Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/oxford-university-press/design-of-a-chimeric-ace-2-fc-silent-fusion-protein-with-ultrahigh-hTxsuuqgEm
- Publisher
- Oxford University Press
- Copyright
- © The Author(s) 2023. Published by Oxford University Press on behalf of Antibody Therapeutics. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
- eISSN
- 2516-4236
- DOI
- 10.1093/abt/tbad001
- Publisher site
- See Article on Publisher Site
Abstract
Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 DESIGN OF A CHIMERIC ACE-2/Fc-SILENT FUSION PROTEIN WITH ULTRAHIGH AFFINITY AND NEUTRALIZING CAPACITY FOR SARS-CoV-2 VARIANTS 1 2 3 4 2 Neil M. Bodie , Rina Hashimoto , David Connolly , Jennifer Chu , Kazuo Takayama , and Bruce D Uhal . Paradigm Immunotherapeutics Inc., Monrovia, CA, USA. Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto, 6068507, Japan. College of Osteopathic Medicine, Michigan State University, East Lansing, MI, USA. Innovation Lab, ACROBiosystems,1 Innovation Way, Newark, DE, 19711, USA Department of Physiology, Michigan State University, East Lansing, MI, USA. Statement of Significance: A new class of ACE-2/Fc-silent IgG fusion proteins was designed to have ultrahigh affinity and superior neutralizing capacity against a variety of SARS-CoV-2 VOCs. The highest binding affinity (femtomolar) was observed against Omicron variant BA.2. Inclusion of the Y-T- E sequence in the IgG domain is expected to triple biological halflife. © The Author(s) 2023. Published by Oxford University Press on behalf of Antibody Therapeutics. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Corresponding Author: Bruce D Uhal, PhD Department of Physiology Michigan State University 3197 Biomedical and Physical Sciences Building 567 Wilson Road UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 East Lansing, MI, 48824, USA Email: uhal@msu.edu Abstract Background: As SARS-CoV-2 continues to mutate into Variants of Concern (VOC), there is growing and urgent need to develop effective antivirals to combat COVID-19. Monoclonal antibodies developed earlier are no longer capable of effectively neutralizing currently active VOCs. This report describes the design of variant-agnostic chimeric molecules consisting of an Angiotensin Converting Enzyme-2 (ACE-2) domain mutated to retain ultrahigh affinity binding to a wide variety of SARS-CoV-2 variants, coupled to an Fc-silent immunoglobulin domain that eliminates antibody-dependent enhancement (ADE) and extends biological half-life. Methods: Molecular modeling, Surrogate Viral Neutralization tests (sVNT) and infection studies of human airway organoid cultures were performed with synthetic chimeras, SARS-CoV-2 spike protein mimics and SARS-CoV-2 Omicron variants B.1.1.214, BA.1, BA.2 and BA.5. Results: ACE-2 mutations L27, V34 and E90 resulted in ultrahigh affinity binding of the LVE-ACE-2 domain to the widest variety of VOCs, with KDs of 93 pM and 73 pM for binding to the Alpha B1.1.7 and Omicron B.1.1.529 variants, and notably, 78fM, 133fM and 1.81pM affinities to the Omicron BA.2, BA2.75 and BQ.1.1 subvariants, respectively. sVNT assays revealed titers of ≥4.9ng/ml, for neutralization of recombinant viral proteins corresponding to the Alpha, Delta and Omicron variants. The values above were obtained with LVE-ACE-2/mAB chimeras containing the FcRn-binding Y-T-E sequence which extends biological half-life 3-4-fold. Conclusions: The ACE-2-mutant/Fc silent fusion proteins described have ultrahigh affinity to a wide variety of SARS-CoV-2 variants including Omicron. It is proposed that these chimeric ACE-2/mABs UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 will constitute variant-agnostic and cost-effective prophylactics against SARS-CoV-2, particularly when administered nasally. Keywords: Lung; ACE-2; coronavirus; therapeutic; fusion protein 1.1 Introduction SARS-CoV-2 has caused the pandemic Coronavirus Disease 2019 (COVID-19), a highly infectious, fatal disease that affects the lungs and other organs. SARS-CoV-2 belongs to the large coronavirus (CoV) family, which are enveloped viruses that have a 26-32 kb, positive-sense, single- stranded RNA genome (Samavati and Uhal, 2020). The viral envelope consists of a lipid bilayer where the viral membrane (M), envelope (E) and spike (S) structural proteins are anchored. The S protein, also known as viral fusion protein, specifically interacts with its primary receptor, the angiotensin-converting 86 enzyme 2 (ACE-2) on the cell surface to mediate virus-cell fusion, resulting in viral infection through mechanisms thought to be similar to those for SARS-CoV-1 (Heurich et al, 2014). The viral S-protein binds to its primary receptor ACE-2 through the Receptor Binding Domain (RBD) of the S subunit (Seyran et al., 2020). A subset of the viral mutations that differentiate variants of SARS-CoV-2 occurs in the RBD portion of the S-subunit (Celik et al., 2022) and thereby affect binding affinity to the viral receptor. In general, mutations that increase binding affinity of the RBD to ACE-2 result in higher infectivity, but other factors such as immune evasion also play important roles in SARS-CoV-2 virulence (Oh et al., 2022). There is an urgent need to develop effective antivirals to combat this newly emerged infectious disease. At the time of this writing, four monoclonal antibodies have been granted Emergency Use UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Authorization (EUA) by the US FDA for clinical use: 1) bamlanivimab plus etesevimab are neutralizing mAbs that bind to different, but overlapping, epitopes in the spike protein RBD; 2) Casirivimab plus imdevimab (REGEN-COV) are recombinant human mAbs that bind to nonoverlapping epitopes of the spike protein RBD; 3) tixagevimab plus cilgavimab (Evusheld) are recombinant human anti-SARS- CoV-2 mAbs that bind nonoverlapping epitopes of the spike protein RBD, and 4) sotrovimab targets an epitope in the RBD that is conserved between SARS-CoV and SARS-CoV-2. Although initially effective at viral neutralization, mAB combinations 1) and 2) have been shown to have significantly reduced neutralizing capacity for the Omicron variant (Shah et al., 2022; Tatham et al., 2022); indeed, on January 24, 2022 the FDA revoked the Emergency Use Authorization (EUA) for REGEN-COV against the Omicron Variant Of Concern (VOC, REGEN-COV Usage Revisions, regencov.com) due to a lack of efficacy against Omicron, and the efficacy of mAB combination 3) for the Omicron variant, initially deemed unclear (Planas et al., 2021), was recently (2-23-2022) found by the FDA to be reduced to the point of requiring a doubling of the dose of Evusheld used to combat the Omicron VOC. Although sotrovimab was thought to retain significant capacity to neutralize the initial Omicron variants at the time of this writing (Cameroni et al., 2021), the FDA subsequently revoked the EUA for sotrovimab on 4/5/2022 (https://www.sotrovimab.com), due to loss of efficacy against Omicron BA.2. Therefore, new variant-agnostic approaches to viral neutralization are needed for the current and future pandemics. Several research groups have developed mutated ACE-2 mimiks, including engineered ACE-2 with optimized binding to the viral RBD (Chan et al., 2020, Glascow et al., 2020) and an ACE-2 triple decoy with enhanced affinity for viral variants (Tanaka et al., 2021). Although each of the above engineered ACE-2 mimiks had higher affinity binding to the SARS-2 RBD than wild-type ACE-2, they all have nanomolar or low, sub-nanomolar binding affinities. In contrast, the data reported herein show UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 binding of our optimized ACE-Fc construct in the picomolar and even femtomolar range to the Omicron BA.1 and BA.2 variants, respectively. In addition, none of the above construct s incorporate the Fc-silent technologies to be discussed below. In addition to resistance of existing products to newly emerging variants of SARS-CoV-2, the concept of Antibody-Dependent Enhancement (ADE) of viral infection is increasingly being recognized as a serious danger in COVID-19 (Sánchez-Zuno et al., 2021, Maemura et al, 2021). In ADE, which was observed in previous outbreaks of dengue virus (DENV), Zika virus (ZIKV), Ebola virus, human immunodeficiency virus (HIV), Aleutian mink disease parvovirus, Coxsackie B virus and others, pre- existing non-neutralizing or sub-neutralizing antibodies against viral surface proteins, generated during a previous infection, promote the subsequent entry of viruses into the cell during a secondary infection, and thereby intensify the ensuing inflammatory process (12). However, ADE has not yet been clinically demonstrated in SARS CoV-2 infection. Instead, “Antibody Dependent Inflammation” (ADI) has been documented (Junqueire et al., 2022). Although severe COVID-19 disease is linked to exuberant inflammation, how SARS-CoV-2 triggers inflammation is not well understood. Monocytes and macrophages are sentinel cells that sense invasive infection to form inflammasomes that activate caspase-1 and gasdermin D (GSDMD), leading to inflammatory death (pyroptosis) and release of potent inflammatory mediators. Junqueire et. al. showed that about 6% of blood monocytes in COVID-19 patients are infected with SARS-CoV-2. Monocyte infection depends on uptake of antibody-opsonized virus by Fcγ receptors, but vaccine recipient plasma does not promote antibody-dependent monocyte infection. SARS-CoV-2 begins to replicate in monocytes, but infection is aborted, and infectious virus is not detected in infected monocyte culture supernatants. Instead, infected cells undergo inflammatory cell death (pyroptosis) mediated by activation of NLRP3 and AIM2 inflammasomes, caspase-1 and GSDMD. Moreover, tissue-resident macrophages, but not infected UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 epithelial and endothelial cells from COVID-19 lung autopsies, have activated inflammasomes. These findings, taken together, suggest that antibody-mediated SARS-CoV-2 uptake by monocytes/macrophages triggers inflammatory cell death that aborts production of infectious virus, but causes systemic Fc receptor-dependent inflammation that contributes to COVID-19 pathogenesis (Junqueire et. al., 2022). For all the reasons above, the objective of this work was to design molecules with high but variant-agnostic binding affinities to a wide variety of SARS-CoV-2 variants, particularly if they might also incorporate features that reduce or eliminate ADI or ADE. In this report we describe the design of just such molecules, which combine a synthetic human ACE-2 domain containing mutations that allow variant-agnostic, ultra-high affinity binding to the SARS-CoV-2 S1 subunit, combined together with an Fc-silent antibody domain that essentially eliminates the potential for ADI or ADE. Moreover, a third mutant option of the antibody domain of the chimera is offered, with the intent to substantially increase (3-4-fold) the biological half-life of the chimera if delivered by aerosol or nasal administration. Given that nasal infection is the most likely route of SARS-CoV-2 entry in humans (Hou et al., 2020), it is proposed that a nasal administration of the new chimeric molecules described herein will constitute an effective prophylactic against SARS-CoV-2 infection that will not only be effective, but also is expected to be economically far superior to current monoclonal antibody treatments for COVID-19. 1.2 Materials and Methods 1.2.1 Viral and protein constructs: Viral Receptor Binding Domain (RBD), S1 protein subunit and S1 subunit trimers were synthesized by Absolute Antibody (Cleveland, United Kingdom ) as recombinant proteins designed on the basis of publicly available sequence data (outbreak.info). Recombinant human ACE-2 constructs were also synthesized by Absolute Antibody (Boston, MA) designed on the basis of sequence data obtained from NCBI protein sequence data and modified as described in Figures 2-5. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 GenScript IgG FL18-740 (Cat. No. Z03516) was purchased from GenScript (Piscataway NJ). The ACE- 2/mAB chimeras were synthesized by Absolute Antibody (Boston, MA). 1.2.2 In silico molecular modeling: Molecular models were derived from publicly available ACE-2 and SARS-CoV-2 sequence databases (Outbreak.info) with Protean 3D Version 17.3 (DNASTAR. Madison, WI) software using the method described by Zhang and Zhang (Zhang and Zhang, 2010), which uses a knowledge-based potential to solve protein folding and protein structure prediction problems. Based on the parent software I-TASSER (Zhou and Skolnick, 2007), the method of Zhang and Zhang can differentiate well between Leucine and Isoleucine, an ability important for the potential analysis of Leucines in viral or ACE-2 variants. Comparisons of atomic-level structures and viral-ACE-2 interactions were achieved with the knowledge-based atomic potential algorithm DFIRE (Zhou and Zhou, 2002), which generates a numerical protein-protein interaction score that becomes more negative with more stabilizing molecular interactions. Mutations in ACE-2 yielding the highest affinity binding to the widest variety of SARS-2 variants were sought. To find these, dozens of in silico experiments were performed to determine the optimal ACE2 mutations (L,V) for the most highly conserved SARSCo V2 RBD anchor amino acid residues RBD L455, F456 and Y473, based on DMS of the SARSCoV2 RBD, see Figure 3B (Starr et al., 2020). The final mutation we chose, ACE2 N90E, was based on the DNASTAR modeling program suggesting steric hinderance of the ACE2 N90 glycan. 1.2.3 Binding affinity determinations: Surface Plasmon Resonance (SPR) assays of protein-protein interactions were performed by Acro Biosystems (Beijing Economic Development Zone, Beijing China) on a Biacore T200 Instrument fitted with Series SCM5 Sensor Chip. Prior to SPR assay, samples were desalted on Zeba Spin 7K MWCO columns. Binding affinities were determined in HBS-N buffer, 10X (0.1M HEPES, 1.5MNaCl) containing EDTA and Tween 20, at a flow rate of 30 μL/minute, run for 120 seconds association and 180 seconds dissociation. The reference subtracted SPR binding curves were UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 blank subtracted, and curve fitting was performed with a 1:1 model to obtain kinetic parameters using the Biacore T200 Evaluation software. Binding data are reported as estimated dissociation constant (KD, Figures 6,10 and Table I). 1.2.4 Surrogate viral neutralization tests The surrogate Viral Neutralization Test (sVNT, C-PASS, GenScript USA Inc., Piscataway, NJ 08854) was used to characterize the antibodies described, using the methodology defined previously (Tan et al., 2020). The manufacturer’s instructions were followed without modification except where specifically noted below. Briefly, the SARS-CoV-2 sVNT Kit is a blocking ELISA detection tool, which mimics the virus neutralization process. The kit contains two key components: the Horseradish peroxidase (HRP) conjugated recombinant SARS-CoV-2 RBD fragment (HRP-RBD) and the human ACE2 receptor protein (hACE2). The protein-protein interaction between HRP-RBD and hACE2 can be blocked by neutralizing antibodies against SARS-CoV-2 RBD; specific applications are described in the Legends to Figures. 1.2.5 SARS-CoV-2 preparation The SARS-CoV-2 strains B.1.1.214 (GISAID accession number: EPI_ISL_2897162), BA.1 (GISAID accession number: EPI_ISL_9638489), BA.2 (GISAID accession number: EPI_ISL_11900505), and BA.5 (GISAID accession number: EPI_ISL_14018094) were isolated from a nasopharyngeal swa b sample of a COVID-19 patient. This study has been approved by the research ethics committee of Kyoto University. The virus was plaque-purified and propagated in TMPRSS2/Vero cells (JCRB1818, JCRB Cell Bank) (Matsuyama et al. 2020). SARS-CoV-2 was stored at -80°C. All experiments including virus infections were done in biosafety level 3 facilities at Kyoto University strictly following regulations. 1.2.6 Airway organoids preparation UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Airway organoids (AO) were generated according to our previous report (Sano et al., 2022). Briefly, normal human bronchial epithelial cells (NHBE, Cat# CC-2540, Lonza) were used to generate AO. NHBE were suspended in 10 mg/ml cold Matrigel growth factor reduced basement membrane matrix (Corning). 50 μl of cell suspension was solidified on pre-warmed cell-culture treated multi-dishes (24- well plates; Thermo Fisher Scientific) at 37 °C for 10 min, and then 500 μl of expansion medium was added to each well. AO were cultured with AO expansion medium for 10 days. To mature the AO, expanded AO were cultured with AO differentiation medium for 5 days. In experiments evaluating the antibodies, AO were dissociated into single cells, and then were seeded into 96-well plates. 1.2.7 Determination of antiviral effects. Human airway organoids prepared as described above were challenged at twenty four hours of culture with virus (MOI=0.1) in the presence of absence of fusion proteins applied at 0.0064, 0.032, 0.16, 0.8, 4, 20 and 100 ug/ml (n=3). Twenty four hours later, media were replaced (with fusion proteins). Twenty four hours thereafter, supernatants were harvested and prepared for determination of viral copy number as described below. 1.2.8 Quantification of viral RNA copy number The cell culture supernatant was mixed with an equal volume of 2×RNA lysis buffer (distilled water containing 0.4 U/uL SUPERase ITM RNase Inhibitor (Thermo Fisher Scientific), 2% Triton X-100, 50 mM KCl, 100 mM Tris-HCl (pH 7.4), and 40% glycerol) and incubated at room temperature for 10 min. The mixture was diluted 10 times with distilled water. Viral RNA was quantified using a One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Bio) on a StepOnePlus real-time PCR system (Thermo Fisher Scientific). The primers used in this experiment are as follows: (forward) AGCCTCTTCTCGTTCCTCATCAC and (reverse) CCGCCATTGCCAGCCATTC. Standard curves were prepared using SARS-CoV-2 RNA (10 copies/μL) purchased from Nihon Gene Research Laboratories. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 1.2.9 Determination of ACE-2 enzyme activity The enzyme activity of ACE-2 within the chimeric fusion proteins was determined with a commercially available ACE-2 assay kit (BPS Bioscience, San Diego, CA). The manufacturer’s instructions were followed directly, and the enzyme activity was expressed as fluorescence units (FU) of fluorogenic substrate converted in 30 minutes by equal amounts of either purified recombinant human ACE-2 (rhACE-2) or fusion protein. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 1.3 Results The basic design of Paradigm’s ACE-2-Fusion protein chimera is shown in Figure 1. A synthetic, mutant variant of human ACE-2 was designed to have high-affinity binding to a wide variety of SARS-CoV-2 variants including Delta and Omicron (data shown below). The ACE-2 was linked to an Fc-silent designer monoclonal antibody of two forms: Fc-silent (L234S/L235T/G236R, “STR”, Wilkinson et al., 2021) and a “live longer” Fc-silent version containing the YTE variant (M252Y/S254T/T256E, Dall’Acqua et al., 2006), which increases binding to FcRn receptor to achieve longer biological half-life as discussed below. Figure 2 shows a three-dimensional model of the ACE- 2/SARS-CoV2 molecular interface with the ACE-2 mutations found to impart high binding affinity to the widest range of SARS-2 variants. In particular, the amino acid (AA) substitutions T27L and H34V interact with SARS-2 RBD amino acids 473 and 456 versus 455 and 453, respectively. The third substitution N90E (ACE2 E90) is discussed next. Figure 3 shows the effect of the ACE-2 AA substitution N90E, which eliminates the site for N- linked glycosylation of ACE-2 at the ACE-2/SARS-2 interface. Surprisingly, elimination of the N-linked glycan resulted in higher affinity binding to several SARS-2 variants, presumably due to loss of steric hindrance otherwise caused by the glycan. In Figure 4, molecular modeling with Protean 3D software of ACE-2 variant binding to a purified, recombinant wild type (w.t.) SARS-2 receptor binding domain (RBD) revealed tighter binding of the ACE-2 LVE variant (DFIRE score -6.67), than that of the ACE-2 amino acid substitutions YTY at positions 27,79 and 330, respectively (DFIRE score -4.53). See Methods for details. Figure 5 shows three dimensional molecular models and binding affinity predictions for the interactions between Paradigm’s ACE-2 LVE/STR chimeric Fusion protein and the purified recombinant RBDs of the w.t. SARS-2 variant (top panel) versus the RBD of the Delta B.1.617.2 variant UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 (bottom panel). The lower DFIRE score of -6.80 for binding to the Delta variant predicts a more stable (tighter) ACE-2/SARS-2 interaction. Consistent with this prediction, the data in Figure 6 shows Surface Plasmon Resonance (SPR) data indicating very high binding affinity of Paradigm’s ACE-2 LVE/STR chimera to either the purified S1/RBD of the Alpha B.1.1.7 variant (378pM) or the purified RBD of the Delta B.1.617.2 variant (554 pM). Surrogate viral neutralization tests (sVNT) are also consistent with the above results; Figure 7 displays sVNT data indicating that Paradigm’s ACE-2 LVE/STR chimeric Fusion protein could neutralize the purified recombinant RBD of either the w.t. SARS-2 Wuhan variant (blue bars) or the Delta variant B1.617.2 (red bars) with nearly equal potency (sVNT titer ~ 4.9ng/ml). In Figure 8, the LVE/STR chimera neutralized the recombinant RBD of the Beta variant B.1.351 with greater potency (red bars, sVNT titer ~2.4ng/ml) than that for the RBD w.t. Wuhan variant (blue bars, titer ~4.9ng/ml). In sVNT tests of the SARS-2 Alpha variant (Figure 9), the LVE ACE-2/STR chimera neutralized the purified RBD of the Alpha variant B1.1.7 significantly better (sVNT titer >4.9ng/ml) than the Genscript Fc-IgG/ACE-2 chimera Z03516 (~6.3ug/ml). Figure 10 displays molecular modeling of the molecular interface between Paradigms’ ACE-2 variant LVE/STR chimera and the RBD of the Omicron variant of SARS-CoV-2 (RBD sequence as of 12/10/2021 at 75% cutoff). Of note, the aliphatic side chain of the Omicron Q493R mutation (purple) makes contact with ACE-2 mutation V34. In molecular modeling (see Methods), simulation of the ACE- 2 LVE/STR chimera binding to the Omicron variant yielded a very favorable DFIRE score of -7.26, indicating a tight, stabilizing interaction. This modeling is consistent with the sVNT results in Figure 11, which show that the Omicron variant sequence known on 9/12/2022, when expressed as either a purified recombinant RBD (top panel) or purified spike protein trimer (bottom panel), could be potently UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 neutralized by Paradigm’s “LiVE” ACE-2 variant LVE/STR STR Fusion protein chimera or by the “LiVE Longer” LVE/STR STR - YTE Fusion protein chimera (sVNT titers~4.9ng/ml). In Figure 12, The LiVE and LiVE Longer fusion proteins were highly effective at inhibiting viral replication of the B.1.1.214 (left) or BA.1 (right) SARS-CoV-2 variants when applied for 2 days to human airway organoid cultures exposed to virus (Sano et al, 2022). Half-maximal inhibition of viral replication was obtained by the “LiVE Longer” fusion protein at 202 ng/ml and 9.3 ng/ml for the B.1.1.214 and BA.1 variants, respectively. Figure 13 displays the antiviral effects of the LiVE or LiVE Longer chimeras and related constructs against the Omicron variants BA.2 and BA.5. Although all constructs potently inhibited viral replication, the most potent inhibition was observed for the LiVE and LiVE Longer chimeras against Omicron BA.5, with IC50s of 29.9 ng/ml and 26.9 ng/ml, respectively. Data in Figure 14 revealed that the chimeric fusion proteins retained very little to no enzymatic activity, when compared to equal amounts of recombinant human ACE-2. Although the reasons for the lack of enzyme activity are not presently clear, they may include steric hindrance caused by the fusion of the ACE-2 domain to the IgG domain, or physical conditions during fusion protein preparation that may be incompatible with preservation of enzyme activity. Figure 15 shows the relative potency of Fc- silencing technologies, determined by Surface Plasmon Resonance (SPR) measurements of the binding of purified, recombinant protein samples of each modified antibody to immobilized recombinant human FcγRI receptor. At the far right, both Paradigm’s Fc-silencing method and mAbsolve’s STR silencing methods show the lowest, almost undetectable binding to FcγRI receptor. The Inset displays SPR data for binding of either the LiVE (non-YTE) or LiVE-Longer chimeras to purified FcRn receptor; note high affinity binding of the YTE chimera to FcRn, but not by the non-YTE variant; binding to FcRn will increase the biological half-life of the chimera in nasal epithelium (see below and Discussion). Figure 16 shows data underlying the inclusion of the YTE mutations in the “LiVE-longer” version of the ACE-2 UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 LVE/STR chimera. Reprinted here with publisher’s permission, Ladel et al. (Ladel et al., 2018) showed that IgG binding to the FcRn receptor, which is permitted by the YTE mutation, results in slow (4-8 hours) transcytosis and recycling of the IgG in the nasal mucosa, which results in a much longer biological half-life of IgGs administered nasally. Table I is a summary of the measured binding affinities, determined by SPR assay, of Paradigm’s LiVE and LiVE-longer chimeric constructs to purified recombinant RBD subunits, S1 subunits containing the RBD, or S1 subunit trimers designed to mimic the Alpha, Delta or Omicron variants of SARS-CoV-2. For comparison, the data are displayed alongside binding data for wild-type ACE-2/Fc fusion proteins from ACRO Biosystems and Genscript, which have binding affinities of 27nM, 16nM and ~3nM, respectively, to the Omicron BA4.6 spike protein trimer and Wuhan strain S1 subunits, respectively. In contrast, all Paradigm constructs had low-to-mid picomolar binding affinities to the Alpha, Delta or Omicron variant protein constructs, all orders of magnitude higher affinity than the commercial wild- type hACE-2 constructs. Of special note, the highest affinity bindings were observed for the YTE variant “LiVE Longer” chimera to the Omicron subvariant BA.2 spike trimer (78fM), to the Omicron subvariant BA2.75 spike trimer (133fM), to the Omicron subvariant spike trimers BA.1 (73pM), BQ.1.1 (1.81pM), and to the Alpha B.1.1.7 variant (93pM). These data are consistent with the sVNT assays described above; implications for potential therapeutics are described in the Discussion section. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 1.4 Discussion This manuscript describes a new generation of chimeric ACE-2/Fusion protein hybrid molecules designed to have four important characteristics: a) ultra-high affinity binding to viral targets; b) preservation of high affinity binding across variant subgroups; c) the option of strong silencing of Fc receptor function to minimize antibody-dependent enhancement (ADE) of infection or complement antibody-dependent enhancement (C’ADE), and d) the option of binding to the FcRn receptor to increase biological half-life, particularly in upper respiratory passages. Given the rapid and consist ent evolution of new variants of SARS-CoV-2 in the last two years, it is proposed that this class of chimeric molecules offers a viable new set of approaches to prophylaxis of SARS-CoV-2 and, in the future with alternate designs, other emerging viral threats yet to come. An important feature of the design presented here is the choice of mutations to engineer into the viral receptor portion of the chimera, which for SARS-CoV-2 is the human ACE-2 protein. Multiple modeling platforms were compared and were used to choose the “L-V-E” ACE-2 variant described; at each step, the modeling results were compared favorably to recently published crystal and cryo -EM structures of ACE-2 bound to SARS-CoV-2 variants. The substitution of E90 for the wild type N eliminates the N-linked glycan, which relieves steric hindrance by the sugar and allows closer ACE- 2/RBD interactions with all other mutants tested (see Figure 3). The amino acid substitutions L27 and V34, which interact with SARS-2 RBD amino acids 473 and 456 versus 455 and 453, respectively (Figure 2), were found in modeling to produce the most stabilizing ACE-2/RBD interactions (lowest D- FIRE score and K by SPR) for the widest number of SARS-2 variants, especially when paired with the E90 substitution to eliminate the N-glycosylation (See Figures 4-5 and Table I). Somewhat surprisingly, when the LVE mutant of ACE-2 was paired with the YTE sequence in the IgG portion of the chimera, the measured binding affinities to several SARS-2 variants were even greater than those measured in the UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 non-YTE construct (to be discussed below, see Table I). Moreover, the sVNT and infection assays reported in Figures 7-9 &11-13 yielded viral neutralization data entirely consistent with the modeling and SPR binding data. Of particular note in the context of the most recent SARS-CoV-2 Omicron sequence at the time of manuscript submission, the SARS CoV-2 RBD mutation N417 (w.t. is K417), along with other Omicron mutations viewed in 3D molecular modeling (see Figure 10, top panel), has caused this RBD amino acid to move further away from the ACE2 D30 amino acid and adopt a more vertical orientation (purple arrow next to V34), compared to the w.t. K417 which was more horizontal (not shown). Across multiple modeling simulations, the choice of valine at ACE-2 position 34 offered the widest variety of favorable ACE-2/RBD interactions, including with the recent the BA.1, BA.2 and BA.5 sublineages of Omicron which have lost the K417 mutation. It is for these reasons that the chimeric molecules described here may be termed “variant agnostic”. Of note, substitution of a tyrosine for the leucine at position 27 (Figure 13, far right “Y-V-E”) resulted in reduced inhibition of viral replication by Omicron subvariant BA.5, when compared to the otherwise identical LVE fusion protein, possibly due to the greater size of the tyrosine side chain relative to leucine. Interestingly, a very recent report describing the relatively new VOC BA.4.6 showed that although BA.4.6 has mutations that allowed nearly complete escape from neutralizing antibodies such as Evusheld, the mutation R346 did not affect binding to ACE-2 (Wang et al, 2022). For these reasons, it was expected and demonstrated that BA.4.6 bound the fusion proteins described here with very high affinity (845pM, see Table I). As suggested in Figure 6, measured binding affinities determined with S1 protein mimics (top panel) versus the RBD only (bottom panel) may have slower off-rate (longer plateau phase). This might possibly be due to the additional residues in the S1 subunit compared to the RBD alone, through some uncharacterized interaction(s) between those additional residues and either the ACE-2 or IgG UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 subdomains of the fusion proteins. In this particular case, the S subunit versus RBD of two different VOCs were analyzed (Alpha versus Delta variants in Fig.6, respectively), so it is unclear if the difference in off-rate was due to variant sequence or the size of the mimic analyzed. The intentional inclusion of the YTE variant of the antibody domain of the chimera was designed to permit increased binding of the “LiVE-Longer” chimeras to the FcRn receptor, which is known to increase the biological half-life of other IgGs currently in use by 3 to 4 fold (Borrok et al., 2017; Zhu et al., 2017). The FcRn receptor binds primarily to the CH2/CH3 interdomain area on IgG Fc, but the Fab arms also contribute to FcRn binding. For this reason, some fusion proteins such as TNFR-IgG Fc mABs (etanercept, trade name Enbrel) have a substantially shorter half-life than normal IgG (Susuki et al., 2021). For this reason, the incorporation of the YTE sequence in Paradigm’s chimeras is expected to not only saturate the FcRn widely expressed in the respiratory tract, but is predicted to substantially increase their biological half-life. In further support of this prediction, Motavizumab-YTE and Omalizumab-YTE have both been shown to have an extended half-life in healthy adults simply as a result of incorporating the YTE sequence (Robble et al. 2013, Liu et al. 2020), a property known to be imparted by binding of this sequence to the FcRn receptor (Mackness et al., 2019). Although biological halflife has not yet been tested for the fusion proteins described here, future pharmacokinetic and pharmacodynamic studies to be performed as part of a later FDA EUA submission are expected to yield a similar halflife extension of 2-4-fold. This is a feature that no other ACE2-Fc fusion proteins to date have taken into account, and is expected to allow lower doses, administered less frequently, to achieve therapeutic efficacy. By analogy to other mAbs containing the YTE sequence (Zhu et al, 2017), it is expected that the Paradigm chimeras expressing YTE will exhibit 3-4-fold increased biological half-life, especially if administered nasally, due to high FcRn expression in the nasal and oral epithelia (Hou et al., 2020). The Surface Plasmon UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Resonance (SPR) data of Figure 15 (see inset) are consistent with this hypothesis, as the YTE construct exhibited nearly 20-fold higher binding affinity to purified FcRn (27 nM) compared to the non-YTE construct (517 nM). The lower pH of the nasal cavity (~5.5, Halwe et al., 2021) is not expected to decrease ACE-2 binding, as computational modeling of chimera-RBD binding at pH 7.4 vs 5.5 yielded DFIRE Scores of -8.54 vs. -8.01, respectively (data not shown). In addition, processing of the LiVE Longer fusion protein through a commonly available home-use nebulizer had no significant effect on the ability of the chimera to neutralize Omicron variants in the sVNT assay (data not shown), supporting the proposed delivery of the fusion proteins by inhalation/nasally. In addition, and somewhat surprisingly, the LiVE-Longer YTE chimeras, when compared to their non-YTE counterparts, also showed consistently higher binding affinities to the SARS-2 protein constructs corresponding to the Alpha variant B.1.1.7 and the Omicron variants B.1.1.529 and BA.1, when these were assayed as S1 subunits or S1 subunit trimers (see Table I). Further, the highest affinity binding was found for the YTE chimera to the Omicron subvariant BA.2 (78 fM). The reason for this increased viral binding by the YTE variant is not presently clear, but may be related to the YTE variant increasing IgG hexamer formation (personal communication, Dr. Neil Bodie). Another potential benefit of incorporating the YTE sequence for FcRn binding is the presence of FcRn expressed by endothelial cells throughout the vasculature (Walters et al., 2016). Recently, extracellular vimentin expressed and released by endothelial cells was shown to act as an adjuvant to ACE-2, increasing ACE-2-mediated entry of SARS-CoV-2 into the endothelium and thereby promoting infection (Amraei et al., 2022). In light of these findings, it might be predicted that high binding of the YTE chimeras to FcRn within the vasculature, together with the increased half-life that binding imparts, would act to further inhibit vimentin-mediated ACE-2-dependent cell entry by the virus. Whether or not these hypotheses are correct will be interesting topics for future investigations. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Regardless, the new chimeric ACE-2/Fc-silent fusion proteins described here offer a promising new approach to prophylaxis of SARS-CoV-2 infection that rigorous pre-clinical testing has shown to be relatively variant-agnostic. On the basis of published data from other mAb preparations containing the YTE sequence, the biological half-life of these constructs is expected to be increased 3-4-fold above that of non-YTE fusion proteins. This feature is expected to not only increase biological half-life, but due to the high expression of FcRn in nasal and oral mucosa, enable lower and less frequent dosing of compound delivered intranasally. Given the stability of these constructs at the acidic pH of the nasal mucosa, it is proposed that intranasal delivery or nebulization may be an optimal delivery route for this proposed prophylactic strategy against SARS-CoV-2 infection. By saturating the respiratory tract FcRn with the “LiVE Longer” mAb, the goal of these YTE prophylactics is to achieve passive sterilizing immunity in future in vivo pre-clinical and human clinical testing. In addition, the design described here offers the possibility to exchange the ACE-2 portion of the construct with other viral receptors, in future efforts to combat viral threats that are likely to emerge. 1.5 Conclusions. In this report we describe the design new molecules which combine a synthetic human ACE-2 domain that is mutated to allow variant-agnostic, ultra-high affinity binding to the SARS-CoV-2 S1 subunit. The ACE-2 domain is combined with an Fc-silent antibody domain that essentially eliminates the potential for ADI or ADE. Moreover, a third mutant option of the antibody domain of the chimera is offered, with the intent to substantially increase (3-4-fold) the biological half-life of the chimera, especially if delivered by aerosol or nasal administration. It is proposed that a nasal administration of the new chimeric molecules described herein will constitute an effective prophylactic against SARS-CoV-2 infection that will not only be effective, but also will be economically superior to current monoclonal antibody treatments for COVID-19. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Data Availability Statement: The authors confirm that the data supporting the findings of this study are available within the article [and/or] its supplementary materials. Acknowledgements We thank Dr. Yoshio Koyanagi, Dr. Takeshi Noda, and Dr. Kazuya Shimura (Kyoto University) for the setup and operation of the BSL-3 laboratory at Kyoto University, Dr. Miki Nagao and Dr. Yasufumi Matsumura (Kyoto University) for isolating SARS-CoV-2, and Ms. Ayaka Sakamoto and Ms. Naoko Yasuhara (Kyoto University) for technical assistance. Funding Statement: Funding for this study was provided by Paradigm Immunotherapeutics Inc.. Conflict of Interest Statement: Neil Bodie DVM reports financial support was provided by Paradigm Immunotherapeutics Inc. Bruce Uhal PhD reports a relationship with Paradigm Immunotherapeutics Inc. that includes equity or stocks. Neil Bodie has patent pending to Paradigm Immunotherapeutics. All other authors have no conflicts to report. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Ethics and Consent Statement: Informed Consent was obtained for studies involving virus isolation and cell isolations for human airway organoid preparations. Both studies were approved by the Research Ethics Committee of Kyoto University. Animal Research Statement: No animal studies were conducted in this research. Author Contributions: Laboratory experiments were designed and performed by NB, RH, JC, and KT. Molecular modeling studies were designed and performed by NB and BU. All authors wrote key sections of the manuscript and edited the document. Compiling of the data, organization of the text and final editing was performed by BU. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 1.5 References 1. Samavati L, Uhal B. (2020). ACE-2, Much More Than Just a Receptor for SARS-CoV-2. Frontiers in Cellular and Infection Microbiology:Virus and Host. Jun 5;10:317. doi: 10.3389/fcimb. 2020.00317. eCollection 2020. PMID: 32582574 2. Heurich A, Hofmann-Winkler H, Gierer S, Liepold T, Jahn O, Pöhlmann S. (2014). TMPRSS2 and ADAM17 cleave ACE2 differentially and only proteolysis by TMPRSS2 augments entry driven by the severe acute respiratory syndrome coronavirus spike protein. J Virol. Jan;88(2):1293-307. doi: 10.1128/JVI.02202-13. Epub 2013 Nov 13. PMID: 24227843; PMCID: PMC3911672. 3. Seyran M, Takayama K, Uversky VN, Lundstrom K, Palù G, Sherchan SP, Attrish D, Rezaei N, Aljabali AAA, Ghosh S, Pizzol D, Chauhan G, Adadi P, Mohamed Abd El-Aziz T, Soares AG, Kandimalla R, Tambuwala M, Hassan SS, Azad GK, Pal Choudhury P, Baetas-da-Cruz W, Serrano- Aroca Á, Brufsky AM, Uhal BD. (2020). The structural basis of accelerated host cell entry by SARS- CoV-2†. FEBS J. Dec 2:10.1111/febs.15651. doi: 10.1111/febs.15651. Online ahead of print.PMID: 33264497 4. Celik I, Khan A, Dwivany FM, Fatimawali, Wei DQ, Tallei TE. (2022). Computational prediction of the effect of mutations in the receptor-binding domain on the interaction between SARS-CoV-2 and human ACE2. Mol Divers. Feb 9. doi: 10.1007/s11030-022-10392-x. Epub ahead of print. PMID: 5. Oh SJ, Shin OS. (2022). SARS-CoV-2-mediated evasion strategies for antiviral interferon pathways. J Microbiol. Feb 5:1–10. doi: 10.1007/s12275-022-1525-1. Epub ahead of print. PMID: 35122601; PMCID: PMC8817151. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 6. Shah M, Woo HG. (2022). Omicron: A Heavily Mutated SARS-CoV-2 Variant Exhibits Stronger Binding to ACE2 and Potently Escapes Approved COVID-19 Therapeutic Antibodies. Front Immunol. Jan 24;12:830527. doi: 10.3389/fimmu.2021.830527. PMID: 35140714; PMCID: PMC8819067. 7. Tatham L, Sharp J, Kijak E, Herriott J, Neary M, Box H, Valentijn A, Cox H, Pertinez H, Curley P, Arshad U, Rajoli RK, Rannard S, Stewart J, Owen A. (2022). Lack of Ronapreve (REGN-CoV; casirivimab and imdevimab) virological efficacy against the SARS-CoV-2 Omicron variant (B.1.1.529) in K18-hACE2 mice. bioRxiv [Preprint]. Jan 24:2022.01.23.477397. doi: 10.1101/2022.01.23.477397. PMID: 35118468; PMCID: PMC8811901. 8. Planas D, Saunders N, Maes P, Guivel-Benhassine F, Planchais C, Buchrieser J, Bolland WH, Porrot F, Staropoli I, Lemoine F, Péré H, Veyer D, Puech J, Rodary J, Baele G, Dellicour S, Raymenants J, Gorissen S, Geenen C, Vanmechelen B, Wawina-Bokalanga T, Martí-Carreras J, Cuypers L, Sève A, Hocqueloux L, Prazuck T, Rey F, Simon-Loriere E, Bruel T, Mouquet H, André E, Schwartz O. (2021). Considerable escape of SARS-CoV-2 Omicron to antibody neutralization. Nature. Dec 23. doi: 10.1038/s41586-021-04389-z. Epub ahead of print. PMID: 35016199. 9. Cameroni E, Bowen JE, Rosen LE, Saliba C, Zepeda SK, Culap K, Pinto D, VanBlargan LA, De Marco A, di Iulio J, Zatta F, Kaiser H, Noack J, Farhat N, Czudnochowski N, Havenar-Daughton C, Sprouse KR, Dillen JR, Powell AE, Chen A, Maher C, Yin L, Sun D, Soriaga L, Bassi J, Silacci- Fregni C, Gustafsson C, Franko NM, Logue J, Iqbal NT, Mazzitelli I, Geffner J, Grifantini R, Chu H, Gori A, Riva A, Giannini O, Ceschi A, Ferrari P, Cippà PE, Franzetti-Pellanda A, Garzoni C, Halfmann PJ, Kawaoka Y, Hebner C, Purcell LA, Piccoli L, Pizzuto MS, Walls AC, Diamond MS, Telenti A, Virgin HW, Lanzavecchia A, Snell G, Veesler D, Corti D. (2021). Broadly neutralizing UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 antibodies overcome SARS-CoV-2 Omicron antigenic shift. Nature. Dec 23. doi: 10.1038/s41586-021- 04386-2. Epub ahead of print. PMID: 35016195. 10. Chan KK, Dorosky D, Sharma P, Abbasi SA, Dye JM, Kranz DM, Herbert AS, Procko E. (2020) Engineering human ACE2 to optimize binding to the spike protein of SARS coronavirus 2. Science. Sep 4;369(6508):1261-1265. doi: 10.1126/science.abc0870. Epub 2020 Aug 4. PMID: 32753553; PMCID: PMC7574912. 11. Glascow A, Glasgow J, Limonta D, Solomon P, Irene Lui I, Yang Zhang Y, Matthew A. Nix MA, Rettko NJ, Zha S, Yamin R, Kao K, Rosenberg OS, Ravetch JV, Wiita AP, Leung KK, Lim SA, Zhou XX, Hobman TC, Kortemme T, Wells JA. (2020) Engineered ACE2 receptor traps potently neutralize SARS-CoV-2. PNAS 117 (45) 28046-28055. https://doi.org/10.1073/pnas.2016093117 12. Tanaka S, Nelson G, Olson CA, Buzko O, Higashide W, Shin A, Gonzalez M, Taft J, Patel R, Buta S, Richardson A, Bogunovic D, Spilman P, Niazi K, Rabizadeh S, Soon-Shiong P. (2021) An ACE2 Triple Decoy that neutralizes SARS-CoV-2 shows enhanced affinity for virus variants. Sci Rep. Jun 17;11(1):12740. doi: 10.1038/s41598-021-91809-9. PMID: 34140558; PMCID: PMC8211782. 13. Sánchez-Zuno, G. A., Matuz-Flores, M. G., González-Estevez, G., Nicoletti, F., Turrubiates- Hernández, F. J., Mangano, K., & Muñoz-Valle, J. F. (2021). A review: Antibody-dependent enhancement in COVID-19: The not so friendly side of antibodies. International journal of UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 immunopathology and pharmacology, 35, 20587384211050199. https://doi.org/10.1177/20587384211050199 14. Maemura T, Kuroda M, Armbrust T, Yamayoshi S, Halfmann PJ, Kawaoka Y. Antibody-Dependent Enhancement of SARS-CoV-2 Infection Is Mediated by the IgG Receptors FcγRIIA and FcγRIIIA but Does Not Contribute to Aberrant Cytokine Production by Macrophages. mBio. 2021 Oct 26;12(5):e0198721. doi: 10.1128/mBio.01987-21. Epub 2021 Sep 28. PMID: 34579572; PMCID: PMC8546849. 15. Karthik K, Senthilkumar TMA, Udhayavel S, Raj GD. Role of antibody-dependent enhancement (ADE) in the virulence of SARS-CoV-2 and its mitigation strategies for the development of vaccines and immunotherapies to counter COVID-19. Hum Vaccin Immunother. 2020 Dec 1;16(12):3055-3060. doi: 10.1080/21645515.2020.1796425. Epub 2020 Aug 26. PMID: 32845733; PMCID: PMC7484565. 16. Junqueira C, Crespo Â, Ranjbar S, de Lacerda LB, Lewandrowski M, Ingber J, Parry B, Ravid S, Clark S, Schrimpf MR, Ho F, Beakes C, Margolin J, Russell N, Kays K, Boucau J, Das Adhikari U, Vora SM, Leger V, Gehrke L, Henderson L, Janssen E, Kwon D, Sander C, Abraham J, Goldberg MB, Wu H, Mehta G, Bell S, Goldfeld AE, Filbin MR, Lieberman J. (2022). FcγR-mediated SARS-CoV-2 infection of monocytes activates inflammation. Nature. Apr 6. doi: 10.1038/s41586-022-04702-4. Epub ahead of print. PMID: 35385861. 17. Hou YJ, Okuda K, Edwards CE, Martinez DR, Asakura T, Dinnon KH 3rd, Kato T, Lee RE, Yount BL, Mascenik TM, Chen G, Olivier KN, Ghio A, Tse LV, Leist SR, Gralinski LE, Schäfer A, Dang H, Gilmore R, Nakano S, Sun L, Fulcher ML, Livraghi-Butrico A, Nicely NI, Cameron M, Cameron C, Kelvin DJ, de Silva A, Margolis DM, Markmann A, Bartelt L, Zumwalt R, Martinez FJ, Salvatore SP, Borczuk A, Tata PR, Sontake V, Kimple A, Jaspers I, O'Neal WK, Randell SH, Boucher RC, Baric RS. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 (2020). SARS-CoV-2 Reverse Genetics Reveals a Variable Infection Gradient in the Respiratory Tract . Cell. Jul 23;182(2):429-446.e14. doi: 10.1016/j.cell.2020.05.042. Epub 2020 May 27. PMID: 32526206; PMCID: PMC7250779. 18. Zhang J, Zhang Y. (2010). A novel side-chain orientation dependent potential derived from random- walk reference state for protein fold selection and structure prediction. PLoS One. Oct 27;5(10):e15386. doi: 10.1371/journal.pone.0015386. PMID: 21060880; PMCID: PMC2965178. 19. Zhou H, Skolnick J. (2007) Ab initio protein structure prediction using chunk-TASSER. Biophys J. Sep 1;93(5):1510-8. doi: 10.1529/biophysj.107.109959. Epub 2007 May 11. PMID: 17496016; PMCID: PMC1948038 20. Zhou HY, Zhou YQ (2002) Distance-scaled, finite ideal-gas reference state improves structure- derived potentials of mean force for structure selection and stability prediction. Protein Science 11: 2714–2726. 21. Starr TN, Greaney AJ, Hilton SK, Ellis D, Crawford KHD, Dingens AS, Navarro MJ, Bowen JE, Tortorici MA, Walls AC, King NP, Veesler D, Bloom JD. (2020) Deep Mutational Scanning of SARS- CoV-2 Receptor Binding Domain Reveals Constraints on Folding and ACE2 Binding. Cell Sep 3;182(5):1295-1310.e20. doi: 10.1016/j.cell.2020.08.012. Epub 2020 Aug 11. PMID: 32841599; PMCID: PMC7418704. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 22. Tan CW, Chia WN, Qin X, Liu P, Chen MI, Tiu C, Hu Z, Chen VC, Young BE, Sia WR, Tan YJ, Foo R, Yi Y, Lye DC, Anderson DE, Wang LF. (2020). A SARS-CoV-2 surrogate virus neutralization test based on antibody-mediated blockage of ACE2-spike protein-protein interaction. Nat Biotechnol. Sep;38(9):1073-1078. doi: 10.1038/s41587-020-0631-z. Epub 2020 Jul 23. PMID: 32704169. 23. Matsuyama S, Nao N, Shirato K, Kawase M, Saito S, Takayama I, Nagata N, Sekizuka T, Katoh H, Kato F, Sakata M, Tahara M, Kutsuna S, Ohmagari N, Kuroda M, Suzuki T, Kageyama T, Takeda M (2020). Enhanced isolation of SARS-CoV-2 by TMPRSS2-expressing cells. Proc Natl Acad Sci U S A. 2020 Mar 31;117(13):7001-7003. doi: 10.1073/pnas.2002589117. Epub Mar 12. PMID: 32165541; PMCID: PMC7132130. 24. Sano E, Suzuki T, Hashimoto R, Itoh Y, Sakamoto A, Sakai Y, Saito A, Okuzaki D, Motooka D, Muramoto Y, Noda T, Takasaki T, Sakuragi JI, Minami S, Kobayashi T, Yamamoto T, Matsumura Y, Nagao M, Okamoto T, Takayama K. (2022) Cell response analysis in SARS-CoV-2 infected bronchial organoids. Commun Biol. 2022 May 30;5(1):516. doi: 10.1038/s42003-022-03499-2. PMID: 35637255; PMCID: PMC9151746. 25. Ladel S, Flamm J, Zadeh A, Filzwieser D, Walter J, Schlossbauer P, Kinscherf R, Lischka K, Luksch H, Schindowski K. Allogenic Fc Domain-Facilitated Uptake of IgG in Nasal Lamina Propria. Pharmaceutics 2018, 10, 107; doi:10.3390/pharmaceutics10030107 UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 26. Borrok MJ, Mody N, Lu X, Kuhn ML, Wu H, Dall'Acqua WF, Tsui P. (2017). An "Fc-Silenced" IgG1 Format With Extended Half-Life Designed for Improved Stability. J Pharm Sci. Apr;106(4):1008- 1017. doi: 10.1016/j.xphs.2016.12.023. Epub 2017 Jan 3. PMID: 28057542. 27. Suzuki T, Hashii N, Tada M, Ishii-Watabe A. The influence of antibody engineering on Fc conformation and Fc receptor binding properties: Analysis of FcRn-binding engineered antibodies and an Fc fusion protein. MAbs. 2021 Jan-Dec;13(1):1923366. doi: 10.1080/19420862.2021.1923366. PMID: 34030575; PMCID: PMC8158039. 28. Robbie GJ, Criste R, Dall'acqua WF, Jensen K, Patel NK, Losonsky GA, Griffin MP. (2013) A novel investigational Fc-modified humanized monoclonal antibody, motavizumab-YTE, has an extended half-life in healthy adults. Antimicrob Agents Chemother. Dec;57(12):6147-53. doi: 10.1128/AAC.01285-13. Epub 2013 Sep 30. PMID: 24080653; PMCID: PMC3837853. 29. Liu P, Pan Z, Gu C, Cao X, Liu X, Zhang J, Xiao Z, Wang X, Guo H, Ju D, Deng SJ. An Omalizumab Biobetter Antibody With Improved Stability and Efficacy for the Treatment of Allergic Diseases. Front Immunol. 2020 Nov 27;11:596908. doi: 10.3389/fimmu.2020.596908. PMID: 33329588; PMCID: PMC7728613. 30. Mackness BC, Jaworski JA, Boudanova E, Park A, Valente D, Mauriac C, Pasquier O, Schmidt T, Kabiri M, Kandira A, Radošević K, Qiu H. Ant ibody Fc engineering for enhanced neonatal Fc receptor UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 binding and prolonged circulation half-life. MAbs. 2019 Oct;11(7):1276-1288. doi: 10.1080/19420862.2019.1633883. Epub 2019 Jul 18. PMID: 31216930; PMCID: PMC6748615. 31. Wang Q, Li Z, Ho J, Guo Y, Yeh AY, Liu M, Wang M, Yu JSheng Z, Huang Y, Liu L, Ho DD. (2022). Resistance of SARS-CoV-2 Omicron Subvariant BA.4.6 to Antibody Neutralization. bioRxiv Preprint, September 06, 2022. doi: https://doi.org/10.1101/2022.09.05.506628 32. Zhu Q, McLellan JS, Kallewaard NL, Ulbrandt ND, Palaszynski S, Zhang J, Moldt B, Khan A, Svabek C, McAuliffe JM, Wrapp D, Patel NK, Cook KE, Richter BWM, Ryan PC, Yuan AQ, Suzich JA. (2017). A highly potent extended half-life antibody as a potential RSV vaccine surrogate for all infants. Sci Transl Med. May 3;9(388):eaaj1928. doi: 10.1126/scitranslmed.aaj1928. PMID: 28469033. 33. Walters BT, Jensen PF, Larraillet V, Lin K, Patapoff T, Schlothauer T, Rand KD, Zhang J. (2016). Conformational Destabilization of Immunoglobulin G Increases the Low pH Binding Affinity with the Neonatal Fc Receptor. J Biol Chem. Jan 22;291(4):1817-1825. doi: 10.1074/jbc.M115.691568. Epub 2015 Dec 1. PMID: 26627822; PMCID: PMC4722460. 34. Amraei R, Xia C, Olejnik J, White MR, Napoleon MA, Lotfollahzadeh S, Hauser BM, Schmidt AG, Chitalia V, Mühlberger E, Costello CE, Rahimi N. (2022). Extracellular vimentin is an attachment factor that facilitates SARS-CoV-2 entry into human endothelial cells. Proc Natl Acad Sci U S A. Feb 8;119(6):e2113874119. doi: 10.1073/pnas.2113874119. PMID: 35078919. 35. Wilkinson I, Anderson S, Fry J, Julien LA, Neville D, Quereshi O, Watts G, Hale G (2021) Fc- engineered antibodies with immune effector functions completely abolished. PLoS ONE 16(12): e0260954. https://doi.org/10.1371/journal.pone.0260954. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 36. Halwe S, Kupke A, Vanshylla K, Liberta F, Gruell H, Zehner M, Rohde C, Krähling V, Gellhorn Serra M, Kreer C, Klüver M, Sauerhering L, Schmidt J, Cai Z, Han F, Young D, Yang G, Widera M, Koch M, Werner A, Kämper L, Becker N, Marlow MS, Eickmann M, Ciesek S, Schiele F, Klein F, Becker S. (2021) Intranasal Administration of a Monoclonal Neutralizing Antibody Protects Mice against SARS-CoV-2 Infection. Viruses. Jul 29;13(8):1498. doi: 10.3390/v13081498. PMID: 34452363; PMCID: PMC8402634. 37. Dall’Acqua WF, Woods RM, Ward ES, Palaszynski SR, Patel NK, Brewah YA, Wu H, Kiener PA, Langermann S. (2002) Increasing the affinity of a human IgG1 for the Neonatal Fc Receptor: Biological Consequence. J. Immunol. 169, 5171–5180. doi: 10.4049/jimmunol.169.9.5171 UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 1.6 TABLE I Binding Affinities of Paradigm’s ACE-2/Fusion protein Chimeras to SARS-CoV-2 Variant Constructs ACE-2/IgG Chimera SARS-CoV-2 Construct K by SPR* LiVE/STR chimera Alpha variant B.1.1.7, S1 subunit 378pM LiVE-Longer YTE chimera Alpha variant B.1.1.7, S1 subunit 93pM LiVE/STR chimera Delta variant B.1.617.2, RBD only 554pM LiVE-Longer YTE chimera Delta B.1.617.2, RBD only 507pM LiVE/STR chimera Omicron BA.1 spike protein trimer 144pM LiVE-Longer YTE chimera Omicron BA.1 spike protein trimer 73pM LiVE-Longer YTE chimera Omicron BA.2 spike protein trimer 78fM LiVE-Longer YTE chimera Omicron BA2.75 spike protein trimer 133fM LiVE-Longer YTE chimera Omicron BA.5 spike protein trimer 5.43pM LiVE/STR chimera Omicron B.1.1.529** RBD only 308pM LiVE-Longer YTE chimera Omicron B.1.1.529** RBD only 402pM LiVE-Longer YTE chimera Omicron BA4.6 spike protein trimer 845pM hACE-2, Fc tag (ACRO)*** Omicron BA4.6 spike protein trimer 27.1nM LiVE-Longer YTE chimera Omicron BQ.1.1 spike protein trimer 1.81pM hACE-2, Fc tag (ACRO)*** Omicron BQ.1.1 spike protein trimer 12.6nM LiVE-Longer YTE chimera Omicron XBB.1 spike protein trimer 215pM hACE-2, Fc tag (ACRO)*** Omicron XBB.1 spike protein trimer 22.4nM hACE-2, Fc tag (ACRO)*** Wuhan variant, S1 subunit 16.0nM hACE-2, Fc (Genscript)**** Wuhan variant, S1 subunit 3.0nM *Surface Plasmon Resonance assay (Acro Biosystems) **Omicron variant B.1.1.529, 01/11/2022 *** Human ACE2, Fc Tag (Cat. No. AC2-H5257, ACRO Biosystems) **** Human ACE-2 Fc fusion protein (Cat. No. Z03516, Genscript) UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 1.7 Legends to Figures. Figure 1. Critical features of Paradigm’s chimeric ACE-2/Fc-silent antibody technology. These include: the use of a full length human ACE-2 domain (amino acids 18-740, blue), which when modified as described next, substantially increases binding affinity for SARS CoV-2 RBD/spike protein (green); the choice of specific mutations in ACE-2 (top right red orange, light green amino acids) that impart picomolar affinity for the RBD and ~femtomolar affinity for the full-length spike protein; linkage of the ACE-2 construct to a completely Fc-silent “STR” mutated monoclonal antibody (yellow, Mike Clark Ph.D., used with permission). The use of STR technology in an ACE2 chimeric prophylactic for SARS CoV-2 is patent pending, see Fig.15. In addition, one of the two mAb chimeras (“LiVE-Longer” vs. “LiVE”) utilizes a Y-T-E variant (red amino acids, bottom) for increased half-life by binding to FcRn, which recycles IgG and is thereby predicted to increase its biological half-life by 3-4-fold (see UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Fig.16 and text for details). The “LiVE” mAB does not contain the YTE sequence; both LiVE and LiVE-Longer are tested in Figs.11-13 below and Table I. This figure was generated by Protean 3D, Version 17.3 (DNASTAR. Madison, WI). Figure 2. Three-dimensional model of the SARS-CoV-2/ACE-2 molecular interface. Multiple In Silico modeling programs were used to predict optimal amino acid substitutions in ACE-2 (green) that would retain high binding affinity to the widest possible range of amino acid variations in the SARS-CoV-2 spike protein receptor binding domain (RBD, red). Two of the three optimal substitutions in ACE-2 depicted here are: T27L (ACE2 L27, blue lower) and H34V (ACE2 V34, blue upper right), shown here in close proximity to RBD amino acids Y473 and F456 versus L455 and Y453, respectively. The third substitution N90E (ACE2 E90, blue upper left) is discussed in Figure 3. See text for details. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Figure 3. The effect of eliminating the glycosylation site at amino acid 90 of ACE-2. The asparagine at amino acid 90 of wild type ACE-2 (N90) is a site for N-linked glycosylation (left panel, ACE-2 N90 CHO) which, when the sugar is present, causes steric hindrance of ACE-2/RBD interaction. Multiple modeling platforms predicted that elimination of the glycosylation site by the mutation N90E (asparagine to glutamate) would relieve steric hindrance and allow closer ACE-2/RBD interaction, particularly in combination with the ACE-2 H34V substitution (right panel, top). Subsequent figures below show data consistent with this prediction. See text for details. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Figure 4. The designed ACE-2 variant LVE/STR chimera scores higher than other ACE-2 Fusion protein competitors by the DFIRE scoring method. Molecular modeling was conducted with Protean 3D Version 17.3 (DNASTAR. Madison, WI) software, aimed at testing Paradigms’ proprietary LiVE variant (ACE-2 mutations T27L, H34V and N90E) binding to w.t. SARS-2 RBD (DFIRE = -6.67), as it compares to the ACE-2 variant YTY (ACE-2 mutations T27Y, L79T and N330Y) binding to the w.t. SARS-2 RBD (DFIRE = -4.53). A lower DFIRE score predicts tighter (stabilizing) protein-protein interactions. See Methods for details. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Figure 5. In Silico testing of SARS CoV-2 Delta variant predicts Paradigm’s ACE-2 variant LVE/STR chimera out-scores competing ACE-2 chimeric technologies. Top Panel: Molecular modeling with Protean 3D Version 17.3 (DNASTAR. Madison, WI) software of ACE-2 LVE construct (green) binding UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 to w.t. SARS-CoV-2 RBD (red) yields DFIRE score = -6.67. Bottom Panel: Identical modeling of ACE- 2 LiVE construct (green) binding to SARS-CoV-2 Delta variant yields DFIRE score = -6.80, slightly tighter (stabilizing) than that for the w.t. RBD. Note rotation of RBD F456 (yellow) in Delta variant toward ACE-2 amino acid 27, made permissive by the T27L mutation. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Figure 6. High binding affinity of Paradigm’s ACE-2 variant LVE/STR chimera to the RBD of Alpha and Delta variants of SARS-CoV-2. Surface Plasmon Resonance (SPR) assays were performed to determine binding affinities between the synthesized, purified LVE/STR chimera and synthesized RBDs of SARS-CoV-2 Alpha or Delta variants. Panel A: The S1 subunit with RBD of SARS-CoV-2 Alpha variant B.1.1.7 was synthesized, purified and subjected to SPR assay against the purified LVE/STR UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 chimera. Determined binding affinity was 0.378 nM (Acro Biosystems). Note slow “off rate” compared to Panel B below. Panel B: The RBD of Delta variant B.1.617.2 was synthesized, purified and subjected to SPR assay against the purified LiVE/STR chimera. Determined binding affinity was 0.554 nM (Acro Biosystems). See Table I for more complete listing of binding affinities. Figure 7. Paradigm’s ACE-2 variant LVE/STR chimera neutralizes Delta Variant B.1.617.2 RBD or w.t. SARS-CoV-2 RBD (Wuhan strain) with nearly equal potency. Surrogate Viral Neutralization Tests (sVNT, see Methods) were performed with SARS-CoV-2 RBD proteins expressing the Delta Variant B.1.617.2 sequence (T478K and L452R mutants, red bars) or the wild type (w.t., original Wuhan strain) sequence (blue bars) incubated with the ACE-2 LiVE/STR construct. Dilutions shown are 0.05mg/ml to 2.4ng/ml, left to right. Note similar sVNT titers of ~4.9ng/ml. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Figure 8. Paradigm’s ACE-2 variant LVE/STR chimera neutralizes Beta Variant B.1.351 RBD significantly better than w.t. SARS-CoV-2 RBD. sVNT assays were performed with SARS-CoV-2 RBD proteins expressing the Beta Variant B.1.351 sequence (K417N, E484K and N501Y mutants, red bars) or the wild type (w.t., original Wuhan strain) sequence (blue bars) incubated with the ACE-2 LiVE/STR construct. Dilutions shown are 0.05mg/ml to 2.4ng/ml, left to right. Note sVNT titers of ~2.4ng/ml for neutralization of the SARS-2 Beta variant. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Figure 9. Paradigm’s ACE-2 variant LVE/STR chimera neutralizes Alpha Variant B.1.1.7 RBD significantly better than GenScript IgG FL18-740 w.t. ACE-2 mAB. sVNT assays were performed with SARS-CoV-2 RBD proteins expressing the Alpha Variant B.1.1.7 sequence (N501Y mutant) challenged with either Paradigm’s ACE-2 variant LVE/STR chimera (dark blue bars) or with the GenScript IgG FL18-740 w.t. ACE-2 mAB (light blue bars, binding affinity 3nM). Dilutions shown are 0.05mg/ml to 2.4ng/ml, left to right. Note sVNT titers of ~6.3ug/ml for the Genscript mAB for neutralization of the Alpha variant, in contrast to ~4.9ng/ml for neutralization of the Alpha variant by the Paradigm construct LiVE-STR. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Figure 10. Paradigms’ ACE-2 variant LVE/STR chimera binds to SARS-2 Omicron variant B.1.1.529 spike protein trimer with high affinity. Top Panel: Molecular modeling of Paradigms’ ACE-2 variant LVE/STR chimera binding to the Omicron variant sequence as of 1/11/2022. Omicron RBD (red) mutations Y473, F456, L455 and N417 are shown at upper left, and ACE-2 (green) mutations LVE are shown in blue. The ACE-2 H34V makes contact with the aliphatic straight chain of Omicron mutation Q493R and K417N. Note the vertical orientation of N417 in close contact with V34, which enabled higher affinity binding compared to the w.t. K417, which assumed a more horizontal orientation in earlier SARS-2 variants. Molecular modeling performed identically to that in Figures 4 and 5 yields superior DFIRE score of -3.38 (stabilizing). See Discussion for details. Bottom Panel: The S1 subunit trimer of SARS-CoV-Omicron variant described above was synthesized, purified and subjected to SPR assay against the purified LVE/STR chimera. Determined binding affinity was 0.144nM (Acro Biosystems); see Table I for more complete listing of binding affinities. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Figure 11. Paradigm’s ACE-2 variant LVE/STR chimeras potently neutralize the SARS-CoV-2 Omicron Variant B.1.1.529. sVNT assays were performed with purified recombinant SARS-CoV-2 RBD (top panel) or spike protein trimers (bottom panel) expressing the Omicron variant sequences described in Fig.10. The bargraphs show inhibition of the binding of Omicron RBD (top) or Omicron spike protein trimer (bottom) to purified recombinant ACE-2 by either Paradigm’s “LiVE” ACE-2 variant LVE/STR UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 STR Fusion protein chimera or by the “LiVE Longer” LVE/STR STR - YTE IgG chimera. Dilutions shown are 0.05mg/ml to 2.4ng/ml, left to right. Note similar sVNT titers of ~4.9ng/ml for neutralization of Omicron RBD or Omicron spike trimers, and slightly better neutralization by the “LiVE Longer” chimera (green). See Figures 1 and 13 for additional details about the ACE-2/Fusion protein chimeras. Figure 12. Antiviral effects of “LiVE” or “LiVE Longer” fusion proteins against SARS-CoV-2 B.1.1.214 or BA.1 infection of human airway organoid cultures. After one day in culture, organoid cultures (1.0×10 cells/well) were infected with 0.1 MOI SARS-CoV-2 B.1.1.214 (A) or BA.1 (B) and then cultured with the medium containing a serially diluted antibody for 2 days. The viral RNA copy number in the cell culture supernatant was measured by qPCR. Data are represented as means ± SD (n=3). See Methods for details UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Figure 13. Antiviral effects of the “LiVE”, “LiVE Longer” or related chimeric fusion proteins against SARS-CoV-2 Omicron BA.2 or BA.5 infection of human airway organoid cultures. Organoid cultures were exposed to Omicron variants BA.2 (top panels) or BA.5 (bottom panels) as described in Materials rd and Methods and were challenged with the fusion proteins “LiVE” (leftmost pair), “LiVE Longer” (3 nd pair from left), modified LiVE without the STR motif (2 from left) or a modified LiVE LONGER with tyrosine substituted for leucine at position 27 (Y-V-E*, rightmost panels). Note the most potent inhibition of Omicron BA.5 replication by the LiVE (IC50= 29.9 ng/ml) and LiVE LONGER fusion proteins (IC50=26.9 ng/ml). See text for details. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Figure 14. ACE-2 enzymatic activity of the chimeric fusion proteins. Equal amounts of recombinant human ACE-2 (rhACE-2) were subjected to measurements of ACE-2 enzyme activity as described in Materials and Methods, using standard ACE-2 enzyme assay methods based on fluorogenic substrate conversion. Results are the mean +/- S.E.M. of eight replicates per group. Note inhibition of ACE-2 activity by the competitive inhibitor peptide DX600 (at 1uM) and the extremely low to negligible activity in any of the chimeric fusion proteins tested. See text for details. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Figure 15. Paradigm's Fc fusion protein including the STR Fc silencing mutations licensed by MAbsolve is Superior to LALA and other Reduced Fc Effector Function Technologies. A comparison of Fc- silencing technologies shows the relative binding of purified IgG1 (control) versus a variety of Fc- mutant antibody technologies to immobilized human FcγRI (CD64), as determined by Surface Plasmon Resonance (SPR) assay (data courtesy of MAbsolve, https://mabsolve.com/science/#linkone). Note extremely low binding of either the YTE variant used by Paradigm (far right bar) or MAbsolve ’s STR variant. Inset: The binding affinities of the non-YTE LiVE or YTE-variant LiVE-Longer ACE-2/Fusion protein chimeras to purified FcRn receptor (Ladel et al., 2018) were determined by SPR assay (Acro Biosystems). Note high affinity binding of the YTE chimera (27nM) to FcRn. See text for details. UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 Figure 16. Longer half-life of nasally-applied chimeric ACE-2/Fc-silent Fusion protein is due to kinetics of FcRn-Dependent IgG Uptake into Olfactory Mucosa. Nasally- applied IgG is slowly transcytosed thru binding to FcRn receptor expressed in porcine or human olfactory epithelia. In this figure, Ladel et al. (Ladel et al., 2018) used ex vivo porcine olfactory mucosa to show to track the uptake of allogenic IgG UNCORRECTED MANUSCRIPT Downloaded from https://academic.oup.com/abt/advance-article/doi/10.1093/abt/tbad001/6994056 by DeepDyve user on 29 January 2023 (red) into porcine olfactory epithelia. (A) Basal levels of endogenous pIgG (porcine IgG) were detected with a low signal at the apical side, in the basal cell layer, glands, cavernous bodies, and blood vessels. This signal served as a blank and was subtracted from the photos showing the penetration of exogenous pIgG. (B) After 30 min, only the areas close to the apical side show immunoreactivity for pIgG, but some signal was detected in the lamina propria. (C) After 4 h, the pIgGs obviously distributed into the lamina propria. * indicate round structure filled with cells and mostly spared from IgG (D) After 8 h, pIgG were detected throughout the whole lamina propria. Nuclei stained with DAPI; epithelial control: quality control for tissue integrity, stained with HE. Scale bar: 100 µm. On this basis, the YTE variant of Paradigm’s ACE-2 LVE/IgG YTE chimera (which binds longer to FcRn, (see Zhu et al., 2017) is predicted to have 3-4-fold longer biological half-life when administered nasally. Reprinted with publisher’s permission from Ladel et al., Allogenic Fc Domain-Facilitated Uptake of IgG in Nasal Lamina Propria. Pharmaceutics, 10:107, 2018. See text for details. UNCORRECTED MANUSCRIPT
Journal
Antibody Therapeutics – Oxford University Press
Published: Jan 20, 2023
Keywords: lung; ACE-2; coronavirus; therapeutic; fusion protein