through grant number SFB852/1. We are grateful to C. Schmidt, L. Ebersbach, K. Topp, and M. Eitinger for technical support during the experiment and laboratory analyses. The authors declare no conflict of interest. LITERATURE CITED Bandrick M. Ariza-Nieto C. Baidoo S. K. Molitor T. W. 2014. Colostral antibody-mediated and cell-mediated immunity contributes to innate and antigen-specific immunity in piglets. Dev. Comp. Immunol.  43( 1): 114– 120. doi: https://doi.org/10.1016/j.dci.2013.11.005. Google Scholar CrossRef Search ADS PubMed  Bojarski C. Weiske J. Schoneberg T. Schroder W. Mankertz J. Schulzke J. D. Florian P. Fromm M. Tauber R. Huber O. 2004. The specific fates of tight junction proteins in apoptotic epithelial cells. J. Cell Sci.  117( 10): 2097– 2107. doi: https://doi.org/10.1242/jcs.01071. Google Scholar CrossRef Search ADS PubMed  Buddington R. K. Sangild P. T. 2011. Companion Animals Symposium: Development of the mammalian gastrointestinal tract, the resident microbiota, and the role of diet in early life. J. Anim. Sci.  89( 5): 1506– 1519. doi: https://doi.org/10.2527/jas.2010-3705. Google Scholar CrossRef Search ADS PubMed  Comstock S. S. Reznikov E. A. Contractor N. Donovan S. M. 2014. Dietary bovine lactoferrin alters mucosal and systemic immune cell responses in neonatal piglets. J. Nutr.  144( 4): 525– 532. doi: https://doi.org/10.3945/jn.113.190264. Google Scholar CrossRef Search ADS PubMed  Fernandes P. O'Donnell C. Lyons C. Keane J. Regan T. O'Brien S. Fallon P. Brint E. Houston A. 2014. Intestinal expression of Fas and Fas ligand is upregulated by bacterial signaling through TLR4 and TLR5, with activation of Fas modulating intestinal TLR-mediated inflammation. J. Immunol.  193( 12): 6103– 6113. doi: https://doi.org/10.4049/jimmunol.1303083. Google Scholar CrossRef Search ADS PubMed  Foxcroft G. R. 2012. Reproduction in farm animals in an era of rapid genetic change: Will genetic change outpace our knowledge of physiology? Reprod. Domest. Anim.  47( Suppl. 4): 313– 319. doi: https://doi.org/10.1111/j.1439-0531.2012.02091.x. Google Scholar CrossRef Search ADS PubMed  Günzel D. Yu A. S. 2013. Claudins and the modulation of tight junction permeability. Physiol. Rev.  93( 2): 525– 569. doi: https://doi.org/10.1152/physrev.00019.2012. Google Scholar CrossRef Search ADS PubMed  Hering N. A. Andres S. Fromm A. van Tol E. A. Amasheh M. Mankertz J. Fromm M. Schulzke J. D. 2011. Transforming growth factor-beta, a whey protein component, strengthens the intestinal barrier by upregulating claudin-4 in HT-29/B6 cells. J. Nutr.  141( 5): 783– 789. doi: https://doi.org/10.3945/jn.110.137588. Google Scholar CrossRef Search ADS PubMed  Inman C. F. Haverson K. Konstantinov S. R. Jones P. H. Harris C. Smidt H. Miller B. Bailey M. Stokes C. 2010. Rearing environment affects development of the immune system in neonates. Clin. Exp. Immunol.  160( 3): 431– 439. doi: https://doi.org/10.1111/j.1365-2249.2010.04090.x. Google Scholar CrossRef Search ADS PubMed  Jacobi S. K. Odle J. 2012. Nutritional factors influencing intestinal health of the neonate. Adv. Nutr.  3( 5): 687– 696. doi: https://doi.org/10.3945/an.112.002683. Google Scholar CrossRef Search ADS PubMed  Jensen A. R. Elnif J. Burrin D. G. Sangild P. T. 2001. Development of intestinal immunoglobulin absorption and enzyme activities in neonatal pigs is diet dependent. J. Nutr.  131: 3259– 3265. Google Scholar CrossRef Search ADS PubMed  Kelly D. Smyth J. A. McCracken K. J. 1991. Digestive development of the early-weaned pig. 1. Effect of continuous nutrient supply on the development of the digestive tract and on changes in digestive enzyme activity during the first week post-weaning. Br. J. Nutr.  65( 02): 169– 180. doi: https://doi.org/10.1079/BJN19910078. Google Scholar CrossRef Search ADS PubMed  Klingspor S. Martens H. Caushi D. Twardziok S. Aschenbach J. R. Lodemann U. 2013. Characterization of the effects of Enterococcus faecium on intestinal epithelial transport properties in piglets. J. Anim. Sci.  91( 4): 1707– 1718. doi: https://doi.org/10.2527/jas.2012-5648. Google Scholar CrossRef Search ADS PubMed  Kröger S. Pieper R. Aschenbach J. R. Martin L. Liu P. Rieger J. Schwelberger H. G. Neumann K. Zentek J. 2015. Effects of high levels of dietary zinc oxide on ex vivo epithelial histamine response and investigations on histamine receptor action in the proximal colon of weaned piglets. J. Anim. Sci.  93( 11): 5265– 5272. doi: https://doi.org/10.2527/jas.2015-9095. Google Scholar CrossRef Search ADS PubMed  Kröger S. Pieper R. Schwelberger H. G. Wang J. Villodre Tudela C. Aschenbach J. R. Van Kessel A. G. Zentek J. 2013. Diets high in heat-treated soybean meal reduce the histamine-induced epithelial response in the colon of weaned piglets and increase epithelial catabolism of histamine. PLoS One  8( 11): e80612. doi: https://doi.org/10.1371/journal.pone.0080612. Google Scholar CrossRef Search ADS PubMed  Lallès J. P. Bosi P. Smidt H. Stokes C. R. 2007. Nutritional management of gut health in pigs around weaning. Proc. Nutr. Soc.  66( 2): 260– 268. doi: https://doi.org/10.1017/S0029665107005484. Google Scholar CrossRef Search ADS PubMed  Liu P. Pieper R. Tedin L. Martin L. Meyer W. Rieger J. Plendl J. Vahjen W. Zentek J. 2014. Effect of dietary zinc oxide on jejunal morphological and immunological characteristics in weaned piglets. J. Anim. Sci.  92( 11): 5009– 5018. doi: https://doi.org/10.2527/jas.2013-6690. Google Scholar CrossRef Search ADS PubMed  Lodemann U. Hubener K. Jansen N. Martens H. 2006. Effects of Enterococcus faecium NCIMB 10415 as probiotic supplement on intestinal transport and barrier function of piglets. Arch. Anim. Nutr.  60( 1): 35– 48. doi: https://doi.org/10.1080/17450390500468099. Google Scholar CrossRef Search ADS PubMed  Mankertz J. Tavalali S. Schmitz H. Mankertz A. Riecken E. O. Fromm M. Schulzke J. D. 2000. Expression from the human occludin promoter is affected by tumor necrosis factor alpha and interferon gamma. J. Cell Sci.  113: 2085– 2090. Google Scholar PubMed  Marion J. Petersen Y. M. Romé V. Thomas F. Sangild P. T. Le Dividich J. Le Huërou-Luron I. 2005. Early weaning stimulates intestinal brush border enzyme activities in piglets, mainly at the posttranscriptional level. J. Pediatr. Gastroenterol. Nutr.  41: 401– 410. doi: https://doi.org/10.1097/01.mpg.0000177704.99786.07. Google Scholar CrossRef Search ADS PubMed  Martin L. Pieper R. Kröger S. Vahjen W. Neumann K. Van Kessel A. G. Zentek J. 2012. Influence of age and Enterococcus faecium NCIMB 10415 on development of small intestinal digestive physiology in piglets. Anim. Feed Sci. Technol.  175( 1–2): 65– 75. doi: https://doi.org/10.1016/j.anifeedsci.2012.04.002. Google Scholar CrossRef Search ADS   Martin L. Pieper R. Schunter N. Vahjen W. Zentek J. 2013. Performance, organ zinc concentration, jejunal brush border membrane enzyme activities and mRNA expression in piglets fed with different levels of dietary zinc. Arch. Anim. Nutr.  67( 3): 248– 261. doi: https://doi.org/10.1080/1745039X.2013.801138. Google Scholar CrossRef Search ADS PubMed  Maslinski C. Kierska D. Fogel W. Kinnunen A. Panula P. 1997. Histamine in mammary gland: Pregnancy and lactation. Comp. Biochem. Physiol. A: Physiol.  116( 1): 57– 64. doi: https://doi.org/10.1016/S0300-9629(96)00117-X. Google Scholar CrossRef Search ADS   Møller H. K. Thymann T. Fink L. N. Frokiaer H. Kvistgaard A. S. Sangild P. T. 2011. Bovine colostrum is superior to enriched formulas in stimulating intestinal function and necrotising enterocolitis resistance in preterm pigs. Br. J. Nutr.  105( 01): 44– 53. doi: https://doi.org/10.1017/S0007114510003168. Google Scholar CrossRef Search ADS PubMed  Montagne L. Boudry G. Favier C. Le Huerou-Luron I. Lallès J. P. Seve B. 2007. Main intestinal markers associated with the changes in gut architecture and function in piglets after weaning. Br. J. Nutr.  97( 01): 45– 57. doi: https://doi.org/10.1017/S000711450720580X. Google Scholar CrossRef Search ADS PubMed  Moran A. W. Al-Rammahi M. A. Arora D. K. Batchelor D. J. Coulter E. A. Ionescu C. Bravo D. Shirazi-Beechey S. P. 2010. Expression of Na+/glucose co-transporter 1 (SGLT1) in the intestine of piglets weaned to different concentrations of dietary carbohydrate. Br. J. Nutr.  104( 05): 647– 655. doi: https://doi.org/10.1017/S0007114510000954. Google Scholar CrossRef Search ADS PubMed  Mulder I. E. Schmidt B. Stokes C. R. Lewis M. Bailey M. Aminov R. I. Prosser J. I. Gill B. P. Pluske J. R. Mayer C. D. Musk C. C. Kelly D. 2009. Environmentally-acquired bacteria influence microbial diversity and natural innate immune responses at gut surfaces. BMC Biol.  7( 1): 79. doi: https://doi.org/10.1186/1741-7007-7-79. Google Scholar CrossRef Search ADS PubMed  Naumann K. Bassler R. 2004. Methodenbuch Band III: Die chemische Untersuchung von Futtermitteln. (In German.) Neumann-Neudamm, Melsungen, Germany. Németh Z. H. Deitch E. A. Szabó C. Haskó G. 2002. Hyperosmotic stress induces nuclear factor-kappaB activation and interleukin-8 production in human intestinal epithelial cells. Am. J. Pathol.  161( 3): 987– 996. doi: https://doi.org/10.1016/S0002-9440(10)64259-9. Google Scholar CrossRef Search ADS PubMed  Pasternak J. A. Kent-Dennis C. Van Kessel A. G. Wilson H. L. 2015. Claudin-4 undergoes age-dependent change in cellular localization on pig jejunal villous epithelial cells, independent of bacterial colonization. Mediators Inflamm.  2015: 263629. doi: https://doi.org/10.1155/2015/263629. Google Scholar CrossRef Search ADS PubMed  Pérez-Cano F. J. Marín-Gallén S. Castell M. Rodríguez -Palmero M. Rivero M. Franch À. Castellote C. 2007. Bovine whey protein concentrate supplementation modulates maturation of immune system in suckling rats. Br. J. Nutr.  98( Suppl. 1): S80– S84. doi: https://doi.org/10.1017/S0007114507838074. Google Scholar PubMed  Pfaffl M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res.  29( 9): e45. doi: https://doi.org/10.1093/nar/29.9.e45. Google Scholar CrossRef Search ADS PubMed  Pieper R. Kröger S. Richter J. F. Wang J. Martin L. Bindelle J. Htoo J. K. von Smolinski D. Vahjen W. Zentek J. Van Kessel A. G. 2012. Fermentable fiber ameliorates fermentable protein-induced changes in microbial ecology, but not the mucosal response, in the colon of piglets. J. Nutr.  142( 4): 661– 667. doi: https://doi.org/10.3945/jn.111.156190. Google Scholar CrossRef Search ADS PubMed  Pieper R. Martin L. Schunter N. Villodre Tudela C. Weise C. Klopfleisch R. Zentek J. Einspanier R. Bondzio A. 2015. Impact of high dietary zinc on zinc accumulation, enzyme activity and proteomic profiles in the pancreas of piglets. J. Trace Elem. Med. Biol.  30: 30– 36. doi: https://doi.org/10.1016/j.jtemb.2015.01.008. Google Scholar CrossRef Search ADS PubMed  Richter J. F. Pieper R. Zakrzewski S. S. Günzel D. Schulzke J. D. Van Kessel A. G. 2014. Diets high in fermentable protein and fibre alter tight junction protein composition with minor effects on barrier function in piglet colon. Br. J. Nutr.  111( 06): 1040– 1049. doi: https://doi.org/10.1017/S0007114513003498. Google Scholar CrossRef Search ADS PubMed  Sangild P. T. Sjostrom H. Noren O. Fowden A. L. Silver M. 1995. The prenatal development and glucocorticoid control of brush-border hydrolases in the pig small intestine. Pediatr. Res.  37( 2): 207– 212. doi: https://doi.org/10.1203/00006450-199502000-00014. Google Scholar CrossRef Search ADS PubMed  Sangild P. T. Thymann T. Schmidt M. Stoll B. Burrin D. G. Buddington R. K. 2013. Invited review: The preterm pig as a model in pediatric gastroenterology. J. Anim. Sci.  91( 10): 4713– 4729. doi: https://doi.org/10.2527/jas.2013-6359. Google Scholar CrossRef Search ADS PubMed  Scharek-Tedin L. Kreuzer-Redmer S. Twardziok S. O. Siepert B. Klopfleisch R. Tedin K. Zentek J. Pieper R. 2015. Probiotic treatment decreases the number of CD14-expressing cells in porcine milk which correlates with several intestinal immune parameters in the piglets. Front. Immunol.  6: 108. doi: https://doi.org/10.3389/fimmu.2015.00108. Google Scholar CrossRef Search ADS PubMed  Schokker D. Zhang J. Zhang L. L. Vastenhouw S. A. Heilig H. G. Smidt H. Rebel J. M. Smits M. A. 2014. Early-life environmental variation affects intestinal microbiota and immune development in new-born piglets. PLoS One  9( 6): e100040. doi: https://doi.org/10.1371/journal.pone.0100040. Google Scholar CrossRef Search ADS PubMed  Shirazi-Beechey S. P. Moran A. W. Bravo D. Al-Rammahi M. 2011. Nonruminant Nutrition Symposium: Intestinal glucose sensing and regulation of glucose absorption: Implications for swine nutrition. J. Anim. Sci.  89( 6): 1854– 1862. doi: https://doi.org/10.2527/jas.2010-3695. Google Scholar CrossRef Search ADS PubMed  Solano-Aguilar G. I. Vengroski K. G. Beshah E. Lunney J. K. 2000. Isolation and purification of lymphocyte subsets from gut-associated lymphoid tissue in neonatal swine. J. Immunol. Methods  241( 1–2): 185– 199. doi: https://doi.org/10.1016/S0022-1759(00)00209-X. Google Scholar CrossRef Search ADS PubMed  Thompson C. L. Wang B. Holmes A. J. 2008. The immediate environment during postnatal development has long-term impact on gut community structure in pigs. ISME J.  2( 7): 739– 748. doi: https://doi.org/10.1038/ismej.2008.29. Google Scholar CrossRef Search ADS PubMed  Thymann T. Møller H. K. Stoll B. Stoy A. C. Buddington R. K. Bering S. B. Jensen B. B. Olutoye O. O. Siggers R. H. Mølbak L. Sangild P. T. Burrin D. G. 2009. Carbohydrate maldigestion induces necrotizing enterocolitis in preterm pigs. Am. J. Physiol. Gastrointest. Liver Physiol.  297( 6): G1115– G1125. doi: https://doi.org/10.1152/ajpgi.00261.2009. Google Scholar CrossRef Search ADS PubMed  Villodre Tudela C. Boudry C. Stumpff F. Aschenbach J. R. Vahjen W. Zentek J. Pieper R. 2015. Down-regulation of monocarboxylate transporter 1 (MCT1) gene expression in the colon of piglets is linked to bacterial protein fermentation and pro-inflammatory cytokine-mediated signalling. Br. J. Nutr.  113( 04): 610– 617. doi: https://doi.org/10.1017/S0007114514004231. Google Scholar CrossRef Search ADS PubMed  Wang M. Radlowski E. C. Monaco M. H. Fahey G. C. Jr Gaskins H. R. Donovan S. M. 2013. Mode of delivery and early nutrition modulate microbial colonization and fermentation products in neonatal piglets. J. Nutr.  143( 6): 795– 803. doi: https://doi.org/10.3945/jn.112.173096. Google Scholar CrossRef Search ADS PubMed  Yang C. Albin D. M. Wang Z. Stoll B. Lackeyram D. Swanson K. C. Yin Y. Tappenden K. A. Mine Y. Yada R. Y. Burrin D. G. Fan M. Z. 2011. Apical Na+-D-glucose cotransporter 1 (SGLT1) activity and protein abundance are expressed along the jejunal crypt-villus axis in the neonatal pig. Am. J. Physiol. Gastrointest. Liver Physiol.  300: G60– 70. doi: https://doi.org/10.1152/ajpgi.00208.2010.1. Google Scholar CrossRef Search ADS PubMed  American Society of Animal Science http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Animal Science Oxford University Press

Bovine milk–based formula leads to early maturation-like morphological, immunological, and functional changes in the jejunum of neonatal piglets

Loading next page...
 
/lp/oxford-university-press/bovine-milk-based-formula-leads-to-early-maturation-like-morphological-kb3r4RE75M

References (48)

ISSN
0021-8812
eISSN
1525-3163
DOI
10.2527/jas.2015-9942
pmid
27065261
Publisher site
See Article on Publisher Site

Abstract

Abstract Artificial rearing and formula feeding is coming more into the focus due to increasing litter sizes and limited nursing capacity of sows. The formula composition is important to effectively support the development of the gut and prevent intestinal dysfunction in neonatal piglets. In this study, newborn piglets (n = 8 per group) were fed a bovine milk–based formula (FO), containing skimmed milk and whey as the sole protein and carbohydrate sources, or were suckled by the sow (sow milk [SM]). After 2 wk, tissue from the jejunum was analyzed for structural (i.e., morphometry) and functional (i.e., disaccharidase activity, glucose transport, permeability toward macromolecules, and immune cell presence) changes and concomitant expression of related genes. Formula-fed piglets had more liquid feces (P < 0.05) over the entire experimental period. Although FO contained twice as much lactose (46% on a DM basis) as SM (21%) and no maltose or starch, the lactase activity was lower (P < 0.05) and glucose transport capacity was higher (P < 0.05) in FO-fed pigs. The relative proportion of intraepithelial natural killer cells and proinflammatory cytokine gene expression (IL-8, TNF-a, and IFN-y) was higher in FO-fed pigs (P < 0.05). Piglets fed FO had deeper crypts, larger villus area, and higher expression of caspase 3 and proliferating cell nuclear antigen (P < 0.05). Epithelial permeability toward fluorescein isothiocyanate–dextran was higher and expression of claudin-4 was lower in FO-fed piglets (P < 0.05). The data suggest an early response to bovine milk–based compounds in the FO accompanied with early onset of functional maturation and impaired barrier function. Whether lactose, absence of species-specific protective factors, or antigenicity of foreign proteins lead to to the observed intestinal reactions requires further clarification. INTRODUCTION The early postnatal period is a critical time for structural and functional development of the neonatal gastrointestinal tract (Buddington and Sangild, 2011), and diet plays an important role in the development of digestive and absorptive capacity (Jacobi and Odle, 2012). The gastrointestinal responses to different diets fed after birth have been investigated in both term and preterm piglets. It is well established that sow milk and formula differ in nutrient and bioactive compound composition and that formula feeding, compared with mothers' milk, may increase the risk for intestinal disorders (Buddington and Sangild, 2011; Jacobi and Odle, 2012; Sangild et al., 2013). In this context, formula feeding can modulate the activity of digestive enzymes, intestinal mass, and microbial activity compared with sow-reared pigs or piglets receiving bovine colostrum (Jensen et al., 2001; Thymann et al., 2009; Wang et al., 2013). Formula feeding may also provide a challenge for the immature immune system due to the presence of foreign proteins or the absence of functional compounds such as growth factors or immune stimulatory factors. In addition, differences in general nutrient composition (i.e., lactose and fat content) between sow milk and formula may shape frequently observed ontogenetic and functional changes. In pigs, genetic selection for hyperproliferation of sows during the past decades has increased the number of live-born pigs but also the number of low-birth-weight piglets per litter (Foxcroft, 2012). As the ability of sows to raise large litters with more than 14 piglets is limited, there is an increased need for alternative, artificial rearing systems for piglets using supplemental or exclusive formula feeding. To date, there is little information available about optimal formula composition and how this will affect the intestinal development. As indicated above, bovine milk–based formula contains foreign proteins, high amounts of lactose, and lower concentrations of fat compared with sow milk. It can be hypothesized that these differences stimulate ontogenetic changes during early life and may be accompanied by changes in immune response and barrier function, thereby predisposing the piglets toward intestinal disorders and inflammation. Therefore, the current study was conducted to study the complex nutrition–host interaction in formula-fed piglets compared with sow-reared piglets. MATERIAL AND METHODS All procedures involving pig handling and treatments were approved by the local state office of occupational health and technical safety “Landesamt für Gesundheit und Soziales Berlin” (regulation number 281/13). Animals, Housing, Diets, and Sampling Sixteen newborn piglets from a total of 4 litters were used in this study. Eight randomly selected piglets (4 male and 4 female) with a mean BW of 1.5 ± 0.2 kg were removed from their mothers 4 h after birth and placed (2 piglets each) in artificial acrylic glass rearing pens (60 by 60 by 100 cm). The choice of the time point allowed an initial colostrum uptake by all piglets to avoid bias based on insufficient early immunoglobulin uptake. The artificial rearing units were equipped with a heating lamp (allowing an ambient temperature of 32 ± 1°C), ventilation, and ad libitum water supply. Within the following 12 h, the 8 piglets were successfully trained to drink the formula (FO) from trays. From this time point on, piglets were offered the premixed and prewarmed FO (1:4 wt/wt; 37°C) every 2 h starting from 0600 until 1200 h. The FO composition was based on skimmed milk powder (630 g/kg), whey powder (150 g/kg), soy oil (199 g/kg), mineral and vitamin premix (10 g/kg), limestone (10 mg/kg), and methionine (1 g/kg). The composition of the FO was chosen according to previous studies (Thymann et al., 2009; Wang et al., 2013) and also from commercially available piglet FO. Another 8 piglets (4 male and 4 female; 1.4 ± 0.2 kg mean BW) were selected and suckled by their mothers together with the remaining littermates as a control group (sow milk [SM]). The chemical composition of FO and average chemical composition of SM from sow-reared litters is provided in Table 1. The BW and fecal score (based on a subjective scoring system from 1 = entirely liquid to 5 = hard pellets) was recorded daily. Table 1. Chemical composition of sow milk (SM) and formula (FO) in the study Item  SM  FO  Ash, g/kg DM  50  71  Protein, g/kg DM  302  226  Ether extract, g/kg DM  373  200  Lactose, g/kg DM  210  460  Lysine, g/kg DM  16  17  Methionine + cysteine, g/kg DM  14  11  Threonine, g/kg DM  11  10  Calcium, g/kg DM  13  14  Phosphorus, g/kg DM  8  7  Potassium, g/kg DM  4  12  Sodium, g/kg DM  3  4  Iron, mg/kg DM  13  70  Zinc, mg/kg DM  37  98  Manganese, mg/kg DM  1  7  Copper, mg/kg DM  5  7  Item  SM  FO  Ash, g/kg DM  50  71  Protein, g/kg DM  302  226  Ether extract, g/kg DM  373  200  Lactose, g/kg DM  210  460  Lysine, g/kg DM  16  17  Methionine + cysteine, g/kg DM  14  11  Threonine, g/kg DM  11  10  Calcium, g/kg DM  13  14  Phosphorus, g/kg DM  8  7  Potassium, g/kg DM  4  12  Sodium, g/kg DM  3  4  Iron, mg/kg DM  13  70  Zinc, mg/kg DM  37  98  Manganese, mg/kg DM  1  7  Copper, mg/kg DM  5  7  View Large Table 1. Chemical composition of sow milk (SM) and formula (FO) in the study Item  SM  FO  Ash, g/kg DM  50  71  Protein, g/kg DM  302  226  Ether extract, g/kg DM  373  200  Lactose, g/kg DM  210  460  Lysine, g/kg DM  16  17  Methionine + cysteine, g/kg DM  14  11  Threonine, g/kg DM  11  10  Calcium, g/kg DM  13  14  Phosphorus, g/kg DM  8  7  Potassium, g/kg DM  4  12  Sodium, g/kg DM  3  4  Iron, mg/kg DM  13  70  Zinc, mg/kg DM  37  98  Manganese, mg/kg DM  1  7  Copper, mg/kg DM  5  7  Item  SM  FO  Ash, g/kg DM  50  71  Protein, g/kg DM  302  226  Ether extract, g/kg DM  373  200  Lactose, g/kg DM  210  460  Lysine, g/kg DM  16  17  Methionine + cysteine, g/kg DM  14  11  Threonine, g/kg DM  11  10  Calcium, g/kg DM  13  14  Phosphorus, g/kg DM  8  7  Potassium, g/kg DM  4  12  Sodium, g/kg DM  3  4  Iron, mg/kg DM  13  70  Zinc, mg/kg DM  37  98  Manganese, mg/kg DM  1  7  Copper, mg/kg DM  5  7  View Large At 14 ± 1 d of age, piglets were killed for tissue and digesta sampling 4 h after the last meal. Pigs were sedated with 20 mg/kg BW of ketamine hydrochloride (Ursotamin; Serumwerk Bernburg AG, Bernburg, Germany) and 2 mg/kg BW of azaperone (Stresnil; Janssen-Cilag GmbH, Neuss, Germany), and 5 mL blood was collected by heart puncture in heparinized containers for immune cell analysis. Pigs were euthanized by intracardial injection of 10 mg/kg BW of T61 (Intervet Deutschland GmbH, Unterschleißheim, Germany). Jejunal contents from the mid jejunum (starting 2 m from the pylorus until 80 cm before the ileocecal valve) were collected and stored at –80°C. Sections from the mid jejunum (starting 2 m from the pylorus) were taken for subsequent analyses. Two 20-cm segments were used for phenotypic analysis of intraepithelial lymphocytes by flow cytometry and functional analysis in Ussing chambers, respectively. Three pieces (2 cm each) located between the 2 larger pieces were either immediately fixed in methyl Carnoy's solution for histological examinations (n = 2) or snap-frozen in liquid nitrogen and stored at –80°C until total RNA extraction and gene expression analysis (n = 1). Chemical Analyses Proximate nutrients (DM, ash, CP, ether extract, and minerals) in SM and FO were determined by classical Weende procedures (Naumann and Bassler, 2004), and lactose was determined enzymatically (ENZYTEC Lactose/D-galactose kit; R-Biopharm AG, Darmstadt, Germany). Trace elements were analyzed by atomic absorption spectrometry in an AAS vario 6 spectrometer (Analytik Jena AG, Jena, Germany) as previously described (Pieper et al., 2015). The AA analyses were performed on a Biochrom 20 Plus AA analyzer (Amersham Pharmacia Biotech Inc., Piscataway, NJ) after hydrolysis of lyophilized samples in 6 M aqueous HCl at 110°C for 24 h. Methionine and cysteine were measured after oxidation (H2O2/formic acid). Morphometry, Histopathology Score, and Functional Analyses For the morphometric analysis, jejunal sections were cut open longitudinally and subsequently fixed in methyl Carnoy's solution (60% methanol, 30% chloroform, and 10% glacial acetic acid, vol/vol/vol). After dehydration and infiltration with solidified paraffin wax, the tissue was embedded, cut at 5 μm with a sledge microtome (Typ 1400; Leitz, Wetzlar, Germany), and subsequently stained with hematoxylin and eosin. Villus height, crypt depth, villus height:crypt depth ratio, and villus area were determined in well-oriented villi and crypt units. Jejunal brush border membrane disaccharidase activity (maltase, lactase, and sucrase) was analyzed as previously described (Martin et al., 2012, 2013). For normalization of enzyme activity data, total protein concentration was determined using the Bradford assay in microtitration plates as previously described (Martin et al., 2012, 2013). Ussing chamber experiments were performed as previously described (Kröger et al., 2013; Richter et al., 2014; Villodre-Tudela et al., 2015) with some modifications. The jejunal epithelium (without serosal and muscle layers) was immediately mounted in Ussing chambers (n = 6 chambers per piglet) with an exposed area of 1.31 cm2 and bathed in 38°C modified Krebs–Ringer buffer solution (pH adjusted to 7.4, containing 115 mmol/L NaCl, 5 mmol/L KCl, 1.5 mmol/L CaCl2, 1.2 mmol/L MgCl2, 0.6 mmol/L NaH2PO4, 2.4 mmol/L Na2HPO4, 25 mmol/L NaHCO3, and 20 mmol/L mannitol). A microcomputer-controlled voltage/current clamp (K. Mussler Scientific Instruments, Aachen, Germany) was used to obtain electrical measurements. Glucose (10 mmol/L final concentration) was added to the mucosal side of 3 chambers. In parallel, mannitol (10 mmol/L final concentration) was added to the serosal compartment to maintain osmolarity. To determine the response toward secretagogues, histamine (100 μmol/L final concentration) was applied to the serosal compartment of 2 chambers. One chamber served as untreated control. The change of short-circuit current (Isc) was determined by subtracting the peak Isc after 3 min from basal Isc as an indirect measure of electrolyte transport. Basal values were obtained as average mean values of the last 3 min before the addition of glucose or histamine, respectively. Permeability to macromolecules was measured using horseradish peroxidase (HRP; 44,000 Da) and fluorescein isothiocyanate–dextran (FITC-D; 4,000 Da). Briefly, the tracer was added to the mucosal side of 3 chambers per piglet. Samples were taken from the serosal side immediately before addition and after 60 min. The HRP activity was measured using the QuantaBlu™ Fluorogenic Peroxidase Substrate Kit (ThermoFischer Scientific, Darmstadt, Germany). The FITC-D fluorescence was measured at 525 nm using a 2300 Multimode plate reader (PerkinElmer Inc., Waltham, MA). Measurements of serial dilutions of the tracer molecules were used to convert the results in nanograms per milliliter and micrograms per milliliter for HRP and FITC-D, respectively. Intraepithelial and Mesenteric Lymph Node Immune Cell Populations The isolation of intraepithelial lymphocytes and enterocytes from the jejunum was performed as previously described (Liu et al., 2014). Immune cells from mesenteric lymph nodes (MLN) were obtained according to a slightly modified protocol (Solano-Aguilar et al., 2000). Briefly, MLN were incubated with 10 mL of Roswell Park Memorial Institute (RPMI)–1640 medium and minced with scalpel blades into pieces of about 2 mm2 to release leukocytes. Cells were subsequently poured through a nylon mesh (200-μm pore size) using another 20 mL of RPMI-1640. The suspension was centrifuged (300 × g for 5 min at 4°C) and erythrolysis was subsequently performed using an ammonium–chloride–potassium buffer containing EDTA. The antibodies used for flow cytometry measurements are listed in Table 2. The resulting suspensions (containing leukocytes and epithelial cells) were subjected to flow cytometry using a FACSCalibur flow cytometer (Becton Dickinson GmbH, Heidelberg, Germany). To analyze the proportion of the stained cells, a lymphocyte gate was constituted following morphological criteria. Proportions of positive immune cells reflect the distribution of subpopulations within the relevant lymphocyte gate. Antibodies and their combinations were used to determine relative amounts of natural killer (NK) cells (CD2+/CD5–), T cells (CD2+/CD5+), α/beta cytotoxic T cells (CD8β+), γ/δ T cells (TcR1 γ+), mature B cells (CD21+), activated T cells (CD4+/CD25med), and T regulatory cells (CD4+/CD25high). Table 2. Primary and secondary antibodies used for flow cytometry staining Specificity  Clone/host species of secondary antibody  Isotype  Cytochrome1  Distributor2  CD2  MSA4  IgG2a  None  VMRD  CD4α  74-12-4  IgG2b  FITC  SouthernBiotech  CD5  9G12  IgG1  None  VMRD  CD8β  PG164A  IgG2a  None  VMRD  TcR1-N4 (δ)  PGLBL22A  IgG1  None  VMRD  CD21  BB6-11C9.6  IgG1κ  None  SouthernBiotech  CD25  K231.3B2  IgG1  None  Acris  IgG2a  Pooled antisera from goats    PE  SouthernBiotech  IgG1  Pooled antisera from goats    FITC  SouthernBiotech  Specificity  Clone/host species of secondary antibody  Isotype  Cytochrome1  Distributor2  CD2  MSA4  IgG2a  None  VMRD  CD4α  74-12-4  IgG2b  FITC  SouthernBiotech  CD5  9G12  IgG1  None  VMRD  CD8β  PG164A  IgG2a  None  VMRD  TcR1-N4 (δ)  PGLBL22A  IgG1  None  VMRD  CD21  BB6-11C9.6  IgG1κ  None  SouthernBiotech  CD25  K231.3B2  IgG1  None  Acris  IgG2a  Pooled antisera from goats    PE  SouthernBiotech  IgG1  Pooled antisera from goats    FITC  SouthernBiotech  1FITC = fluorescein isothiocyanate; PE = phycoerythrin. 2VMRD = VMRD, Inc., Pullman, WA; SouthernBiotech = SouthernBiotech, Birmingham, AL; Acris = Acris Antibodies, Inc., San Diego, CA. View Large Table 2. Primary and secondary antibodies used for flow cytometry staining Specificity  Clone/host species of secondary antibody  Isotype  Cytochrome1  Distributor2  CD2  MSA4  IgG2a  None  VMRD  CD4α  74-12-4  IgG2b  FITC  SouthernBiotech  CD5  9G12  IgG1  None  VMRD  CD8β  PG164A  IgG2a  None  VMRD  TcR1-N4 (δ)  PGLBL22A  IgG1  None  VMRD  CD21  BB6-11C9.6  IgG1κ  None  SouthernBiotech  CD25  K231.3B2  IgG1  None  Acris  IgG2a  Pooled antisera from goats    PE  SouthernBiotech  IgG1  Pooled antisera from goats    FITC  SouthernBiotech  Specificity  Clone/host species of secondary antibody  Isotype  Cytochrome1  Distributor2  CD2  MSA4  IgG2a  None  VMRD  CD4α  74-12-4  IgG2b  FITC  SouthernBiotech  CD5  9G12  IgG1  None  VMRD  CD8β  PG164A  IgG2a  None  VMRD  TcR1-N4 (δ)  PGLBL22A  IgG1  None  VMRD  CD21  BB6-11C9.6  IgG1κ  None  SouthernBiotech  CD25  K231.3B2  IgG1  None  Acris  IgG2a  Pooled antisera from goats    PE  SouthernBiotech  IgG1  Pooled antisera from goats    FITC  SouthernBiotech  1FITC = fluorescein isothiocyanate; PE = phycoerythrin. 2VMRD = VMRD, Inc., Pullman, WA; SouthernBiotech = SouthernBiotech, Birmingham, AL; Acris = Acris Antibodies, Inc., San Diego, CA. View Large Gene Expression Analysis Jejunal gene expression was studied as previously described (Villodre-Tudela et al., 2015). Briefly, total RNA was extracted using the NucleoSpin RNAII kit (Marchery-Nagel GmbH & Co. KG, Düren, Germany). The mRNA quality and quantity was determined on an Agilent 2100 Bioanalyzer (Agilent Technologies Deutschland GmbH & Co. KG, Waldbronn, Germany) followed by reverse transcription of 100 ng RNA into cDNA in a final volume of 20 μL using Super Script III Reverse Transcriptase First-Strand cDNA Synthesis System (Invitrogen, Carlsbad, CA). Primers for proliferating cell nuclear antigen (PCNA), caspase 3 (CASP3), lactase-phlorizin-hydrolase (LPH), sodium coupled glucose transporter 1 (SGLT1), diamine oxidase (DAO), histamine N-methyl transferase (HNMT), tumor necrosis factor α (TNF-α), interferon γ (IFN-γ), IL-8, zonula occludens-1 (ZO-1), occludin (OCLN), claudin-2 (CLDN-2), and claudin-4 (CLDN-4) were used (Table 3). The real-time quantitative PCR was performed on a Stratagene MX3000p (Stratagene, Amsterdam, The Netherlands). Gene expression data were normalized using 60S ribosomal protein L19 (RPL19), β2–microglobulin, and succinate dehydrogenase subunit A (SDHA) as housekeeping genes and times-fold expression was calculated based on mean cycle threshold values of the housekeeping genes using the real-time PCR efficiency (Pfaffl, 2001). Table 3. List of primers used in this study Target1  Sequences of primers (5′ to 3′)  AT2, °C  Reference  RPL19  GCTTGCCTCCAGTGTCCTC  60  Pieper et al., 2012  GCGTTGGCGATTTCATTAG  SDHA  CAAACTCGCTCCTGGACCTC  60  Martin et al., 2013  CCGGAGGATCTTCTCAAGC  Beta-2 microglobulin  CCCCGAAGGTTCAGGTTTAC  60  Martin et al., 2013  CGGCAGCTATACTGATCCAC  PCNA  TGCCGAGATCTCAGTCACATTGGA  60  Pieper et al., 2012  CCATTTCCGAGTTCTCCACTTGCA  Caspase 3  ATTCAGGCCTGCCGAGGCAC  60  Pieper et al., 2012  CCCACTGTCCGTCTCAATCCCA  SGLT1  AAAGGAGAGGTCTGGGATGGTAA  60  Martin et al., 2012  ATTTCCCTAGTGGCCTGAGATTG  LPH  CTTGCTATACGACCTGAGGGG  60  This study  TGGCTGGCGACACACATAA  DAO  GCCTGAAGCCGCCCCCTTTT  60  Kröger et al., 2015  TGTGGGGGAACCTCGGGCTT  HNMT  GGAGCTTGTTTTCTGACCACGGCA  60  Kröger et al., 2015  TCCTGCATGCACTGGTGTTCCG  TNF-α  CAAGCCACTCCAGGACCCCCT  60  Villodre Tudela et al., 2015  AGAGTCGTCCGGCTGCCTGT  IL-8  GGTCTGCCTGGACCCCAAGGAA  60  Villodre Tudela et al., 2015  TGGGAGCCACGGAGAATGGGTT  IFN-γ  TCCAGCGCAAAGCCATCAGTG  60  Villodre Tudela et al., 2015  ATGCTCTCTGGCCTTGGAACATAGT  ZO-1  ACAGTGCCCAGAGACCAAGA  60  This study  CATTTCCTCGGGGTAGGGGT  OCLN  CAGGTGCACCCTCCAGATTG  60  This study  CAGCGGGTCACCTGATCTTC  CLDN-2  TAGGCTACATCCTGGGCCTT  60  This study  ACGTAAGAACTCGTTCGCCA  CLDN-4  CTCTCTTCGGACGCTGACTG  60  This study  GGGTCTAGGAGCTGGAAGGA  Target1  Sequences of primers (5′ to 3′)  AT2, °C  Reference  RPL19  GCTTGCCTCCAGTGTCCTC  60  Pieper et al., 2012  GCGTTGGCGATTTCATTAG  SDHA  CAAACTCGCTCCTGGACCTC  60  Martin et al., 2013  CCGGAGGATCTTCTCAAGC  Beta-2 microglobulin  CCCCGAAGGTTCAGGTTTAC  60  Martin et al., 2013  CGGCAGCTATACTGATCCAC  PCNA  TGCCGAGATCTCAGTCACATTGGA  60  Pieper et al., 2012  CCATTTCCGAGTTCTCCACTTGCA  Caspase 3  ATTCAGGCCTGCCGAGGCAC  60  Pieper et al., 2012  CCCACTGTCCGTCTCAATCCCA  SGLT1  AAAGGAGAGGTCTGGGATGGTAA  60  Martin et al., 2012  ATTTCCCTAGTGGCCTGAGATTG  LPH  CTTGCTATACGACCTGAGGGG  60  This study  TGGCTGGCGACACACATAA  DAO  GCCTGAAGCCGCCCCCTTTT  60  Kröger et al., 2015  TGTGGGGGAACCTCGGGCTT  HNMT  GGAGCTTGTTTTCTGACCACGGCA  60  Kröger et al., 2015  TCCTGCATGCACTGGTGTTCCG  TNF-α  CAAGCCACTCCAGGACCCCCT  60  Villodre Tudela et al., 2015  AGAGTCGTCCGGCTGCCTGT  IL-8  GGTCTGCCTGGACCCCAAGGAA  60  Villodre Tudela et al., 2015  TGGGAGCCACGGAGAATGGGTT  IFN-γ  TCCAGCGCAAAGCCATCAGTG  60  Villodre Tudela et al., 2015  ATGCTCTCTGGCCTTGGAACATAGT  ZO-1  ACAGTGCCCAGAGACCAAGA  60  This study  CATTTCCTCGGGGTAGGGGT  OCLN  CAGGTGCACCCTCCAGATTG  60  This study  CAGCGGGTCACCTGATCTTC  CLDN-2  TAGGCTACATCCTGGGCCTT  60  This study  ACGTAAGAACTCGTTCGCCA  CLDN-4  CTCTCTTCGGACGCTGACTG  60  This study  GGGTCTAGGAGCTGGAAGGA  1RPL19 = 60S ribosomal protein L19; SDHA = succinate dehydrogenase subunit A; PCNA = proliferating cell nuclear antigen; SGLT1 = sodium-dependent glucose transporter 1; LPH = lactase-phlorizin hydrolase; DAO = diamine oxidase (ameloride binding protein); HNMT = histamine N-methyl transferase; ZO-1 = zonula occludens-1; OCLN = occludin; CLDN-2 = claudin-2; CLDN-4 = claudin-4. 2AT = annealing temperature. View Large Table 3. List of primers used in this study Target1  Sequences of primers (5′ to 3′)  AT2, °C  Reference  RPL19  GCTTGCCTCCAGTGTCCTC  60  Pieper et al., 2012  GCGTTGGCGATTTCATTAG  SDHA  CAAACTCGCTCCTGGACCTC  60  Martin et al., 2013  CCGGAGGATCTTCTCAAGC  Beta-2 microglobulin  CCCCGAAGGTTCAGGTTTAC  60  Martin et al., 2013  CGGCAGCTATACTGATCCAC  PCNA  TGCCGAGATCTCAGTCACATTGGA  60  Pieper et al., 2012  CCATTTCCGAGTTCTCCACTTGCA  Caspase 3  ATTCAGGCCTGCCGAGGCAC  60  Pieper et al., 2012  CCCACTGTCCGTCTCAATCCCA  SGLT1  AAAGGAGAGGTCTGGGATGGTAA  60  Martin et al., 2012  ATTTCCCTAGTGGCCTGAGATTG  LPH  CTTGCTATACGACCTGAGGGG  60  This study  TGGCTGGCGACACACATAA  DAO  GCCTGAAGCCGCCCCCTTTT  60  Kröger et al., 2015  TGTGGGGGAACCTCGGGCTT  HNMT  GGAGCTTGTTTTCTGACCACGGCA  60  Kröger et al., 2015  TCCTGCATGCACTGGTGTTCCG  TNF-α  CAAGCCACTCCAGGACCCCCT  60  Villodre Tudela et al., 2015  AGAGTCGTCCGGCTGCCTGT  IL-8  GGTCTGCCTGGACCCCAAGGAA  60  Villodre Tudela et al., 2015  TGGGAGCCACGGAGAATGGGTT  IFN-γ  TCCAGCGCAAAGCCATCAGTG  60  Villodre Tudela et al., 2015  ATGCTCTCTGGCCTTGGAACATAGT  ZO-1  ACAGTGCCCAGAGACCAAGA  60  This study  CATTTCCTCGGGGTAGGGGT  OCLN  CAGGTGCACCCTCCAGATTG  60  This study  CAGCGGGTCACCTGATCTTC  CLDN-2  TAGGCTACATCCTGGGCCTT  60  This study  ACGTAAGAACTCGTTCGCCA  CLDN-4  CTCTCTTCGGACGCTGACTG  60  This study  GGGTCTAGGAGCTGGAAGGA  Target1  Sequences of primers (5′ to 3′)  AT2, °C  Reference  RPL19  GCTTGCCTCCAGTGTCCTC  60  Pieper et al., 2012  GCGTTGGCGATTTCATTAG  SDHA  CAAACTCGCTCCTGGACCTC  60  Martin et al., 2013  CCGGAGGATCTTCTCAAGC  Beta-2 microglobulin  CCCCGAAGGTTCAGGTTTAC  60  Martin et al., 2013  CGGCAGCTATACTGATCCAC  PCNA  TGCCGAGATCTCAGTCACATTGGA  60  Pieper et al., 2012  CCATTTCCGAGTTCTCCACTTGCA  Caspase 3  ATTCAGGCCTGCCGAGGCAC  60  Pieper et al., 2012  CCCACTGTCCGTCTCAATCCCA  SGLT1  AAAGGAGAGGTCTGGGATGGTAA  60  Martin et al., 2012  ATTTCCCTAGTGGCCTGAGATTG  LPH  CTTGCTATACGACCTGAGGGG  60  This study  TGGCTGGCGACACACATAA  DAO  GCCTGAAGCCGCCCCCTTTT  60  Kröger et al., 2015  TGTGGGGGAACCTCGGGCTT  HNMT  GGAGCTTGTTTTCTGACCACGGCA  60  Kröger et al., 2015  TCCTGCATGCACTGGTGTTCCG  TNF-α  CAAGCCACTCCAGGACCCCCT  60  Villodre Tudela et al., 2015  AGAGTCGTCCGGCTGCCTGT  IL-8  GGTCTGCCTGGACCCCAAGGAA  60  Villodre Tudela et al., 2015  TGGGAGCCACGGAGAATGGGTT  IFN-γ  TCCAGCGCAAAGCCATCAGTG  60  Villodre Tudela et al., 2015  ATGCTCTCTGGCCTTGGAACATAGT  ZO-1  ACAGTGCCCAGAGACCAAGA  60  This study  CATTTCCTCGGGGTAGGGGT  OCLN  CAGGTGCACCCTCCAGATTG  60  This study  CAGCGGGTCACCTGATCTTC  CLDN-2  TAGGCTACATCCTGGGCCTT  60  This study  ACGTAAGAACTCGTTCGCCA  CLDN-4  CTCTCTTCGGACGCTGACTG  60  This study  GGGTCTAGGAGCTGGAAGGA  1RPL19 = 60S ribosomal protein L19; SDHA = succinate dehydrogenase subunit A; PCNA = proliferating cell nuclear antigen; SGLT1 = sodium-dependent glucose transporter 1; LPH = lactase-phlorizin hydrolase; DAO = diamine oxidase (ameloride binding protein); HNMT = histamine N-methyl transferase; ZO-1 = zonula occludens-1; OCLN = occludin; CLDN-2 = claudin-2; CLDN-4 = claudin-4. 2AT = annealing temperature. View Large Statistical Analysis Normally distributed data were analyzed by Students t test in SPSS (version 21.0; IBM, Chicago, IL). Not normally distributed data were analyzed using the Mann–Whitney test. No influence of gender or litter was determined on the analyzed parameters and therefore main effects of group (SM vs. FO) were analyzed. Differences at P < 0.05 were considered significant. Data were given as mean ± SE unless otherwise stated. RESULTS Growth and Fecal Scores Initial and final BW were not different between SM- and FO-fed piglets (Table 4). Mean ADG during the first and second samplings and over the entire period did not significantly differ. During the first experimental week, signs of diarrhea occurred in FO-fed piglets (P < 0.001). Also, fecal scores during the entire period were lower (P < 0.001) for FO-fed piglets compared with SM-fed piglets. No other clinical signs of impaired health were determined. Table 4. Zootechnical data (BW, ADG, and fecal scores) in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Item  SM  FO  P-value  BW, kg      Day 0  1.4 (0.2)  1.5 (0.2)  0.121      Day 7  2.5 (0.1)  2.5 (0.1)  0.659      Day 14  5.1 (0.2)  5.0 (0.1)  0.759  ADG, g/d      Day 0 to 7  162 (13)  137 (11)  0.166      Day 7 to 14  417 (40)  356 (11)  0.232      Day 0 to 14  223 (23)  187 (10)  0.145  Fecal scores1      Day 0 to 7  3.1 (0.1)  2.5 (0.1)  <0.001      Day 0 to 14  3.0 (0.1)  2.7 (0.1)  <0.001  Item  SM  FO  P-value  BW, kg      Day 0  1.4 (0.2)  1.5 (0.2)  0.121      Day 7  2.5 (0.1)  2.5 (0.1)  0.659      Day 14  5.1 (0.2)  5.0 (0.1)  0.759  ADG, g/d      Day 0 to 7  162 (13)  137 (11)  0.166      Day 7 to 14  417 (40)  356 (11)  0.232      Day 0 to 14  223 (23)  187 (10)  0.145  Fecal scores1      Day 0 to 7  3.1 (0.1)  2.5 (0.1)  <0.001      Day 0 to 14  3.0 (0.1)  2.7 (0.1)  <0.001  1Scoring system: 1 = entirely liquid to 5 = hard pellets. View Large Table 4. Zootechnical data (BW, ADG, and fecal scores) in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Item  SM  FO  P-value  BW, kg      Day 0  1.4 (0.2)  1.5 (0.2)  0.121      Day 7  2.5 (0.1)  2.5 (0.1)  0.659      Day 14  5.1 (0.2)  5.0 (0.1)  0.759  ADG, g/d      Day 0 to 7  162 (13)  137 (11)  0.166      Day 7 to 14  417 (40)  356 (11)  0.232      Day 0 to 14  223 (23)  187 (10)  0.145  Fecal scores1      Day 0 to 7  3.1 (0.1)  2.5 (0.1)  <0.001      Day 0 to 14  3.0 (0.1)  2.7 (0.1)  <0.001  Item  SM  FO  P-value  BW, kg      Day 0  1.4 (0.2)  1.5 (0.2)  0.121      Day 7  2.5 (0.1)  2.5 (0.1)  0.659      Day 14  5.1 (0.2)  5.0 (0.1)  0.759  ADG, g/d      Day 0 to 7  162 (13)  137 (11)  0.166      Day 7 to 14  417 (40)  356 (11)  0.232      Day 0 to 14  223 (23)  187 (10)  0.145  Fecal scores1      Day 0 to 7  3.1 (0.1)  2.5 (0.1)  <0.001      Day 0 to 14  3.0 (0.1)  2.7 (0.1)  <0.001  1Scoring system: 1 = entirely liquid to 5 = hard pellets. View Large Jejunal Morphometry, Cell Turnover, and Barrier Function Piglets fed FO had deeper crypts (P = 0.052) and greater villus area (P < 0.05) in the jejunum compared with SM-fed piglets (Table 5). Villus height and villus-to-crypt week ratio was not different between the 2 groups. Cross sections revealed mild signs of crypt and villus hyperplasia associated with immune cell infiltrations (Fig. 1A). In addition, gene expression for CASP3 and PCNA was greater (P < 0.05) in FO-fed piglets (Fig. 1B and 1C). Permeability toward HRP was not significantly different between groups whereas permeability toward FITC-D was greater (P < 0.05) in piglets fed FO compared with piglets fed SM (Fig. 2A and 2B). Finally, expression of CLDN-4 was lower in FO-fed piglets (P < 0.05) whereas OCLN, ZO-1, and CLDN-2 did not differ compared with SM-fed piglets (Fig. 2C–2F). Table 5. Jejunal morphometry measures in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Morphometry  SM  FO  P-value  Villus height, μm  764 (103)  742 (67)  0.738  Crypt depth, μm  147 (24)  174 (22)  0.052  Villus area, μm2 × 1,000  70 (8)  98 (14)  0.012  Villus height:crypt depth ratio  5.2 (0.8)  4.3 (0.6)  0.116  Morphometry  SM  FO  P-value  Villus height, μm  764 (103)  742 (67)  0.738  Crypt depth, μm  147 (24)  174 (22)  0.052  Villus area, μm2 × 1,000  70 (8)  98 (14)  0.012  Villus height:crypt depth ratio  5.2 (0.8)  4.3 (0.6)  0.116  View Large Table 5. Jejunal morphometry measures in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Morphometry  SM  FO  P-value  Villus height, μm  764 (103)  742 (67)  0.738  Crypt depth, μm  147 (24)  174 (22)  0.052  Villus area, μm2 × 1,000  70 (8)  98 (14)  0.012  Villus height:crypt depth ratio  5.2 (0.8)  4.3 (0.6)  0.116  Morphometry  SM  FO  P-value  Villus height, μm  764 (103)  742 (67)  0.738  Crypt depth, μm  147 (24)  174 (22)  0.052  Villus area, μm2 × 1,000  70 (8)  98 (14)  0.012  Villus height:crypt depth ratio  5.2 (0.8)  4.3 (0.6)  0.116  View Large Figure 1. View large Download slide Morphological characteristics and measures for cell turnover in jejunal tissue. (A) Representative hematoxylin and eosin-stained jejunal cross sections of piglets suckled by the sow (sow milk [SM]) or fed bovine milk–based formula (FO). (B) Expression of caspase 3 (CASP3) and (C) proliferating cell nuclear antigen (PCNA) in the jejunum of piglets fed with SM () or FO (). Values are given as mean ± SE. a,bSuperscripts indicate significant differences (P < 0.05). Figure 1. View large Download slide Morphological characteristics and measures for cell turnover in jejunal tissue. (A) Representative hematoxylin and eosin-stained jejunal cross sections of piglets suckled by the sow (sow milk [SM]) or fed bovine milk–based formula (FO). (B) Expression of caspase 3 (CASP3) and (C) proliferating cell nuclear antigen (PCNA) in the jejunum of piglets fed with SM () or FO (). Values are given as mean ± SE. a,bSuperscripts indicate significant differences (P < 0.05). Figure 2. View large Download slide Jejunal permeability toward (A) horseradish peroxidase (HRP; 44,000 Da), (B) fluorescein isothiocyanate (FITC)–dextran (400 Da), and expression of (C) occludin (OCLN), (D) zonula occludens-1 (ZO-1), (E) claudin-2 (CLDN-2), and (F) claudin-4 (CLDN-4) in piglets fed with sow milk () or formula (). Values are given as mean ± SE. a,bSuperscripts indicate significant differences (P < 0.05). Figure 2. View large Download slide Jejunal permeability toward (A) horseradish peroxidase (HRP; 44,000 Da), (B) fluorescein isothiocyanate (FITC)–dextran (400 Da), and expression of (C) occludin (OCLN), (D) zonula occludens-1 (ZO-1), (E) claudin-2 (CLDN-2), and (F) claudin-4 (CLDN-4) in piglets fed with sow milk () or formula (). Values are given as mean ± SE. a,bSuperscripts indicate significant differences (P < 0.05). Disaccharidase Activity, Glucose Absorption, and Secretory Response Activity of lactase was lower (P < 0.05) in FO-fed piglets, whereas activity of maltase and sucrase did not differ between treatments (Table 6). Gene expression of LPH was not different between the 2 groups (Table 6). Response in Isc toward glucose as indicator of glucose absorption capacity and expression of SGLT1 was greater in FO-fed piglets (P < 0.05). Secretory response toward histamine and gene expression of DAO and HNMT did not differ between treatments (Table 6). Table 6. Jejunal brush border enzyme activities, absorptive and secretory capacity, and expression of genes involved in glucose transport (SGLT1), digestive enzymes (LPH), and histamine metabolism (DAO and HNMT) in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Item  SM  FO  P-value  Enzyme activity      Lactase, units/g protein  338 (66)  156 (30)  0.024      Maltase, units/g protein  302 (86)  444 (78)  0.244      Sucrase, units/g protein  135 (41)  73 (26)  0.219  Electrophyiological response1      Absorption (glucose), μA/cm2  16 (3)  47 (11)  0.019      Secretion (histamine), μA/cm2  20 (2)  29 (7)  0.201  Gene expression2      SGLT1  1.1 (0.2)  2.1 (0.3)  0.012      LPH  1.0 (0.1)  1.1 (0.1)  0.661      DAO  1.1 (0.2)  1.0 (0.2)  0.836      HNMT  1.1 (0.1)  1.3 (0.1)  0.182  Item  SM  FO  P-value  Enzyme activity      Lactase, units/g protein  338 (66)  156 (30)  0.024      Maltase, units/g protein  302 (86)  444 (78)  0.244      Sucrase, units/g protein  135 (41)  73 (26)  0.219  Electrophyiological response1      Absorption (glucose), μA/cm2  16 (3)  47 (11)  0.019      Secretion (histamine), μA/cm2  20 (2)  29 (7)  0.201  Gene expression2      SGLT1  1.1 (0.2)  2.1 (0.3)  0.012      LPH  1.0 (0.1)  1.1 (0.1)  0.661      DAO  1.1 (0.2)  1.0 (0.2)  0.836      HNMT  1.1 (0.1)  1.3 (0.1)  0.182  1Response measured in Ussing chambers. 2Expressed as fold change. View Large Table 6. Jejunal brush border enzyme activities, absorptive and secretory capacity, and expression of genes involved in glucose transport (SGLT1), digestive enzymes (LPH), and histamine metabolism (DAO and HNMT) in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Item  SM  FO  P-value  Enzyme activity      Lactase, units/g protein  338 (66)  156 (30)  0.024      Maltase, units/g protein  302 (86)  444 (78)  0.244      Sucrase, units/g protein  135 (41)  73 (26)  0.219  Electrophyiological response1      Absorption (glucose), μA/cm2  16 (3)  47 (11)  0.019      Secretion (histamine), μA/cm2  20 (2)  29 (7)  0.201  Gene expression2      SGLT1  1.1 (0.2)  2.1 (0.3)  0.012      LPH  1.0 (0.1)  1.1 (0.1)  0.661      DAO  1.1 (0.2)  1.0 (0.2)  0.836      HNMT  1.1 (0.1)  1.3 (0.1)  0.182  Item  SM  FO  P-value  Enzyme activity      Lactase, units/g protein  338 (66)  156 (30)  0.024      Maltase, units/g protein  302 (86)  444 (78)  0.244      Sucrase, units/g protein  135 (41)  73 (26)  0.219  Electrophyiological response1      Absorption (glucose), μA/cm2  16 (3)  47 (11)  0.019      Secretion (histamine), μA/cm2  20 (2)  29 (7)  0.201  Gene expression2      SGLT1  1.1 (0.2)  2.1 (0.3)  0.012      LPH  1.0 (0.1)  1.1 (0.1)  0.661      DAO  1.1 (0.2)  1.0 (0.2)  0.836      HNMT  1.1 (0.1)  1.3 (0.1)  0.182  1Response measured in Ussing chambers. 2Expressed as fold change. View Large Immune Cells and Cytokine Expression The absolute numbers of lymphocytes in the jejunal epithelium were very low (data not shown). However, relative proportions of NK cells in the jejunal epithelium were greater (P < 0.05) and the number of IgM+ B cells in MLN was lower (P < 0.05) in FO-fed piglets (Table 7). The other measured lymphocyte subsets in the jejunal epithelium and MLN did not differ between treatments. Gene expression of TNF-α, IFN-γ, and IL-8 in jejunal tissue was greater (P < 0.05) in FO-fed piglets compared with SM-fed piglets (Table 7). Table 7. Relative proportion of lymphocyte populations in the jejunal epithelium (intraepithelial lymphocytes [IEL]) and in mesenteric lymph nodes (MLN) and jejunal gene expression (TNF-α, IFN-γ, and IL-8) in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Item  SM  FO  P-value  IEL, % of total lymphocytes      NK1 cells  21 (6)  46 (8)  0.001      T cells  23 (8)  33 (13)  0.134      Cytotoxic T cells  4 (18)  5 (1)  0.270      γδ T cells  15 (3)  16 (6)  0.729  MLN, % of total lymphocytes      B cells  37 (6)  23 (9)  0.008      Activated T cells  5 (1)  5 (1)  0.459      Regulatory T cells  2 (1)  2 (1)  0.635  Gene expression2      TNF-α  1.0 (0.2)  2.3 (0.2)  0.001      IFN-y  1.1 (0.2)  2.1 (0.2)  0.001      IL-8  1.1 (0.1)  2.6 (0.3)  0.001  Item  SM  FO  P-value  IEL, % of total lymphocytes      NK1 cells  21 (6)  46 (8)  0.001      T cells  23 (8)  33 (13)  0.134      Cytotoxic T cells  4 (18)  5 (1)  0.270      γδ T cells  15 (3)  16 (6)  0.729  MLN, % of total lymphocytes      B cells  37 (6)  23 (9)  0.008      Activated T cells  5 (1)  5 (1)  0.459      Regulatory T cells  2 (1)  2 (1)  0.635  Gene expression2      TNF-α  1.0 (0.2)  2.3 (0.2)  0.001      IFN-y  1.1 (0.2)  2.1 (0.2)  0.001      IL-8  1.1 (0.1)  2.6 (0.3)  0.001  1NK = natural killer. 2Expressed as fold change. View Large Table 7. Relative proportion of lymphocyte populations in the jejunal epithelium (intraepithelial lymphocytes [IEL]) and in mesenteric lymph nodes (MLN) and jejunal gene expression (TNF-α, IFN-γ, and IL-8) in piglets fed with sow milk (SM) or formula (FO). Data are given as means (SE) Item  SM  FO  P-value  IEL, % of total lymphocytes      NK1 cells  21 (6)  46 (8)  0.001      T cells  23 (8)  33 (13)  0.134      Cytotoxic T cells  4 (18)  5 (1)  0.270      γδ T cells  15 (3)  16 (6)  0.729  MLN, % of total lymphocytes      B cells  37 (6)  23 (9)  0.008      Activated T cells  5 (1)  5 (1)  0.459      Regulatory T cells  2 (1)  2 (1)  0.635  Gene expression2      TNF-α  1.0 (0.2)  2.3 (0.2)  0.001      IFN-y  1.1 (0.2)  2.1 (0.2)  0.001      IL-8  1.1 (0.1)  2.6 (0.3)  0.001  Item  SM  FO  P-value  IEL, % of total lymphocytes      NK1 cells  21 (6)  46 (8)  0.001      T cells  23 (8)  33 (13)  0.134      Cytotoxic T cells  4 (18)  5 (1)  0.270      γδ T cells  15 (3)  16 (6)  0.729  MLN, % of total lymphocytes      B cells  37 (6)  23 (9)  0.008      Activated T cells  5 (1)  5 (1)  0.459      Regulatory T cells  2 (1)  2 (1)  0.635  Gene expression2      TNF-α  1.0 (0.2)  2.3 (0.2)  0.001      IFN-y  1.1 (0.2)  2.1 (0.2)  0.001      IL-8  1.1 (0.1)  2.6 (0.3)  0.001  1NK = natural killer. 2Expressed as fold change. View Large DISCUSSION Feeding FO instead of SM may result in exposure to substantially changed nutrient profiles including lactose and fat content as well as foreign, bovine milk–based proteins. In the current study, the lactose content in the FO was twice as high compared with SM but had a level similar to those reported in previous studies (Thymann et al., 2009; Wang et al., 2013; Comstock et al., 2014). Interestingly, the activity of lactase in FO-fed piglets was lower whereas maltase activity was slightly higher compared with SM-fed piglets. Similar results regarding lactase and maltase activity have been previously reported in FO-fed piglets and may represent a subclinically compromised digestive function (Marion et al., 2005; Thymann et al., 2009). This seems to be contradictory to dietary nutrient profiles because no source of starch or maltodextrins was included in the FO diet. On the other hand, the decline of lactase activity accompanied with increased maltase activity is also often used as an indicator for gut maturation during early life when the piglets' diet changes from milk to cereal-based diets containing high levels of starch and other complex carbohydrates (Kelly et al., 1991; Montagne et al., 2007; Lallès et al., 2007). Besides a possible regulation by their substrates, lactase and maltase activity may also underlie hormonal control (Sangild et al., 1995). In the current experiment, changes in brush border membrane enzyme activity was accompanied by deeper crypts, increased CASP3 and PCNA expression, and hyperplasic appearance (e.g., greater villus area) of the jejunal epithelium of FO-fed piglets, which is in good agreement with previous reports in normal and early weaned piglets (Marion et al., 2005). Although speculative, it may be possible that morphological changes and cell renewal during early life or the postweaning period involve an ontogenetically programmed change in brush border membrane enzyme activity independent of dietary substrate supply. Therefore, lower lactase activity and slightly increased maltase activity could be addressed by inclusion of maltodextrins into piglet FO. However, studies with preterm piglets showed that inclusion of maltodextrins instead of lactose increased the incidence of necrotizing enterocolitis and was accompanied by carbohydrate maldigestion and absorption (Thymann et al., 2009). The FO-fed piglets had a greater capacity for glucose absorption and expression of SGLT1 compared with SM-fed piglets. This could be due to the increased carbohydrate-to-fat ratio in the FO-fed groups and a shift toward glucose as energy source. The SGLT1 is considered the primary route for glucose uptake in porcine enterocytes (Moran et al., 2010). A peak in glucose absorption capacity has been also shown during the early postweaning period in pigs (Lodemann et al., 2006; Klingspor et al., 2013). Interestingly, both expression and functional activity (i.e., response to glucose in Ussing chambers) of SGLT1 were greater in FO-fed piglets. Expression of the SGLT1 gene, protein translation, and activity on the apical membrane changes along the crypt–villus axis as a result of enterocyte differentiation (Moran et al., 2010; Yang et al., 2011). Besides a possible regulation through dietary sugars (Shirazi-Beechey et al., 2011), the increased SGLT1 expression and activity suggests an earlier shift from fetal to adult type enterocytes in the FO-fed piglets. Histamine was used to study epithelial secretory reactions in the current study. Analysis of SM samples in our institute revealed considerable histamine concentrations (approximately 200 μmol/L; unpublished data). We therefore hypothesized that epithelial reactions toward histamine might differ between FO-fed piglets and SM-fed piglets. Increased histamine release from mast cells or bacterial histidine decarboxylation may lead to adaptation of histamine metabolism including elevated tissue expression of DAO and HNMT (Kröger et al., 2013). However, there were no differences in secretory response or expression of enzymes involved in histamine metabolism in the current study. Although histamine might be involved in functional development of the mammary gland (Maslinski et al., 1997) and considerable concentrations appear also in the milk, its role on the development of the neonatal gut is yet not clear. With regard to the immunological differences between the groups, the lower relative frequencies of NK cells in the intestinal epithelium of the SM-fed piglets together with the lower expression levels of IFN-γ, a cytokine predominantly produced by NK cells and NK T cells, hint at an immune-regulating impact of the SM. This branch of the natural immune system may be suppressed by bioactive factors in porcine milk. Although porcine colostral immune cells show a relatively high NK cell activity in comparison with peripheral blood mononuclear cells from sows and piglets, this activity is not transferred to the neonatal pigs. Although the colostral cells translocate into the piglets' blood circulation, the NK activity is not increased after suckling (Bandrick et al., 2014). The observed lower relative frequencies of intraepithelial NK cells in the piglets suckled by their mothers in the current study may fit to this observation as well as the lower gene expression levels of proinflammatory cytokines. In turn, the higher NK cell frequencies in the FO-fed group may have led to an increased rate in Fas/Fas ligand apoptosis of intestinal epithelial cells. Sow milk seems to regulate this kind of natural immune response in the piglets. Bovine milk whey protein can enhance the innate immunity of suckling rats by increasing the NK cell proportion in both epithelial and lamina propria compartments (Pérez-Cano et al., 2007). Therefore, bovine milk whey protein may support the development of the mucosal immune system differently compared with porcine milk. The effect of the milk whey protein in a suckling neonate may also depend on another important aspect: assuming that immunological information is delivered via milk, the similarity of the microbiota between the donor and acceptor of the milk could be crucial. For example, it has been shown that bovine colostrum whey causes bacteria-dependent modulation of cytokine responses from stimulated dendritic cells in vitro (Møller et al., 2011). We have recently shown the expression of membranous CD14 (mCD14) on epithelial cells in the SM (Scharek-Tedin et al., 2015). Anchored to the cell membrane, CD14 acts as a coreceptor for the detection of bacterial lipopolysaccharide along with the Toll-like receptor (TLR) 4. The TLR play an import role in mediating intestinal inflammation and homeostasis. Bacterial signaling through TLR4 upregulates the expression of Fas and Fas ligand on intestinal epithelial cells and induces the expression of IL-8 (Fernandes et al., 2014). If mCD14 delivered with the SM acts as an additional lipopolysaccharide receptor, this could have a regulating effect on the expression of IL-8. In this previous study, the abundance of mCD14-expressing cells in the SM was correlated to some immunological changes in the offspring. It was positively correlated to the frequency of γδ T cells in the piglets' jejunal epithelium, to the percentages of activated T helper cells in the MLN, and to increased abundance of IgM+ B cells in the MLN after weaning (Scharek-Tedin et al., 2015). Moreover, mCD14 in SM was negatively correlated to IL-8 in the jejunal tissue of those piglets. Apparently, the development of the piglet's adaptive immune system was promoted in the piglets that had excess to high levels of mCD14, whereas inflammation seemed to be suppressed by this factor. The greater expression levels of IL-8 in the actual FO-fed piglets indicate epithelial stress, possibly mediated by stronger TLR signaling or perhaps induced by hyperosmotic stress (Németh et al., 2002). Whether the observed hyperplasia of the villi is an indication for a hyperosmotic situation is unclear. Although speculative, the lower abundance of B cells in the MLN and greater expression of IL-8 in FO-fed piglets of the current study may, therefore, reflect the absence of immunomodulating factors from SM including CD14. The concomitant epithelial stress apparently led to increased intestinal paracellular permeability. Permeability changes are frequently considered a result of mucosal inflammation because tight junction (TJ) proteins are responsive to the mucosal cytokine profiles or intestinal luminal environment (Günzel and Yu, 2013). The TJ proteins are composed of numerous structural and functional proteins including occludin and claudin family members differing in their functional role (Günzel and Yu, 2013). Previous study in pigs showed that changes in intestinal TJ protein composition (i.e., claudin-1, -2, -3, and -4; tricellulin; and occludin) were related to expression of proinflammatory cytokines in weaned pigs (Pieper et al., 2012; Richter et al., 2014). In the current study, CLDN-4 was less expressed in FO-fed piglets. Claudin-4 belongs to the barrier-forming and “tightening” TJ proteins and is regulated through several factors including cytokines (Hering et al., 2011; Günzel and Yu, 2013). In neonatal piglets, claudin-4 was not localized in the region of jejunal TJ, suggesting a key role of the TJ protein in “gut closure” and the uptake of macromolecules, antibodies, and milk cells during the first days of life (Pasternak et al., 2015). A regulatory influence of proinflammatory cytokines such as TNFα and IFNγ on other TJ proteins such as OCLN is also well established in humans and rodent models (Mankertz et al., 2000). Interestingly, the onset of apoptosis and CASP3 activation has been shown to induce disruption of epithelial barrier function and fragmentation of TJ proteins such as OCLN and ZO-1 (Bojarski et al., 2004). This may indicate a link between epithelial cell turnover and epithelial barrier function. In this context, it is interesting to note that CLDN-2 expression is usually high at birth and declines afterward (Günzel and Yu, 2013). However, because only TJ mRNA but not protein expression was measured in the present study, the abovementioned statements related to TJ composition are still speculative and require further elucidation in future studies. Finally, the early environment is an important factor shaping the establishment of the intestinal microbial ecosystem (Thompson et al., 2008). Artificial rearing and FO feeding also involves removal of the neonatal piglets from the sow into new environments, which may therefore alter the intestinal ecosystem and influence the development of the gut-associated immune system and physiology (Mulder et al., 2009; Inman et al., 2010; Schokker et al., 2014). In the current study, we cannot exclude such effects because piglets were moved into artificial rearing units 1 d after birth. However, preliminary analyses of microbial ecology measures (bacterial profiles and metabolites) rather indicates changes according to dietary supply of fermentable substrates such as lactose in FO-fed piglets (R. Pieper, W. Vahjen, and J. Zentek, unpublished data) and requires further analysis. In conclusion, the current study reveals considerable physiological, immunological, and morphological changes associated with feeding of bovine milk–based FO to neonatal piglets compared with sow-reared counterparts. Although some of these aspects have been previously reported, the current data suggest that these changes reflect an early maturation–type reaction of the neonatal gut leading to lower digestive capacity and greater gut permeability. To develop piglet FO that help to maintain or improve gut functionality, further studies would be required to determine whether this is mainly due to the presence of high lactose concentrations or foreign immunostimulatory proteins (e.g., bovine whey proteins), the absence of porcine immune and growth factors in the FO, or altered microbial colonization patterns in artificially reared piglets. Footnotes 1 This study was financially supported by the German Research Foundation (DFG) through grant number SFB852/1. We are grateful to C. Schmidt, L. Ebersbach, K. Topp, and M. Eitinger for technical support during the experiment and laboratory analyses. The authors declare no conflict of interest. LITERATURE CITED Bandrick M. Ariza-Nieto C. Baidoo S. K. Molitor T. W. 2014. Colostral antibody-mediated and cell-mediated immunity contributes to innate and antigen-specific immunity in piglets. Dev. Comp. Immunol.  43( 1): 114– 120. doi: https://doi.org/10.1016/j.dci.2013.11.005. Google Scholar CrossRef Search ADS PubMed  Bojarski C. Weiske J. Schoneberg T. Schroder W. Mankertz J. Schulzke J. D. Florian P. Fromm M. Tauber R. Huber O. 2004. The specific fates of tight junction proteins in apoptotic epithelial cells. J. Cell Sci.  117( 10): 2097– 2107. doi: https://doi.org/10.1242/jcs.01071. Google Scholar CrossRef Search ADS PubMed  Buddington R. K. Sangild P. T. 2011. Companion Animals Symposium: Development of the mammalian gastrointestinal tract, the resident microbiota, and the role of diet in early life. J. Anim. Sci.  89( 5): 1506– 1519. doi: https://doi.org/10.2527/jas.2010-3705. Google Scholar CrossRef Search ADS PubMed  Comstock S. S. Reznikov E. A. Contractor N. Donovan S. M. 2014. Dietary bovine lactoferrin alters mucosal and systemic immune cell responses in neonatal piglets. J. Nutr.  144( 4): 525– 532. doi: https://doi.org/10.3945/jn.113.190264. Google Scholar CrossRef Search ADS PubMed  Fernandes P. O'Donnell C. Lyons C. Keane J. Regan T. O'Brien S. Fallon P. Brint E. Houston A. 2014. Intestinal expression of Fas and Fas ligand is upregulated by bacterial signaling through TLR4 and TLR5, with activation of Fas modulating intestinal TLR-mediated inflammation. J. Immunol.  193( 12): 6103– 6113. doi: https://doi.org/10.4049/jimmunol.1303083. Google Scholar CrossRef Search ADS PubMed  Foxcroft G. R. 2012. Reproduction in farm animals in an era of rapid genetic change: Will genetic change outpace our knowledge of physiology? Reprod. Domest. Anim.  47( Suppl. 4): 313– 319. doi: https://doi.org/10.1111/j.1439-0531.2012.02091.x. Google Scholar CrossRef Search ADS PubMed  Günzel D. Yu A. S. 2013. Claudins and the modulation of tight junction permeability. Physiol. Rev.  93( 2): 525– 569. doi: https://doi.org/10.1152/physrev.00019.2012. Google Scholar CrossRef Search ADS PubMed  Hering N. A. Andres S. Fromm A. van Tol E. A. Amasheh M. Mankertz J. Fromm M. Schulzke J. D. 2011. Transforming growth factor-beta, a whey protein component, strengthens the intestinal barrier by upregulating claudin-4 in HT-29/B6 cells. J. Nutr.  141( 5): 783– 789. doi: https://doi.org/10.3945/jn.110.137588. Google Scholar CrossRef Search ADS PubMed  Inman C. F. Haverson K. Konstantinov S. R. Jones P. H. Harris C. Smidt H. Miller B. Bailey M. Stokes C. 2010. Rearing environment affects development of the immune system in neonates. Clin. Exp. Immunol.  160( 3): 431– 439. doi: https://doi.org/10.1111/j.1365-2249.2010.04090.x. Google Scholar CrossRef Search ADS PubMed  Jacobi S. K. Odle J. 2012. Nutritional factors influencing intestinal health of the neonate. Adv. Nutr.  3( 5): 687– 696. doi: https://doi.org/10.3945/an.112.002683. Google Scholar CrossRef Search ADS PubMed  Jensen A. R. Elnif J. Burrin D. G. Sangild P. T. 2001. Development of intestinal immunoglobulin absorption and enzyme activities in neonatal pigs is diet dependent. J. Nutr.  131: 3259– 3265. Google Scholar CrossRef Search ADS PubMed  Kelly D. Smyth J. A. McCracken K. J. 1991. Digestive development of the early-weaned pig. 1. Effect of continuous nutrient supply on the development of the digestive tract and on changes in digestive enzyme activity during the first week post-weaning. Br. J. Nutr.  65( 02): 169– 180. doi: https://doi.org/10.1079/BJN19910078. Google Scholar CrossRef Search ADS PubMed  Klingspor S. Martens H. Caushi D. Twardziok S. Aschenbach J. R. Lodemann U. 2013. Characterization of the effects of Enterococcus faecium on intestinal epithelial transport properties in piglets. J. Anim. Sci.  91( 4): 1707– 1718. doi: https://doi.org/10.2527/jas.2012-5648. Google Scholar CrossRef Search ADS PubMed  Kröger S. Pieper R. Aschenbach J. R. Martin L. Liu P. Rieger J. Schwelberger H. G. Neumann K. Zentek J. 2015. Effects of high levels of dietary zinc oxide on ex vivo epithelial histamine response and investigations on histamine receptor action in the proximal colon of weaned piglets. J. Anim. Sci.  93( 11): 5265– 5272. doi: https://doi.org/10.2527/jas.2015-9095. Google Scholar CrossRef Search ADS PubMed  Kröger S. Pieper R. Schwelberger H. G. Wang J. Villodre Tudela C. Aschenbach J. R. Van Kessel A. G. Zentek J. 2013. Diets high in heat-treated soybean meal reduce the histamine-induced epithelial response in the colon of weaned piglets and increase epithelial catabolism of histamine. PLoS One  8( 11): e80612. doi: https://doi.org/10.1371/journal.pone.0080612. Google Scholar CrossRef Search ADS PubMed  Lallès J. P. Bosi P. Smidt H. Stokes C. R. 2007. Nutritional management of gut health in pigs around weaning. Proc. Nutr. Soc.  66( 2): 260– 268. doi: https://doi.org/10.1017/S0029665107005484. Google Scholar CrossRef Search ADS PubMed  Liu P. Pieper R. Tedin L. Martin L. Meyer W. Rieger J. Plendl J. Vahjen W. Zentek J. 2014. Effect of dietary zinc oxide on jejunal morphological and immunological characteristics in weaned piglets. J. Anim. Sci.  92( 11): 5009– 5018. doi: https://doi.org/10.2527/jas.2013-6690. Google Scholar CrossRef Search ADS PubMed  Lodemann U. Hubener K. Jansen N. Martens H. 2006. Effects of Enterococcus faecium NCIMB 10415 as probiotic supplement on intestinal transport and barrier function of piglets. Arch. Anim. Nutr.  60( 1): 35– 48. doi: https://doi.org/10.1080/17450390500468099. Google Scholar CrossRef Search ADS PubMed  Mankertz J. Tavalali S. Schmitz H. Mankertz A. Riecken E. O. Fromm M. Schulzke J. D. 2000. Expression from the human occludin promoter is affected by tumor necrosis factor alpha and interferon gamma. J. Cell Sci.  113: 2085– 2090. Google Scholar PubMed  Marion J. Petersen Y. M. Romé V. Thomas F. Sangild P. T. Le Dividich J. Le Huërou-Luron I. 2005. Early weaning stimulates intestinal brush border enzyme activities in piglets, mainly at the posttranscriptional level. J. Pediatr. Gastroenterol. Nutr.  41: 401– 410. doi: https://doi.org/10.1097/01.mpg.0000177704.99786.07. Google Scholar CrossRef Search ADS PubMed  Martin L. Pieper R. Kröger S. Vahjen W. Neumann K. Van Kessel A. G. Zentek J. 2012. Influence of age and Enterococcus faecium NCIMB 10415 on development of small intestinal digestive physiology in piglets. Anim. Feed Sci. Technol.  175( 1–2): 65– 75. doi: https://doi.org/10.1016/j.anifeedsci.2012.04.002. Google Scholar CrossRef Search ADS   Martin L. Pieper R. Schunter N. Vahjen W. Zentek J. 2013. Performance, organ zinc concentration, jejunal brush border membrane enzyme activities and mRNA expression in piglets fed with different levels of dietary zinc. Arch. Anim. Nutr.  67( 3): 248– 261. doi: https://doi.org/10.1080/1745039X.2013.801138. Google Scholar CrossRef Search ADS PubMed  Maslinski C. Kierska D. Fogel W. Kinnunen A. Panula P. 1997. Histamine in mammary gland: Pregnancy and lactation. Comp. Biochem. Physiol. A: Physiol.  116( 1): 57– 64. doi: https://doi.org/10.1016/S0300-9629(96)00117-X. Google Scholar CrossRef Search ADS   Møller H. K. Thymann T. Fink L. N. Frokiaer H. Kvistgaard A. S. Sangild P. T. 2011. Bovine colostrum is superior to enriched formulas in stimulating intestinal function and necrotising enterocolitis resistance in preterm pigs. Br. J. Nutr.  105( 01): 44– 53. doi: https://doi.org/10.1017/S0007114510003168. Google Scholar CrossRef Search ADS PubMed  Montagne L. Boudry G. Favier C. Le Huerou-Luron I. Lallès J. P. Seve B. 2007. Main intestinal markers associated with the changes in gut architecture and function in piglets after weaning. Br. J. Nutr.  97( 01): 45– 57. doi: https://doi.org/10.1017/S000711450720580X. Google Scholar CrossRef Search ADS PubMed  Moran A. W. Al-Rammahi M. A. Arora D. K. Batchelor D. J. Coulter E. A. Ionescu C. Bravo D. Shirazi-Beechey S. P. 2010. Expression of Na+/glucose co-transporter 1 (SGLT1) in the intestine of piglets weaned to different concentrations of dietary carbohydrate. Br. J. Nutr.  104( 05): 647– 655. doi: https://doi.org/10.1017/S0007114510000954. Google Scholar CrossRef Search ADS PubMed  Mulder I. E. Schmidt B. Stokes C. R. Lewis M. Bailey M. Aminov R. I. Prosser J. I. Gill B. P. Pluske J. R. Mayer C. D. Musk C. C. Kelly D. 2009. Environmentally-acquired bacteria influence microbial diversity and natural innate immune responses at gut surfaces. BMC Biol.  7( 1): 79. doi: https://doi.org/10.1186/1741-7007-7-79. Google Scholar CrossRef Search ADS PubMed  Naumann K. Bassler R. 2004. Methodenbuch Band III: Die chemische Untersuchung von Futtermitteln. (In German.) Neumann-Neudamm, Melsungen, Germany. Németh Z. H. Deitch E. A. Szabó C. Haskó G. 2002. Hyperosmotic stress induces nuclear factor-kappaB activation and interleukin-8 production in human intestinal epithelial cells. Am. J. Pathol.  161( 3): 987– 996. doi: https://doi.org/10.1016/S0002-9440(10)64259-9. Google Scholar CrossRef Search ADS PubMed  Pasternak J. A. Kent-Dennis C. Van Kessel A. G. Wilson H. L. 2015. Claudin-4 undergoes age-dependent change in cellular localization on pig jejunal villous epithelial cells, independent of bacterial colonization. Mediators Inflamm.  2015: 263629. doi: https://doi.org/10.1155/2015/263629. Google Scholar CrossRef Search ADS PubMed  Pérez-Cano F. J. Marín-Gallén S. Castell M. Rodríguez -Palmero M. Rivero M. Franch À. Castellote C. 2007. Bovine whey protein concentrate supplementation modulates maturation of immune system in suckling rats. Br. J. Nutr.  98( Suppl. 1): S80– S84. doi: https://doi.org/10.1017/S0007114507838074. Google Scholar PubMed  Pfaffl M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res.  29( 9): e45. doi: https://doi.org/10.1093/nar/29.9.e45. Google Scholar CrossRef Search ADS PubMed  Pieper R. Kröger S. Richter J. F. Wang J. Martin L. Bindelle J. Htoo J. K. von Smolinski D. Vahjen W. Zentek J. Van Kessel A. G. 2012. Fermentable fiber ameliorates fermentable protein-induced changes in microbial ecology, but not the mucosal response, in the colon of piglets. J. Nutr.  142( 4): 661– 667. doi: https://doi.org/10.3945/jn.111.156190. Google Scholar CrossRef Search ADS PubMed  Pieper R. Martin L. Schunter N. Villodre Tudela C. Weise C. Klopfleisch R. Zentek J. Einspanier R. Bondzio A. 2015. Impact of high dietary zinc on zinc accumulation, enzyme activity and proteomic profiles in the pancreas of piglets. J. Trace Elem. Med. Biol.  30: 30– 36. doi: https://doi.org/10.1016/j.jtemb.2015.01.008. Google Scholar CrossRef Search ADS PubMed  Richter J. F. Pieper R. Zakrzewski S. S. Günzel D. Schulzke J. D. Van Kessel A. G. 2014. Diets high in fermentable protein and fibre alter tight junction protein composition with minor effects on barrier function in piglet colon. Br. J. Nutr.  111( 06): 1040– 1049. doi: https://doi.org/10.1017/S0007114513003498. Google Scholar CrossRef Search ADS PubMed  Sangild P. T. Sjostrom H. Noren O. Fowden A. L. Silver M. 1995. The prenatal development and glucocorticoid control of brush-border hydrolases in the pig small intestine. Pediatr. Res.  37( 2): 207– 212. doi: https://doi.org/10.1203/00006450-199502000-00014. Google Scholar CrossRef Search ADS PubMed  Sangild P. T. Thymann T. Schmidt M. Stoll B. Burrin D. G. Buddington R. K. 2013. Invited review: The preterm pig as a model in pediatric gastroenterology. J. Anim. Sci.  91( 10): 4713– 4729. doi: https://doi.org/10.2527/jas.2013-6359. Google Scholar CrossRef Search ADS PubMed  Scharek-Tedin L. Kreuzer-Redmer S. Twardziok S. O. Siepert B. Klopfleisch R. Tedin K. Zentek J. Pieper R. 2015. Probiotic treatment decreases the number of CD14-expressing cells in porcine milk which correlates with several intestinal immune parameters in the piglets. Front. Immunol.  6: 108. doi: https://doi.org/10.3389/fimmu.2015.00108. Google Scholar CrossRef Search ADS PubMed  Schokker D. Zhang J. Zhang L. L. Vastenhouw S. A. Heilig H. G. Smidt H. Rebel J. M. Smits M. A. 2014. Early-life environmental variation affects intestinal microbiota and immune development in new-born piglets. PLoS One  9( 6): e100040. doi: https://doi.org/10.1371/journal.pone.0100040. Google Scholar CrossRef Search ADS PubMed  Shirazi-Beechey S. P. Moran A. W. Bravo D. Al-Rammahi M. 2011. Nonruminant Nutrition Symposium: Intestinal glucose sensing and regulation of glucose absorption: Implications for swine nutrition. J. Anim. Sci.  89( 6): 1854– 1862. doi: https://doi.org/10.2527/jas.2010-3695. Google Scholar CrossRef Search ADS PubMed  Solano-Aguilar G. I. Vengroski K. G. Beshah E. Lunney J. K. 2000. Isolation and purification of lymphocyte subsets from gut-associated lymphoid tissue in neonatal swine. J. Immunol. Methods  241( 1–2): 185– 199. doi: https://doi.org/10.1016/S0022-1759(00)00209-X. Google Scholar CrossRef Search ADS PubMed  Thompson C. L. Wang B. Holmes A. J. 2008. The immediate environment during postnatal development has long-term impact on gut community structure in pigs. ISME J.  2( 7): 739– 748. doi: https://doi.org/10.1038/ismej.2008.29. Google Scholar CrossRef Search ADS PubMed  Thymann T. Møller H. K. Stoll B. Stoy A. C. Buddington R. K. Bering S. B. Jensen B. B. Olutoye O. O. Siggers R. H. Mølbak L. Sangild P. T. Burrin D. G. 2009. Carbohydrate maldigestion induces necrotizing enterocolitis in preterm pigs. Am. J. Physiol. Gastrointest. Liver Physiol.  297( 6): G1115– G1125. doi: https://doi.org/10.1152/ajpgi.00261.2009. Google Scholar CrossRef Search ADS PubMed  Villodre Tudela C. Boudry C. Stumpff F. Aschenbach J. R. Vahjen W. Zentek J. Pieper R. 2015. Down-regulation of monocarboxylate transporter 1 (MCT1) gene expression in the colon of piglets is linked to bacterial protein fermentation and pro-inflammatory cytokine-mediated signalling. Br. J. Nutr.  113( 04): 610– 617. doi: https://doi.org/10.1017/S0007114514004231. Google Scholar CrossRef Search ADS PubMed  Wang M. Radlowski E. C. Monaco M. H. Fahey G. C. Jr Gaskins H. R. Donovan S. M. 2013. Mode of delivery and early nutrition modulate microbial colonization and fermentation products in neonatal piglets. J. Nutr.  143( 6): 795– 803. doi: https://doi.org/10.3945/jn.112.173096. Google Scholar CrossRef Search ADS PubMed  Yang C. Albin D. M. Wang Z. Stoll B. Lackeyram D. Swanson K. C. Yin Y. Tappenden K. A. Mine Y. Yada R. Y. Burrin D. G. Fan M. Z. 2011. Apical Na+-D-glucose cotransporter 1 (SGLT1) activity and protein abundance are expressed along the jejunal crypt-villus axis in the neonatal pig. Am. J. Physiol. Gastrointest. Liver Physiol.  300: G60– 70. doi: https://doi.org/10.1152/ajpgi.00208.2010.1. Google Scholar CrossRef Search ADS PubMed  American Society of Animal Science

Journal

Journal of Animal ScienceOxford University Press

Published: Mar 1, 2016

There are no references for this article.