Get 20M+ Full-Text Papers For Less Than $1.50/day. Subscribe now for You or Your Team.

Learn More →

Early weaning increases intestinal permeability, alters expression of cytokine and tight junction proteins, and activates mitogen-activated protein kinases in pigs

Early weaning increases intestinal permeability, alters expression of cytokine and tight junction... Abstract Although weaning stress has been reported to impair intestinal barrier function, the mechanisms have not yet been elucidated. In the present study, the intestinal morphology and permeability and mRNA expressions of tight junction proteins and cytokines in the intestine of piglets during the 2 wk after weaning were assessed. The phosphorylated (activated) ratios of p38, c-Jun NH2–terminal kinase (JNK), and extracellular regulated kinases (ERK1/2) were determined to investigate whether mitogen-activated protein kinase (MAPK) signaling pathways are involved in the early weaning process. A shorter villus and deeper crypt were observed on d 3 and 7 postweaning. Although damaged intestinal morphology recovered to preweaning values on d 14 postweaning, the intestinal mucosal barrier, which was reflected by transepithelial electrical resistance (TER) and paracellular flux of dextran (4 kDa) in the Ussing chamber and tight junction protein expression, was not recovered. Compared with the preweaning stage (d 0), jejunal TER and mRNA expressions of occludin and claudin-1 on d 3, 7, and 14 postweaning and Zonula occludens-1 (ZO-1) mRNA on d 3 and 7 postweaning were reduced, and paracellular flux of dextran on d 3, 7, and 14 postweaning was increased. An increase (P < 0.05) of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) mRNA on d 3 and d 7 postweaning and an increase (P < 0.05) of interferon-γ (IFN-γ) mRNA on d 3 postweaning were observed compared with d 0. No significant increase of transforming growth factor β1 (TGF-β1) and interleukin-10 (IL-10) mRNA after weaning was observed. The phosphorylated (activated) ratios of JNK and p38 on d 3 and 7 postweaning and the phosphorylated ratio of ERK1/2 on d 3 postweaning were increased (P < 0.05) compared with d 0. The results indicated that early weaning induced sustained impairment in the intestinal barrier, decreased mRNA expression of tight junction proteins, and upregulated the expression of proinflammatory cytokines, but anti-inflammatory cytokines were not affected in the intestine of piglets. The recovery of the intestinal barrier function was slower than that of the intestinal mucosal morphology. The weaning stress activated MAPK signaling pathways in the intestine, which may be an important mechanism of weaning-associated enteric disorders of piglets. INTRODUCTION Weaning piglets are abruptly forced to combined stressors, such as removal from sow and littermates, transportation to a new environment, fighting and establishment of social hierarchy, and abrupt changes in diet (Moeser et al., 2007). Although weaning stress is reported to impair intestinal barrier function (Moeser et al., 2007; Smith et al., 2010; Wijtten et al., 2011a; Hu et al., 2012), the mechanisms have not yet been elucidated. The intestinal barrier is mainly formed by a layer of epithelial cells joined together by tight junctions (Li et al., 2012). Tight junction proteins form a dynamic seal between epithelial cells, becoming the rate-limiting step in the paracellular pathway and forming the principle physical barrier (Li et al., 2012). It would be of interest to investigate whether the compromised paracellular barrier function after weaning might be attributed to the alterations of tight junctions. However, few data are available regarding the effects of early weaning on tight junction protein expression in piglets. Cytokines have an important physiological and pathological effect on the intestinal tight junction barrier (Al-Sadi et al., 2009). Pro-inflammatory cytokines such as tumor necrosis factor-α (TNF-α), interferon-γ (IFN-γ), IL-6 and anti-inflammatory cytokines like IL-10 and transforming growth factor β (TGF-β) regulate intestinal barrier differently (Al-Sadi et al., 2009). Changes in the intestinal cytokine network may be expected in weaning pigs. Only a few studies have investigated the gene expression of inflammatory cytokines in the intestine of piglets after weaning (Pié et al., 2004). Moreover, few data are available regarding the effect of early weaning on anti-inflammatory cytokines. Mitogen-activated protein kinase (MAPK) pathways, a family of serine-threonine kinases, transduce signals from a diverse array of extracellular stimuli (Pearson et al., 2001; Shifflett et al., 2004). The 3 primary MAPK signaling pathways are the extracellular regulated kinases (ERK1/2), p38 MAPK, and c-Jun NH2–terminal kinase (JNK; Shifflett et al., 2004). Whether early weaning results in MAPK activation remains unknown. It would be of interest to determine the involvement of MAPK signaling pathway in early weaning piglets. In the present study, the intestinal morphology and permeability and mRNA expressions of tight junction proteins and cytokines in the intestine of piglets during the 2 wk after weaning were assessed. The phosphorylated (activated) ratios of p38, JNK, and ERK1/2 were determined to investigate whether MAPK signaling pathways are involved in the early weaning process. MATERIALS AND METHODS All procedures were approved by the Zhejiang University Animal Care and Use Committee. Animals, Housing, and Diet Six litters (Duroc × Landrace × Yorkshire, 9 to 11 piglets per litter) were selected. At 20 d of age (preweaning stage), 1 piglet from each of 6 different litters was killed. At weaning day (21 d of age), 3 piglets from each of 6 different litters were allocated to 1 of the 3 experimental groups killed at 3, 7, and 14 d postweaning. For each group, 6 piglets from 6 different litters were removed from the sow, mixed, and housed in nursery pens. The 3 pens had an equal numbers of males and females, with an average BW of the piglets of 5.7 ± 0.2 kg (mean ± SE). The weaned piglets were given ad libitum access to feed and water. Diet was formulated to meet requirements suggested by the NRC (1998; Table 1). Table 1. Ingredient and chemical composition of the weaned diet on an as-fed basis Item  Value  Ingredients, g/kg      Maize  553.5      Soybean meal, CP 460  165      Extruded full-fat soybean, CP 355  120      Fish meal, CP 628  50      Dried whey, CP 120  60      Spray-dried plasma protein, CP 750  20      Limestone meal  5      Dicalcium phosphate  12      Sodium chloride  3      L-Lysine HCl  1      DL-Methionine  0.5      Vitamin-mineral premix1  10  Analyzed composition, g/kg      DE,2 MJ/kg  14.36      CP  219.2      Lysine  14.8      Methionine  4.0      Calcium  9.1      Total phosphorus  7.2  Item  Value  Ingredients, g/kg      Maize  553.5      Soybean meal, CP 460  165      Extruded full-fat soybean, CP 355  120      Fish meal, CP 628  50      Dried whey, CP 120  60      Spray-dried plasma protein, CP 750  20      Limestone meal  5      Dicalcium phosphate  12      Sodium chloride  3      L-Lysine HCl  1      DL-Methionine  0.5      Vitamin-mineral premix1  10  Analyzed composition, g/kg      DE,2 MJ/kg  14.36      CP  219.2      Lysine  14.8      Methionine  4.0      Calcium  9.1      Total phosphorus  7.2  1Provided per kilogram of diet: vitamin A, 6,000 IU; vitamin E, 50 IU; vitamin D3, 600 IU; vitamin K3, 1.5 mg; biotin, 0.10 mg; riboflavin, 8.0 mg; thiamine, 2.0 mg; niacin, 30 mg; pantothenic acid, 20 mg; pyridoxine, 3.0 mg; folic acid, 0.6 mg; vitamin B12, 0.04 mg; choline, 800 mg; Cu (CuSO4·5H2O), 16 mg; Fe (FeSO4), 125 mg; Zn (ZnSO4), 100 mg; Mn (MnSO4·H2O), 15 mg; Se (Na2SeO3), 0.3 mg; I (KI), 0.2 mg. 2Digestible energy was calculated from data provide by Feed Database in China (2011). View Large Table 1. Ingredient and chemical composition of the weaned diet on an as-fed basis Item  Value  Ingredients, g/kg      Maize  553.5      Soybean meal, CP 460  165      Extruded full-fat soybean, CP 355  120      Fish meal, CP 628  50      Dried whey, CP 120  60      Spray-dried plasma protein, CP 750  20      Limestone meal  5      Dicalcium phosphate  12      Sodium chloride  3      L-Lysine HCl  1      DL-Methionine  0.5      Vitamin-mineral premix1  10  Analyzed composition, g/kg      DE,2 MJ/kg  14.36      CP  219.2      Lysine  14.8      Methionine  4.0      Calcium  9.1      Total phosphorus  7.2  Item  Value  Ingredients, g/kg      Maize  553.5      Soybean meal, CP 460  165      Extruded full-fat soybean, CP 355  120      Fish meal, CP 628  50      Dried whey, CP 120  60      Spray-dried plasma protein, CP 750  20      Limestone meal  5      Dicalcium phosphate  12      Sodium chloride  3      L-Lysine HCl  1      DL-Methionine  0.5      Vitamin-mineral premix1  10  Analyzed composition, g/kg      DE,2 MJ/kg  14.36      CP  219.2      Lysine  14.8      Methionine  4.0      Calcium  9.1      Total phosphorus  7.2  1Provided per kilogram of diet: vitamin A, 6,000 IU; vitamin E, 50 IU; vitamin D3, 600 IU; vitamin K3, 1.5 mg; biotin, 0.10 mg; riboflavin, 8.0 mg; thiamine, 2.0 mg; niacin, 30 mg; pantothenic acid, 20 mg; pyridoxine, 3.0 mg; folic acid, 0.6 mg; vitamin B12, 0.04 mg; choline, 800 mg; Cu (CuSO4·5H2O), 16 mg; Fe (FeSO4), 125 mg; Zn (ZnSO4), 100 mg; Mn (MnSO4·H2O), 15 mg; Se (Na2SeO3), 0.3 mg; I (KI), 0.2 mg. 2Digestible energy was calculated from data provide by Feed Database in China (2011). View Large Sequential Killing and Intestinal Tissue Sampling On the day of preweaning (d 0) and d 3, 7, and 14 postweaning, 6 piglets were killed by euthanasia with an intravenous injection of sodium pentobarbital (40 mg/kg BW). Segments of mid-jejunum were harvested immediately after euthanasia and prepared for Ussing chamber studies. Adjacent specimens were fixed in buffered formalin until morphology measurements. Mucosal scrapings from the remaining jejunum were collected, rapidly frozen in liquid nitrogen, and stored at −80°C. Intestinal Morphological Analyses The specimens of mid-jejunum were embedded in paraffin, sectioned (5 μm), and stained with hematoxylin-eosin. A total of 10 intact, well-oriented crypt-villus units were selected for each intestinal cross section in triplicate. Villus height and crypt depth were determined using an image processing and analysis system (Version 1, Leica Imaging Systems Ltd., Cambridge, UK). Ex vivo Ussing Chamber to Measure Intestinal Permeability The intestinal epithelial tight junction permeability was measured by transepithelial electrical resistance (TER; Ω·cm2) and paracellular flux of fluorescein isothiocyanate (FITC) dextran 4 kDa (FD4) in Ussing chambers. The Ussing chamber procedures were performed as described previously (Hamard et al., 2010; Overman et al., 2012). Briefly, segments of jejunum were stripped from the seromuscular layer in oxygenated (95% O2/5% CO2) Ringer's solution and then mounted in an EasyMount Ussing chamber system (model VCC MC6, Physiologic Instruments, San Diego, CA). The clamps were connected to Acquire and Analyze software (Physiologic Instruments) for automatic data collection. After a 30-min equilibration period on Ussing chambers, TER was recorded at 15-min intervals over a 2-h period. The probe FD4 (Sigma-Aldrich, St. Louis, MO) was added to the mucosal side at the final concentration of 0.375 mg/mL. Mucosal-to-serosal flux of FD4 (ng·cm−2·h−1) was performed by sampling 100 μL of solution from the serosal side at 30-min intervals over a 2-h period and replaced with 100 μL of fresh Ringer's solution to keep the volume constant. The concentrations of FD4 in the serosal side were measured by fluorescence microplate reader (FLx800, Bio-Tek Instruments Inc., Winooski, VT). mRNA Expression of Cytokines and Tight Junction Proteins from Jejunal Mucosa by Real-Time PCR The mRNA expression of cytokines (TNF-α, IL-6, IFN-γ, TGF-β1, and IL-10) and tight junction proteins (occludin, claudin-1, and ZO-1) from jejunal mucosa was determined by quantitative real-time PCR (qRT-PCR) as described by Liu et al. (2008). Briefly, total RNA was isolated using the TRIzol Reagent (Invitrogen, Carlsbad, CA) and treated with RNase-free DNase I before cDNA synthesis following the manufacturer's guidelines. The GenBank accession numbers, sequences of forward and reverse primers, and fragment sizes are presented in Table 2. The qRT-PCR was performed on a StepOne Plus real-time PCR system (Applied Biosystems, Foster City, CA) using a SYBR Green Master mix (Promega, Madison, WI) according to the kit's instructions. The housekeeping gene, Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), exhibited no variation across treatment groups. The preweaning (d 0 postweaning) pigs were used as the reference sample. The comparative cycle threshold (Ct) method (2-ΔΔCt; Livak and Schmittgen, 2001) was used to analyze the relative expression was used to analyze the relative expression (fold changes), calculated relative to the values from the preweaning (d 0 postweaning) pigs. Table 2. GenBank accession numbers, sequences of forward and reverse primers, and fragment sizes used for real-time PCR Target  GeneBank number  Primer sequence  Size, bp  Tumor necrosis factor-α  NM_214022.1  F:5′CATCGCCGTCTCCTACCA3′  199  R:5′CCCAGATTCAGCAAAGTCCA3′  IL-6  NM_001252429.1  F:5′CCTGTCCACTGGGCACATAAC3′  253  R:5′CAAGAAACACCTGGCTCTGAAAC3′  Interferon-γ  NM_213948.1  F:5′GAGCCAAATTGTCTCCTTCTAC3′  140  R:5′CGAAGTCATTCAGTTTCCCAG3′  Transforming growth factor β1  NM_214015.1  F:5′GGACCTTATCCTGAATGCCTT3′  133  R:5′TAGGTTACCACTGAGCCACAAT3′  IL-10  NM_214041.1  F:5′GAAGGACCAGATGGGCGACTT3′  256  R:5′CACCTCCTCCACGGCCCTTG3′  Occludin  NM_001163647.1  F:5′ TCCTGGGTGTGATGGTGTTC3′  145  R:5′ CGTAGAGTCCAGTCACCGCA3′  Claudin-1  NM_001244539.1  F:5′ AGAAGATGCGGATGGCTGTC3′  193  R:5′ CCCAGAAGGCAGAGAGAAGC3′  Zonula occludens-1  XM_003353439.2  F:5′AAGCCCTAAGTTCAATCACAATCT3′  130  R:5′ ATCAAACTCAGGAGGCGGC3′  Glyceraldehyde-3-phosphate dehydrogenase  NM_001206359.1  F:5′ATGGTGAAGGTCGGAGTGAAC3′  235  R:5′CTCGCTCCTGGAAGATGGT3′  Target  GeneBank number  Primer sequence  Size, bp  Tumor necrosis factor-α  NM_214022.1  F:5′CATCGCCGTCTCCTACCA3′  199  R:5′CCCAGATTCAGCAAAGTCCA3′  IL-6  NM_001252429.1  F:5′CCTGTCCACTGGGCACATAAC3′  253  R:5′CAAGAAACACCTGGCTCTGAAAC3′  Interferon-γ  NM_213948.1  F:5′GAGCCAAATTGTCTCCTTCTAC3′  140  R:5′CGAAGTCATTCAGTTTCCCAG3′  Transforming growth factor β1  NM_214015.1  F:5′GGACCTTATCCTGAATGCCTT3′  133  R:5′TAGGTTACCACTGAGCCACAAT3′  IL-10  NM_214041.1  F:5′GAAGGACCAGATGGGCGACTT3′  256  R:5′CACCTCCTCCACGGCCCTTG3′  Occludin  NM_001163647.1  F:5′ TCCTGGGTGTGATGGTGTTC3′  145  R:5′ CGTAGAGTCCAGTCACCGCA3′  Claudin-1  NM_001244539.1  F:5′ AGAAGATGCGGATGGCTGTC3′  193  R:5′ CCCAGAAGGCAGAGAGAAGC3′  Zonula occludens-1  XM_003353439.2  F:5′AAGCCCTAAGTTCAATCACAATCT3′  130  R:5′ ATCAAACTCAGGAGGCGGC3′  Glyceraldehyde-3-phosphate dehydrogenase  NM_001206359.1  F:5′ATGGTGAAGGTCGGAGTGAAC3′  235  R:5′CTCGCTCCTGGAAGATGGT3′  View Large Table 2. GenBank accession numbers, sequences of forward and reverse primers, and fragment sizes used for real-time PCR Target  GeneBank number  Primer sequence  Size, bp  Tumor necrosis factor-α  NM_214022.1  F:5′CATCGCCGTCTCCTACCA3′  199  R:5′CCCAGATTCAGCAAAGTCCA3′  IL-6  NM_001252429.1  F:5′CCTGTCCACTGGGCACATAAC3′  253  R:5′CAAGAAACACCTGGCTCTGAAAC3′  Interferon-γ  NM_213948.1  F:5′GAGCCAAATTGTCTCCTTCTAC3′  140  R:5′CGAAGTCATTCAGTTTCCCAG3′  Transforming growth factor β1  NM_214015.1  F:5′GGACCTTATCCTGAATGCCTT3′  133  R:5′TAGGTTACCACTGAGCCACAAT3′  IL-10  NM_214041.1  F:5′GAAGGACCAGATGGGCGACTT3′  256  R:5′CACCTCCTCCACGGCCCTTG3′  Occludin  NM_001163647.1  F:5′ TCCTGGGTGTGATGGTGTTC3′  145  R:5′ CGTAGAGTCCAGTCACCGCA3′  Claudin-1  NM_001244539.1  F:5′ AGAAGATGCGGATGGCTGTC3′  193  R:5′ CCCAGAAGGCAGAGAGAAGC3′  Zonula occludens-1  XM_003353439.2  F:5′AAGCCCTAAGTTCAATCACAATCT3′  130  R:5′ ATCAAACTCAGGAGGCGGC3′  Glyceraldehyde-3-phosphate dehydrogenase  NM_001206359.1  F:5′ATGGTGAAGGTCGGAGTGAAC3′  235  R:5′CTCGCTCCTGGAAGATGGT3′  Target  GeneBank number  Primer sequence  Size, bp  Tumor necrosis factor-α  NM_214022.1  F:5′CATCGCCGTCTCCTACCA3′  199  R:5′CCCAGATTCAGCAAAGTCCA3′  IL-6  NM_001252429.1  F:5′CCTGTCCACTGGGCACATAAC3′  253  R:5′CAAGAAACACCTGGCTCTGAAAC3′  Interferon-γ  NM_213948.1  F:5′GAGCCAAATTGTCTCCTTCTAC3′  140  R:5′CGAAGTCATTCAGTTTCCCAG3′  Transforming growth factor β1  NM_214015.1  F:5′GGACCTTATCCTGAATGCCTT3′  133  R:5′TAGGTTACCACTGAGCCACAAT3′  IL-10  NM_214041.1  F:5′GAAGGACCAGATGGGCGACTT3′  256  R:5′CACCTCCTCCACGGCCCTTG3′  Occludin  NM_001163647.1  F:5′ TCCTGGGTGTGATGGTGTTC3′  145  R:5′ CGTAGAGTCCAGTCACCGCA3′  Claudin-1  NM_001244539.1  F:5′ AGAAGATGCGGATGGCTGTC3′  193  R:5′ CCCAGAAGGCAGAGAGAAGC3′  Zonula occludens-1  XM_003353439.2  F:5′AAGCCCTAAGTTCAATCACAATCT3′  130  R:5′ ATCAAACTCAGGAGGCGGC3′  Glyceraldehyde-3-phosphate dehydrogenase  NM_001206359.1  F:5′ATGGTGAAGGTCGGAGTGAAC3′  235  R:5′CTCGCTCCTGGAAGATGGT3′  View Large Western Blot Analysis The total abundance of each of the 3 primary MAPK (JNK, p38, ERK1/2) and their phosphorylated (p; activated) forms of MAPK (p-JNK, p-p38, p-ERK1/2) in jejunal mucosa were analyzed by Western blot as previously described (Shifflett et al., 2004). Briefly, after electrophoresis the proteins were transferred to polyvinylidene difluoride membrane (Millipore, Bedford, MA). These primary antibodies were used (Cell Signaling Technology, Inc., Danvers, MA): MAPK antibodies, rabbit IgG; phospho-p38 (Thr180/Tyr182 phosphorylation), rabbit IgG; phospho-ERK 1/2 (Thr202/Tyr204 phosphorylation), rabbit IgG; and phospho-JNK (Thr183/Tyr185 phosphorylation), rabbit IgG. The secondary antibody was horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (Santa Cruz Biotechnology, Santa Cruz, CA). An enhanced chemiluminescence detection kit (Amersham, Arlington Heights, IL) was used to detect the positive bands. The values were calculated as the ratios of their phosphorylation levels (p-JNK, p-p38, p-ERK) and the total abundance of MAPK. The values in samples from the preweaning (d 0 postweaning) pigs were used as the reference sample. The protein expression of all samples was expressed as fold changes, calculated relative to the values from the preweaning (d 0 postweaning) pigs. Statistical Analysis Results were expressed as the means ± SEM. Data were subjected to 1-way ANOVA followed by Duncan's multiple range tests. Differences were considered statistically significant at P < 0.05. Statistical analyses were performed with the SAS software package (SAS Inst. Inc., Cary, NC). RESULTS Intestinal Morphology and Barrier Function in Porcine Jejunum after Weaning Table 3 shows jejunal morphology and barrier function of piglets at different time points (0, 3, 7, and 14 d postweaning). Compared with the preweaning stage (d 0 postweaning), villus height and the ratio of villus height and crypt depth on d 3 and 7 postweaning were decreased (P < 0.05). However, these variables had no significant effect (P > 0.05) between on d 0 and 14 postweaning. The intestinal barrier function of piglets was reflected by TER and paracellular flux of FD4 measured in Ussing chambers. A significant decrease in jejunal TER and an increase in mucosal-to-serosal flux of paracellular FD4 were observed on d 3, 7, and 14 postweaning, compared with the d 0 values. Although villus height and crypt depth returned to preweaning values on d 14 postweaning, intestinal mucosal barrier was not recovered, indicating the recovery of mucosal barrier is slower than that of morphology. Table 3. Intestinal architecture and barrier function in porcine jejunum after weaning   Day postweaning    Item  0  3  7  14  SEM  Villus height, μm  765a  452b  468b  731a  24.6  Crypt depth, μm  274b  316a  320a  285b  11.2  Villus height:crypt depth  2.8a  1.4b  1.5b  2.6a  0.11  TER,1 Ω·cm2  65.8a  51.4b  48.7b  53.5b  2.95  FD4 flux,2 μg·cm−2·h−1  1.2c  1.7b  2.3a  2.0ab  0.12    Day postweaning    Item  0  3  7  14  SEM  Villus height, μm  765a  452b  468b  731a  24.6  Crypt depth, μm  274b  316a  320a  285b  11.2  Villus height:crypt depth  2.8a  1.4b  1.5b  2.6a  0.11  TER,1 Ω·cm2  65.8a  51.4b  48.7b  53.5b  2.95  FD4 flux,2 μg·cm−2·h−1  1.2c  1.7b  2.3a  2.0ab  0.12  a–cMeans within a row with different letters differ significantly (P < 0.05). Data are means of 6 pigs. 1TER = Transepithelial electrical resistance. 2FD4 = Fluorescein isothiocyanate dextran (4 kDa). View Large Table 3. Intestinal architecture and barrier function in porcine jejunum after weaning   Day postweaning    Item  0  3  7  14  SEM  Villus height, μm  765a  452b  468b  731a  24.6  Crypt depth, μm  274b  316a  320a  285b  11.2  Villus height:crypt depth  2.8a  1.4b  1.5b  2.6a  0.11  TER,1 Ω·cm2  65.8a  51.4b  48.7b  53.5b  2.95  FD4 flux,2 μg·cm−2·h−1  1.2c  1.7b  2.3a  2.0ab  0.12    Day postweaning    Item  0  3  7  14  SEM  Villus height, μm  765a  452b  468b  731a  24.6  Crypt depth, μm  274b  316a  320a  285b  11.2  Villus height:crypt depth  2.8a  1.4b  1.5b  2.6a  0.11  TER,1 Ω·cm2  65.8a  51.4b  48.7b  53.5b  2.95  FD4 flux,2 μg·cm−2·h−1  1.2c  1.7b  2.3a  2.0ab  0.12  a–cMeans within a row with different letters differ significantly (P < 0.05). Data are means of 6 pigs. 1TER = Transepithelial electrical resistance. 2FD4 = Fluorescein isothiocyanate dextran (4 kDa). View Large Tight Junction Protein Expression Table 4 shows mRNA expression of occludin, claudin-1, and ZO-1 in jejunal mucosa during the 2 wk after weaning. Compared with the preweaning stage (d 0 postweaning), mRNA expression of occludin and claudin-1 on d 3, 7, and 14 postweaning and ZO-1 mRNA on d 3 and 7 postweaning was decreased (P < 0.05). Table 4. Tight junction protein mRNA expressions in jejunal mucosa of piglets after weaning1   Day postweaning    Item  0  3  7  14  SEM  Occludin  1.00a  0.53b  0.41b  0.57b  0.12  Claudin-1  1.00a  0.64b  0.53b  0.61b  0.09  Zonula occludens-1  1.00a  0.62b  0.72b  0.79ab  0.11    Day postweaning    Item  0  3  7  14  SEM  Occludin  1.00a  0.53b  0.41b  0.57b  0.12  Claudin-1  1.00a  0.64b  0.53b  0.61b  0.09  Zonula occludens-1  1.00a  0.62b  0.72b  0.79ab  0.11  a–cMeans within a row with different letters differ significantly (P < 0.05). 1The comparative cycle threshold method was used to analyze the relative expression (fold changes), calculated relative to the values in samples from the preweaning (d 0 postweaning) pigs. Data are means of 6 pigs. View Large Table 4. Tight junction protein mRNA expressions in jejunal mucosa of piglets after weaning1   Day postweaning    Item  0  3  7  14  SEM  Occludin  1.00a  0.53b  0.41b  0.57b  0.12  Claudin-1  1.00a  0.64b  0.53b  0.61b  0.09  Zonula occludens-1  1.00a  0.62b  0.72b  0.79ab  0.11    Day postweaning    Item  0  3  7  14  SEM  Occludin  1.00a  0.53b  0.41b  0.57b  0.12  Claudin-1  1.00a  0.64b  0.53b  0.61b  0.09  Zonula occludens-1  1.00a  0.62b  0.72b  0.79ab  0.11  a–cMeans within a row with different letters differ significantly (P < 0.05). 1The comparative cycle threshold method was used to analyze the relative expression (fold changes), calculated relative to the values in samples from the preweaning (d 0 postweaning) pigs. Data are means of 6 pigs. View Large Proinflammatory Cytokine mRNA Table 5 shows cytokine mRNA abundance in jejunal mucosa of piglets during the 2 wk after weaning. For TNF-α and IL-6 mRNA, an increase (P < 0.05) was observed on d 3 and 7 postweaning compared with d 0. An increase (P < 0.05) of IFN-γ mRNA was found on d 3 postweaning compared with d 0. The mRNA expressions of TNF-α and IL-6 on d 14 postweaning and the mRNA expression of IFN-γ on d 7 and 14 postweaning returned to preweaning values. By contrast, no significant increase of TGF-β1 and IL-10 mRNA during the 2 wk after weaning was observed (P > 0.05). Table 5. Cytokine mRNA expressions in jejunal mucosa of piglets after weaning1   Day postweaning    Item  0  3  7  14  SEM  Tumor necrosis factor-α  1.00c  4.48a  2.97ab  1.38bc  0.56  Interferon-γ  1.00b  3.04a  1.94ab  1.06b  0.51  IL-6  1.00b  3.85a  3.08a  1.31b  0.45  Transforming growth factor β1  1.00  1.32  1.40  1.25  0.17  IL-10  1.00  1.48  1.51  1.42  0.20    Day postweaning    Item  0  3  7  14  SEM  Tumor necrosis factor-α  1.00c  4.48a  2.97ab  1.38bc  0.56  Interferon-γ  1.00b  3.04a  1.94ab  1.06b  0.51  IL-6  1.00b  3.85a  3.08a  1.31b  0.45  Transforming growth factor β1  1.00  1.32  1.40  1.25  0.17  IL-10  1.00  1.48  1.51  1.42  0.20  a–cMeans within a row with different letters differ significantly (P < 0.05). 1The comparative cycle threshold method was used to analyze the relative expression (fold changes), calculated relative to the values in samples from the preweaning (d 0 postweaning) pigs. Data are means of 6 pigs. View Large Table 5. Cytokine mRNA expressions in jejunal mucosa of piglets after weaning1   Day postweaning    Item  0  3  7  14  SEM  Tumor necrosis factor-α  1.00c  4.48a  2.97ab  1.38bc  0.56  Interferon-γ  1.00b  3.04a  1.94ab  1.06b  0.51  IL-6  1.00b  3.85a  3.08a  1.31b  0.45  Transforming growth factor β1  1.00  1.32  1.40  1.25  0.17  IL-10  1.00  1.48  1.51  1.42  0.20    Day postweaning    Item  0  3  7  14  SEM  Tumor necrosis factor-α  1.00c  4.48a  2.97ab  1.38bc  0.56  Interferon-γ  1.00b  3.04a  1.94ab  1.06b  0.51  IL-6  1.00b  3.85a  3.08a  1.31b  0.45  Transforming growth factor β1  1.00  1.32  1.40  1.25  0.17  IL-10  1.00  1.48  1.51  1.42  0.20  a–cMeans within a row with different letters differ significantly (P < 0.05). 1The comparative cycle threshold method was used to analyze the relative expression (fold changes), calculated relative to the values in samples from the preweaning (d 0 postweaning) pigs. Data are means of 6 pigs. View Large Mitogen-Activated Protein Kinase Signal Pathways Table 6 shows the effects of early weaning stress on the 3 MAPK signaling pathways (JNK, p38, ERK). Jejunal mucosa was analyzed by Western blot for the total content of each of the 3 primary MAPK and their phosphorylated (activated) forms of MAPK (p-JNK, p-p38, p-ERK). The total protein for each of the MAPK was unchanged during the 2 wk after weaning. However, compared with the preweaning stage (d 0 postweaning), the ratios of the phosphorylated forms and the total levels of JNK and p38 (p-JNK/JNK and p-p38/p38) on d 3 and 7 postweaning were increased (P < 0.05). The ratio of the phosphorylated forms and the total ERK (p-ERK/ERK) on d 3 postweaning was greater (P < 0.05) than that on d 0, then returned to preweaning values on d 7 and 14 postweaning. Table 6. Effects of early weaning stress on mitogen-activated protein kinase (MAPK) signal pathways in jejunal mucosa of piglets   Day postweaning    Item1  0  3  7  14  SEM  p-JNK/JNK  1.00b  2.32a  2.64a  1.51b  0.25  p-p38/p38  1.00b  3.26a  2.88a  1.74b  0.31  p-ERK/ERK  1.00b  1.74a  1.28ab  1.36ab  0.19    Day postweaning    Item1  0  3  7  14  SEM  p-JNK/JNK  1.00b  2.32a  2.64a  1.51b  0.25  p-p38/p38  1.00b  3.26a  2.88a  1.74b  0.31  p-ERK/ERK  1.00b  1.74a  1.28ab  1.36ab  0.19  a–cMeans within a row with different letters differ significantly (P < 0.05). 1The 3 mitogen-activated protein kinase (MAPK) signaling pathways are the c-Jun NH2–terminal kinase (JNK), p38 MAPK, and extracellular regulated kinases (ERK1/2). The values were calculated as the ratios of their phosphorylation levels (p-JNK, p-p38, p-ERK) and the total levels of MAPK. The values in samples from the preweaning (d 0 postweaning) pigs were used as the reference sample. The protein expression of all samples was expressed as fold changes, calculated relative to the values from the preweaning (d 0 postweaning) pigs. View Large Table 6. Effects of early weaning stress on mitogen-activated protein kinase (MAPK) signal pathways in jejunal mucosa of piglets   Day postweaning    Item1  0  3  7  14  SEM  p-JNK/JNK  1.00b  2.32a  2.64a  1.51b  0.25  p-p38/p38  1.00b  3.26a  2.88a  1.74b  0.31  p-ERK/ERK  1.00b  1.74a  1.28ab  1.36ab  0.19    Day postweaning    Item1  0  3  7  14  SEM  p-JNK/JNK  1.00b  2.32a  2.64a  1.51b  0.25  p-p38/p38  1.00b  3.26a  2.88a  1.74b  0.31  p-ERK/ERK  1.00b  1.74a  1.28ab  1.36ab  0.19  a–cMeans within a row with different letters differ significantly (P < 0.05). 1The 3 mitogen-activated protein kinase (MAPK) signaling pathways are the c-Jun NH2–terminal kinase (JNK), p38 MAPK, and extracellular regulated kinases (ERK1/2). The values were calculated as the ratios of their phosphorylation levels (p-JNK, p-p38, p-ERK) and the total levels of MAPK. The values in samples from the preweaning (d 0 postweaning) pigs were used as the reference sample. The protein expression of all samples was expressed as fold changes, calculated relative to the values from the preweaning (d 0 postweaning) pigs. View Large DISCUSSION In agreement with earlier reports (Tang et al., 1999; Boudry et al., 2004; Montagne et al., 2007), the present study showed that villus height and the ratio of villus height and crypt depth on d 3 and 7 postweaning were decreased compared with the preweaning stage. The shorter villus and deeper crypt verified the deterioration of intestinal morphology induced by weaning. Additionally, the present study showed that villus height and crypt depth returned to the preweaning value on d 14 postweaning. In contrast to this finding, Boudry et al. (2004) reported that villous height in the jejunum was still significantly lower on d 15 postweaning than d 0. In the present experiment, the Ussing chamber technique was used to monitor intestinal permeability in terms of TER and flux of FD4. Transepithelial electrical resistance is considered to reflect the opening of the tight junctions between epithelial cells and the paracellular permeability of the intestinal mucosa (Wijtten et al., 2011a). A decreased TER reflects increased paracellular permeability. Marker probe FD4 is added to the solution in the Ussing chamber at the mucosal site. The appearance of this marker probe in the chamber at the serosal site represents its permeability across the epithelium (Wijtten et al., 2011a). The flux of intact FD4 across the intestinal epithelium occurs mainly through paracellular pathways (Hamard et al., 2010; Overman et al., 2012). An increased flux of FD4 reflects increased paracellular permeability and impaired intestinal barrier. A significant decrease in jejunal TER and an increase in mucosal-to-serosal flux of paracellular FD4 on d 3, 7, and 14 postweaning compared with d 0 were observed in the present study. Similarly, using [3H]mannitol and [14C]inulin as marker probes, Moeser et al. (2007) and Smith et al. (2010) reported that the flux of mannitol and inulin over the jejunum was significantly increased and TER was significantly decreased when pigs were weaned at 15 to 21 d of age. However, Montagne et al. (2007) used HRP as a marker probe and found that the HRP flux across the jejunum epithelium declined on d 2 postweaning and stayed at this low level until d 15 postweaning. Wijtten et al. (2011b) used the recovery in urine of orally administered lactulose to assess intestinal permeability and found that lactulose recovery in the urine was greater at d 4, 8, and 12 after weaning compared with the first day after weaning, whereas the HRP flux was not affected over time. Although villus height and crypt depth returned to preweaning values on d 14 postweaning, intestinal mucosal barrier did not recover, indicating the recovery of intestinal barrier function is slower than that of intestinal mucosal morphology. Similarly, Chang et al. (2005) investigated the functional and morphological changes of the gut barrier of rats during the restitution process after hemorrhagic shock and found that the restitution of gut barrier function was obviously slower than that of the morphology and there was no direct correlation between them. Early life stress is a predisposing factor for the development of chronic intestinal disorders in adult life (Smith et al., 2010). Epidemiological studies have demonstrated that early life psychological stress is associated with the development of chronic, persistent intestinal disorders in adult life (O'Mahony et al., 2009). Neonatal maternal separation in rodents can induce long-term defects in the intestinal epithelial barrier associated with an exaggerated immune response to an external immune stimulus (Gareau et al., 2007). Smith et al. (2010) demonstrated that early weaning (15- to 21-d weaning age) resulted in sustained impairment in intestinal barrier function at 5 and 9 wk of age. In contrast, Lodemann et al. (2008) reported that the mannitol flux across the mid-jejunum on 7 d postweaning was significantly less than the preweaning value, and TER was not different from preweaning. Wijtten et al. (2011a) indicated that the impairment of the paracellular barrier function of piglets is almost exclusively observed in the first week after weaning and returns to the preweaning level at 2 wk after weaning. These discrepancies might be related to the difference in the weaning process and handling of the pigs. The intestinal barrier is composed of a layer of columnar epithelium and interepithelial tight junctions. Tight junction proteins, such as claudins, occludins and zonula occludens, form the tight junction at the boundary of 2 adjacent cells, working as a rate-limiting step in the paracellular pathway and forming a selectively permeable barrier (Li et al., 2012). To better clarify the molecular mechanism for the impaired mucosal barrier function in weaning piglets, we determined the changes in the mRNA expression of occludin, ZO-1, and claudin-1 after weaning for the first time. The results showed that mRNA expression of occludin and claudin-1 on d 3, 7, and 14 postweaning and ZO-1 mRNA on d 3 and 7 postweaning was decreased compared with d 0. The results indicated that the decreased tight junction protein in early weaned pigs coincided with the increased intestinal epithelial paracellular permeability. Cytokines play an important role in the immune and inflammatory responses. They also participate in the regulation of the intestinal barrier integrity (Al-Sadi et al., 2009). Most proinflammatory cytokines, such as TNF-α, IFN-γ, and IL-6, increase intestinal epithelial permeability (Youakim and Ahdieh, 1999; Al-Sadi and Thomas, 2007). On the other hand, anti-inflammatory cytokines, like IL-10 and TGF-β, attenuate or protect against intestinal inflammation by preserving the barrier function (Madsen et al., 1997; Howe et al., 2005). Many studies reported that enteric infection and intestinal inflammatory diseases were associated with the alternations in the expression of proinflammatory cytokines in the intestine of humans and animals (Murtaugh et al., 1996; McClane and Rombeau, 1999). However, only a few studies investigated the expression of cytokines in the intestine of piglets after weaning. The present study analyzed the gene expressions of proinflammatory and anti-inflammatory cytokines in the intestine of 21-d-old weaned piglets during the 2 wk after weaning. The results showed that mRNA expression of TNF-α and IL-6 was increased on d 3 and 7 postweaning compared with d 0 and returned to preweaning values on d 14 postweaning, and IFN-γ mRNA was increased on d 3 postweaning compared with d 0 and returned to preweaning values on d 7 and 14 postweaning. This study also demonstrated for the first time that no significant alternations of anti-inflammatory cytokines (TGF-β1 and IL-10) mRNA were observed during the 2 wk after weaning. In findings similar to ours, Pié et al. (2004) reported that weaning stress upregulated expression of proinflammatory cytokines in the intestine of 28-d-old weaned piglets. However, there are discrepancies between the 2 studies. Pié et al. (2004) reported that the mRNA expressions of proinflammatory cytokines (TNF-γ, IL-6, and IL-1β) increased between d 0 and 2 and rapidly returned to preweaning values between d 2 and 8. However, the present results showed that mRNA expression of TNF-α and IL-6 was still increased on d 7 postweaning compared with d 0. The discrepancies might be related to the difference in the weaning age (weaned at the age of 21 and 28 d, respectively). Overproduction of proinflammatory cytokines has a negative influence on gut integrity and epithelial function (Liu et al., 2008). The tight junction barrier disruptive actions of TNF-α and IFN-γ have been well established (Madara and Stafford, 1989; Youakim and Ahdieh, 1999; Ma et al., 2005). It has been reported that IFN-γ-induced reductions in epithelial barrier function are linked to decreases in the expression of tight junction proteins such as occludin and ZO-1 (Blikslager et al., 2007). The cytokine INF-γ can act synergistically with TNF-α to induce impairment in tight junctions (Al-Sadi et al., 2009). Conversely, TGF-β and IL-10 are anti-inflammatory cytokines and can attenuate the defects in tight junction permeability (Madsen et al., 1997; Howe et al., 2005). Reported actions of TGF-β on the repair of the epithelium after injury include enhanced epithelial cell migration, upregulated expression of extracellular matrix proteins and cell surface integrin, and decreases in epithelial paracellular permeability (Blikslager et al., 2007). Exogenous IL-10 administration in total parenteral nutrition (TPN) mice attenuated the TPN-induced reductions in expression of occludin and ZO-1 and a loss of intestinal barrier function (Sun et al., 2008). The present study showed that early weaning upregulated the expression of proinflammatory cytokines in the intestine of piglets but had no effect on the expression of anti-inflammatory cytokines, which coincided with the decreased expression of tight junction protein and increased intestinal epithelial paracellular permeability. From the nutritional perspective, controlling the early intestinal inflammation and facilitating the restoration of the injured intestinal mucosa may have potential benefits in alleviating intestinal barrier impairment induced by weaning stress. The MAPK signaling pathways transduce signals from a diverse array of extracellular stimuli and form a highly integrated network to regulate cellular functions, such as differentiation, proliferation, and cell death (Pearson et al., 2001; Shifflett et al., 2004). The 3 primary MAPK signaling pathways are the ERK1/2, p38 and JNK. The MAPK signaling cascades are viewed as parallel pathways, although cross talk may exist (Xiao et al., 2002; Shifflett et al., 2004). Upon phosphorylation and subsequent activation of an MAPK, the MAPK can enter the cell nucleus and activate transcription factors, which ultimately results in expression of target genes and a biological response (Shifflett et al., 2004). To determine whether early weaning influences MAPK signaling pathways, we measured the total levels of each of the 3 primary MAPK (JNK, p38, ERK) and their phosphorylated forms (p-JNK, p-p38, p-ERK). We demonstrated for the first time that the ratios of p-p38/p38 and p-JNK/JNK on d 3 and 7 postweaning and the ratio of p-ERK/ERK on d 3 postweaning were increased compared with d 0, indicating early weaning stress in pigs induced activation of MAPK signaling pathways. Patrick et al. (2006) suggest that downstream effectors of MAPK signaling pathways mediate the TNFα/IFNγ-induced junctional reorganization that modulates Madin-Darby canine kidney cell barrier function. Our hypothesis is that the weaning stress activates MAPK signaling pathways in the intestine, resulting in intestinal dysfunction, which may be an important mechanism of weaning-associated enteric disorders of piglets. However, the exact role of this signaling pathway remains to be elucidated. In a follow-up study, the specific inhibitors of MAPK may be used to investigate whether inhibition of MAPK can block the weaning-induced damage of the intestinal epithelial barrier. In summary, the shorter villus and deeper crypt verified the deterioration of intestinal morphology induced by early weaning. Weaning resulted in sustained impairment in the intestinal barrier on d 3, 7, and 14 postweaning. Although villus height and crypt depth returned to preweaning values on d 14 postweaning, intestinal mucosal barrier was not recovered, indicating the recovery of the intestinal barrier function is slower than that of intestinal mucosal morphology. The decreased mRNA expression of tight junction proteins after weaning coincided with the increased intestinal epithelial paracellular permeability. The expression of proinflammatory cytokines in the intestine of piglets was transiently upregulated by weaning, but expression of anti-inflammatory cytokines was not affected. The weaning stress activates MAPK signaling pathways in the intestine, which may be an important mechanism of weaning-associated enteric disorders of piglets. LITERATURE CITED Al-Sadi R. Boivin M. Ma T. 2009. Mechanism of cytokine modulation of epithelial tight junction barrier. Front. Biosci.  14: 2765– 2778. Google Scholar CrossRef Search ADS   Al-Sadi R. M. Thomas Y. M. 2007. IL-1β causes an increase in intestinal epithelial tight junction permeability. J. Immunol.  178: 4641– 4649. Google Scholar CrossRef Search ADS PubMed  Blikslager A. T. Moeser A. J. Gookin J. L. Jones S. L. Odle J. 2007. Restoration of barrier function in injured intestinal mucosa. Physiol. Rev.  87: 545– 564. Google Scholar CrossRef Search ADS PubMed  Boudry G. Péron V. Le Huërou-Luron I. Lallès J. P. Sève B. 2004. Weaning induces both transient and long-lasting modifications of absorptive, secretory, and barrier properties of piglet intestine. J. Nutr.  134: 2256– 2262. Google Scholar CrossRef Search ADS PubMed  Chang J. X. Chen S. Ma L. P. Jiang L. Y. Chen J. W. Chang R. M. Wen L. Q. Wu W. Jiang Z. P. Huang Z. T. 2005. Functional and morphological changes of the gut barrier during the restitution process after hemorrhagic shock. World J. Gastroenterol.  11: 5485– 5491. Google Scholar CrossRef Search ADS PubMed  Feed Database in China. 2011. Table of feed composition and nutritive value in China.  22th ed. China Feed, Beijing, China. Gareau M. G. Jury J. Perdue M. H. 2007. Neonatal maternal separation of rat pups results in abnormal cholinergic regulation of epithelial permeability. Am. J. Physiol. Gastrointest. Liver Physiol.  293: G198– G203. Google Scholar CrossRef Search ADS PubMed  Hamard A. Mazurais D. Boudry G. Le Huërou-Luron I. Sèvea B. Le Floc'ha N. 2010. A moderate threonine deficiency affects gene expression profile, paracellular permeability and glucose absorption capacity in the ileum of piglets. J. Nutr. Biochem  21: 914– 921. Google Scholar CrossRef Search ADS PubMed  Howe K. L. Reardon C. Wang A. Nazli A. McKay D. M. 2005. Transforming growth factor-beta regulation of epithelial tight junction proteins enhances barrier function and blocks enterohemorrhagic Escherichia coli O157:H7-induced increased permeability. Am. J. Pathol.  167: 1587– 1597. Google Scholar CrossRef Search ADS PubMed  Hu C. H. Gu L. Y. Luan Z. S. Song J. Zhu K. 2012. Effects of montmorillonite–zinc oxide hybrid on performance, diarrhea, intestinal permeability and morphology of weanling pigs. Anim. Feed Sci. Technol.  177: 108– 115. Google Scholar CrossRef Search ADS   Li X. Akhtar S. Choudhry M. A. 2012. Alteration in intestine tight junction protein phosphorylation and apoptosis is associated with increase in IL-18 levels following alcohol intoxication and burn injury. Biochim. Biophys. Acta.  1822: 196– 203. Google Scholar CrossRef Search ADS PubMed  Liu Y. L. Huang J. J. Hou Y. Q. Zhu H. L. Zhao S. J. Ding B. Y. Yin Y. L. Yi G. F. Shi J. X. Fan W. 2008. Dietary arginine supplementation alleviates intestinal mucosal disruption induced by Escherichia coli lipopolysaccharide in weaned pigs. Br. J. Nutr.  100: 552– 560. Google Scholar CrossRef Search ADS PubMed  Livak K. J. Schmittgen T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and 2-ΔΔCt method. Methods  25: 402– 408. Google Scholar CrossRef Search ADS PubMed  Lodemann U. Lorenz B. M. Weyrauch K. D. Martensa H. 2008. Effects of Bacillus cereus var. toyoi as probiotic feed supplement on intestinal transport and barrier function in piglets. Arch. Anim. Nutr.  62: 87– 106. Google Scholar CrossRef Search ADS PubMed  Ma T. Y. Boivin M. A. Ye D. Pedram A. Said H. M. 2005. Mechanism of TNF-α modulation of Caco-2 intestinal epithelial tight junction barrier: Role of myosin light-chain kinase protein expression. Am. J. Physiol.  288: G422– G430. Madara J. L. Stafford J. 1989. Interferon-γ directly affects barrier function of cultured intestinal epithelial monolayers. J. Clin. Invest.  83: 724– 727. Google Scholar CrossRef Search ADS PubMed  Madsen K. Lewis S. A. Tavernini M. M. Hibbard J. Fedorak R. N. 1997. Interleukin 10 prevents cytokine-induced disruption of T84 monolayer barrier integrity and limits chloride secretion. Gastroenterology  113: 151– 159. Google Scholar CrossRef Search ADS PubMed  McClane S. J. Rombeau J. L. 1999. Cytokines and inflammatory bowel disease: A review. JPEN J. Parenter. Enteral. Nutr.  23: S20– S24. Google Scholar CrossRef Search ADS PubMed  Moeser A. J. Ryan K. A. Nighot P. K. Blikslager A. T. 2007. Gastrointestinal dysfunction induced by early weaning is attenuated by delayed weaning and mast cell blockade in pigs. Am. J. Physiol. Gastrointest. Liver Physiol.  293: G413– G421. Google Scholar CrossRef Search ADS PubMed  Montagne L. Boundry G. Favier C. Le Huerou-Luron I. Lallès J. P. Sève B. 2007. Main intestinal markers associated with the changes in gut architecture and function in piglets after weaning. Br. J. Nutr.  97: 45– 57. Google Scholar CrossRef Search ADS PubMed  Murtaugh M. P. Baarsch M. J. Zhou Y. Scamurra R. W. Lin G. 1996. Inflammatory cytokines in animal health and disease. Vet. Immunol. Immunopathol.  54: 45– 55. Google Scholar CrossRef Search ADS PubMed  NRC. 1998. Nutrient requirements of swine.  10th ed. Natl. Acad. Press, Washington, DC. O'Mahony S. M. Marchesi J. R. Scully P. Codling C. Ceolho A. M. Quigley E. M. Cryan J. F. Dinan T. G. 2009. Early life stress alters behavior, immunity, and microbiota in rats: Implications for irritable bowel syndrome and psychiatric illnesses. Biol. Psychiatry  65: 263– 267. Google Scholar CrossRef Search ADS PubMed  Overman E. L. Rivier J. E. Moeser A. J. 2012. CRF induces intestinal epithelial barrier injury via the release of mast cell proteases and TNF-a. PLoS ONE.  7( 6): e39935. Google Scholar CrossRef Search ADS PubMed  Patrick D. M. Leone A. K. Shellenberger J. J. Dudowicz K. A. King J. M. 2006. Proinflammatory cytokines tumor necrosis factor-α and interferon-γ modulate epithelial barrier function in Madin-Darby canine kidney cells through mitogen activated protein kinase signaling. BMC Physiol.  6: 2. Google Scholar CrossRef Search ADS PubMed  Pearson G. Robinson F. Beers Gibson T. Xu B. Karandikar M. Berman K. Cobb M. H. 2001. Mitogen-activated protein (MAP) kinase pathways: Regulation and physiological functions. Endocr. Rev.  22: 153– 183. Google Scholar PubMed  Pié S. Lallès J. P. Blazy F. Laffitte J. Sève B. Oswald I. P. 2004. Weaning is associated with an upregulation of expression of inflammatory cytokines in the intestine of piglets. J. Nutr.  134: 641– 647. Google Scholar CrossRef Search ADS PubMed  Shifflett D. E. Jones S. L. Moeser A. J. Blikslager A. T. 2004. Mitogen-activated protein kinases regulate COX-2 and mucosal recovery in ischemic-injured porcine ileum. Am. J. Physiol. Gastrointest. Liver. Physiol.  286: G906– G913. Google Scholar CrossRef Search ADS PubMed  Smith F. Clark J. E. Overman B. L. Tozel C. C. Huang J. H. Rivier J. E. Blisklager A. T. Moeser A. J. 2010. Early weaning stress impairs development of mucosal barrier function in the porcine intestine. Am. J. Physiol. Gastrointest. Liver. Physiol.  298: G352– G363. Google Scholar CrossRef Search ADS PubMed  Sun X. Yang H. Nose K. Nose S. Haxhija E. Q. Koga H. Feng Y. J. Teitelbaum D. H. 2008. Decline in intestinal mucosal IL-10 expression and decreased intestinal barrier function in a mouse model of total parenteral nutrition. Am. J. Physiol. Gastrointest. Liver Physiol.  294: G139– G147. Google Scholar CrossRef Search ADS PubMed  Tang M. Laarveld B. Van Kessel A. G. Hamilton D. L. Estrada A. Patience J. F. 1999. Effect of segregated early weaning on postweaning small intestinal development in pigs. J. Anim. Sci.  77: 3191– 3200. Google Scholar CrossRef Search ADS PubMed  Wijtten P. J. A. van der Meulen J. Verstegen M. W. A. 2011a. Intestinal barrier function and absorption in pigs after weaning: A review. Br. J. Nutr.  105: 967– 981. Google Scholar CrossRef Search ADS   Wijtten P. J. A. Verstijnen J. J. van Kempen T. A. T. G. Perdok H. B. Gort G. Verstegen M. W. A. 2011b. Lactulose as a marker of intestinal barrier function in pigs after weaning. J. Anim. Sci.  89: 1347– 1357. Google Scholar CrossRef Search ADS   Xiao Y. Q. Malcolm K. Worthen G. S. Gardai S. Schiemann W. P. Fadok V. A. Bratton D. L. Henson P. M. 2002. Cross-talk between ERK and p38 MAPK mediates selective suppression of pro-inflammatory cytokines by transforming growth factor-β. J. Biol. Chem.  277: 14884. Google Scholar CrossRef Search ADS PubMed  Youakim A. Ahdieh M. 1999. Interferon-gamma decreases barrier function in T84 cells by reducing ZO-1 levels and disrupting apical actin. Am. J. Physiol.  276: G1279– G1288. Google Scholar PubMed  Footnotes 1 This research was jointly supported by the National Natural Science Foundation of China (grant number 31072039), the Zhejiang Provincial Natural Science Foundation (grant number Z3100071), the “948” Project from the Ministry of Agriculture (grant number 2011-G7), and the Program for Changjiang Scholars and Innovative Research Team in University (grant number IRT1040). American Society of Animal Science http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Animal Science Oxford University Press

Early weaning increases intestinal permeability, alters expression of cytokine and tight junction proteins, and activates mitogen-activated protein kinases in pigs

Journal of Animal Science , Volume 91 (3) – Mar 1, 2013

Loading next page...
 
/lp/oxford-university-press/early-weaning-increases-intestinal-permeability-alters-expression-of-EO7viV0eOZ

References (34)

ISSN
0021-8812
eISSN
1525-3163
DOI
10.2527/jas.2012-5796
pmid
23230104
Publisher site
See Article on Publisher Site

Abstract

Abstract Although weaning stress has been reported to impair intestinal barrier function, the mechanisms have not yet been elucidated. In the present study, the intestinal morphology and permeability and mRNA expressions of tight junction proteins and cytokines in the intestine of piglets during the 2 wk after weaning were assessed. The phosphorylated (activated) ratios of p38, c-Jun NH2–terminal kinase (JNK), and extracellular regulated kinases (ERK1/2) were determined to investigate whether mitogen-activated protein kinase (MAPK) signaling pathways are involved in the early weaning process. A shorter villus and deeper crypt were observed on d 3 and 7 postweaning. Although damaged intestinal morphology recovered to preweaning values on d 14 postweaning, the intestinal mucosal barrier, which was reflected by transepithelial electrical resistance (TER) and paracellular flux of dextran (4 kDa) in the Ussing chamber and tight junction protein expression, was not recovered. Compared with the preweaning stage (d 0), jejunal TER and mRNA expressions of occludin and claudin-1 on d 3, 7, and 14 postweaning and Zonula occludens-1 (ZO-1) mRNA on d 3 and 7 postweaning were reduced, and paracellular flux of dextran on d 3, 7, and 14 postweaning was increased. An increase (P < 0.05) of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) mRNA on d 3 and d 7 postweaning and an increase (P < 0.05) of interferon-γ (IFN-γ) mRNA on d 3 postweaning were observed compared with d 0. No significant increase of transforming growth factor β1 (TGF-β1) and interleukin-10 (IL-10) mRNA after weaning was observed. The phosphorylated (activated) ratios of JNK and p38 on d 3 and 7 postweaning and the phosphorylated ratio of ERK1/2 on d 3 postweaning were increased (P < 0.05) compared with d 0. The results indicated that early weaning induced sustained impairment in the intestinal barrier, decreased mRNA expression of tight junction proteins, and upregulated the expression of proinflammatory cytokines, but anti-inflammatory cytokines were not affected in the intestine of piglets. The recovery of the intestinal barrier function was slower than that of the intestinal mucosal morphology. The weaning stress activated MAPK signaling pathways in the intestine, which may be an important mechanism of weaning-associated enteric disorders of piglets. INTRODUCTION Weaning piglets are abruptly forced to combined stressors, such as removal from sow and littermates, transportation to a new environment, fighting and establishment of social hierarchy, and abrupt changes in diet (Moeser et al., 2007). Although weaning stress is reported to impair intestinal barrier function (Moeser et al., 2007; Smith et al., 2010; Wijtten et al., 2011a; Hu et al., 2012), the mechanisms have not yet been elucidated. The intestinal barrier is mainly formed by a layer of epithelial cells joined together by tight junctions (Li et al., 2012). Tight junction proteins form a dynamic seal between epithelial cells, becoming the rate-limiting step in the paracellular pathway and forming the principle physical barrier (Li et al., 2012). It would be of interest to investigate whether the compromised paracellular barrier function after weaning might be attributed to the alterations of tight junctions. However, few data are available regarding the effects of early weaning on tight junction protein expression in piglets. Cytokines have an important physiological and pathological effect on the intestinal tight junction barrier (Al-Sadi et al., 2009). Pro-inflammatory cytokines such as tumor necrosis factor-α (TNF-α), interferon-γ (IFN-γ), IL-6 and anti-inflammatory cytokines like IL-10 and transforming growth factor β (TGF-β) regulate intestinal barrier differently (Al-Sadi et al., 2009). Changes in the intestinal cytokine network may be expected in weaning pigs. Only a few studies have investigated the gene expression of inflammatory cytokines in the intestine of piglets after weaning (Pié et al., 2004). Moreover, few data are available regarding the effect of early weaning on anti-inflammatory cytokines. Mitogen-activated protein kinase (MAPK) pathways, a family of serine-threonine kinases, transduce signals from a diverse array of extracellular stimuli (Pearson et al., 2001; Shifflett et al., 2004). The 3 primary MAPK signaling pathways are the extracellular regulated kinases (ERK1/2), p38 MAPK, and c-Jun NH2–terminal kinase (JNK; Shifflett et al., 2004). Whether early weaning results in MAPK activation remains unknown. It would be of interest to determine the involvement of MAPK signaling pathway in early weaning piglets. In the present study, the intestinal morphology and permeability and mRNA expressions of tight junction proteins and cytokines in the intestine of piglets during the 2 wk after weaning were assessed. The phosphorylated (activated) ratios of p38, JNK, and ERK1/2 were determined to investigate whether MAPK signaling pathways are involved in the early weaning process. MATERIALS AND METHODS All procedures were approved by the Zhejiang University Animal Care and Use Committee. Animals, Housing, and Diet Six litters (Duroc × Landrace × Yorkshire, 9 to 11 piglets per litter) were selected. At 20 d of age (preweaning stage), 1 piglet from each of 6 different litters was killed. At weaning day (21 d of age), 3 piglets from each of 6 different litters were allocated to 1 of the 3 experimental groups killed at 3, 7, and 14 d postweaning. For each group, 6 piglets from 6 different litters were removed from the sow, mixed, and housed in nursery pens. The 3 pens had an equal numbers of males and females, with an average BW of the piglets of 5.7 ± 0.2 kg (mean ± SE). The weaned piglets were given ad libitum access to feed and water. Diet was formulated to meet requirements suggested by the NRC (1998; Table 1). Table 1. Ingredient and chemical composition of the weaned diet on an as-fed basis Item  Value  Ingredients, g/kg      Maize  553.5      Soybean meal, CP 460  165      Extruded full-fat soybean, CP 355  120      Fish meal, CP 628  50      Dried whey, CP 120  60      Spray-dried plasma protein, CP 750  20      Limestone meal  5      Dicalcium phosphate  12      Sodium chloride  3      L-Lysine HCl  1      DL-Methionine  0.5      Vitamin-mineral premix1  10  Analyzed composition, g/kg      DE,2 MJ/kg  14.36      CP  219.2      Lysine  14.8      Methionine  4.0      Calcium  9.1      Total phosphorus  7.2  Item  Value  Ingredients, g/kg      Maize  553.5      Soybean meal, CP 460  165      Extruded full-fat soybean, CP 355  120      Fish meal, CP 628  50      Dried whey, CP 120  60      Spray-dried plasma protein, CP 750  20      Limestone meal  5      Dicalcium phosphate  12      Sodium chloride  3      L-Lysine HCl  1      DL-Methionine  0.5      Vitamin-mineral premix1  10  Analyzed composition, g/kg      DE,2 MJ/kg  14.36      CP  219.2      Lysine  14.8      Methionine  4.0      Calcium  9.1      Total phosphorus  7.2  1Provided per kilogram of diet: vitamin A, 6,000 IU; vitamin E, 50 IU; vitamin D3, 600 IU; vitamin K3, 1.5 mg; biotin, 0.10 mg; riboflavin, 8.0 mg; thiamine, 2.0 mg; niacin, 30 mg; pantothenic acid, 20 mg; pyridoxine, 3.0 mg; folic acid, 0.6 mg; vitamin B12, 0.04 mg; choline, 800 mg; Cu (CuSO4·5H2O), 16 mg; Fe (FeSO4), 125 mg; Zn (ZnSO4), 100 mg; Mn (MnSO4·H2O), 15 mg; Se (Na2SeO3), 0.3 mg; I (KI), 0.2 mg. 2Digestible energy was calculated from data provide by Feed Database in China (2011). View Large Table 1. Ingredient and chemical composition of the weaned diet on an as-fed basis Item  Value  Ingredients, g/kg      Maize  553.5      Soybean meal, CP 460  165      Extruded full-fat soybean, CP 355  120      Fish meal, CP 628  50      Dried whey, CP 120  60      Spray-dried plasma protein, CP 750  20      Limestone meal  5      Dicalcium phosphate  12      Sodium chloride  3      L-Lysine HCl  1      DL-Methionine  0.5      Vitamin-mineral premix1  10  Analyzed composition, g/kg      DE,2 MJ/kg  14.36      CP  219.2      Lysine  14.8      Methionine  4.0      Calcium  9.1      Total phosphorus  7.2  Item  Value  Ingredients, g/kg      Maize  553.5      Soybean meal, CP 460  165      Extruded full-fat soybean, CP 355  120      Fish meal, CP 628  50      Dried whey, CP 120  60      Spray-dried plasma protein, CP 750  20      Limestone meal  5      Dicalcium phosphate  12      Sodium chloride  3      L-Lysine HCl  1      DL-Methionine  0.5      Vitamin-mineral premix1  10  Analyzed composition, g/kg      DE,2 MJ/kg  14.36      CP  219.2      Lysine  14.8      Methionine  4.0      Calcium  9.1      Total phosphorus  7.2  1Provided per kilogram of diet: vitamin A, 6,000 IU; vitamin E, 50 IU; vitamin D3, 600 IU; vitamin K3, 1.5 mg; biotin, 0.10 mg; riboflavin, 8.0 mg; thiamine, 2.0 mg; niacin, 30 mg; pantothenic acid, 20 mg; pyridoxine, 3.0 mg; folic acid, 0.6 mg; vitamin B12, 0.04 mg; choline, 800 mg; Cu (CuSO4·5H2O), 16 mg; Fe (FeSO4), 125 mg; Zn (ZnSO4), 100 mg; Mn (MnSO4·H2O), 15 mg; Se (Na2SeO3), 0.3 mg; I (KI), 0.2 mg. 2Digestible energy was calculated from data provide by Feed Database in China (2011). View Large Sequential Killing and Intestinal Tissue Sampling On the day of preweaning (d 0) and d 3, 7, and 14 postweaning, 6 piglets were killed by euthanasia with an intravenous injection of sodium pentobarbital (40 mg/kg BW). Segments of mid-jejunum were harvested immediately after euthanasia and prepared for Ussing chamber studies. Adjacent specimens were fixed in buffered formalin until morphology measurements. Mucosal scrapings from the remaining jejunum were collected, rapidly frozen in liquid nitrogen, and stored at −80°C. Intestinal Morphological Analyses The specimens of mid-jejunum were embedded in paraffin, sectioned (5 μm), and stained with hematoxylin-eosin. A total of 10 intact, well-oriented crypt-villus units were selected for each intestinal cross section in triplicate. Villus height and crypt depth were determined using an image processing and analysis system (Version 1, Leica Imaging Systems Ltd., Cambridge, UK). Ex vivo Ussing Chamber to Measure Intestinal Permeability The intestinal epithelial tight junction permeability was measured by transepithelial electrical resistance (TER; Ω·cm2) and paracellular flux of fluorescein isothiocyanate (FITC) dextran 4 kDa (FD4) in Ussing chambers. The Ussing chamber procedures were performed as described previously (Hamard et al., 2010; Overman et al., 2012). Briefly, segments of jejunum were stripped from the seromuscular layer in oxygenated (95% O2/5% CO2) Ringer's solution and then mounted in an EasyMount Ussing chamber system (model VCC MC6, Physiologic Instruments, San Diego, CA). The clamps were connected to Acquire and Analyze software (Physiologic Instruments) for automatic data collection. After a 30-min equilibration period on Ussing chambers, TER was recorded at 15-min intervals over a 2-h period. The probe FD4 (Sigma-Aldrich, St. Louis, MO) was added to the mucosal side at the final concentration of 0.375 mg/mL. Mucosal-to-serosal flux of FD4 (ng·cm−2·h−1) was performed by sampling 100 μL of solution from the serosal side at 30-min intervals over a 2-h period and replaced with 100 μL of fresh Ringer's solution to keep the volume constant. The concentrations of FD4 in the serosal side were measured by fluorescence microplate reader (FLx800, Bio-Tek Instruments Inc., Winooski, VT). mRNA Expression of Cytokines and Tight Junction Proteins from Jejunal Mucosa by Real-Time PCR The mRNA expression of cytokines (TNF-α, IL-6, IFN-γ, TGF-β1, and IL-10) and tight junction proteins (occludin, claudin-1, and ZO-1) from jejunal mucosa was determined by quantitative real-time PCR (qRT-PCR) as described by Liu et al. (2008). Briefly, total RNA was isolated using the TRIzol Reagent (Invitrogen, Carlsbad, CA) and treated with RNase-free DNase I before cDNA synthesis following the manufacturer's guidelines. The GenBank accession numbers, sequences of forward and reverse primers, and fragment sizes are presented in Table 2. The qRT-PCR was performed on a StepOne Plus real-time PCR system (Applied Biosystems, Foster City, CA) using a SYBR Green Master mix (Promega, Madison, WI) according to the kit's instructions. The housekeeping gene, Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), exhibited no variation across treatment groups. The preweaning (d 0 postweaning) pigs were used as the reference sample. The comparative cycle threshold (Ct) method (2-ΔΔCt; Livak and Schmittgen, 2001) was used to analyze the relative expression was used to analyze the relative expression (fold changes), calculated relative to the values from the preweaning (d 0 postweaning) pigs. Table 2. GenBank accession numbers, sequences of forward and reverse primers, and fragment sizes used for real-time PCR Target  GeneBank number  Primer sequence  Size, bp  Tumor necrosis factor-α  NM_214022.1  F:5′CATCGCCGTCTCCTACCA3′  199  R:5′CCCAGATTCAGCAAAGTCCA3′  IL-6  NM_001252429.1  F:5′CCTGTCCACTGGGCACATAAC3′  253  R:5′CAAGAAACACCTGGCTCTGAAAC3′  Interferon-γ  NM_213948.1  F:5′GAGCCAAATTGTCTCCTTCTAC3′  140  R:5′CGAAGTCATTCAGTTTCCCAG3′  Transforming growth factor β1  NM_214015.1  F:5′GGACCTTATCCTGAATGCCTT3′  133  R:5′TAGGTTACCACTGAGCCACAAT3′  IL-10  NM_214041.1  F:5′GAAGGACCAGATGGGCGACTT3′  256  R:5′CACCTCCTCCACGGCCCTTG3′  Occludin  NM_001163647.1  F:5′ TCCTGGGTGTGATGGTGTTC3′  145  R:5′ CGTAGAGTCCAGTCACCGCA3′  Claudin-1  NM_001244539.1  F:5′ AGAAGATGCGGATGGCTGTC3′  193  R:5′ CCCAGAAGGCAGAGAGAAGC3′  Zonula occludens-1  XM_003353439.2  F:5′AAGCCCTAAGTTCAATCACAATCT3′  130  R:5′ ATCAAACTCAGGAGGCGGC3′  Glyceraldehyde-3-phosphate dehydrogenase  NM_001206359.1  F:5′ATGGTGAAGGTCGGAGTGAAC3′  235  R:5′CTCGCTCCTGGAAGATGGT3′  Target  GeneBank number  Primer sequence  Size, bp  Tumor necrosis factor-α  NM_214022.1  F:5′CATCGCCGTCTCCTACCA3′  199  R:5′CCCAGATTCAGCAAAGTCCA3′  IL-6  NM_001252429.1  F:5′CCTGTCCACTGGGCACATAAC3′  253  R:5′CAAGAAACACCTGGCTCTGAAAC3′  Interferon-γ  NM_213948.1  F:5′GAGCCAAATTGTCTCCTTCTAC3′  140  R:5′CGAAGTCATTCAGTTTCCCAG3′  Transforming growth factor β1  NM_214015.1  F:5′GGACCTTATCCTGAATGCCTT3′  133  R:5′TAGGTTACCACTGAGCCACAAT3′  IL-10  NM_214041.1  F:5′GAAGGACCAGATGGGCGACTT3′  256  R:5′CACCTCCTCCACGGCCCTTG3′  Occludin  NM_001163647.1  F:5′ TCCTGGGTGTGATGGTGTTC3′  145  R:5′ CGTAGAGTCCAGTCACCGCA3′  Claudin-1  NM_001244539.1  F:5′ AGAAGATGCGGATGGCTGTC3′  193  R:5′ CCCAGAAGGCAGAGAGAAGC3′  Zonula occludens-1  XM_003353439.2  F:5′AAGCCCTAAGTTCAATCACAATCT3′  130  R:5′ ATCAAACTCAGGAGGCGGC3′  Glyceraldehyde-3-phosphate dehydrogenase  NM_001206359.1  F:5′ATGGTGAAGGTCGGAGTGAAC3′  235  R:5′CTCGCTCCTGGAAGATGGT3′  View Large Table 2. GenBank accession numbers, sequences of forward and reverse primers, and fragment sizes used for real-time PCR Target  GeneBank number  Primer sequence  Size, bp  Tumor necrosis factor-α  NM_214022.1  F:5′CATCGCCGTCTCCTACCA3′  199  R:5′CCCAGATTCAGCAAAGTCCA3′  IL-6  NM_001252429.1  F:5′CCTGTCCACTGGGCACATAAC3′  253  R:5′CAAGAAACACCTGGCTCTGAAAC3′  Interferon-γ  NM_213948.1  F:5′GAGCCAAATTGTCTCCTTCTAC3′  140  R:5′CGAAGTCATTCAGTTTCCCAG3′  Transforming growth factor β1  NM_214015.1  F:5′GGACCTTATCCTGAATGCCTT3′  133  R:5′TAGGTTACCACTGAGCCACAAT3′  IL-10  NM_214041.1  F:5′GAAGGACCAGATGGGCGACTT3′  256  R:5′CACCTCCTCCACGGCCCTTG3′  Occludin  NM_001163647.1  F:5′ TCCTGGGTGTGATGGTGTTC3′  145  R:5′ CGTAGAGTCCAGTCACCGCA3′  Claudin-1  NM_001244539.1  F:5′ AGAAGATGCGGATGGCTGTC3′  193  R:5′ CCCAGAAGGCAGAGAGAAGC3′  Zonula occludens-1  XM_003353439.2  F:5′AAGCCCTAAGTTCAATCACAATCT3′  130  R:5′ ATCAAACTCAGGAGGCGGC3′  Glyceraldehyde-3-phosphate dehydrogenase  NM_001206359.1  F:5′ATGGTGAAGGTCGGAGTGAAC3′  235  R:5′CTCGCTCCTGGAAGATGGT3′  Target  GeneBank number  Primer sequence  Size, bp  Tumor necrosis factor-α  NM_214022.1  F:5′CATCGCCGTCTCCTACCA3′  199  R:5′CCCAGATTCAGCAAAGTCCA3′  IL-6  NM_001252429.1  F:5′CCTGTCCACTGGGCACATAAC3′  253  R:5′CAAGAAACACCTGGCTCTGAAAC3′  Interferon-γ  NM_213948.1  F:5′GAGCCAAATTGTCTCCTTCTAC3′  140  R:5′CGAAGTCATTCAGTTTCCCAG3′  Transforming growth factor β1  NM_214015.1  F:5′GGACCTTATCCTGAATGCCTT3′  133  R:5′TAGGTTACCACTGAGCCACAAT3′  IL-10  NM_214041.1  F:5′GAAGGACCAGATGGGCGACTT3′  256  R:5′CACCTCCTCCACGGCCCTTG3′  Occludin  NM_001163647.1  F:5′ TCCTGGGTGTGATGGTGTTC3′  145  R:5′ CGTAGAGTCCAGTCACCGCA3′  Claudin-1  NM_001244539.1  F:5′ AGAAGATGCGGATGGCTGTC3′  193  R:5′ CCCAGAAGGCAGAGAGAAGC3′  Zonula occludens-1  XM_003353439.2  F:5′AAGCCCTAAGTTCAATCACAATCT3′  130  R:5′ ATCAAACTCAGGAGGCGGC3′  Glyceraldehyde-3-phosphate dehydrogenase  NM_001206359.1  F:5′ATGGTGAAGGTCGGAGTGAAC3′  235  R:5′CTCGCTCCTGGAAGATGGT3′  View Large Western Blot Analysis The total abundance of each of the 3 primary MAPK (JNK, p38, ERK1/2) and their phosphorylated (p; activated) forms of MAPK (p-JNK, p-p38, p-ERK1/2) in jejunal mucosa were analyzed by Western blot as previously described (Shifflett et al., 2004). Briefly, after electrophoresis the proteins were transferred to polyvinylidene difluoride membrane (Millipore, Bedford, MA). These primary antibodies were used (Cell Signaling Technology, Inc., Danvers, MA): MAPK antibodies, rabbit IgG; phospho-p38 (Thr180/Tyr182 phosphorylation), rabbit IgG; phospho-ERK 1/2 (Thr202/Tyr204 phosphorylation), rabbit IgG; and phospho-JNK (Thr183/Tyr185 phosphorylation), rabbit IgG. The secondary antibody was horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (Santa Cruz Biotechnology, Santa Cruz, CA). An enhanced chemiluminescence detection kit (Amersham, Arlington Heights, IL) was used to detect the positive bands. The values were calculated as the ratios of their phosphorylation levels (p-JNK, p-p38, p-ERK) and the total abundance of MAPK. The values in samples from the preweaning (d 0 postweaning) pigs were used as the reference sample. The protein expression of all samples was expressed as fold changes, calculated relative to the values from the preweaning (d 0 postweaning) pigs. Statistical Analysis Results were expressed as the means ± SEM. Data were subjected to 1-way ANOVA followed by Duncan's multiple range tests. Differences were considered statistically significant at P < 0.05. Statistical analyses were performed with the SAS software package (SAS Inst. Inc., Cary, NC). RESULTS Intestinal Morphology and Barrier Function in Porcine Jejunum after Weaning Table 3 shows jejunal morphology and barrier function of piglets at different time points (0, 3, 7, and 14 d postweaning). Compared with the preweaning stage (d 0 postweaning), villus height and the ratio of villus height and crypt depth on d 3 and 7 postweaning were decreased (P < 0.05). However, these variables had no significant effect (P > 0.05) between on d 0 and 14 postweaning. The intestinal barrier function of piglets was reflected by TER and paracellular flux of FD4 measured in Ussing chambers. A significant decrease in jejunal TER and an increase in mucosal-to-serosal flux of paracellular FD4 were observed on d 3, 7, and 14 postweaning, compared with the d 0 values. Although villus height and crypt depth returned to preweaning values on d 14 postweaning, intestinal mucosal barrier was not recovered, indicating the recovery of mucosal barrier is slower than that of morphology. Table 3. Intestinal architecture and barrier function in porcine jejunum after weaning   Day postweaning    Item  0  3  7  14  SEM  Villus height, μm  765a  452b  468b  731a  24.6  Crypt depth, μm  274b  316a  320a  285b  11.2  Villus height:crypt depth  2.8a  1.4b  1.5b  2.6a  0.11  TER,1 Ω·cm2  65.8a  51.4b  48.7b  53.5b  2.95  FD4 flux,2 μg·cm−2·h−1  1.2c  1.7b  2.3a  2.0ab  0.12    Day postweaning    Item  0  3  7  14  SEM  Villus height, μm  765a  452b  468b  731a  24.6  Crypt depth, μm  274b  316a  320a  285b  11.2  Villus height:crypt depth  2.8a  1.4b  1.5b  2.6a  0.11  TER,1 Ω·cm2  65.8a  51.4b  48.7b  53.5b  2.95  FD4 flux,2 μg·cm−2·h−1  1.2c  1.7b  2.3a  2.0ab  0.12  a–cMeans within a row with different letters differ significantly (P < 0.05). Data are means of 6 pigs. 1TER = Transepithelial electrical resistance. 2FD4 = Fluorescein isothiocyanate dextran (4 kDa). View Large Table 3. Intestinal architecture and barrier function in porcine jejunum after weaning   Day postweaning    Item  0  3  7  14  SEM  Villus height, μm  765a  452b  468b  731a  24.6  Crypt depth, μm  274b  316a  320a  285b  11.2  Villus height:crypt depth  2.8a  1.4b  1.5b  2.6a  0.11  TER,1 Ω·cm2  65.8a  51.4b  48.7b  53.5b  2.95  FD4 flux,2 μg·cm−2·h−1  1.2c  1.7b  2.3a  2.0ab  0.12    Day postweaning    Item  0  3  7  14  SEM  Villus height, μm  765a  452b  468b  731a  24.6  Crypt depth, μm  274b  316a  320a  285b  11.2  Villus height:crypt depth  2.8a  1.4b  1.5b  2.6a  0.11  TER,1 Ω·cm2  65.8a  51.4b  48.7b  53.5b  2.95  FD4 flux,2 μg·cm−2·h−1  1.2c  1.7b  2.3a  2.0ab  0.12  a–cMeans within a row with different letters differ significantly (P < 0.05). Data are means of 6 pigs. 1TER = Transepithelial electrical resistance. 2FD4 = Fluorescein isothiocyanate dextran (4 kDa). View Large Tight Junction Protein Expression Table 4 shows mRNA expression of occludin, claudin-1, and ZO-1 in jejunal mucosa during the 2 wk after weaning. Compared with the preweaning stage (d 0 postweaning), mRNA expression of occludin and claudin-1 on d 3, 7, and 14 postweaning and ZO-1 mRNA on d 3 and 7 postweaning was decreased (P < 0.05). Table 4. Tight junction protein mRNA expressions in jejunal mucosa of piglets after weaning1   Day postweaning    Item  0  3  7  14  SEM  Occludin  1.00a  0.53b  0.41b  0.57b  0.12  Claudin-1  1.00a  0.64b  0.53b  0.61b  0.09  Zonula occludens-1  1.00a  0.62b  0.72b  0.79ab  0.11    Day postweaning    Item  0  3  7  14  SEM  Occludin  1.00a  0.53b  0.41b  0.57b  0.12  Claudin-1  1.00a  0.64b  0.53b  0.61b  0.09  Zonula occludens-1  1.00a  0.62b  0.72b  0.79ab  0.11  a–cMeans within a row with different letters differ significantly (P < 0.05). 1The comparative cycle threshold method was used to analyze the relative expression (fold changes), calculated relative to the values in samples from the preweaning (d 0 postweaning) pigs. Data are means of 6 pigs. View Large Table 4. Tight junction protein mRNA expressions in jejunal mucosa of piglets after weaning1   Day postweaning    Item  0  3  7  14  SEM  Occludin  1.00a  0.53b  0.41b  0.57b  0.12  Claudin-1  1.00a  0.64b  0.53b  0.61b  0.09  Zonula occludens-1  1.00a  0.62b  0.72b  0.79ab  0.11    Day postweaning    Item  0  3  7  14  SEM  Occludin  1.00a  0.53b  0.41b  0.57b  0.12  Claudin-1  1.00a  0.64b  0.53b  0.61b  0.09  Zonula occludens-1  1.00a  0.62b  0.72b  0.79ab  0.11  a–cMeans within a row with different letters differ significantly (P < 0.05). 1The comparative cycle threshold method was used to analyze the relative expression (fold changes), calculated relative to the values in samples from the preweaning (d 0 postweaning) pigs. Data are means of 6 pigs. View Large Proinflammatory Cytokine mRNA Table 5 shows cytokine mRNA abundance in jejunal mucosa of piglets during the 2 wk after weaning. For TNF-α and IL-6 mRNA, an increase (P < 0.05) was observed on d 3 and 7 postweaning compared with d 0. An increase (P < 0.05) of IFN-γ mRNA was found on d 3 postweaning compared with d 0. The mRNA expressions of TNF-α and IL-6 on d 14 postweaning and the mRNA expression of IFN-γ on d 7 and 14 postweaning returned to preweaning values. By contrast, no significant increase of TGF-β1 and IL-10 mRNA during the 2 wk after weaning was observed (P > 0.05). Table 5. Cytokine mRNA expressions in jejunal mucosa of piglets after weaning1   Day postweaning    Item  0  3  7  14  SEM  Tumor necrosis factor-α  1.00c  4.48a  2.97ab  1.38bc  0.56  Interferon-γ  1.00b  3.04a  1.94ab  1.06b  0.51  IL-6  1.00b  3.85a  3.08a  1.31b  0.45  Transforming growth factor β1  1.00  1.32  1.40  1.25  0.17  IL-10  1.00  1.48  1.51  1.42  0.20    Day postweaning    Item  0  3  7  14  SEM  Tumor necrosis factor-α  1.00c  4.48a  2.97ab  1.38bc  0.56  Interferon-γ  1.00b  3.04a  1.94ab  1.06b  0.51  IL-6  1.00b  3.85a  3.08a  1.31b  0.45  Transforming growth factor β1  1.00  1.32  1.40  1.25  0.17  IL-10  1.00  1.48  1.51  1.42  0.20  a–cMeans within a row with different letters differ significantly (P < 0.05). 1The comparative cycle threshold method was used to analyze the relative expression (fold changes), calculated relative to the values in samples from the preweaning (d 0 postweaning) pigs. Data are means of 6 pigs. View Large Table 5. Cytokine mRNA expressions in jejunal mucosa of piglets after weaning1   Day postweaning    Item  0  3  7  14  SEM  Tumor necrosis factor-α  1.00c  4.48a  2.97ab  1.38bc  0.56  Interferon-γ  1.00b  3.04a  1.94ab  1.06b  0.51  IL-6  1.00b  3.85a  3.08a  1.31b  0.45  Transforming growth factor β1  1.00  1.32  1.40  1.25  0.17  IL-10  1.00  1.48  1.51  1.42  0.20    Day postweaning    Item  0  3  7  14  SEM  Tumor necrosis factor-α  1.00c  4.48a  2.97ab  1.38bc  0.56  Interferon-γ  1.00b  3.04a  1.94ab  1.06b  0.51  IL-6  1.00b  3.85a  3.08a  1.31b  0.45  Transforming growth factor β1  1.00  1.32  1.40  1.25  0.17  IL-10  1.00  1.48  1.51  1.42  0.20  a–cMeans within a row with different letters differ significantly (P < 0.05). 1The comparative cycle threshold method was used to analyze the relative expression (fold changes), calculated relative to the values in samples from the preweaning (d 0 postweaning) pigs. Data are means of 6 pigs. View Large Mitogen-Activated Protein Kinase Signal Pathways Table 6 shows the effects of early weaning stress on the 3 MAPK signaling pathways (JNK, p38, ERK). Jejunal mucosa was analyzed by Western blot for the total content of each of the 3 primary MAPK and their phosphorylated (activated) forms of MAPK (p-JNK, p-p38, p-ERK). The total protein for each of the MAPK was unchanged during the 2 wk after weaning. However, compared with the preweaning stage (d 0 postweaning), the ratios of the phosphorylated forms and the total levels of JNK and p38 (p-JNK/JNK and p-p38/p38) on d 3 and 7 postweaning were increased (P < 0.05). The ratio of the phosphorylated forms and the total ERK (p-ERK/ERK) on d 3 postweaning was greater (P < 0.05) than that on d 0, then returned to preweaning values on d 7 and 14 postweaning. Table 6. Effects of early weaning stress on mitogen-activated protein kinase (MAPK) signal pathways in jejunal mucosa of piglets   Day postweaning    Item1  0  3  7  14  SEM  p-JNK/JNK  1.00b  2.32a  2.64a  1.51b  0.25  p-p38/p38  1.00b  3.26a  2.88a  1.74b  0.31  p-ERK/ERK  1.00b  1.74a  1.28ab  1.36ab  0.19    Day postweaning    Item1  0  3  7  14  SEM  p-JNK/JNK  1.00b  2.32a  2.64a  1.51b  0.25  p-p38/p38  1.00b  3.26a  2.88a  1.74b  0.31  p-ERK/ERK  1.00b  1.74a  1.28ab  1.36ab  0.19  a–cMeans within a row with different letters differ significantly (P < 0.05). 1The 3 mitogen-activated protein kinase (MAPK) signaling pathways are the c-Jun NH2–terminal kinase (JNK), p38 MAPK, and extracellular regulated kinases (ERK1/2). The values were calculated as the ratios of their phosphorylation levels (p-JNK, p-p38, p-ERK) and the total levels of MAPK. The values in samples from the preweaning (d 0 postweaning) pigs were used as the reference sample. The protein expression of all samples was expressed as fold changes, calculated relative to the values from the preweaning (d 0 postweaning) pigs. View Large Table 6. Effects of early weaning stress on mitogen-activated protein kinase (MAPK) signal pathways in jejunal mucosa of piglets   Day postweaning    Item1  0  3  7  14  SEM  p-JNK/JNK  1.00b  2.32a  2.64a  1.51b  0.25  p-p38/p38  1.00b  3.26a  2.88a  1.74b  0.31  p-ERK/ERK  1.00b  1.74a  1.28ab  1.36ab  0.19    Day postweaning    Item1  0  3  7  14  SEM  p-JNK/JNK  1.00b  2.32a  2.64a  1.51b  0.25  p-p38/p38  1.00b  3.26a  2.88a  1.74b  0.31  p-ERK/ERK  1.00b  1.74a  1.28ab  1.36ab  0.19  a–cMeans within a row with different letters differ significantly (P < 0.05). 1The 3 mitogen-activated protein kinase (MAPK) signaling pathways are the c-Jun NH2–terminal kinase (JNK), p38 MAPK, and extracellular regulated kinases (ERK1/2). The values were calculated as the ratios of their phosphorylation levels (p-JNK, p-p38, p-ERK) and the total levels of MAPK. The values in samples from the preweaning (d 0 postweaning) pigs were used as the reference sample. The protein expression of all samples was expressed as fold changes, calculated relative to the values from the preweaning (d 0 postweaning) pigs. View Large DISCUSSION In agreement with earlier reports (Tang et al., 1999; Boudry et al., 2004; Montagne et al., 2007), the present study showed that villus height and the ratio of villus height and crypt depth on d 3 and 7 postweaning were decreased compared with the preweaning stage. The shorter villus and deeper crypt verified the deterioration of intestinal morphology induced by weaning. Additionally, the present study showed that villus height and crypt depth returned to the preweaning value on d 14 postweaning. In contrast to this finding, Boudry et al. (2004) reported that villous height in the jejunum was still significantly lower on d 15 postweaning than d 0. In the present experiment, the Ussing chamber technique was used to monitor intestinal permeability in terms of TER and flux of FD4. Transepithelial electrical resistance is considered to reflect the opening of the tight junctions between epithelial cells and the paracellular permeability of the intestinal mucosa (Wijtten et al., 2011a). A decreased TER reflects increased paracellular permeability. Marker probe FD4 is added to the solution in the Ussing chamber at the mucosal site. The appearance of this marker probe in the chamber at the serosal site represents its permeability across the epithelium (Wijtten et al., 2011a). The flux of intact FD4 across the intestinal epithelium occurs mainly through paracellular pathways (Hamard et al., 2010; Overman et al., 2012). An increased flux of FD4 reflects increased paracellular permeability and impaired intestinal barrier. A significant decrease in jejunal TER and an increase in mucosal-to-serosal flux of paracellular FD4 on d 3, 7, and 14 postweaning compared with d 0 were observed in the present study. Similarly, using [3H]mannitol and [14C]inulin as marker probes, Moeser et al. (2007) and Smith et al. (2010) reported that the flux of mannitol and inulin over the jejunum was significantly increased and TER was significantly decreased when pigs were weaned at 15 to 21 d of age. However, Montagne et al. (2007) used HRP as a marker probe and found that the HRP flux across the jejunum epithelium declined on d 2 postweaning and stayed at this low level until d 15 postweaning. Wijtten et al. (2011b) used the recovery in urine of orally administered lactulose to assess intestinal permeability and found that lactulose recovery in the urine was greater at d 4, 8, and 12 after weaning compared with the first day after weaning, whereas the HRP flux was not affected over time. Although villus height and crypt depth returned to preweaning values on d 14 postweaning, intestinal mucosal barrier did not recover, indicating the recovery of intestinal barrier function is slower than that of intestinal mucosal morphology. Similarly, Chang et al. (2005) investigated the functional and morphological changes of the gut barrier of rats during the restitution process after hemorrhagic shock and found that the restitution of gut barrier function was obviously slower than that of the morphology and there was no direct correlation between them. Early life stress is a predisposing factor for the development of chronic intestinal disorders in adult life (Smith et al., 2010). Epidemiological studies have demonstrated that early life psychological stress is associated with the development of chronic, persistent intestinal disorders in adult life (O'Mahony et al., 2009). Neonatal maternal separation in rodents can induce long-term defects in the intestinal epithelial barrier associated with an exaggerated immune response to an external immune stimulus (Gareau et al., 2007). Smith et al. (2010) demonstrated that early weaning (15- to 21-d weaning age) resulted in sustained impairment in intestinal barrier function at 5 and 9 wk of age. In contrast, Lodemann et al. (2008) reported that the mannitol flux across the mid-jejunum on 7 d postweaning was significantly less than the preweaning value, and TER was not different from preweaning. Wijtten et al. (2011a) indicated that the impairment of the paracellular barrier function of piglets is almost exclusively observed in the first week after weaning and returns to the preweaning level at 2 wk after weaning. These discrepancies might be related to the difference in the weaning process and handling of the pigs. The intestinal barrier is composed of a layer of columnar epithelium and interepithelial tight junctions. Tight junction proteins, such as claudins, occludins and zonula occludens, form the tight junction at the boundary of 2 adjacent cells, working as a rate-limiting step in the paracellular pathway and forming a selectively permeable barrier (Li et al., 2012). To better clarify the molecular mechanism for the impaired mucosal barrier function in weaning piglets, we determined the changes in the mRNA expression of occludin, ZO-1, and claudin-1 after weaning for the first time. The results showed that mRNA expression of occludin and claudin-1 on d 3, 7, and 14 postweaning and ZO-1 mRNA on d 3 and 7 postweaning was decreased compared with d 0. The results indicated that the decreased tight junction protein in early weaned pigs coincided with the increased intestinal epithelial paracellular permeability. Cytokines play an important role in the immune and inflammatory responses. They also participate in the regulation of the intestinal barrier integrity (Al-Sadi et al., 2009). Most proinflammatory cytokines, such as TNF-α, IFN-γ, and IL-6, increase intestinal epithelial permeability (Youakim and Ahdieh, 1999; Al-Sadi and Thomas, 2007). On the other hand, anti-inflammatory cytokines, like IL-10 and TGF-β, attenuate or protect against intestinal inflammation by preserving the barrier function (Madsen et al., 1997; Howe et al., 2005). Many studies reported that enteric infection and intestinal inflammatory diseases were associated with the alternations in the expression of proinflammatory cytokines in the intestine of humans and animals (Murtaugh et al., 1996; McClane and Rombeau, 1999). However, only a few studies investigated the expression of cytokines in the intestine of piglets after weaning. The present study analyzed the gene expressions of proinflammatory and anti-inflammatory cytokines in the intestine of 21-d-old weaned piglets during the 2 wk after weaning. The results showed that mRNA expression of TNF-α and IL-6 was increased on d 3 and 7 postweaning compared with d 0 and returned to preweaning values on d 14 postweaning, and IFN-γ mRNA was increased on d 3 postweaning compared with d 0 and returned to preweaning values on d 7 and 14 postweaning. This study also demonstrated for the first time that no significant alternations of anti-inflammatory cytokines (TGF-β1 and IL-10) mRNA were observed during the 2 wk after weaning. In findings similar to ours, Pié et al. (2004) reported that weaning stress upregulated expression of proinflammatory cytokines in the intestine of 28-d-old weaned piglets. However, there are discrepancies between the 2 studies. Pié et al. (2004) reported that the mRNA expressions of proinflammatory cytokines (TNF-γ, IL-6, and IL-1β) increased between d 0 and 2 and rapidly returned to preweaning values between d 2 and 8. However, the present results showed that mRNA expression of TNF-α and IL-6 was still increased on d 7 postweaning compared with d 0. The discrepancies might be related to the difference in the weaning age (weaned at the age of 21 and 28 d, respectively). Overproduction of proinflammatory cytokines has a negative influence on gut integrity and epithelial function (Liu et al., 2008). The tight junction barrier disruptive actions of TNF-α and IFN-γ have been well established (Madara and Stafford, 1989; Youakim and Ahdieh, 1999; Ma et al., 2005). It has been reported that IFN-γ-induced reductions in epithelial barrier function are linked to decreases in the expression of tight junction proteins such as occludin and ZO-1 (Blikslager et al., 2007). The cytokine INF-γ can act synergistically with TNF-α to induce impairment in tight junctions (Al-Sadi et al., 2009). Conversely, TGF-β and IL-10 are anti-inflammatory cytokines and can attenuate the defects in tight junction permeability (Madsen et al., 1997; Howe et al., 2005). Reported actions of TGF-β on the repair of the epithelium after injury include enhanced epithelial cell migration, upregulated expression of extracellular matrix proteins and cell surface integrin, and decreases in epithelial paracellular permeability (Blikslager et al., 2007). Exogenous IL-10 administration in total parenteral nutrition (TPN) mice attenuated the TPN-induced reductions in expression of occludin and ZO-1 and a loss of intestinal barrier function (Sun et al., 2008). The present study showed that early weaning upregulated the expression of proinflammatory cytokines in the intestine of piglets but had no effect on the expression of anti-inflammatory cytokines, which coincided with the decreased expression of tight junction protein and increased intestinal epithelial paracellular permeability. From the nutritional perspective, controlling the early intestinal inflammation and facilitating the restoration of the injured intestinal mucosa may have potential benefits in alleviating intestinal barrier impairment induced by weaning stress. The MAPK signaling pathways transduce signals from a diverse array of extracellular stimuli and form a highly integrated network to regulate cellular functions, such as differentiation, proliferation, and cell death (Pearson et al., 2001; Shifflett et al., 2004). The 3 primary MAPK signaling pathways are the ERK1/2, p38 and JNK. The MAPK signaling cascades are viewed as parallel pathways, although cross talk may exist (Xiao et al., 2002; Shifflett et al., 2004). Upon phosphorylation and subsequent activation of an MAPK, the MAPK can enter the cell nucleus and activate transcription factors, which ultimately results in expression of target genes and a biological response (Shifflett et al., 2004). To determine whether early weaning influences MAPK signaling pathways, we measured the total levels of each of the 3 primary MAPK (JNK, p38, ERK) and their phosphorylated forms (p-JNK, p-p38, p-ERK). We demonstrated for the first time that the ratios of p-p38/p38 and p-JNK/JNK on d 3 and 7 postweaning and the ratio of p-ERK/ERK on d 3 postweaning were increased compared with d 0, indicating early weaning stress in pigs induced activation of MAPK signaling pathways. Patrick et al. (2006) suggest that downstream effectors of MAPK signaling pathways mediate the TNFα/IFNγ-induced junctional reorganization that modulates Madin-Darby canine kidney cell barrier function. Our hypothesis is that the weaning stress activates MAPK signaling pathways in the intestine, resulting in intestinal dysfunction, which may be an important mechanism of weaning-associated enteric disorders of piglets. However, the exact role of this signaling pathway remains to be elucidated. In a follow-up study, the specific inhibitors of MAPK may be used to investigate whether inhibition of MAPK can block the weaning-induced damage of the intestinal epithelial barrier. In summary, the shorter villus and deeper crypt verified the deterioration of intestinal morphology induced by early weaning. Weaning resulted in sustained impairment in the intestinal barrier on d 3, 7, and 14 postweaning. Although villus height and crypt depth returned to preweaning values on d 14 postweaning, intestinal mucosal barrier was not recovered, indicating the recovery of the intestinal barrier function is slower than that of intestinal mucosal morphology. The decreased mRNA expression of tight junction proteins after weaning coincided with the increased intestinal epithelial paracellular permeability. The expression of proinflammatory cytokines in the intestine of piglets was transiently upregulated by weaning, but expression of anti-inflammatory cytokines was not affected. The weaning stress activates MAPK signaling pathways in the intestine, which may be an important mechanism of weaning-associated enteric disorders of piglets. LITERATURE CITED Al-Sadi R. Boivin M. Ma T. 2009. Mechanism of cytokine modulation of epithelial tight junction barrier. Front. Biosci.  14: 2765– 2778. Google Scholar CrossRef Search ADS   Al-Sadi R. M. Thomas Y. M. 2007. IL-1β causes an increase in intestinal epithelial tight junction permeability. J. Immunol.  178: 4641– 4649. Google Scholar CrossRef Search ADS PubMed  Blikslager A. T. Moeser A. J. Gookin J. L. Jones S. L. Odle J. 2007. Restoration of barrier function in injured intestinal mucosa. Physiol. Rev.  87: 545– 564. Google Scholar CrossRef Search ADS PubMed  Boudry G. Péron V. Le Huërou-Luron I. Lallès J. P. Sève B. 2004. Weaning induces both transient and long-lasting modifications of absorptive, secretory, and barrier properties of piglet intestine. J. Nutr.  134: 2256– 2262. Google Scholar CrossRef Search ADS PubMed  Chang J. X. Chen S. Ma L. P. Jiang L. Y. Chen J. W. Chang R. M. Wen L. Q. Wu W. Jiang Z. P. Huang Z. T. 2005. Functional and morphological changes of the gut barrier during the restitution process after hemorrhagic shock. World J. Gastroenterol.  11: 5485– 5491. Google Scholar CrossRef Search ADS PubMed  Feed Database in China. 2011. Table of feed composition and nutritive value in China.  22th ed. China Feed, Beijing, China. Gareau M. G. Jury J. Perdue M. H. 2007. Neonatal maternal separation of rat pups results in abnormal cholinergic regulation of epithelial permeability. Am. J. Physiol. Gastrointest. Liver Physiol.  293: G198– G203. Google Scholar CrossRef Search ADS PubMed  Hamard A. Mazurais D. Boudry G. Le Huërou-Luron I. Sèvea B. Le Floc'ha N. 2010. A moderate threonine deficiency affects gene expression profile, paracellular permeability and glucose absorption capacity in the ileum of piglets. J. Nutr. Biochem  21: 914– 921. Google Scholar CrossRef Search ADS PubMed  Howe K. L. Reardon C. Wang A. Nazli A. McKay D. M. 2005. Transforming growth factor-beta regulation of epithelial tight junction proteins enhances barrier function and blocks enterohemorrhagic Escherichia coli O157:H7-induced increased permeability. Am. J. Pathol.  167: 1587– 1597. Google Scholar CrossRef Search ADS PubMed  Hu C. H. Gu L. Y. Luan Z. S. Song J. Zhu K. 2012. Effects of montmorillonite–zinc oxide hybrid on performance, diarrhea, intestinal permeability and morphology of weanling pigs. Anim. Feed Sci. Technol.  177: 108– 115. Google Scholar CrossRef Search ADS   Li X. Akhtar S. Choudhry M. A. 2012. Alteration in intestine tight junction protein phosphorylation and apoptosis is associated with increase in IL-18 levels following alcohol intoxication and burn injury. Biochim. Biophys. Acta.  1822: 196– 203. Google Scholar CrossRef Search ADS PubMed  Liu Y. L. Huang J. J. Hou Y. Q. Zhu H. L. Zhao S. J. Ding B. Y. Yin Y. L. Yi G. F. Shi J. X. Fan W. 2008. Dietary arginine supplementation alleviates intestinal mucosal disruption induced by Escherichia coli lipopolysaccharide in weaned pigs. Br. J. Nutr.  100: 552– 560. Google Scholar CrossRef Search ADS PubMed  Livak K. J. Schmittgen T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and 2-ΔΔCt method. Methods  25: 402– 408. Google Scholar CrossRef Search ADS PubMed  Lodemann U. Lorenz B. M. Weyrauch K. D. Martensa H. 2008. Effects of Bacillus cereus var. toyoi as probiotic feed supplement on intestinal transport and barrier function in piglets. Arch. Anim. Nutr.  62: 87– 106. Google Scholar CrossRef Search ADS PubMed  Ma T. Y. Boivin M. A. Ye D. Pedram A. Said H. M. 2005. Mechanism of TNF-α modulation of Caco-2 intestinal epithelial tight junction barrier: Role of myosin light-chain kinase protein expression. Am. J. Physiol.  288: G422– G430. Madara J. L. Stafford J. 1989. Interferon-γ directly affects barrier function of cultured intestinal epithelial monolayers. J. Clin. Invest.  83: 724– 727. Google Scholar CrossRef Search ADS PubMed  Madsen K. Lewis S. A. Tavernini M. M. Hibbard J. Fedorak R. N. 1997. Interleukin 10 prevents cytokine-induced disruption of T84 monolayer barrier integrity and limits chloride secretion. Gastroenterology  113: 151– 159. Google Scholar CrossRef Search ADS PubMed  McClane S. J. Rombeau J. L. 1999. Cytokines and inflammatory bowel disease: A review. JPEN J. Parenter. Enteral. Nutr.  23: S20– S24. Google Scholar CrossRef Search ADS PubMed  Moeser A. J. Ryan K. A. Nighot P. K. Blikslager A. T. 2007. Gastrointestinal dysfunction induced by early weaning is attenuated by delayed weaning and mast cell blockade in pigs. Am. J. Physiol. Gastrointest. Liver Physiol.  293: G413– G421. Google Scholar CrossRef Search ADS PubMed  Montagne L. Boundry G. Favier C. Le Huerou-Luron I. Lallès J. P. Sève B. 2007. Main intestinal markers associated with the changes in gut architecture and function in piglets after weaning. Br. J. Nutr.  97: 45– 57. Google Scholar CrossRef Search ADS PubMed  Murtaugh M. P. Baarsch M. J. Zhou Y. Scamurra R. W. Lin G. 1996. Inflammatory cytokines in animal health and disease. Vet. Immunol. Immunopathol.  54: 45– 55. Google Scholar CrossRef Search ADS PubMed  NRC. 1998. Nutrient requirements of swine.  10th ed. Natl. Acad. Press, Washington, DC. O'Mahony S. M. Marchesi J. R. Scully P. Codling C. Ceolho A. M. Quigley E. M. Cryan J. F. Dinan T. G. 2009. Early life stress alters behavior, immunity, and microbiota in rats: Implications for irritable bowel syndrome and psychiatric illnesses. Biol. Psychiatry  65: 263– 267. Google Scholar CrossRef Search ADS PubMed  Overman E. L. Rivier J. E. Moeser A. J. 2012. CRF induces intestinal epithelial barrier injury via the release of mast cell proteases and TNF-a. PLoS ONE.  7( 6): e39935. Google Scholar CrossRef Search ADS PubMed  Patrick D. M. Leone A. K. Shellenberger J. J. Dudowicz K. A. King J. M. 2006. Proinflammatory cytokines tumor necrosis factor-α and interferon-γ modulate epithelial barrier function in Madin-Darby canine kidney cells through mitogen activated protein kinase signaling. BMC Physiol.  6: 2. Google Scholar CrossRef Search ADS PubMed  Pearson G. Robinson F. Beers Gibson T. Xu B. Karandikar M. Berman K. Cobb M. H. 2001. Mitogen-activated protein (MAP) kinase pathways: Regulation and physiological functions. Endocr. Rev.  22: 153– 183. Google Scholar PubMed  Pié S. Lallès J. P. Blazy F. Laffitte J. Sève B. Oswald I. P. 2004. Weaning is associated with an upregulation of expression of inflammatory cytokines in the intestine of piglets. J. Nutr.  134: 641– 647. Google Scholar CrossRef Search ADS PubMed  Shifflett D. E. Jones S. L. Moeser A. J. Blikslager A. T. 2004. Mitogen-activated protein kinases regulate COX-2 and mucosal recovery in ischemic-injured porcine ileum. Am. J. Physiol. Gastrointest. Liver. Physiol.  286: G906– G913. Google Scholar CrossRef Search ADS PubMed  Smith F. Clark J. E. Overman B. L. Tozel C. C. Huang J. H. Rivier J. E. Blisklager A. T. Moeser A. J. 2010. Early weaning stress impairs development of mucosal barrier function in the porcine intestine. Am. J. Physiol. Gastrointest. Liver. Physiol.  298: G352– G363. Google Scholar CrossRef Search ADS PubMed  Sun X. Yang H. Nose K. Nose S. Haxhija E. Q. Koga H. Feng Y. J. Teitelbaum D. H. 2008. Decline in intestinal mucosal IL-10 expression and decreased intestinal barrier function in a mouse model of total parenteral nutrition. Am. J. Physiol. Gastrointest. Liver Physiol.  294: G139– G147. Google Scholar CrossRef Search ADS PubMed  Tang M. Laarveld B. Van Kessel A. G. Hamilton D. L. Estrada A. Patience J. F. 1999. Effect of segregated early weaning on postweaning small intestinal development in pigs. J. Anim. Sci.  77: 3191– 3200. Google Scholar CrossRef Search ADS PubMed  Wijtten P. J. A. van der Meulen J. Verstegen M. W. A. 2011a. Intestinal barrier function and absorption in pigs after weaning: A review. Br. J. Nutr.  105: 967– 981. Google Scholar CrossRef Search ADS   Wijtten P. J. A. Verstijnen J. J. van Kempen T. A. T. G. Perdok H. B. Gort G. Verstegen M. W. A. 2011b. Lactulose as a marker of intestinal barrier function in pigs after weaning. J. Anim. Sci.  89: 1347– 1357. Google Scholar CrossRef Search ADS   Xiao Y. Q. Malcolm K. Worthen G. S. Gardai S. Schiemann W. P. Fadok V. A. Bratton D. L. Henson P. M. 2002. Cross-talk between ERK and p38 MAPK mediates selective suppression of pro-inflammatory cytokines by transforming growth factor-β. J. Biol. Chem.  277: 14884. Google Scholar CrossRef Search ADS PubMed  Youakim A. Ahdieh M. 1999. Interferon-gamma decreases barrier function in T84 cells by reducing ZO-1 levels and disrupting apical actin. Am. J. Physiol.  276: G1279– G1288. Google Scholar PubMed  Footnotes 1 This research was jointly supported by the National Natural Science Foundation of China (grant number 31072039), the Zhejiang Provincial Natural Science Foundation (grant number Z3100071), the “948” Project from the Ministry of Agriculture (grant number 2011-G7), and the Program for Changjiang Scholars and Innovative Research Team in University (grant number IRT1040). American Society of Animal Science

Journal

Journal of Animal ScienceOxford University Press

Published: Mar 1, 2013

There are no references for this article.