Get 20M+ Full-Text Papers For Less Than $1.50/day. Subscribe now for You or Your Team.

Learn More →

Gene expression profiling analysis reveals weaning-induced cell cycle arrest and apoptosis in the small intestine of pigs

Gene expression profiling analysis reveals weaning-induced cell cycle arrest and apoptosis in the... ABSTRACT In swine production, weaning is a critical event for porcine weaning-associated disease, such as postweaning stress syndrome, which involves intestinal dysfunction. However, little is known about the molecular mechanisms of intestinal dysfunction in pigs during weaning. To gain new insight into the interaction between weaning stress and intestinal function, 4 pigs at 25 d of age for each of the weaning and the suckling groups for a total of 40 pigs were used to analyze changes in the genomic expression in the intestines of weaned pigs by microarray analysis. Four hundred forty-five genes showed altered expression after weaning treatment (286 upregulated and 159 downregulated) at the cutoff criteria of the fold change ≥1.5 or <0.67 and P < 0.05. Most of these altered genes are cellular process related and regulators that may be involved in biological regulation, developmental processes, and metabolic processes. A keen interest was paid in deciphering expression changes in apoptosis or cell cycle control genes. The altered genomic expression of 8 selected genes related to the cell cycle process was confirmed by quantitative real-time PCR. Of the 8 genes tested, increased (P < 0.05) expression of genes involved in apoptosis (cytochrome c, somatic, and ataxia telangiectasia mutated), pro-inflammatory signals (tumor necrosis factor and NO synthases 2), and a transcription factor (nuclear factor of activated T cells, cytoplasmic, and calcineurin-dependent 2) were detected in weaned pigs compared with suckling pigs, but the expression of cell cycle control-related genes, such as E2F transcription factor 5-like, was lower (P < 0.05) in weaned pigs than suckling pigs. Weaned pigs also showed increased interleukin 8 expression and decreased SMAD family member 4 expression although no significant differences (P > 0.05) were observed when compared with the suckling pigs. These selected genes likely indicate that weaning induced cell cycle arrest, enhanced apoptosis, and inhibited cell proliferation. The results of this study provide a basis for understanding the molecular pathogenesis of weaning treatment. INTRODUCTION In animal development, both breast feeding and weaning are important physiology events in the growth of the small intestine. During early suckling, the small intestine grows rapidly because the breast milk contains growth factors that stimulate intestinal growth (Heird et al., 1984). During the weaning period, the diet changes from milk to a solid diet and an intense rebuilding of intestine tissues takes place so that the intestines can mature (Cummins and Thompson, 2002). During intestinal maturation, the old intestinal cells are gradually replaced by the newly differentiated cells with mature functions (Smith and Peacock, 1980; Zabielski et al., 2008). In intensive livestock production, postweaning can also make the juvenile mammalian gut mature through a series of adaptive changes including cell proliferation, differentiation, and apoptosis (Dvorak et al., 2000; Boudry et al., 2004). However, piglet weaning is often associated with gastrointestinal dysfunction, which is a major problem in swine production (Lecce, 1986). Evidence has shown that early weaning could decrease the expression of genes related to cell proliferation and increase the expression of cell growth-related genes after dietary glutamine supplementation in weaned pigs (Wang et al., 2008). We also previously demonstrated that weaning induces cell apoptosis (Zhu et al., 2013). It seems that enterocyte cellular processes play an important role during weaning. Changes in individual intestinal mucosal genes are uniquely regulated, and the cellular and molecular events associated with these changes in the intestines of weaned pigs are yet to be elucidated. The aim of this work is therefore to increase our understanding of the mechanism of the transcription network changes in the small intestine that underlie the performance of weaning using a genomic approach. MATERIALS AND METHODS All animal procedures were performed according to protocols approved by the Biological Studies Animal Care and Use Committee of Shanghai, PR China. Experimental Design and Tissue Collection A total of forty 21-d-old pigs (Duroc × Landrace) from 4 litters (10 pigs per litter) were used in this experiment. At 21 d of age, 5 pigs from each litter for a total of 20 pigs were randomly selected and assigned to the weaning group. The others were assigned to the suckling group. Pigs in the weaning group were weaned and moved from the farrowing pens to the nursery pens without mixing any litters (5 piglets per pen) and had ad libitum access to the basal diet and water, as previously described (Zhu et al., 2012), with 14.48 MJ/kg DE and 20.50% CP (N × 6.25). The suckling pigs continued to be nursed by sows without mixing any litters. At 25 d of age, 1 piglet closest to the average BW was selected from each litter, resulting in a total of 4 pigs per group. Animals were then anesthetized by intramuscular injection with sodium pentobarbital (50 mg/kg BW) and then euthanized. Jejunal samples, approximately 2 cm in length, were resected from the middle portion of the jejunum, washed in PBS, and frozen in liquid N2, and stored at –80°C before their use for the isolation of total RNA. Ribonucleic Acid Preparation The total RNA of jejunum tissues was extracted following the Trizol reagent instructions (Invitrogen, Carlsbad, CA) and checked for RNA integrity and purity using an Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA). The qualified total RNA was further purified using an RNeasy mini kit (QIAGEN, GmBH, Germany) and an RNase-Free DNase Set (QIAGEN, GmBH, Germany). Only those samples that had an optical density 260: optical density 280 ratio of approximately 2.0 and showed no degradation (RNA integrity number ≥ 7.0) were used to generate labeled targets. Microarray Hybridization and Data Analysis The RNA sample from each group was hybridized to an Agilent Porcine 4 × 44 K 1-color gene expression microarray (catalog number 026440; Agilent Technologies) containing 43,603 probe sets, as described in Gene Expression Omnibus (www.ncbi.nlm.nih.gov/geo/). Therefore, 8 BeadChips were used in total, 4 for each of suckling and weaning groups. Total RNA was amplified and labeled using a Low Input Quick Amp Labeling Kit (Agilent Technologies), following the manufacturer's instructions. A green fluorescent dye Cy3 was used to label the samples from the suckling and the weaned individuals. After 17 h of hybridization, slides were washed with a Gene Expression Wash Buffer Kit (Agilent Technologies), following the manufacturer's instructions. The slides were then scanned on an Agilent Microarray Scanner (Agilent Technologies), and data were extracted with Feature Extraction Software 10.7 (Agilent Technologies). Raw data were normalized using a quantile algorithm, Gene Spring Software 11.0 (Agilent Technologies). Microarrays were provided by Shanghai Biochip Co., Ltd. Gene Ontogeny Category and Pathway Analysis The Shanghai Biotechnologies Corporation Analysis System (SAS; http://sas.ebioservice.com) was used to further identify the differentially expressed genes between the weaned and the suckling pigs by comparing the log2 (normalized signal) of 2 groups, and the genes with values of P < 0.05 were extracted. To further clarify the function of the differentially expressed genes in this study, transcripts were first annotated to pig (ssc), and then other significant transcripts were annotated against human (hsa), mouse (mmu), and rat (rno) genes. Highly expressed genes expressed in weaned pigs that showed at least a 1.5-fold higher or lower expression level than in those of suckling pigs were selected for further study. The data discussed in this study have been deposited in the National Center for Biotechnology Information Gene Expression Omnibus with accession number GSE48050. Additionally, the differentially expressed genes identified between the 2 groups were mapped to Gene Ontology (GO; www.geneontology.org/) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG; www.genome.jp/kegg/) pathways to identify potential pathways associated with weaning treatment. In addition, P values < 0.05 and a false discovery rate < 0.05 were considered statistically significant. Gene Network Analysis The gene network analysis of the differentially expressed genes involved in significant pathways was performed using the KEGG database. Keen interest was paid to the apoptosis or cell cycle pathways. The gene-to-gene or protein-to-protein interaction information in the database was also analyzed, and gene networks were established. Confirmation of BeadChip Results by Quantitative Real-Time PCR Based on the analysis above, quantitative real-time PCR (qRT-PCR) was used to verify the potential apoptosis- and cell cycle control-related genes in jejunum tissues of those pigs analyzed with microarrays and to exclude any false positives in the microarray results. According to the relevant studies and network analysis results, specific genes were selected for verification. Primers were designed to amplify sequences of 100 to 250 bp (Table 1) using primer design software (Primer Premier 5.0; PREMIER Biosoft International, Palo Alto, CA). Amplification efficiencies were calculated based on the slope of the line E = 10(–1/slope) – 1, considering an ideal value range (0.95 ≤ E ≤ 1.05). Reactions were performed in a volume of 20 μL with Prime Script RT Master Mix (TaKaRa, Otsu, Japan), according to the manufacturer's instructions, and performed in an Eppendorf Mastercycler ep Realplex Real-Time Quantitative PCR System (Eppendorf, Germany). Amplification conditions were 95°C for 30 s, 35 cycles of 95°C for 5 s, annealing for 15 s, and 72°C for 10 s followed by melting curve analysis. Each sample and no template controls were run in triplicate. Beta-actin and β-2-microglobulin were also amplified with the target genes under the same conditions as the internal controls to normalize the reactions. After completion of the PCR amplification, the relative fold change after weaning was calculated based on the 2–(ΔΔCt) method (Livak and Schmittgen, 2001) and normalized against β-actin and β-2-microglobulin. Reported fold changes in expression are the ratios of treatment over control suckling values. For each gene, expression values between groups were compared with a t test, and differences were considered significant at P < 0.05. Table 1. Specific primer sequences used in real-time quantitative real-time PCR Gene name1  GenBank  Primer (5′–3′)  Product (bp)  E2F5  XM_001924905  TCCAGAAATGGGTCAGAATG  226      GATATGTTGCTCAGGCAGGT    IL-8  NM_213867  AACTGGCTGTTGCCTTCTTG  252      CCTTCTGCACCCACTTTTCC    Smad4  NM_214072  CGGTGTTGATGACCTTCGT  169      GGCAATAGGCATGGTATGA    NFATC2  NM_001113452  TGGTGCCTGCCATTCCTATCT  161      GGCTCCTCGGCTACCTTCTG    NOS2  NM_001143690  CTCAAATCGCAGCAGAATC  242      TTGTCCTTGACCCAGTAGC    TNF-α  NM_214022  ACGCTCTTCTGCCTACTGC  162      TCCCTCGGCTTTGACATT    ATM  NM_001123080  CTCACAAACAAGCCGATCCA  179      TCAACTCCAGCCAGAAAGCA    CYCS  NM_001129970  TCCCCTCCTACAGAGATGGTT  165      ATGAGATAGCAAAGGGATCGT    B2M  NM_213978  TTCACACCGCTCCAGTAG  166      CCAGATACATAGCAGTTCAGG    β-actin  DQ452569.1  GGACCTGACCGACTACCTCAT  181      GGGCAGCTCGTAGCTCTTCT    Gene name1  GenBank  Primer (5′–3′)  Product (bp)  E2F5  XM_001924905  TCCAGAAATGGGTCAGAATG  226      GATATGTTGCTCAGGCAGGT    IL-8  NM_213867  AACTGGCTGTTGCCTTCTTG  252      CCTTCTGCACCCACTTTTCC    Smad4  NM_214072  CGGTGTTGATGACCTTCGT  169      GGCAATAGGCATGGTATGA    NFATC2  NM_001113452  TGGTGCCTGCCATTCCTATCT  161      GGCTCCTCGGCTACCTTCTG    NOS2  NM_001143690  CTCAAATCGCAGCAGAATC  242      TTGTCCTTGACCCAGTAGC    TNF-α  NM_214022  ACGCTCTTCTGCCTACTGC  162      TCCCTCGGCTTTGACATT    ATM  NM_001123080  CTCACAAACAAGCCGATCCA  179      TCAACTCCAGCCAGAAAGCA    CYCS  NM_001129970  TCCCCTCCTACAGAGATGGTT  165      ATGAGATAGCAAAGGGATCGT    B2M  NM_213978  TTCACACCGCTCCAGTAG  166      CCAGATACATAGCAGTTCAGG    β-actin  DQ452569.1  GGACCTGACCGACTACCTCAT  181      GGGCAGCTCGTAGCTCTTCT    1NOS2 = nitric oxide synthase 2, inducible; CYCS = cytochrome c, somatic; NAFTC2 = nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2; ATM = ataxia telangiectasia mutated; TNF-α = tumor necrosis factor α; IL-8 = interleukin 8; Smad4 = SMAD family member 4; E2F5 = E2F transcription factor 5-like; B2M = beta-2-microglobulin. View Large Table 1. Specific primer sequences used in real-time quantitative real-time PCR Gene name1  GenBank  Primer (5′–3′)  Product (bp)  E2F5  XM_001924905  TCCAGAAATGGGTCAGAATG  226      GATATGTTGCTCAGGCAGGT    IL-8  NM_213867  AACTGGCTGTTGCCTTCTTG  252      CCTTCTGCACCCACTTTTCC    Smad4  NM_214072  CGGTGTTGATGACCTTCGT  169      GGCAATAGGCATGGTATGA    NFATC2  NM_001113452  TGGTGCCTGCCATTCCTATCT  161      GGCTCCTCGGCTACCTTCTG    NOS2  NM_001143690  CTCAAATCGCAGCAGAATC  242      TTGTCCTTGACCCAGTAGC    TNF-α  NM_214022  ACGCTCTTCTGCCTACTGC  162      TCCCTCGGCTTTGACATT    ATM  NM_001123080  CTCACAAACAAGCCGATCCA  179      TCAACTCCAGCCAGAAAGCA    CYCS  NM_001129970  TCCCCTCCTACAGAGATGGTT  165      ATGAGATAGCAAAGGGATCGT    B2M  NM_213978  TTCACACCGCTCCAGTAG  166      CCAGATACATAGCAGTTCAGG    β-actin  DQ452569.1  GGACCTGACCGACTACCTCAT  181      GGGCAGCTCGTAGCTCTTCT    Gene name1  GenBank  Primer (5′–3′)  Product (bp)  E2F5  XM_001924905  TCCAGAAATGGGTCAGAATG  226      GATATGTTGCTCAGGCAGGT    IL-8  NM_213867  AACTGGCTGTTGCCTTCTTG  252      CCTTCTGCACCCACTTTTCC    Smad4  NM_214072  CGGTGTTGATGACCTTCGT  169      GGCAATAGGCATGGTATGA    NFATC2  NM_001113452  TGGTGCCTGCCATTCCTATCT  161      GGCTCCTCGGCTACCTTCTG    NOS2  NM_001143690  CTCAAATCGCAGCAGAATC  242      TTGTCCTTGACCCAGTAGC    TNF-α  NM_214022  ACGCTCTTCTGCCTACTGC  162      TCCCTCGGCTTTGACATT    ATM  NM_001123080  CTCACAAACAAGCCGATCCA  179      TCAACTCCAGCCAGAAAGCA    CYCS  NM_001129970  TCCCCTCCTACAGAGATGGTT  165      ATGAGATAGCAAAGGGATCGT    B2M  NM_213978  TTCACACCGCTCCAGTAG  166      CCAGATACATAGCAGTTCAGG    β-actin  DQ452569.1  GGACCTGACCGACTACCTCAT  181      GGGCAGCTCGTAGCTCTTCT    1NOS2 = nitric oxide synthase 2, inducible; CYCS = cytochrome c, somatic; NAFTC2 = nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2; ATM = ataxia telangiectasia mutated; TNF-α = tumor necrosis factor α; IL-8 = interleukin 8; Smad4 = SMAD family member 4; E2F5 = E2F transcription factor 5-like; B2M = beta-2-microglobulin. View Large RESULTS Transcriptome To identify candidate genes associated with weaning response, Agilent Porcine 1-color gene expression microarrays were used to study gene expression profiles after weaning in pigs. We identified 445 annotated transcripts that were differentially expressed between the weaned and the suckling jejunums at the cutoff criteria of the fold change ≥1.5 or < 0.67 and P < 0.05 (using the 2-sample t statistical test). Among these genes, 286 genes were upregulated and 159 genes were downregulated (Supplementary File 1). Most of these genes are cellular process related and regulators that may be involved in cellular binding, translation regulation, catalytic activity, biological regulation, developmental processes, and metabolic process. Other genes that were found to be differentially expressed are closely related to immune responses. Among the most interesting findings were that highly abundant transcripts in weaned pigs were highly enriched in functions related to cellular processes and with roles in cell differentiation, motion, cell death, and the cell cycle. In Table 2 and Table 3, most of the differentially expressed genes related to cell cycle regulation are listed. Among these genes are some oncogenes, for example, caspase-10, tumor necrosis factor (TNF), interleukin 8 (IL-8), and ataxia telangiectasia mutated (ATM) are upregulated whereas cell cycle regulators such as E2F transcription factor 5-like (E2F5) and SMAD family member 4 (Smad4) are downregulated. Table 2. Fold changes and P-values for the upregulated cellular process-related genes in weaned pigs versus suckling pigs Gene  NCBI no.  Description  P-value  Fold change  CYP1A1  NM_214412  cytochrome P450 1A1  0.0009  21.4000  NOS2  NM_001143690  nitric oxide synthase 2, inducible  0.0066  8.1900  CSTB  NM_001097496  cystatin B (stefin B)  0.0029  7.2817  TEX11  XM_003484125  testis expressed 11  0.0121  3.7868  NFATC2  NM_001113452  nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2  0.0357  3.5955  AREG  NM_214376  amphiregulin  0.0038  3.4800  LIFR-beta  U97364  leukemia inhibitory factor receptor beta  0.0091  2.8226  IFNB1  NM_001003923  interferon beta  0.0109  2.7857  CYCS  NM_001129970  cytochrome c, somatic  0.0041  2.5381  PSMC5  XM_001925501  proteasome (prosome, macropain) 26S subunit, ATPase, 5  0.0001  2.5314  TDRD1  XM_001927041  tudor domain-containing protein 1-like  0.0350  2.4912  TNF  NM_214022  tumor necrosis factor  0.0008  2.4013  FCAR  NM_001123112  Fc fragment of IgA, receptor for  0.0474  2.3783  IL8  NM_213867  interleukin 8  0.0134  2.3620  ATM  NM_001123080  ataxia telangiectasia mutated  0.0388  2.2134  SH2B3  XM_001929523  SH2B adaptor protein 3  0.0048  2.1362  PVRL1  NM_001001262  poliovirus receptor-related 1 (herpesvirus entry mediator C)  0.0362  2.0915  TXNRD1  NM_214154  thioredoxin reductase 1  0.0124  2.0607  CSF2  NM_214118  colony stimulating factor 2 (granulocyte-macrophage)  0.0007  2.1500  ANG  NM_001044573  angiogenin  0.0380  2.0878  CCL24  NM_001161434  chemokine ligand 24-like protein  0.0183  2.0400  CCDC99  XM_003134063  coiled-coil domain containing 99  0.0467  2.0403  ADCYAP1  NM_001001544  adenylate cyclase activating polypeptide 1 (pituitary)  0.0298  2.0058  GBP2  NM_001128474  guanylate binding protein 2, interferon-inducible  0.0103  1.9568  AATK  XM_003357943  apoptosis-associated tyrosine kinase  0.0416  1.9276  GAL  NM_214234  galanin prepropeptide  0.0117  1.9151  TBK1  NM_001105292  TANK-binding kinase 1  0.0262  1.9134  BAD  XM_003122573  bcl2 antagonist of cell death-like  0.0000  1.8911  PSMA4  NM_001244468  proteasome (prosome, macropain) subunit, alpha type, 4  0.0126  1.8909  PSMB3  NM_001144902  proteasome (prosome, macropain) subunit, beta type, 3  0.0176  1.8866  SMN1  NM_001130735  survival of motor neuron 1, telomeric  0.0015  1.8325  TIAM1  XM_003132751  T-lymphoma invasion and metastasis-inducing protein 1-like  0.0214  1.8163  PF4  XM_003126161  platelet factor 4-like  0.0350  1.8076  ANAPC1  XM_003124813  anaphase promoting complex subunit 1  0.0040  1.7896  ERH  NM_001185163  enhancer of rudimentary homolog (Drosophila)  0.0033  1.7437  MTBP  XM_001924836  Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104 kDa  0.0204  1.7202  TRIM35  XM_001928380  tripartite motif containing 35  0.0060  1.6604  0ITGB2  NM_213908  integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)  0.0119  1.6589  RIPK1  XM_003128161  receptor (TNFRSF)-interacting serine-threonine kinase 1  0.0000  1.6500  TCF19  NM_001167591  transcription factor 19  0.0475  1.6466  PSMB8  NM_213935.1  proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)  0.0400  1.6410  IFI30  NM_001131046  interferon, gamma-inducible protein 30  0.0155  1.6241  LCP1  XM_001929138  lymphocyte cytosolic protein 1 (L-plastin)  0.0116  1.6210  BMP7  NM_001105290  bone morphogenetic protein 7  0.0138  1.6040  TIMP1  NM_213857  TIMP metallopeptidase inhibitor 1  0.0049  1.6002  IRF8  NM_001252427  interferon regulatory factor 8  0.0301  1.5952  PPP3CC  XM_003483381  protein phosphatase 3, catalytic subunit, gamma isozyme, transcript variant 2  0.0010  1.5800  SFRS5  XM_003360745  serine/arginine-rich splicing factor 5  0.0354  1.5752  PSMA3  XM_001927990  multicatalytic proteinase subunit K  0.0003  1.5319  Caspase-10  NM_001161640  caspase 10, apoptosis-related cysteine peptidase  0.0100  1.5300  VAV2  XM_001927141  vav 2 guanine nucleotide exchange factor  0.0020  1.5200  CDKN3  NM_214320  cyclin-dependent kinase inhibitor 3  0.0489  1.5057  CCAR1  XM_001928522  cell division cycle and apoptosis regulator 1  0.0390  1.5007  Gene  NCBI no.  Description  P-value  Fold change  CYP1A1  NM_214412  cytochrome P450 1A1  0.0009  21.4000  NOS2  NM_001143690  nitric oxide synthase 2, inducible  0.0066  8.1900  CSTB  NM_001097496  cystatin B (stefin B)  0.0029  7.2817  TEX11  XM_003484125  testis expressed 11  0.0121  3.7868  NFATC2  NM_001113452  nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2  0.0357  3.5955  AREG  NM_214376  amphiregulin  0.0038  3.4800  LIFR-beta  U97364  leukemia inhibitory factor receptor beta  0.0091  2.8226  IFNB1  NM_001003923  interferon beta  0.0109  2.7857  CYCS  NM_001129970  cytochrome c, somatic  0.0041  2.5381  PSMC5  XM_001925501  proteasome (prosome, macropain) 26S subunit, ATPase, 5  0.0001  2.5314  TDRD1  XM_001927041  tudor domain-containing protein 1-like  0.0350  2.4912  TNF  NM_214022  tumor necrosis factor  0.0008  2.4013  FCAR  NM_001123112  Fc fragment of IgA, receptor for  0.0474  2.3783  IL8  NM_213867  interleukin 8  0.0134  2.3620  ATM  NM_001123080  ataxia telangiectasia mutated  0.0388  2.2134  SH2B3  XM_001929523  SH2B adaptor protein 3  0.0048  2.1362  PVRL1  NM_001001262  poliovirus receptor-related 1 (herpesvirus entry mediator C)  0.0362  2.0915  TXNRD1  NM_214154  thioredoxin reductase 1  0.0124  2.0607  CSF2  NM_214118  colony stimulating factor 2 (granulocyte-macrophage)  0.0007  2.1500  ANG  NM_001044573  angiogenin  0.0380  2.0878  CCL24  NM_001161434  chemokine ligand 24-like protein  0.0183  2.0400  CCDC99  XM_003134063  coiled-coil domain containing 99  0.0467  2.0403  ADCYAP1  NM_001001544  adenylate cyclase activating polypeptide 1 (pituitary)  0.0298  2.0058  GBP2  NM_001128474  guanylate binding protein 2, interferon-inducible  0.0103  1.9568  AATK  XM_003357943  apoptosis-associated tyrosine kinase  0.0416  1.9276  GAL  NM_214234  galanin prepropeptide  0.0117  1.9151  TBK1  NM_001105292  TANK-binding kinase 1  0.0262  1.9134  BAD  XM_003122573  bcl2 antagonist of cell death-like  0.0000  1.8911  PSMA4  NM_001244468  proteasome (prosome, macropain) subunit, alpha type, 4  0.0126  1.8909  PSMB3  NM_001144902  proteasome (prosome, macropain) subunit, beta type, 3  0.0176  1.8866  SMN1  NM_001130735  survival of motor neuron 1, telomeric  0.0015  1.8325  TIAM1  XM_003132751  T-lymphoma invasion and metastasis-inducing protein 1-like  0.0214  1.8163  PF4  XM_003126161  platelet factor 4-like  0.0350  1.8076  ANAPC1  XM_003124813  anaphase promoting complex subunit 1  0.0040  1.7896  ERH  NM_001185163  enhancer of rudimentary homolog (Drosophila)  0.0033  1.7437  MTBP  XM_001924836  Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104 kDa  0.0204  1.7202  TRIM35  XM_001928380  tripartite motif containing 35  0.0060  1.6604  0ITGB2  NM_213908  integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)  0.0119  1.6589  RIPK1  XM_003128161  receptor (TNFRSF)-interacting serine-threonine kinase 1  0.0000  1.6500  TCF19  NM_001167591  transcription factor 19  0.0475  1.6466  PSMB8  NM_213935.1  proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)  0.0400  1.6410  IFI30  NM_001131046  interferon, gamma-inducible protein 30  0.0155  1.6241  LCP1  XM_001929138  lymphocyte cytosolic protein 1 (L-plastin)  0.0116  1.6210  BMP7  NM_001105290  bone morphogenetic protein 7  0.0138  1.6040  TIMP1  NM_213857  TIMP metallopeptidase inhibitor 1  0.0049  1.6002  IRF8  NM_001252427  interferon regulatory factor 8  0.0301  1.5952  PPP3CC  XM_003483381  protein phosphatase 3, catalytic subunit, gamma isozyme, transcript variant 2  0.0010  1.5800  SFRS5  XM_003360745  serine/arginine-rich splicing factor 5  0.0354  1.5752  PSMA3  XM_001927990  multicatalytic proteinase subunit K  0.0003  1.5319  Caspase-10  NM_001161640  caspase 10, apoptosis-related cysteine peptidase  0.0100  1.5300  VAV2  XM_001927141  vav 2 guanine nucleotide exchange factor  0.0020  1.5200  CDKN3  NM_214320  cyclin-dependent kinase inhibitor 3  0.0489  1.5057  CCAR1  XM_001928522  cell division cycle and apoptosis regulator 1  0.0390  1.5007  1NCBI = National Center for Biotechnology Information. View Large Table 2. Fold changes and P-values for the upregulated cellular process-related genes in weaned pigs versus suckling pigs Gene  NCBI no.  Description  P-value  Fold change  CYP1A1  NM_214412  cytochrome P450 1A1  0.0009  21.4000  NOS2  NM_001143690  nitric oxide synthase 2, inducible  0.0066  8.1900  CSTB  NM_001097496  cystatin B (stefin B)  0.0029  7.2817  TEX11  XM_003484125  testis expressed 11  0.0121  3.7868  NFATC2  NM_001113452  nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2  0.0357  3.5955  AREG  NM_214376  amphiregulin  0.0038  3.4800  LIFR-beta  U97364  leukemia inhibitory factor receptor beta  0.0091  2.8226  IFNB1  NM_001003923  interferon beta  0.0109  2.7857  CYCS  NM_001129970  cytochrome c, somatic  0.0041  2.5381  PSMC5  XM_001925501  proteasome (prosome, macropain) 26S subunit, ATPase, 5  0.0001  2.5314  TDRD1  XM_001927041  tudor domain-containing protein 1-like  0.0350  2.4912  TNF  NM_214022  tumor necrosis factor  0.0008  2.4013  FCAR  NM_001123112  Fc fragment of IgA, receptor for  0.0474  2.3783  IL8  NM_213867  interleukin 8  0.0134  2.3620  ATM  NM_001123080  ataxia telangiectasia mutated  0.0388  2.2134  SH2B3  XM_001929523  SH2B adaptor protein 3  0.0048  2.1362  PVRL1  NM_001001262  poliovirus receptor-related 1 (herpesvirus entry mediator C)  0.0362  2.0915  TXNRD1  NM_214154  thioredoxin reductase 1  0.0124  2.0607  CSF2  NM_214118  colony stimulating factor 2 (granulocyte-macrophage)  0.0007  2.1500  ANG  NM_001044573  angiogenin  0.0380  2.0878  CCL24  NM_001161434  chemokine ligand 24-like protein  0.0183  2.0400  CCDC99  XM_003134063  coiled-coil domain containing 99  0.0467  2.0403  ADCYAP1  NM_001001544  adenylate cyclase activating polypeptide 1 (pituitary)  0.0298  2.0058  GBP2  NM_001128474  guanylate binding protein 2, interferon-inducible  0.0103  1.9568  AATK  XM_003357943  apoptosis-associated tyrosine kinase  0.0416  1.9276  GAL  NM_214234  galanin prepropeptide  0.0117  1.9151  TBK1  NM_001105292  TANK-binding kinase 1  0.0262  1.9134  BAD  XM_003122573  bcl2 antagonist of cell death-like  0.0000  1.8911  PSMA4  NM_001244468  proteasome (prosome, macropain) subunit, alpha type, 4  0.0126  1.8909  PSMB3  NM_001144902  proteasome (prosome, macropain) subunit, beta type, 3  0.0176  1.8866  SMN1  NM_001130735  survival of motor neuron 1, telomeric  0.0015  1.8325  TIAM1  XM_003132751  T-lymphoma invasion and metastasis-inducing protein 1-like  0.0214  1.8163  PF4  XM_003126161  platelet factor 4-like  0.0350  1.8076  ANAPC1  XM_003124813  anaphase promoting complex subunit 1  0.0040  1.7896  ERH  NM_001185163  enhancer of rudimentary homolog (Drosophila)  0.0033  1.7437  MTBP  XM_001924836  Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104 kDa  0.0204  1.7202  TRIM35  XM_001928380  tripartite motif containing 35  0.0060  1.6604  0ITGB2  NM_213908  integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)  0.0119  1.6589  RIPK1  XM_003128161  receptor (TNFRSF)-interacting serine-threonine kinase 1  0.0000  1.6500  TCF19  NM_001167591  transcription factor 19  0.0475  1.6466  PSMB8  NM_213935.1  proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)  0.0400  1.6410  IFI30  NM_001131046  interferon, gamma-inducible protein 30  0.0155  1.6241  LCP1  XM_001929138  lymphocyte cytosolic protein 1 (L-plastin)  0.0116  1.6210  BMP7  NM_001105290  bone morphogenetic protein 7  0.0138  1.6040  TIMP1  NM_213857  TIMP metallopeptidase inhibitor 1  0.0049  1.6002  IRF8  NM_001252427  interferon regulatory factor 8  0.0301  1.5952  PPP3CC  XM_003483381  protein phosphatase 3, catalytic subunit, gamma isozyme, transcript variant 2  0.0010  1.5800  SFRS5  XM_003360745  serine/arginine-rich splicing factor 5  0.0354  1.5752  PSMA3  XM_001927990  multicatalytic proteinase subunit K  0.0003  1.5319  Caspase-10  NM_001161640  caspase 10, apoptosis-related cysteine peptidase  0.0100  1.5300  VAV2  XM_001927141  vav 2 guanine nucleotide exchange factor  0.0020  1.5200  CDKN3  NM_214320  cyclin-dependent kinase inhibitor 3  0.0489  1.5057  CCAR1  XM_001928522  cell division cycle and apoptosis regulator 1  0.0390  1.5007  Gene  NCBI no.  Description  P-value  Fold change  CYP1A1  NM_214412  cytochrome P450 1A1  0.0009  21.4000  NOS2  NM_001143690  nitric oxide synthase 2, inducible  0.0066  8.1900  CSTB  NM_001097496  cystatin B (stefin B)  0.0029  7.2817  TEX11  XM_003484125  testis expressed 11  0.0121  3.7868  NFATC2  NM_001113452  nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2  0.0357  3.5955  AREG  NM_214376  amphiregulin  0.0038  3.4800  LIFR-beta  U97364  leukemia inhibitory factor receptor beta  0.0091  2.8226  IFNB1  NM_001003923  interferon beta  0.0109  2.7857  CYCS  NM_001129970  cytochrome c, somatic  0.0041  2.5381  PSMC5  XM_001925501  proteasome (prosome, macropain) 26S subunit, ATPase, 5  0.0001  2.5314  TDRD1  XM_001927041  tudor domain-containing protein 1-like  0.0350  2.4912  TNF  NM_214022  tumor necrosis factor  0.0008  2.4013  FCAR  NM_001123112  Fc fragment of IgA, receptor for  0.0474  2.3783  IL8  NM_213867  interleukin 8  0.0134  2.3620  ATM  NM_001123080  ataxia telangiectasia mutated  0.0388  2.2134  SH2B3  XM_001929523  SH2B adaptor protein 3  0.0048  2.1362  PVRL1  NM_001001262  poliovirus receptor-related 1 (herpesvirus entry mediator C)  0.0362  2.0915  TXNRD1  NM_214154  thioredoxin reductase 1  0.0124  2.0607  CSF2  NM_214118  colony stimulating factor 2 (granulocyte-macrophage)  0.0007  2.1500  ANG  NM_001044573  angiogenin  0.0380  2.0878  CCL24  NM_001161434  chemokine ligand 24-like protein  0.0183  2.0400  CCDC99  XM_003134063  coiled-coil domain containing 99  0.0467  2.0403  ADCYAP1  NM_001001544  adenylate cyclase activating polypeptide 1 (pituitary)  0.0298  2.0058  GBP2  NM_001128474  guanylate binding protein 2, interferon-inducible  0.0103  1.9568  AATK  XM_003357943  apoptosis-associated tyrosine kinase  0.0416  1.9276  GAL  NM_214234  galanin prepropeptide  0.0117  1.9151  TBK1  NM_001105292  TANK-binding kinase 1  0.0262  1.9134  BAD  XM_003122573  bcl2 antagonist of cell death-like  0.0000  1.8911  PSMA4  NM_001244468  proteasome (prosome, macropain) subunit, alpha type, 4  0.0126  1.8909  PSMB3  NM_001144902  proteasome (prosome, macropain) subunit, beta type, 3  0.0176  1.8866  SMN1  NM_001130735  survival of motor neuron 1, telomeric  0.0015  1.8325  TIAM1  XM_003132751  T-lymphoma invasion and metastasis-inducing protein 1-like  0.0214  1.8163  PF4  XM_003126161  platelet factor 4-like  0.0350  1.8076  ANAPC1  XM_003124813  anaphase promoting complex subunit 1  0.0040  1.7896  ERH  NM_001185163  enhancer of rudimentary homolog (Drosophila)  0.0033  1.7437  MTBP  XM_001924836  Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104 kDa  0.0204  1.7202  TRIM35  XM_001928380  tripartite motif containing 35  0.0060  1.6604  0ITGB2  NM_213908  integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)  0.0119  1.6589  RIPK1  XM_003128161  receptor (TNFRSF)-interacting serine-threonine kinase 1  0.0000  1.6500  TCF19  NM_001167591  transcription factor 19  0.0475  1.6466  PSMB8  NM_213935.1  proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)  0.0400  1.6410  IFI30  NM_001131046  interferon, gamma-inducible protein 30  0.0155  1.6241  LCP1  XM_001929138  lymphocyte cytosolic protein 1 (L-plastin)  0.0116  1.6210  BMP7  NM_001105290  bone morphogenetic protein 7  0.0138  1.6040  TIMP1  NM_213857  TIMP metallopeptidase inhibitor 1  0.0049  1.6002  IRF8  NM_001252427  interferon regulatory factor 8  0.0301  1.5952  PPP3CC  XM_003483381  protein phosphatase 3, catalytic subunit, gamma isozyme, transcript variant 2  0.0010  1.5800  SFRS5  XM_003360745  serine/arginine-rich splicing factor 5  0.0354  1.5752  PSMA3  XM_001927990  multicatalytic proteinase subunit K  0.0003  1.5319  Caspase-10  NM_001161640  caspase 10, apoptosis-related cysteine peptidase  0.0100  1.5300  VAV2  XM_001927141  vav 2 guanine nucleotide exchange factor  0.0020  1.5200  CDKN3  NM_214320  cyclin-dependent kinase inhibitor 3  0.0489  1.5057  CCAR1  XM_001928522  cell division cycle and apoptosis regulator 1  0.0390  1.5007  1NCBI = National Center for Biotechnology Information. View Large Table 3. Fold changes and P-values for the downregulated cellular process-related genes in weaned pigs versus suckling pigs Gene  NCBI1 no.  Description  P-value  Fold change  FOXO3  NM_001135959  forkhead box O3  0.0097  0.6333  RRAGC  XM_003127801  Ras-related GTP binding C  0.0415  0.6239  MACF1  XM_003127807  microtubule-actin crosslinking factor 1, transcript variant 1  0.0017  0.6237  ACVR1  XM_001927798  activin A receptor, type I  0.0143  0.6210  SOS2  XM_001925014  son of sevenless homolog 2 (Drosophila)  0.0000  0.6200  SMAD4  NM_214072  SMAD family member 4  0.0374  0.6050  NEUROD1  XM_003359578  neurogenic differentiation 1  0.0393  0.6026  ESR1  NM_214220  estrogen receptor 1  0.0208  0.5824  EXO1  XM_003130555  exonuclease 1  0.0289  0.5713  ALB  NM_001005208  albumin  0.0100  0.5700  TXNIP  NM_214313.2  thioredoxin interacting protein  0.0196  0.5622  C8B  NM_001097451  complement component 8, beta polypeptide  0.0171  0.5570  NOTCH2  XM_003481477  notch 2  0.0039  0.5542  CTNNBL1  HQ403605  catenin beta-like 1 protein  0.0097  0.5500  LTA  NM_214453  lymphotoxin alpha (tumor necrosis factor superfamily, member 1)  0.0119  0.5400  VEGFA  NM_214084  vascular endothelial growth factor A  0.0144  0.5293  HORMAD1  NM_001194981  HORMA domain containing 1  0.0171  0.5065  MMD  NM_001044595  monocyte to macrophage differentiation-associated  0.0219  0.5029  c-JUN  NM_213880  c-jun oncogene  0.0129  0.4329  CCK  NM_214237  cholecystokinin  0.0164  0.4281  CDC23  NM_001267826  cell division cycle 23 homolog (S. cerevisiae)  0.0482  0.4112  CCR6  DQ991099  chemokine (C-C motif) receptor 6  0.0163  0.3474  STRADB  XM_003133587  STE20-related kinase adaptor beta  0.0274  0.3407  E2F5  XM_001924905  E2F transcription factor 5-like  0.0148  0.3162  GPX2  NM_001115136  glutathione peroxidase 2 (gastrointestinal)  0.0285  0.2244  PHGDH  NM_001123162  phosphoglycerate dehydrogenase  0.0343  0.2134  F12  NM_214242  coagulation factor XII (Hageman factor)  0.0471  0.0952  Gene  NCBI1 no.  Description  P-value  Fold change  FOXO3  NM_001135959  forkhead box O3  0.0097  0.6333  RRAGC  XM_003127801  Ras-related GTP binding C  0.0415  0.6239  MACF1  XM_003127807  microtubule-actin crosslinking factor 1, transcript variant 1  0.0017  0.6237  ACVR1  XM_001927798  activin A receptor, type I  0.0143  0.6210  SOS2  XM_001925014  son of sevenless homolog 2 (Drosophila)  0.0000  0.6200  SMAD4  NM_214072  SMAD family member 4  0.0374  0.6050  NEUROD1  XM_003359578  neurogenic differentiation 1  0.0393  0.6026  ESR1  NM_214220  estrogen receptor 1  0.0208  0.5824  EXO1  XM_003130555  exonuclease 1  0.0289  0.5713  ALB  NM_001005208  albumin  0.0100  0.5700  TXNIP  NM_214313.2  thioredoxin interacting protein  0.0196  0.5622  C8B  NM_001097451  complement component 8, beta polypeptide  0.0171  0.5570  NOTCH2  XM_003481477  notch 2  0.0039  0.5542  CTNNBL1  HQ403605  catenin beta-like 1 protein  0.0097  0.5500  LTA  NM_214453  lymphotoxin alpha (tumor necrosis factor superfamily, member 1)  0.0119  0.5400  VEGFA  NM_214084  vascular endothelial growth factor A  0.0144  0.5293  HORMAD1  NM_001194981  HORMA domain containing 1  0.0171  0.5065  MMD  NM_001044595  monocyte to macrophage differentiation-associated  0.0219  0.5029  c-JUN  NM_213880  c-jun oncogene  0.0129  0.4329  CCK  NM_214237  cholecystokinin  0.0164  0.4281  CDC23  NM_001267826  cell division cycle 23 homolog (S. cerevisiae)  0.0482  0.4112  CCR6  DQ991099  chemokine (C-C motif) receptor 6  0.0163  0.3474  STRADB  XM_003133587  STE20-related kinase adaptor beta  0.0274  0.3407  E2F5  XM_001924905  E2F transcription factor 5-like  0.0148  0.3162  GPX2  NM_001115136  glutathione peroxidase 2 (gastrointestinal)  0.0285  0.2244  PHGDH  NM_001123162  phosphoglycerate dehydrogenase  0.0343  0.2134  F12  NM_214242  coagulation factor XII (Hageman factor)  0.0471  0.0952  1NCBI = National Center for Biotechnology Information. View Large Table 3. Fold changes and P-values for the downregulated cellular process-related genes in weaned pigs versus suckling pigs Gene  NCBI1 no.  Description  P-value  Fold change  FOXO3  NM_001135959  forkhead box O3  0.0097  0.6333  RRAGC  XM_003127801  Ras-related GTP binding C  0.0415  0.6239  MACF1  XM_003127807  microtubule-actin crosslinking factor 1, transcript variant 1  0.0017  0.6237  ACVR1  XM_001927798  activin A receptor, type I  0.0143  0.6210  SOS2  XM_001925014  son of sevenless homolog 2 (Drosophila)  0.0000  0.6200  SMAD4  NM_214072  SMAD family member 4  0.0374  0.6050  NEUROD1  XM_003359578  neurogenic differentiation 1  0.0393  0.6026  ESR1  NM_214220  estrogen receptor 1  0.0208  0.5824  EXO1  XM_003130555  exonuclease 1  0.0289  0.5713  ALB  NM_001005208  albumin  0.0100  0.5700  TXNIP  NM_214313.2  thioredoxin interacting protein  0.0196  0.5622  C8B  NM_001097451  complement component 8, beta polypeptide  0.0171  0.5570  NOTCH2  XM_003481477  notch 2  0.0039  0.5542  CTNNBL1  HQ403605  catenin beta-like 1 protein  0.0097  0.5500  LTA  NM_214453  lymphotoxin alpha (tumor necrosis factor superfamily, member 1)  0.0119  0.5400  VEGFA  NM_214084  vascular endothelial growth factor A  0.0144  0.5293  HORMAD1  NM_001194981  HORMA domain containing 1  0.0171  0.5065  MMD  NM_001044595  monocyte to macrophage differentiation-associated  0.0219  0.5029  c-JUN  NM_213880  c-jun oncogene  0.0129  0.4329  CCK  NM_214237  cholecystokinin  0.0164  0.4281  CDC23  NM_001267826  cell division cycle 23 homolog (S. cerevisiae)  0.0482  0.4112  CCR6  DQ991099  chemokine (C-C motif) receptor 6  0.0163  0.3474  STRADB  XM_003133587  STE20-related kinase adaptor beta  0.0274  0.3407  E2F5  XM_001924905  E2F transcription factor 5-like  0.0148  0.3162  GPX2  NM_001115136  glutathione peroxidase 2 (gastrointestinal)  0.0285  0.2244  PHGDH  NM_001123162  phosphoglycerate dehydrogenase  0.0343  0.2134  F12  NM_214242  coagulation factor XII (Hageman factor)  0.0471  0.0952  Gene  NCBI1 no.  Description  P-value  Fold change  FOXO3  NM_001135959  forkhead box O3  0.0097  0.6333  RRAGC  XM_003127801  Ras-related GTP binding C  0.0415  0.6239  MACF1  XM_003127807  microtubule-actin crosslinking factor 1, transcript variant 1  0.0017  0.6237  ACVR1  XM_001927798  activin A receptor, type I  0.0143  0.6210  SOS2  XM_001925014  son of sevenless homolog 2 (Drosophila)  0.0000  0.6200  SMAD4  NM_214072  SMAD family member 4  0.0374  0.6050  NEUROD1  XM_003359578  neurogenic differentiation 1  0.0393  0.6026  ESR1  NM_214220  estrogen receptor 1  0.0208  0.5824  EXO1  XM_003130555  exonuclease 1  0.0289  0.5713  ALB  NM_001005208  albumin  0.0100  0.5700  TXNIP  NM_214313.2  thioredoxin interacting protein  0.0196  0.5622  C8B  NM_001097451  complement component 8, beta polypeptide  0.0171  0.5570  NOTCH2  XM_003481477  notch 2  0.0039  0.5542  CTNNBL1  HQ403605  catenin beta-like 1 protein  0.0097  0.5500  LTA  NM_214453  lymphotoxin alpha (tumor necrosis factor superfamily, member 1)  0.0119  0.5400  VEGFA  NM_214084  vascular endothelial growth factor A  0.0144  0.5293  HORMAD1  NM_001194981  HORMA domain containing 1  0.0171  0.5065  MMD  NM_001044595  monocyte to macrophage differentiation-associated  0.0219  0.5029  c-JUN  NM_213880  c-jun oncogene  0.0129  0.4329  CCK  NM_214237  cholecystokinin  0.0164  0.4281  CDC23  NM_001267826  cell division cycle 23 homolog (S. cerevisiae)  0.0482  0.4112  CCR6  DQ991099  chemokine (C-C motif) receptor 6  0.0163  0.3474  STRADB  XM_003133587  STE20-related kinase adaptor beta  0.0274  0.3407  E2F5  XM_001924905  E2F transcription factor 5-like  0.0148  0.3162  GPX2  NM_001115136  glutathione peroxidase 2 (gastrointestinal)  0.0285  0.2244  PHGDH  NM_001123162  phosphoglycerate dehydrogenase  0.0343  0.2134  F12  NM_214242  coagulation factor XII (Hageman factor)  0.0471  0.0952  1NCBI = National Center for Biotechnology Information. View Large Gene Ontology Category Analysis The functional annotations of the differentially expressed genes were classified in terms of biological process with SAS tools for the overrepresentation of specific GO terms. The results are expressed as bar charts and are shown in Fig. 1. The differentially expressed genes enriched in biological processes were mainly involved in cellular processes, biological regulation, metabolic processes, the regulation of biological processes, and so on (Fig. 1A). In particular, the genes associated with cellular processes (Fig. 1B) mainly related to cell communication, cell adhesion, cell death, cellular component organization, cell cycle, and cellular metabolic processes were highly enriched among the differentially expressed genes, which indicated an active cellular process in the enterocytes of weaned pigs. Figure 1. View largeDownload slide Functional category of differentially expressed transcripts induced by weaning in pigs. (A) Gene ontology (GO) biological processes for significantly differentially expressed genes. (B) Gene ontology categories of cellular processes. P value < 0.05 and false discovery rate < 0.05 were used as thresholds to select significant GO categories. Figure 1. View largeDownload slide Functional category of differentially expressed transcripts induced by weaning in pigs. (A) Gene ontology (GO) biological processes for significantly differentially expressed genes. (B) Gene ontology categories of cellular processes. P value < 0.05 and false discovery rate < 0.05 were used as thresholds to select significant GO categories. Kyoto Encyclopedia of Genes and Genomes Pathway Analyses As shown in Table 4, by using the KEGG database, the significant pathways were found to mainly contain cellular process (cell growth and death, cell communication, and cell motility), signal transduction (MAPK signaling pathway and Jak-STAT signaling pathway), signaling molecules and interaction, and several pathways associated with the immune response (chemokine signaling pathway, Toll-like receptor signaling pathway, T cell receptor signaling pathway, B cell receptor signaling pathway, and natural killer cell-mediated cytotoxicity). Among these pathways, cellular processes may play an important role in the jejunum after weaning. Table 4. Top Kyoto Encyclopedia of Genes and Genomes pathways enriched with differentially expressed genes induced by weaning Associated terms  Pathway name1  Hits  FDR2  P-value  Cell communication  Focal adhesion  14  0.0000  0.0000  Cell growth and death  Cell cycle  5  0.0011  0.0420    Apoptosis  10  0.0000  0.0000  Cell motility  Regulation of actin cytoskeleton  7  0.0002  0.0024  Development  Axon guidance  8  0.0001  0.0007  Signal transduction  Wnt signaling pathway  6  0.0001  0.0018    TGF-beta signaling pathway  7  0.0001  0.0003    MAPK signaling pathway  10  0.0000  0.0001    Jak-STAT signaling pathway  8  0.0000  0.0001    ErbB signaling pathway  5  0.0001  0.0009    VEGF signaling pathway  6  0.0000  0.0001    Phosphatidylinositol signaling system  3  0.0009  0.0265  Immune system  Chemokine signaling pathway  12  0.0000  0.0000    Leukocyte transendothelial migration  5  0.0002  0.0034    Antigen processing and presentation  3  0.0012  0.0389    Toll-like receptor signaling pathway  8  0.0000  0.0000    T cell receptor signaling pathway  10  0.0000  0.0000    B cell receptor signaling pathway  8  0.0000  0.0000    Hematopoietic cell lineage  4  0.0003  0.0067    Natural killer cell mediated cytotoxicity  9  0.0000  0.0000    Fc epsilon RI signaling pathway  6  0.0000  0.0001  Lipid Metabolism  Glycerophospholipid metabolism  3  0.0010  0.0291    Ether lipid metabolism  2  0.0012  0.0361  Amino Acid Metabolism  Tryptophan metabolism  3  0.0003  0.0051    Glycine, serine and threonine metabolism  2  0.0010  0.0292  Translation  Ribosome  4  0.0003  0.0067    Aminoacyl-tRNA biosynthesis  3  0.0003  0.0054  Folding, sorting, and degradation  Ubiquitin mediated proteolysis  6  0.0001  0.0012    Proteasome  4  0.0001  0.0008  Endocrine system  Insulin signaling pathway  6  0.0001  0.0011    Progesterone-mediated oocyte maturation  3  0.0012  0.0358    PPAR signaling pathway  4  0.0002  0.0030    Adipocytokine signaling pathway  4  0.0002  0.0027  Signaling molecules and interaction  Cytokine-cytokine receptor interaction  16  0.0000  0.0000    Neuroactive ligand-receptor interaction  7  0.0006  0.0173    Cell adhesion molecules  6  0.0001  0.0010    ECM-receptor interaction  6  0.0000  0.0001  Associated terms  Pathway name1  Hits  FDR2  P-value  Cell communication  Focal adhesion  14  0.0000  0.0000  Cell growth and death  Cell cycle  5  0.0011  0.0420    Apoptosis  10  0.0000  0.0000  Cell motility  Regulation of actin cytoskeleton  7  0.0002  0.0024  Development  Axon guidance  8  0.0001  0.0007  Signal transduction  Wnt signaling pathway  6  0.0001  0.0018    TGF-beta signaling pathway  7  0.0001  0.0003    MAPK signaling pathway  10  0.0000  0.0001    Jak-STAT signaling pathway  8  0.0000  0.0001    ErbB signaling pathway  5  0.0001  0.0009    VEGF signaling pathway  6  0.0000  0.0001    Phosphatidylinositol signaling system  3  0.0009  0.0265  Immune system  Chemokine signaling pathway  12  0.0000  0.0000    Leukocyte transendothelial migration  5  0.0002  0.0034    Antigen processing and presentation  3  0.0012  0.0389    Toll-like receptor signaling pathway  8  0.0000  0.0000    T cell receptor signaling pathway  10  0.0000  0.0000    B cell receptor signaling pathway  8  0.0000  0.0000    Hematopoietic cell lineage  4  0.0003  0.0067    Natural killer cell mediated cytotoxicity  9  0.0000  0.0000    Fc epsilon RI signaling pathway  6  0.0000  0.0001  Lipid Metabolism  Glycerophospholipid metabolism  3  0.0010  0.0291    Ether lipid metabolism  2  0.0012  0.0361  Amino Acid Metabolism  Tryptophan metabolism  3  0.0003  0.0051    Glycine, serine and threonine metabolism  2  0.0010  0.0292  Translation  Ribosome  4  0.0003  0.0067    Aminoacyl-tRNA biosynthesis  3  0.0003  0.0054  Folding, sorting, and degradation  Ubiquitin mediated proteolysis  6  0.0001  0.0012    Proteasome  4  0.0001  0.0008  Endocrine system  Insulin signaling pathway  6  0.0001  0.0011    Progesterone-mediated oocyte maturation  3  0.0012  0.0358    PPAR signaling pathway  4  0.0002  0.0030    Adipocytokine signaling pathway  4  0.0002  0.0027  Signaling molecules and interaction  Cytokine-cytokine receptor interaction  16  0.0000  0.0000    Neuroactive ligand-receptor interaction  7  0.0006  0.0173    Cell adhesion molecules  6  0.0001  0.0010    ECM-receptor interaction  6  0.0000  0.0001  1TGF = Transforming growth factor; MAPK = Mitogen-activated protein kinases; Jak = Janus kinase; STAT = signal transducer and activator of transcription; VEGF = vascular endothelial growth factor; Fc epsilon RI = Fc epsilon response induction; PPAR = Peroxisome Proliferator Activatived Receptors; ECM = extracellular matrix. 2FDR = false discovery rate. View Large Table 4. Top Kyoto Encyclopedia of Genes and Genomes pathways enriched with differentially expressed genes induced by weaning Associated terms  Pathway name1  Hits  FDR2  P-value  Cell communication  Focal adhesion  14  0.0000  0.0000  Cell growth and death  Cell cycle  5  0.0011  0.0420    Apoptosis  10  0.0000  0.0000  Cell motility  Regulation of actin cytoskeleton  7  0.0002  0.0024  Development  Axon guidance  8  0.0001  0.0007  Signal transduction  Wnt signaling pathway  6  0.0001  0.0018    TGF-beta signaling pathway  7  0.0001  0.0003    MAPK signaling pathway  10  0.0000  0.0001    Jak-STAT signaling pathway  8  0.0000  0.0001    ErbB signaling pathway  5  0.0001  0.0009    VEGF signaling pathway  6  0.0000  0.0001    Phosphatidylinositol signaling system  3  0.0009  0.0265  Immune system  Chemokine signaling pathway  12  0.0000  0.0000    Leukocyte transendothelial migration  5  0.0002  0.0034    Antigen processing and presentation  3  0.0012  0.0389    Toll-like receptor signaling pathway  8  0.0000  0.0000    T cell receptor signaling pathway  10  0.0000  0.0000    B cell receptor signaling pathway  8  0.0000  0.0000    Hematopoietic cell lineage  4  0.0003  0.0067    Natural killer cell mediated cytotoxicity  9  0.0000  0.0000    Fc epsilon RI signaling pathway  6  0.0000  0.0001  Lipid Metabolism  Glycerophospholipid metabolism  3  0.0010  0.0291    Ether lipid metabolism  2  0.0012  0.0361  Amino Acid Metabolism  Tryptophan metabolism  3  0.0003  0.0051    Glycine, serine and threonine metabolism  2  0.0010  0.0292  Translation  Ribosome  4  0.0003  0.0067    Aminoacyl-tRNA biosynthesis  3  0.0003  0.0054  Folding, sorting, and degradation  Ubiquitin mediated proteolysis  6  0.0001  0.0012    Proteasome  4  0.0001  0.0008  Endocrine system  Insulin signaling pathway  6  0.0001  0.0011    Progesterone-mediated oocyte maturation  3  0.0012  0.0358    PPAR signaling pathway  4  0.0002  0.0030    Adipocytokine signaling pathway  4  0.0002  0.0027  Signaling molecules and interaction  Cytokine-cytokine receptor interaction  16  0.0000  0.0000    Neuroactive ligand-receptor interaction  7  0.0006  0.0173    Cell adhesion molecules  6  0.0001  0.0010    ECM-receptor interaction  6  0.0000  0.0001  Associated terms  Pathway name1  Hits  FDR2  P-value  Cell communication  Focal adhesion  14  0.0000  0.0000  Cell growth and death  Cell cycle  5  0.0011  0.0420    Apoptosis  10  0.0000  0.0000  Cell motility  Regulation of actin cytoskeleton  7  0.0002  0.0024  Development  Axon guidance  8  0.0001  0.0007  Signal transduction  Wnt signaling pathway  6  0.0001  0.0018    TGF-beta signaling pathway  7  0.0001  0.0003    MAPK signaling pathway  10  0.0000  0.0001    Jak-STAT signaling pathway  8  0.0000  0.0001    ErbB signaling pathway  5  0.0001  0.0009    VEGF signaling pathway  6  0.0000  0.0001    Phosphatidylinositol signaling system  3  0.0009  0.0265  Immune system  Chemokine signaling pathway  12  0.0000  0.0000    Leukocyte transendothelial migration  5  0.0002  0.0034    Antigen processing and presentation  3  0.0012  0.0389    Toll-like receptor signaling pathway  8  0.0000  0.0000    T cell receptor signaling pathway  10  0.0000  0.0000    B cell receptor signaling pathway  8  0.0000  0.0000    Hematopoietic cell lineage  4  0.0003  0.0067    Natural killer cell mediated cytotoxicity  9  0.0000  0.0000    Fc epsilon RI signaling pathway  6  0.0000  0.0001  Lipid Metabolism  Glycerophospholipid metabolism  3  0.0010  0.0291    Ether lipid metabolism  2  0.0012  0.0361  Amino Acid Metabolism  Tryptophan metabolism  3  0.0003  0.0051    Glycine, serine and threonine metabolism  2  0.0010  0.0292  Translation  Ribosome  4  0.0003  0.0067    Aminoacyl-tRNA biosynthesis  3  0.0003  0.0054  Folding, sorting, and degradation  Ubiquitin mediated proteolysis  6  0.0001  0.0012    Proteasome  4  0.0001  0.0008  Endocrine system  Insulin signaling pathway  6  0.0001  0.0011    Progesterone-mediated oocyte maturation  3  0.0012  0.0358    PPAR signaling pathway  4  0.0002  0.0030    Adipocytokine signaling pathway  4  0.0002  0.0027  Signaling molecules and interaction  Cytokine-cytokine receptor interaction  16  0.0000  0.0000    Neuroactive ligand-receptor interaction  7  0.0006  0.0173    Cell adhesion molecules  6  0.0001  0.0010    ECM-receptor interaction  6  0.0000  0.0001  1TGF = Transforming growth factor; MAPK = Mitogen-activated protein kinases; Jak = Janus kinase; STAT = signal transducer and activator of transcription; VEGF = vascular endothelial growth factor; Fc epsilon RI = Fc epsilon response induction; PPAR = Peroxisome Proliferator Activatived Receptors; ECM = extracellular matrix. 2FDR = false discovery rate. View Large Confirmation of Microarray Findings with Quantitative Real-Time PCR To independently confirm the microarray results, qRT-PCR was performed on samples from the weaned and the suckling pigs that had been exposed to the same experimental conditions that were used in the microarray assay. The relative expression levels of 8 differentially expressed genes, ATM, cytochrome c, somatic (CYCS), nuclear factor of activated T cells (NFATC2), E2F5, NOS2, Smad4, IL-8, and TNF were assayed. As shown in Table 5, we found that apoptosis-related genes (CYCS, IL-8, TNF, NOS2, and ATM) and a transcription factor (NFATC2) were upregulated but that cell cycle control-related genes (E2F5 and Smad4) were downregulated. After weaning, higher expression levels of CYCS (P < 0.01), TNF (P < 0.05), NOS2 (P < 0.05), ATM (P < 0.05), and NFATC2 (P < 0.05) were detected in weaned pigs compared with suckling pigs. No significant differences in IL-8 and Smad4 gene expression were observed between the weaned and the suckling pigs by qRT-PCR (P > 0.05). Expression of E2F5 was lower (P < 0.05) in weaned pigs than suckling pigs. The results showed that the altered expression of these 8 genes identified by qRT-PCR was consistent with the microarray results (Table 5) although the extent of the changes as measured by the 2 methods did not match exactly due to the different nature of the procedures. The data could indicate that the results from the microarray analysis are good indicators of overall changes in gene expression. Table 5. Validation of the microarray data by quantitative real-time PCR (qRT-PCR) analysis of 8 representative genes   Microarray results  qRT-PCR results2    Gene name1  P-value  Fold change  P-value  Fold change  Regulation  CYCS  **  2.5381  **  8.4623  Up  TNF  **  2.4013  *  4.5948  Up  NOS2  **  8.1900  *  15.5500  Up  NFATC2  **  3.5955  *  9.6463  Up  IL-8  *  2.3620  #  3.0000  Up  ATM  *  2.2134  *  4.2100  Up  Smad4  *  0.6050  #  0.4475  Down  E2F5  *  0.3162  *  0.4310  Down    Microarray results  qRT-PCR results2    Gene name1  P-value  Fold change  P-value  Fold change  Regulation  CYCS  **  2.5381  **  8.4623  Up  TNF  **  2.4013  *  4.5948  Up  NOS2  **  8.1900  *  15.5500  Up  NFATC2  **  3.5955  *  9.6463  Up  IL-8  *  2.3620  #  3.0000  Up  ATM  *  2.2134  *  4.2100  Up  Smad4  *  0.6050  #  0.4475  Down  E2F5  *  0.3162  *  0.4310  Down  1NOS2 = nitric oxide synthase 2, inducible; CYCS = cytochrome c, somatic; NAFTC2 = nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2; ATM = ataxia telangiectasia mutated; TNF = tumor necrosis factor; IL-8 = interleukin 8; Smad4 = SMAD family member 4; E2F5 = E2F transcription factor 5-like. 2The qRT-PCR expression column gives the relative expression of the selected genes in weaning pigs compared with the suckling pigs after normalization against the expression of the housekeeping genes β-actin and beta-2-microglobulin. *P < 0.05; **P < 0.01; #P > 0.05. View Large Table 5. Validation of the microarray data by quantitative real-time PCR (qRT-PCR) analysis of 8 representative genes   Microarray results  qRT-PCR results2    Gene name1  P-value  Fold change  P-value  Fold change  Regulation  CYCS  **  2.5381  **  8.4623  Up  TNF  **  2.4013  *  4.5948  Up  NOS2  **  8.1900  *  15.5500  Up  NFATC2  **  3.5955  *  9.6463  Up  IL-8  *  2.3620  #  3.0000  Up  ATM  *  2.2134  *  4.2100  Up  Smad4  *  0.6050  #  0.4475  Down  E2F5  *  0.3162  *  0.4310  Down    Microarray results  qRT-PCR results2    Gene name1  P-value  Fold change  P-value  Fold change  Regulation  CYCS  **  2.5381  **  8.4623  Up  TNF  **  2.4013  *  4.5948  Up  NOS2  **  8.1900  *  15.5500  Up  NFATC2  **  3.5955  *  9.6463  Up  IL-8  *  2.3620  #  3.0000  Up  ATM  *  2.2134  *  4.2100  Up  Smad4  *  0.6050  #  0.4475  Down  E2F5  *  0.3162  *  0.4310  Down  1NOS2 = nitric oxide synthase 2, inducible; CYCS = cytochrome c, somatic; NAFTC2 = nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2; ATM = ataxia telangiectasia mutated; TNF = tumor necrosis factor; IL-8 = interleukin 8; Smad4 = SMAD family member 4; E2F5 = E2F transcription factor 5-like. 2The qRT-PCR expression column gives the relative expression of the selected genes in weaning pigs compared with the suckling pigs after normalization against the expression of the housekeeping genes β-actin and beta-2-microglobulin. *P < 0.05; **P < 0.01; #P > 0.05. View Large Signaling Network of Cellular Processes The differentially expressed genes involved in significant pathways were analyzed for their possible interactions, and the networks of genes involved in cellular processes were established using the KEGG database. Based on the results of the genomewide expression analysis between the weaned and the suckling pigs and the information of these selected genes linked to cell cycle machinery from online databases, the network of these selected genes was constructed and is shown in Fig. 2. Weaning leads to cell cycle arrest in the G0/G1 phase through the inhibition of E2F5 and the Smad4-dependent pathway and the activation of ATM and the CYCS-dependent apoptosis-related pathway. Weaning also induced increased gene expression of inflammatory factors (IL-8 and TNF), which inhibit the immune response. Figure 2. View largeDownload slide The signaling network of cell cycle processes caused by weaning stress in pigs. The relationships between genes and biological processes are indicated by lines, which represent positive promotion with a black arrow end and dotted lines indicating indirect effects. NOS2 = nitric oxide synthase 2, inducible; CYCS = cytochrome c, somatic; ATM = ataxia telangiectasia mutated; TNF = tumor necrosis factor; IL-8 = interleukin 8; Smad4 = SMAD family member 4; E2F5 = E2F transcription factor 5-like; c-JUN = c-jun oncogene; P53 = tumor protein 53; BAD = bcl2 antagonist of cell death-like; MAP3K14 = mitogen-activated protein kinase kinase kinase 14. Figure 2. View largeDownload slide The signaling network of cell cycle processes caused by weaning stress in pigs. The relationships between genes and biological processes are indicated by lines, which represent positive promotion with a black arrow end and dotted lines indicating indirect effects. NOS2 = nitric oxide synthase 2, inducible; CYCS = cytochrome c, somatic; ATM = ataxia telangiectasia mutated; TNF = tumor necrosis factor; IL-8 = interleukin 8; Smad4 = SMAD family member 4; E2F5 = E2F transcription factor 5-like; c-JUN = c-jun oncogene; P53 = tumor protein 53; BAD = bcl2 antagonist of cell death-like; MAP3K14 = mitogen-activated protein kinase kinase kinase 14. DISCUSSION Microarray analysis has been used to detect genomewide perturbations during various treatments and is particularly useful for screening the genes involved in specific biological processes of interest, such as diseases and responses to environmental stimuli. In the present study, we successfully identified 445 genes that were differentially expressed between the suckling and the weaned pigs. With the SAS, the differentially expressed genes displayed 2 main trends in weaned pigs, and these genes are critical in metabolic and cellular process pathways. These genes will likely contribute to our further research in weaned pigs. To our knowledge, no genomewide changes have been reported in weaned pigs. Such insight may lead to new rational approaches for preventing gastrointestinal dysfunction from weaning. Wang et al. (2008) selected 39 genes of known function that were differentially expressed, including 21 upregulated and 18 downregulated genes in the jejunum of 28-d-old weaned pigs compared with age-matched suckling pigs, and also proved that weaning increases oxidative stress but decreases cell proliferation in the gut. When compared with the genes presented herein, no differentially expressed genes were found to be in common between the 2 studies. The very different transcriptional profiles between the 2 experiments are likely due to the different microarray assays and the different ages of the weaned pigs that were used. We previously reported that weaned pigs showed extensive apoptosis in the jejunum (Zhu et al., 2013). Apoptosis can be triggered by many different cellular stimuli, including various types of stress and damage, and can lead to the dysfunction of cell survival mechanisms. Accordingly, in the present study, the cellular process-related pathways were most important to our research goals. We identified a group of cell death- and cell cycle-related genes with expression levels that were significantly different, suggesting that they may have important effects in the regulation of apoptosis and, consequently, in the pathogenesis of weaning-induced intestinal dysfunction. Among these genes, tumor suppressors such as caspase-10 and CYCs were substantially upregulated as were proto-oncogenes such as ATM. Expression levels of the cell cycle control-associated genes Smad4 and E2F5 were downregulated in response to weaning. The transforming growth factor-β signaling pathway is involved in a variety of biological processes, including cell proliferation, apoptosis, and cell cycle control (Siegel and Massague, 2003; Heldin et al., 2009). The Smad4 gene functions as a key tumor suppressor, which plays a crucial role in the downstream regulation of transforming growth factor-β signaling (Nakao et al., 1997). The loss of Smad4 could initiate tumor development and invasion (Takaku et al., 1998). The inactivation of the Smad4 gene also correlates with the abrogation of transforming growth factor-β-induced growth inhibition and cell cycle arrest (Lee and Bae, 2002). The Smad4 gene also has an essential role in anti-inflammation under pathological conditions (Meng et al., 2012). Haploinsufficiency of Smad4 can augment the susceptibility of acute colitis inflammation in mammals (Szigeti et al., 2012). Deletion of Smad4 from skin can result in delayed wound healing and enhanced inflammation-associated carcinogenesis (Owens et al., 2010). In the present study, the loss of Smad4 might contribute to increased intestinal inflammation susceptibility in weaned pigs. As a member of the E2F transcription factor family, E2F5 binds to the promoters of the target genes involved in cell cycle control and consequently regulates the expression of these genes (Chen et al., 2009). The overexpression of E2F5 induces the uncontrolled proliferation of cells in diverse cancers, and E2F5 knockdown seems to arrest the cell cycle at the G0/Gl phase (Jiang et al., 2011). In addition, the deregulated expression of E2F family member genes could induce both inappropriate S phase entry and apoptosis (Shan and Lee, 1994). Here, the downregulation of E2F5 likely indicates that the cell cycle of enterocytes was blocked at G0/Gl after weaning treatment. Furthermore, a balance between cell proliferation and death is required for tissue homeostasis. Proliferation and apoptosis are tightly coupled and linked by cell cycle regulators (Vermeulen et al., 2003). The cell cycle is controlled by various positive and negative regulators, such as the E2F family of transcription factors and the tumor suppressor protein p53. The E2F proteins are implicated in promoting S phase of the cell cycle whereas the tumor suppressor protein p53 is a negative regulator of cell growth, which has the potential to prevent the release of E2F, arrest cells in G1 phase, and thereby prevent entry into S phase and induce apoptotic death (Harper et al., 1993; Ko and Prives, 1996). Evidence has shown that p53 specifically inhibits E2F5 transcription (Vaishnav and Pant, 1999). We also previously observed the upregulation of p53 in weaned pigs (Zhu et al., 2012). Hence, it seems that weaning induces cell cycle arrest via p53-dependent pathways. Connections between the cell cycle and cell death have long been noted. Many apoptotic stimuli can induce cell cycle arrest before cell death, thereby affecting both apoptotic and cell cycle machinery. It has been reported that, under some circumstances, p53 can also induce apoptosis in response to stress stimuli (Vaseva and Moll, 2009). There are 2 main apoptotic pathways: the intrinsic (mitochondrial) and the extrinsic (death receptor) pathway. As a proapoptotic member of the Bcl-2 family, the Bcl-2 antagonist of cell death-like (BAD) regulates apoptotic mitochondrial events through the regulation of cytochrome c release from the mitochondria via the alteration of mitochondrial membrane permeability (Zha et al., 1996). Tumor suppressor protein p53 has a critical role in the regulation of the Bcl-2 family (Vaseva and Moll, 2009). The induction of the extrinsic apoptotic pathway involves the stimulation of death receptors belonging to the tumor necrosis factor receptor family, such as Fas and TNF-α (Locksley et al., 2001). The cell death signal mediates the cleavage of the proapoptotic factors that go on to inflict mitochondrial damage and result in cytochrome c release (Sundararajan et al., 2001). Additionally, TNF is an important mediator of inflammation. It not only induces its own secretion but also stimulates the production of other inflammatory cytokines and chemokines, such as IL-6 and IL-8 (Williams et al., 2008). In the present study, we detected changes in the expression of genes associated with the regulation of cell apoptosis including the upregulated proapoptotic genes CYCs, caspase-10, and BAD and the upregulation of the inflammatory cytokine genes TNF and IL-8 in weaned pigs, supporting our previous work on the effects of weaning-induced apoptosis in pigs (Zhu et al., 2013). All of the gene expression changes seem to be consistent with our previous finding that weaning increases apoptosis, and both of the mitochondria-mediated and Fas-mediated apoptosis pathways were activated (Zhu et al., 2013). Here, we confirmed this observation and improved this approach. Furthermore, NO, as a member of the reactive oxygen species, has been implicated in cell damage, apoptosis, and cell necrosis due to its direct oxidizing effects on DNA, lipids, and proteins (Calcerrada et al., 2011). The intracellular damage caused by NO was mainly due to the oxidization of DNA, which interfered with DNA repair and caused posttranslational modifications (Jaiswal et al., 2001). The normal cellular response to DNA damage results in the accumulation of p53, which in turn induces cell cycle arrest or apoptosis, thus imposing a delay on cell cycle progression and control of DNA repair and replication (Forrester et al., 1996). In mammals, NO is exclusively synthesized by NO synthases (NOS), which exist in 3 major isoforms: neuronal NOS, inducible NOS, and endothelial NOS (Messmer and Brune, 1996). Among these, the expression of NO synthase 2 (NOS2) is inducible when its activity is triggered under stress conditions (Lowenstein and Padalko, 2004). In the present study, weaning stress also increased NOS2 expression, which might be responsible for the increased generation of NO and H2O2 in the sera of the weaned pigs (Zhu et al., 2012). In addition, DNA damage induces several cellular responses including checkpoint activity, DNA repair, and triggering of the apoptotic pathways. The cellular response to stress is initiated by the activation of the ATM protein kinases, key players in the activation of cell cycle checkpoints in response to stress-induced DNA double strand breaks. Once ATM is activated, it can regulate the G1/S cell cycle checkpoint through p53 phosphorylation and can then induce p21 to inhibit cyclin kinase activity. The cells then either progress from G1 to S phase or apoptosis is triggered (Banin et al., 1998; Abraham, 2001). Moreover, ATM activation is also important for the initiation of DNA end resection, allowing time for DNA repair and cell survival (Rotman and Shiloh, 1999). Here, we observed an upregulation of ATM in weaned pigs, which likely indicates that weaning not only induces cell cycle arrest but also initiates the mechanism of DNA repair. In addition, NFATC2, as a member of the nuclear factor of activated T cells (NFAT) family, plays a positive role in modulating the calcineurin-NFAT interaction (Ortega-Perez et al., 2005). The suppression of NFATC2 mRNA promotes cell growth and proliferation (Vieira et al., 2012). The loss of both NFATC2 and calcineurin Aα in mice enhanced the expression of cyclin-dependent kinase 4 (a cell cycle control related gene), indicating that the calcineurin-NFAT signaling pathway has a negative role in cell cycle progression (Baksh et al., 2002). Inhibiting calcineurin-NFAT pathway activation in megakaryocytes decreases apoptosis by suppressing the expression of proapoptotic Fas ligand (Arabanian et al., 2012). Here, the upregulation of NFATC2 in weaned pigs might indicate an inhibition of epithelial cell proliferation induced by weaning stress. In weaned pigs, a decreased crypt cell proliferation index and increased villus cell apoptosis were observed in weaned pigs challenged with lipopolysaccharide (Liu et al., 2008). Wang et al. (2008) also found decreased cell proliferation- and differentiation-related gene expression, in weaned pigs, and dietary additives could increase the crypt cell proliferation (Jiang et al., 2000; Liu et al., 2008). However, weaning also induced obvious villus shedding, villus shortening, and crypt hyperplasia (Cera et al., 1988). Here, the crypt hyperplasia seems to contradict the reduced cell proliferation in weaned pigs. The dynamic process of epithelial cell turnover is a function of the rates of cell proliferation, migration, differentiation, and apoptosis. In the small intestine, cell proliferation begins at the bottom of intestinal crypts, where the stem cells give rise to progenitor cells. During migration toward the villus tip, progenitor cells differentiate into goblet cells, enterocytes, or enteroendocrine cells. Then, the intestinal cells undergo apoptosis and shed into the gut lumen after 3 d of functional differentiation, thus balancing the continuous production of new cells (Bullen et al., 2006). To some degree, decreased cell proliferation and increased apoptosis may be the main mechanisms responsible for intestinal mucosal injury (Sukhotnik et al., 2005; Liu et al., 2008). However, more work is needed to understand the exact mechanisms of crypt hyperplasia and epithelial cell proliferation in weaned pigs. In conclusion, the work reported herein suggests that weaning induces cell cycle arrest, enhances apoptosis, and inhibits epithelial cell proliferation, which may provide insight into the mechanism of weaning stress in a postweaning study. The observed differential mechanism of cell death induced by weaning provides a potential new direction for exploring the role of the cell cycle in weaned pigs as well as p53-dependent apoptosis in weaning treatment with antioxidants. LITERATURE CITED Abraham R. T 2001. Cell cycle checkpoint signaling through the ATM and ATR kinases. Genes Dev.  15: 2177– 2196. Google Scholar CrossRef Search ADS PubMed  Arabanian L. S. Kujawski S. Habermann I. Ehninger G. Kiani A. 2012. Regulation of fas/fas ligand-mediated apoptosis by nuclear factor of activated T cells in megakaryocytes. Br. J. Haematol.  156: 523– 534. Google Scholar CrossRef Search ADS PubMed  Baksh S. Widlund H. R. Frazer-Abel A. A. Du J. Fosmire S. Fisher D. E. DeCaprio J. A. Modiano J. F. Burakoff S. J. 2002. NFATC2–mediated repression of cyclin-dependent kinase 4 expression. Mol. Cell  10: 1071– 1081. Google Scholar CrossRef Search ADS PubMed  Banin S. Moyal L. Shieh S. Taya Y. Anderson C. W. Chessa L. Smorodinsky N. I. Prives C. Reiss Y. Shiloh Y. Ziv Y. 1998. Enhanced phosphorylation of p53 by ATM in response to DNA damage. Science  281: 1674– 1677. Google Scholar CrossRef Search ADS PubMed  Boudry G. Peron V. Le Huerou-Luron I. Lalles J. P. Seve B. 2004. Weaning induces both transient and long-lasting modifications of absorptive, secretory, and barrier properties of piglet intestine. J. Nutr.  134: 2256– 2262. Google Scholar CrossRef Search ADS PubMed  Bullen T. F. Forrest S. Campbell F. Dodson A. R. Hershman M. J. Pritchard D. M. Turner J. R. Montrose M. H. Watson A. J. 2006. Characterization of epithelial cell shedding from human small intestine. Lab. Invest.  86: 1052– 1063. Google Scholar CrossRef Search ADS PubMed  Calcerrada P. Peluffo G. Radi R. 2011. Nitric oxide-derived oxidants with a focus on peroxynitrite: Molecular targets, cellular responses and therapeutic implications. Curr. Pharm. Des.  17: 3905– 3932. Google Scholar CrossRef Search ADS PubMed  Cera K. Mahan D. Cross R. Reinhart G. Whitmoyer R. 1988. Effect of age, weaning and postweaning diet on small intestinal growth and jejunal morphology in young swine. J. Anim. Sci.  66: 574– 584. Google Scholar CrossRef Search ADS PubMed  Chen H. Z. Tsai S. Y. Leone G. 2009. Emerging roles of E2Fs in cancer: An exit from cell cycle control. Nat. Rev. Cancer  9: 785– 797. Google Scholar CrossRef Search ADS PubMed  Cummins A. G. Thompson F. M. 2002. Effect of breast milk and weaning on epithelial growth of the small intestine in humans. Gut  51: 748– 754. Google Scholar CrossRef Search ADS PubMed  Dvorak B. McWilliam D. L. Williams C. S. Dominguez J. A. Machen N. W. McCuskey R. S. Philipps A. F. 2000. Artificial formula induces precocious maturation of the small intestine of artificially reared suckling rats. J. Pediatr. Gastroenterol. Nutr.  31: 162– 169. Google Scholar CrossRef Search ADS PubMed  Forrester K. Ambs S. Lupold S. E. Kapust R. B. Spillare E. A. Weinberg W. C. Felley-Bosco E. Wang X. W. Geller D. A. Zeng T. E. Billiar T. R. Harris C. C. 1996. Nitric oxide-induced p53 accumulation and regulation of inducible nitric oxide synthase expression by wild-type p53. Proc. Natl. Acad. Sci. USA  93: 2442– 2447. Google Scholar CrossRef Search ADS   Harper J. W. Adami G. R. Wei N. Keyomarsi K. Elledge S. J. 1993. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell  75: 805– 816. Google Scholar CrossRef Search ADS PubMed  Heird W. C. Schwarz S. M. Hansen I. H. 1984. Colostrum-induced enteric mucosal growth in beagle puppies. Pediatr. Res.  18: 512– 515. Google Scholar CrossRef Search ADS PubMed  Heldin C. H. Landstrom M. Moustakas A. 2009. Mechanism of TGF-beta signaling to growth arrest, apoptosis, and epithelial-mesenchymal transition. Curr. Opin. Cell Biol.  21: 166– 176. Google Scholar CrossRef Search ADS PubMed  Jaiswal M. LaRusso N. F. Gores G. J. 2001. Nitric oxide in gastrointestinal epithelial cell carcinogenesis: Linking inflammation to oncogenesis. Am. J. Physiol. Gastrointest. Liver Physiol.  281: G626– G634. Google Scholar CrossRef Search ADS PubMed  Jiang R. Chang X. Stoll B. Fan M. Z. Arthington J. Weaver E. Campbell J. Burrin D. G. 2000. Dietary plasma protein reduces small intestinal growth and lamina propria cell density in early weaned pigs. J. Nutr.  130: 21– 26. Google Scholar CrossRef Search ADS PubMed  Jiang Y. Yim S. H. Xu H. D. Jung S. H. Yang S. Y. Hu H. J. Jung C. K. Chung Y. J. 2011. A potential oncogenic role of the commonly observed E2F5 overexpression in hepatocellular carcinoma. World J. Gastroenterol.  17: 470– 477. Google Scholar CrossRef Search ADS PubMed  Ko L. J. Prives C. 1996. p53: Puzzle and paradigm. Genes Dev.  10: 1054– 1072. Google Scholar CrossRef Search ADS PubMed  Lecce J. G 1986. Diarrhea: The nemesis of the artificially reared, early weaned piglet and a strategy for defense. J. Anim. Sci.  63: 1307– 1313. Google Scholar CrossRef Search ADS PubMed  Lee K. Y. Bae S. C. 2002. TGF-beta-dependent cell growth arrest and apoptosis. J. Biochem. Mol. Biol.  35: 47– 53. Google Scholar PubMed  Liu Y. Huang J. Hou Y. Zhu H. Zhao S. Ding B. Yin Y. Yi G. Shi J. Fan W. 2008. Dietary arginine supplementation alleviates intestinal mucosal disruption induced by Escherichia coli lipopolysaccharide in weaned pigs. Br. J. Nutr.  100: 552– 560. Google Scholar CrossRef Search ADS PubMed  Livak K. J. Schmittgen T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods  25: 402– 408. Google Scholar CrossRef Search ADS PubMed  Locksley R. M. Killeen N. Lenardo M. J. 2001. The TNF and TNF receptor superfamilies: Integrating mammalian biology. Cell  104: 487– 501. Google Scholar CrossRef Search ADS PubMed  Lowenstein C. J. Padalko E. 2004. iNOS (NOS2) at a glance. J. Cell Sci.  117: 2865– 2867. Google Scholar CrossRef Search ADS PubMed  Meng X. M. Huang X. R. Xiao J. Chung A. C. Qin W. Chen H. Y. Lan H. Y. 2012. Disruption of Smad4 impairs TGF-beta/Smad3 and Smad7 transcriptional regulation during renal inflammation and fibrosis in vivo and in vitro. Kidney Int.  81: 266– 279. Google Scholar CrossRef Search ADS PubMed  Messmer U. K. Brune B. 1996. Nitric oxide-induced apoptosis: P53-dependent and p53-independent signalling pathways. Biochem. J.  319: 299– 305. Google Scholar CrossRef Search ADS PubMed  Nakao A. Imamura T. Souchelnytskyi S. Kawabata M. Ishisaki A. Oeda E. Tamaki K. Hanai J. Heldin C. Miyazono K. 1997. TGF-β receptor-mediated signalling through Smad2, Smad3 and Smad4. EMBO J.  16: 5353– 5362. Google Scholar CrossRef Search ADS PubMed  Ortega-Perez I. Cano E. Were F. Villar M. Vazquez J. Redondo J. M. 2005. c-Jun N-terminal kinase (JNK) positively regulates NFATc2 transactivation through phosphorylation within the N-terminal regulatory domain. J. Biol. Chem.  280: 20867– 20878. Google Scholar CrossRef Search ADS PubMed  Owens P. Engelking E. Han G. Haeger S. M. Wang X. J. 2010. Epidermal Smad4 deletion results in aberrant wound healing. Am. J. Pathol.  176: 122– 133. Google Scholar CrossRef Search ADS PubMed  Rotman G. Shiloh Y. 1999. ATM: A mediator of multiple responses to genotoxic stress. Oncogene  18: 6135– 6144. Google Scholar CrossRef Search ADS PubMed  Shan B. Lee W. H. 1994. Deregulated expression of E2F-1 induces S-phase entry and leads to apoptosis. Mol. Cell. Biol.  14: 8166– 8173. Google Scholar CrossRef Search ADS PubMed  Siegel P. M. Massague J. 2003. Cytostatic and apoptotic actions of TGF-beta in homeostasis and cancer. Nat. Rev. Cancer  3: 807– 821. Google Scholar CrossRef Search ADS PubMed  Smith M. W. Peacock M. A. 1980. Anomalous replacement of foetal enterocytes in the neonatal pig. Proc. R. Soc. Lond. B Biol. Sci.  206: 411– 420. Google Scholar CrossRef Search ADS   Sukhotnik I. Helou H. Mogilner J. Lurie M. Bernsteyn A. Coran A. G. Shiloni E. 2005. Oral arginine improves intestinal recovery following ischemia-reperfusion injury in rat. Pediatr. Surg. Int.  21: 191– 196. Google Scholar CrossRef Search ADS PubMed  Sundararajan R. Cuconati A. Nelson D. White E. 2001. Tumor necrosis factor-alpha induces Bax-Bak interaction and apoptosis, which is inhibited by adenovirus E1B 19K. J. Biol. Chem.  276: 45120– 45127. Google Scholar CrossRef Search ADS PubMed  Szigeti R. Pangas S. A. Nagy-Szakal D. Dowd S. E. Shulman R. J. Olive A. P. Popek E. J. Finegold M. J. Kellermayer R. 2012. SMAD4 haploinsufficiency associates with augmented colonic inflammation in select humans and mice. Ann. Clin. Lab. Sci.  42: 401– 408. Google Scholar PubMed  Takaku K. Oshima M. Miyoshi H. Matsui M. Seldin M. F. Taketo M. M. 1998. Intestinal tumorigenesis in compound mutant mice of both Dpc4 (Smad4) and Apc genes. Cell  92: 645– 656. Google Scholar CrossRef Search ADS PubMed  Vaishnav Y. N. Pant V. 1999. Differential regulation of E2F transcription factors by p53 tumor suppressor protein. DNA Cell Biol.  18: 911– 922. Google Scholar CrossRef Search ADS PubMed  Vaseva A. V. Moll U. M. 2009. The mitochondrial p53 pathway. Biochim. Biophys. Acta  1787: 414– 420. Vermeulen K. Berneman Z. N. Van Bockstaele D. R. 2003. Cell cycle and apoptosis. Cell Prolif.  36: 165– 175. Google Scholar CrossRef Search ADS PubMed  Vieira L. Vaz A. Matos P. Ambrosio A. P. Nogueira M. Marques B. Pereira A. M. Jordan P. da Silva M. G. 2012. Three-way translocation (X;20;16)(p11;q13;q23) in essential thrombocythemia implicates NFATC2 in dysregulation of CSF2 expression and megakaryocyte proliferation. Genes Chromosomes Cancer  51: 1093– 1108. Google Scholar CrossRef Search ADS PubMed  Wang J. J. Chen L. X. Li P. Li X. L. Zhou H. J. Wang F. L. Li D. F. Yin Y. L. Wu G. Y. 2008. Gene expression is altered in piglet small intestine by weaning and dietary glutamine supplementation. J. Nutr.  138: 1025– 1032. Google Scholar CrossRef Search ADS PubMed  Williams L. M. Lali F. Willetts K. Balague C. Godessart N. Brennan F. Feldmann M. Foxwell B. M. 2008. Rac mediates TNF-induced cytokine production via modulation of NF-kappaB. Mol. Immunol.  45: 2446– 2454. Google Scholar CrossRef Search ADS PubMed  Zabielski R. Godlewski M. M. Guilloteau P. 2008. Control of development of gastrointestinal system in neonates. J. Physiol. Pharmacol.  59( Suppl. 1): 35– 54. Google Scholar PubMed  Zha J. Harada H. Yang E. Jockel J. Korsmeyer S. J. 1996. Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14–3-3 not BCL-X(L). Cell  87: 619– 628. Google Scholar CrossRef Search ADS PubMed  Zhu L. H. Cai X. Guo Q. Chen X. L. Zhu S. W. Xu J. X. 2013. Effect of N-acetyl cysteine on enterocyte apoptosis and intracellular signalling pathways' response to oxidative stress in weaned piglets. Br. J. Nutr.  110: 1938– 1947. Google Scholar CrossRef Search ADS PubMed  Zhu L. H. Zhao K. L. Chen X. L. Xu J. X. 2012. Impact of weaning and an antioxidant blend on intestinal barrier function and antioxidant status in pigs. J. Anim. Sci.  90: 2581– 2589. Google Scholar CrossRef Search ADS PubMed  Footnotes 1 This study was supported financially by the National Natural Science Foundation of China (grant no. 30972103) and the Students' Innovation Foundation of Shanghai Jiaotong University (grant no. z-150-005). American Society of Animal Science http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Animal Science Oxford University Press

Gene expression profiling analysis reveals weaning-induced cell cycle arrest and apoptosis in the small intestine of pigs

Loading next page...
 
/lp/oxford-university-press/gene-expression-profiling-analysis-reveals-weaning-induced-cell-cycle-iLM80cyaL4

References (56)

ISSN
0021-8812
eISSN
1525-3163
DOI
10.2527/jas.2013-7551
pmid
24496830
Publisher site
See Article on Publisher Site

Abstract

ABSTRACT In swine production, weaning is a critical event for porcine weaning-associated disease, such as postweaning stress syndrome, which involves intestinal dysfunction. However, little is known about the molecular mechanisms of intestinal dysfunction in pigs during weaning. To gain new insight into the interaction between weaning stress and intestinal function, 4 pigs at 25 d of age for each of the weaning and the suckling groups for a total of 40 pigs were used to analyze changes in the genomic expression in the intestines of weaned pigs by microarray analysis. Four hundred forty-five genes showed altered expression after weaning treatment (286 upregulated and 159 downregulated) at the cutoff criteria of the fold change ≥1.5 or <0.67 and P < 0.05. Most of these altered genes are cellular process related and regulators that may be involved in biological regulation, developmental processes, and metabolic processes. A keen interest was paid in deciphering expression changes in apoptosis or cell cycle control genes. The altered genomic expression of 8 selected genes related to the cell cycle process was confirmed by quantitative real-time PCR. Of the 8 genes tested, increased (P < 0.05) expression of genes involved in apoptosis (cytochrome c, somatic, and ataxia telangiectasia mutated), pro-inflammatory signals (tumor necrosis factor and NO synthases 2), and a transcription factor (nuclear factor of activated T cells, cytoplasmic, and calcineurin-dependent 2) were detected in weaned pigs compared with suckling pigs, but the expression of cell cycle control-related genes, such as E2F transcription factor 5-like, was lower (P < 0.05) in weaned pigs than suckling pigs. Weaned pigs also showed increased interleukin 8 expression and decreased SMAD family member 4 expression although no significant differences (P > 0.05) were observed when compared with the suckling pigs. These selected genes likely indicate that weaning induced cell cycle arrest, enhanced apoptosis, and inhibited cell proliferation. The results of this study provide a basis for understanding the molecular pathogenesis of weaning treatment. INTRODUCTION In animal development, both breast feeding and weaning are important physiology events in the growth of the small intestine. During early suckling, the small intestine grows rapidly because the breast milk contains growth factors that stimulate intestinal growth (Heird et al., 1984). During the weaning period, the diet changes from milk to a solid diet and an intense rebuilding of intestine tissues takes place so that the intestines can mature (Cummins and Thompson, 2002). During intestinal maturation, the old intestinal cells are gradually replaced by the newly differentiated cells with mature functions (Smith and Peacock, 1980; Zabielski et al., 2008). In intensive livestock production, postweaning can also make the juvenile mammalian gut mature through a series of adaptive changes including cell proliferation, differentiation, and apoptosis (Dvorak et al., 2000; Boudry et al., 2004). However, piglet weaning is often associated with gastrointestinal dysfunction, which is a major problem in swine production (Lecce, 1986). Evidence has shown that early weaning could decrease the expression of genes related to cell proliferation and increase the expression of cell growth-related genes after dietary glutamine supplementation in weaned pigs (Wang et al., 2008). We also previously demonstrated that weaning induces cell apoptosis (Zhu et al., 2013). It seems that enterocyte cellular processes play an important role during weaning. Changes in individual intestinal mucosal genes are uniquely regulated, and the cellular and molecular events associated with these changes in the intestines of weaned pigs are yet to be elucidated. The aim of this work is therefore to increase our understanding of the mechanism of the transcription network changes in the small intestine that underlie the performance of weaning using a genomic approach. MATERIALS AND METHODS All animal procedures were performed according to protocols approved by the Biological Studies Animal Care and Use Committee of Shanghai, PR China. Experimental Design and Tissue Collection A total of forty 21-d-old pigs (Duroc × Landrace) from 4 litters (10 pigs per litter) were used in this experiment. At 21 d of age, 5 pigs from each litter for a total of 20 pigs were randomly selected and assigned to the weaning group. The others were assigned to the suckling group. Pigs in the weaning group were weaned and moved from the farrowing pens to the nursery pens without mixing any litters (5 piglets per pen) and had ad libitum access to the basal diet and water, as previously described (Zhu et al., 2012), with 14.48 MJ/kg DE and 20.50% CP (N × 6.25). The suckling pigs continued to be nursed by sows without mixing any litters. At 25 d of age, 1 piglet closest to the average BW was selected from each litter, resulting in a total of 4 pigs per group. Animals were then anesthetized by intramuscular injection with sodium pentobarbital (50 mg/kg BW) and then euthanized. Jejunal samples, approximately 2 cm in length, were resected from the middle portion of the jejunum, washed in PBS, and frozen in liquid N2, and stored at –80°C before their use for the isolation of total RNA. Ribonucleic Acid Preparation The total RNA of jejunum tissues was extracted following the Trizol reagent instructions (Invitrogen, Carlsbad, CA) and checked for RNA integrity and purity using an Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA). The qualified total RNA was further purified using an RNeasy mini kit (QIAGEN, GmBH, Germany) and an RNase-Free DNase Set (QIAGEN, GmBH, Germany). Only those samples that had an optical density 260: optical density 280 ratio of approximately 2.0 and showed no degradation (RNA integrity number ≥ 7.0) were used to generate labeled targets. Microarray Hybridization and Data Analysis The RNA sample from each group was hybridized to an Agilent Porcine 4 × 44 K 1-color gene expression microarray (catalog number 026440; Agilent Technologies) containing 43,603 probe sets, as described in Gene Expression Omnibus (www.ncbi.nlm.nih.gov/geo/). Therefore, 8 BeadChips were used in total, 4 for each of suckling and weaning groups. Total RNA was amplified and labeled using a Low Input Quick Amp Labeling Kit (Agilent Technologies), following the manufacturer's instructions. A green fluorescent dye Cy3 was used to label the samples from the suckling and the weaned individuals. After 17 h of hybridization, slides were washed with a Gene Expression Wash Buffer Kit (Agilent Technologies), following the manufacturer's instructions. The slides were then scanned on an Agilent Microarray Scanner (Agilent Technologies), and data were extracted with Feature Extraction Software 10.7 (Agilent Technologies). Raw data were normalized using a quantile algorithm, Gene Spring Software 11.0 (Agilent Technologies). Microarrays were provided by Shanghai Biochip Co., Ltd. Gene Ontogeny Category and Pathway Analysis The Shanghai Biotechnologies Corporation Analysis System (SAS; http://sas.ebioservice.com) was used to further identify the differentially expressed genes between the weaned and the suckling pigs by comparing the log2 (normalized signal) of 2 groups, and the genes with values of P < 0.05 were extracted. To further clarify the function of the differentially expressed genes in this study, transcripts were first annotated to pig (ssc), and then other significant transcripts were annotated against human (hsa), mouse (mmu), and rat (rno) genes. Highly expressed genes expressed in weaned pigs that showed at least a 1.5-fold higher or lower expression level than in those of suckling pigs were selected for further study. The data discussed in this study have been deposited in the National Center for Biotechnology Information Gene Expression Omnibus with accession number GSE48050. Additionally, the differentially expressed genes identified between the 2 groups were mapped to Gene Ontology (GO; www.geneontology.org/) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG; www.genome.jp/kegg/) pathways to identify potential pathways associated with weaning treatment. In addition, P values < 0.05 and a false discovery rate < 0.05 were considered statistically significant. Gene Network Analysis The gene network analysis of the differentially expressed genes involved in significant pathways was performed using the KEGG database. Keen interest was paid to the apoptosis or cell cycle pathways. The gene-to-gene or protein-to-protein interaction information in the database was also analyzed, and gene networks were established. Confirmation of BeadChip Results by Quantitative Real-Time PCR Based on the analysis above, quantitative real-time PCR (qRT-PCR) was used to verify the potential apoptosis- and cell cycle control-related genes in jejunum tissues of those pigs analyzed with microarrays and to exclude any false positives in the microarray results. According to the relevant studies and network analysis results, specific genes were selected for verification. Primers were designed to amplify sequences of 100 to 250 bp (Table 1) using primer design software (Primer Premier 5.0; PREMIER Biosoft International, Palo Alto, CA). Amplification efficiencies were calculated based on the slope of the line E = 10(–1/slope) – 1, considering an ideal value range (0.95 ≤ E ≤ 1.05). Reactions were performed in a volume of 20 μL with Prime Script RT Master Mix (TaKaRa, Otsu, Japan), according to the manufacturer's instructions, and performed in an Eppendorf Mastercycler ep Realplex Real-Time Quantitative PCR System (Eppendorf, Germany). Amplification conditions were 95°C for 30 s, 35 cycles of 95°C for 5 s, annealing for 15 s, and 72°C for 10 s followed by melting curve analysis. Each sample and no template controls were run in triplicate. Beta-actin and β-2-microglobulin were also amplified with the target genes under the same conditions as the internal controls to normalize the reactions. After completion of the PCR amplification, the relative fold change after weaning was calculated based on the 2–(ΔΔCt) method (Livak and Schmittgen, 2001) and normalized against β-actin and β-2-microglobulin. Reported fold changes in expression are the ratios of treatment over control suckling values. For each gene, expression values between groups were compared with a t test, and differences were considered significant at P < 0.05. Table 1. Specific primer sequences used in real-time quantitative real-time PCR Gene name1  GenBank  Primer (5′–3′)  Product (bp)  E2F5  XM_001924905  TCCAGAAATGGGTCAGAATG  226      GATATGTTGCTCAGGCAGGT    IL-8  NM_213867  AACTGGCTGTTGCCTTCTTG  252      CCTTCTGCACCCACTTTTCC    Smad4  NM_214072  CGGTGTTGATGACCTTCGT  169      GGCAATAGGCATGGTATGA    NFATC2  NM_001113452  TGGTGCCTGCCATTCCTATCT  161      GGCTCCTCGGCTACCTTCTG    NOS2  NM_001143690  CTCAAATCGCAGCAGAATC  242      TTGTCCTTGACCCAGTAGC    TNF-α  NM_214022  ACGCTCTTCTGCCTACTGC  162      TCCCTCGGCTTTGACATT    ATM  NM_001123080  CTCACAAACAAGCCGATCCA  179      TCAACTCCAGCCAGAAAGCA    CYCS  NM_001129970  TCCCCTCCTACAGAGATGGTT  165      ATGAGATAGCAAAGGGATCGT    B2M  NM_213978  TTCACACCGCTCCAGTAG  166      CCAGATACATAGCAGTTCAGG    β-actin  DQ452569.1  GGACCTGACCGACTACCTCAT  181      GGGCAGCTCGTAGCTCTTCT    Gene name1  GenBank  Primer (5′–3′)  Product (bp)  E2F5  XM_001924905  TCCAGAAATGGGTCAGAATG  226      GATATGTTGCTCAGGCAGGT    IL-8  NM_213867  AACTGGCTGTTGCCTTCTTG  252      CCTTCTGCACCCACTTTTCC    Smad4  NM_214072  CGGTGTTGATGACCTTCGT  169      GGCAATAGGCATGGTATGA    NFATC2  NM_001113452  TGGTGCCTGCCATTCCTATCT  161      GGCTCCTCGGCTACCTTCTG    NOS2  NM_001143690  CTCAAATCGCAGCAGAATC  242      TTGTCCTTGACCCAGTAGC    TNF-α  NM_214022  ACGCTCTTCTGCCTACTGC  162      TCCCTCGGCTTTGACATT    ATM  NM_001123080  CTCACAAACAAGCCGATCCA  179      TCAACTCCAGCCAGAAAGCA    CYCS  NM_001129970  TCCCCTCCTACAGAGATGGTT  165      ATGAGATAGCAAAGGGATCGT    B2M  NM_213978  TTCACACCGCTCCAGTAG  166      CCAGATACATAGCAGTTCAGG    β-actin  DQ452569.1  GGACCTGACCGACTACCTCAT  181      GGGCAGCTCGTAGCTCTTCT    1NOS2 = nitric oxide synthase 2, inducible; CYCS = cytochrome c, somatic; NAFTC2 = nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2; ATM = ataxia telangiectasia mutated; TNF-α = tumor necrosis factor α; IL-8 = interleukin 8; Smad4 = SMAD family member 4; E2F5 = E2F transcription factor 5-like; B2M = beta-2-microglobulin. View Large Table 1. Specific primer sequences used in real-time quantitative real-time PCR Gene name1  GenBank  Primer (5′–3′)  Product (bp)  E2F5  XM_001924905  TCCAGAAATGGGTCAGAATG  226      GATATGTTGCTCAGGCAGGT    IL-8  NM_213867  AACTGGCTGTTGCCTTCTTG  252      CCTTCTGCACCCACTTTTCC    Smad4  NM_214072  CGGTGTTGATGACCTTCGT  169      GGCAATAGGCATGGTATGA    NFATC2  NM_001113452  TGGTGCCTGCCATTCCTATCT  161      GGCTCCTCGGCTACCTTCTG    NOS2  NM_001143690  CTCAAATCGCAGCAGAATC  242      TTGTCCTTGACCCAGTAGC    TNF-α  NM_214022  ACGCTCTTCTGCCTACTGC  162      TCCCTCGGCTTTGACATT    ATM  NM_001123080  CTCACAAACAAGCCGATCCA  179      TCAACTCCAGCCAGAAAGCA    CYCS  NM_001129970  TCCCCTCCTACAGAGATGGTT  165      ATGAGATAGCAAAGGGATCGT    B2M  NM_213978  TTCACACCGCTCCAGTAG  166      CCAGATACATAGCAGTTCAGG    β-actin  DQ452569.1  GGACCTGACCGACTACCTCAT  181      GGGCAGCTCGTAGCTCTTCT    Gene name1  GenBank  Primer (5′–3′)  Product (bp)  E2F5  XM_001924905  TCCAGAAATGGGTCAGAATG  226      GATATGTTGCTCAGGCAGGT    IL-8  NM_213867  AACTGGCTGTTGCCTTCTTG  252      CCTTCTGCACCCACTTTTCC    Smad4  NM_214072  CGGTGTTGATGACCTTCGT  169      GGCAATAGGCATGGTATGA    NFATC2  NM_001113452  TGGTGCCTGCCATTCCTATCT  161      GGCTCCTCGGCTACCTTCTG    NOS2  NM_001143690  CTCAAATCGCAGCAGAATC  242      TTGTCCTTGACCCAGTAGC    TNF-α  NM_214022  ACGCTCTTCTGCCTACTGC  162      TCCCTCGGCTTTGACATT    ATM  NM_001123080  CTCACAAACAAGCCGATCCA  179      TCAACTCCAGCCAGAAAGCA    CYCS  NM_001129970  TCCCCTCCTACAGAGATGGTT  165      ATGAGATAGCAAAGGGATCGT    B2M  NM_213978  TTCACACCGCTCCAGTAG  166      CCAGATACATAGCAGTTCAGG    β-actin  DQ452569.1  GGACCTGACCGACTACCTCAT  181      GGGCAGCTCGTAGCTCTTCT    1NOS2 = nitric oxide synthase 2, inducible; CYCS = cytochrome c, somatic; NAFTC2 = nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2; ATM = ataxia telangiectasia mutated; TNF-α = tumor necrosis factor α; IL-8 = interleukin 8; Smad4 = SMAD family member 4; E2F5 = E2F transcription factor 5-like; B2M = beta-2-microglobulin. View Large RESULTS Transcriptome To identify candidate genes associated with weaning response, Agilent Porcine 1-color gene expression microarrays were used to study gene expression profiles after weaning in pigs. We identified 445 annotated transcripts that were differentially expressed between the weaned and the suckling jejunums at the cutoff criteria of the fold change ≥1.5 or < 0.67 and P < 0.05 (using the 2-sample t statistical test). Among these genes, 286 genes were upregulated and 159 genes were downregulated (Supplementary File 1). Most of these genes are cellular process related and regulators that may be involved in cellular binding, translation regulation, catalytic activity, biological regulation, developmental processes, and metabolic process. Other genes that were found to be differentially expressed are closely related to immune responses. Among the most interesting findings were that highly abundant transcripts in weaned pigs were highly enriched in functions related to cellular processes and with roles in cell differentiation, motion, cell death, and the cell cycle. In Table 2 and Table 3, most of the differentially expressed genes related to cell cycle regulation are listed. Among these genes are some oncogenes, for example, caspase-10, tumor necrosis factor (TNF), interleukin 8 (IL-8), and ataxia telangiectasia mutated (ATM) are upregulated whereas cell cycle regulators such as E2F transcription factor 5-like (E2F5) and SMAD family member 4 (Smad4) are downregulated. Table 2. Fold changes and P-values for the upregulated cellular process-related genes in weaned pigs versus suckling pigs Gene  NCBI no.  Description  P-value  Fold change  CYP1A1  NM_214412  cytochrome P450 1A1  0.0009  21.4000  NOS2  NM_001143690  nitric oxide synthase 2, inducible  0.0066  8.1900  CSTB  NM_001097496  cystatin B (stefin B)  0.0029  7.2817  TEX11  XM_003484125  testis expressed 11  0.0121  3.7868  NFATC2  NM_001113452  nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2  0.0357  3.5955  AREG  NM_214376  amphiregulin  0.0038  3.4800  LIFR-beta  U97364  leukemia inhibitory factor receptor beta  0.0091  2.8226  IFNB1  NM_001003923  interferon beta  0.0109  2.7857  CYCS  NM_001129970  cytochrome c, somatic  0.0041  2.5381  PSMC5  XM_001925501  proteasome (prosome, macropain) 26S subunit, ATPase, 5  0.0001  2.5314  TDRD1  XM_001927041  tudor domain-containing protein 1-like  0.0350  2.4912  TNF  NM_214022  tumor necrosis factor  0.0008  2.4013  FCAR  NM_001123112  Fc fragment of IgA, receptor for  0.0474  2.3783  IL8  NM_213867  interleukin 8  0.0134  2.3620  ATM  NM_001123080  ataxia telangiectasia mutated  0.0388  2.2134  SH2B3  XM_001929523  SH2B adaptor protein 3  0.0048  2.1362  PVRL1  NM_001001262  poliovirus receptor-related 1 (herpesvirus entry mediator C)  0.0362  2.0915  TXNRD1  NM_214154  thioredoxin reductase 1  0.0124  2.0607  CSF2  NM_214118  colony stimulating factor 2 (granulocyte-macrophage)  0.0007  2.1500  ANG  NM_001044573  angiogenin  0.0380  2.0878  CCL24  NM_001161434  chemokine ligand 24-like protein  0.0183  2.0400  CCDC99  XM_003134063  coiled-coil domain containing 99  0.0467  2.0403  ADCYAP1  NM_001001544  adenylate cyclase activating polypeptide 1 (pituitary)  0.0298  2.0058  GBP2  NM_001128474  guanylate binding protein 2, interferon-inducible  0.0103  1.9568  AATK  XM_003357943  apoptosis-associated tyrosine kinase  0.0416  1.9276  GAL  NM_214234  galanin prepropeptide  0.0117  1.9151  TBK1  NM_001105292  TANK-binding kinase 1  0.0262  1.9134  BAD  XM_003122573  bcl2 antagonist of cell death-like  0.0000  1.8911  PSMA4  NM_001244468  proteasome (prosome, macropain) subunit, alpha type, 4  0.0126  1.8909  PSMB3  NM_001144902  proteasome (prosome, macropain) subunit, beta type, 3  0.0176  1.8866  SMN1  NM_001130735  survival of motor neuron 1, telomeric  0.0015  1.8325  TIAM1  XM_003132751  T-lymphoma invasion and metastasis-inducing protein 1-like  0.0214  1.8163  PF4  XM_003126161  platelet factor 4-like  0.0350  1.8076  ANAPC1  XM_003124813  anaphase promoting complex subunit 1  0.0040  1.7896  ERH  NM_001185163  enhancer of rudimentary homolog (Drosophila)  0.0033  1.7437  MTBP  XM_001924836  Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104 kDa  0.0204  1.7202  TRIM35  XM_001928380  tripartite motif containing 35  0.0060  1.6604  0ITGB2  NM_213908  integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)  0.0119  1.6589  RIPK1  XM_003128161  receptor (TNFRSF)-interacting serine-threonine kinase 1  0.0000  1.6500  TCF19  NM_001167591  transcription factor 19  0.0475  1.6466  PSMB8  NM_213935.1  proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)  0.0400  1.6410  IFI30  NM_001131046  interferon, gamma-inducible protein 30  0.0155  1.6241  LCP1  XM_001929138  lymphocyte cytosolic protein 1 (L-plastin)  0.0116  1.6210  BMP7  NM_001105290  bone morphogenetic protein 7  0.0138  1.6040  TIMP1  NM_213857  TIMP metallopeptidase inhibitor 1  0.0049  1.6002  IRF8  NM_001252427  interferon regulatory factor 8  0.0301  1.5952  PPP3CC  XM_003483381  protein phosphatase 3, catalytic subunit, gamma isozyme, transcript variant 2  0.0010  1.5800  SFRS5  XM_003360745  serine/arginine-rich splicing factor 5  0.0354  1.5752  PSMA3  XM_001927990  multicatalytic proteinase subunit K  0.0003  1.5319  Caspase-10  NM_001161640  caspase 10, apoptosis-related cysteine peptidase  0.0100  1.5300  VAV2  XM_001927141  vav 2 guanine nucleotide exchange factor  0.0020  1.5200  CDKN3  NM_214320  cyclin-dependent kinase inhibitor 3  0.0489  1.5057  CCAR1  XM_001928522  cell division cycle and apoptosis regulator 1  0.0390  1.5007  Gene  NCBI no.  Description  P-value  Fold change  CYP1A1  NM_214412  cytochrome P450 1A1  0.0009  21.4000  NOS2  NM_001143690  nitric oxide synthase 2, inducible  0.0066  8.1900  CSTB  NM_001097496  cystatin B (stefin B)  0.0029  7.2817  TEX11  XM_003484125  testis expressed 11  0.0121  3.7868  NFATC2  NM_001113452  nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2  0.0357  3.5955  AREG  NM_214376  amphiregulin  0.0038  3.4800  LIFR-beta  U97364  leukemia inhibitory factor receptor beta  0.0091  2.8226  IFNB1  NM_001003923  interferon beta  0.0109  2.7857  CYCS  NM_001129970  cytochrome c, somatic  0.0041  2.5381  PSMC5  XM_001925501  proteasome (prosome, macropain) 26S subunit, ATPase, 5  0.0001  2.5314  TDRD1  XM_001927041  tudor domain-containing protein 1-like  0.0350  2.4912  TNF  NM_214022  tumor necrosis factor  0.0008  2.4013  FCAR  NM_001123112  Fc fragment of IgA, receptor for  0.0474  2.3783  IL8  NM_213867  interleukin 8  0.0134  2.3620  ATM  NM_001123080  ataxia telangiectasia mutated  0.0388  2.2134  SH2B3  XM_001929523  SH2B adaptor protein 3  0.0048  2.1362  PVRL1  NM_001001262  poliovirus receptor-related 1 (herpesvirus entry mediator C)  0.0362  2.0915  TXNRD1  NM_214154  thioredoxin reductase 1  0.0124  2.0607  CSF2  NM_214118  colony stimulating factor 2 (granulocyte-macrophage)  0.0007  2.1500  ANG  NM_001044573  angiogenin  0.0380  2.0878  CCL24  NM_001161434  chemokine ligand 24-like protein  0.0183  2.0400  CCDC99  XM_003134063  coiled-coil domain containing 99  0.0467  2.0403  ADCYAP1  NM_001001544  adenylate cyclase activating polypeptide 1 (pituitary)  0.0298  2.0058  GBP2  NM_001128474  guanylate binding protein 2, interferon-inducible  0.0103  1.9568  AATK  XM_003357943  apoptosis-associated tyrosine kinase  0.0416  1.9276  GAL  NM_214234  galanin prepropeptide  0.0117  1.9151  TBK1  NM_001105292  TANK-binding kinase 1  0.0262  1.9134  BAD  XM_003122573  bcl2 antagonist of cell death-like  0.0000  1.8911  PSMA4  NM_001244468  proteasome (prosome, macropain) subunit, alpha type, 4  0.0126  1.8909  PSMB3  NM_001144902  proteasome (prosome, macropain) subunit, beta type, 3  0.0176  1.8866  SMN1  NM_001130735  survival of motor neuron 1, telomeric  0.0015  1.8325  TIAM1  XM_003132751  T-lymphoma invasion and metastasis-inducing protein 1-like  0.0214  1.8163  PF4  XM_003126161  platelet factor 4-like  0.0350  1.8076  ANAPC1  XM_003124813  anaphase promoting complex subunit 1  0.0040  1.7896  ERH  NM_001185163  enhancer of rudimentary homolog (Drosophila)  0.0033  1.7437  MTBP  XM_001924836  Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104 kDa  0.0204  1.7202  TRIM35  XM_001928380  tripartite motif containing 35  0.0060  1.6604  0ITGB2  NM_213908  integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)  0.0119  1.6589  RIPK1  XM_003128161  receptor (TNFRSF)-interacting serine-threonine kinase 1  0.0000  1.6500  TCF19  NM_001167591  transcription factor 19  0.0475  1.6466  PSMB8  NM_213935.1  proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)  0.0400  1.6410  IFI30  NM_001131046  interferon, gamma-inducible protein 30  0.0155  1.6241  LCP1  XM_001929138  lymphocyte cytosolic protein 1 (L-plastin)  0.0116  1.6210  BMP7  NM_001105290  bone morphogenetic protein 7  0.0138  1.6040  TIMP1  NM_213857  TIMP metallopeptidase inhibitor 1  0.0049  1.6002  IRF8  NM_001252427  interferon regulatory factor 8  0.0301  1.5952  PPP3CC  XM_003483381  protein phosphatase 3, catalytic subunit, gamma isozyme, transcript variant 2  0.0010  1.5800  SFRS5  XM_003360745  serine/arginine-rich splicing factor 5  0.0354  1.5752  PSMA3  XM_001927990  multicatalytic proteinase subunit K  0.0003  1.5319  Caspase-10  NM_001161640  caspase 10, apoptosis-related cysteine peptidase  0.0100  1.5300  VAV2  XM_001927141  vav 2 guanine nucleotide exchange factor  0.0020  1.5200  CDKN3  NM_214320  cyclin-dependent kinase inhibitor 3  0.0489  1.5057  CCAR1  XM_001928522  cell division cycle and apoptosis regulator 1  0.0390  1.5007  1NCBI = National Center for Biotechnology Information. View Large Table 2. Fold changes and P-values for the upregulated cellular process-related genes in weaned pigs versus suckling pigs Gene  NCBI no.  Description  P-value  Fold change  CYP1A1  NM_214412  cytochrome P450 1A1  0.0009  21.4000  NOS2  NM_001143690  nitric oxide synthase 2, inducible  0.0066  8.1900  CSTB  NM_001097496  cystatin B (stefin B)  0.0029  7.2817  TEX11  XM_003484125  testis expressed 11  0.0121  3.7868  NFATC2  NM_001113452  nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2  0.0357  3.5955  AREG  NM_214376  amphiregulin  0.0038  3.4800  LIFR-beta  U97364  leukemia inhibitory factor receptor beta  0.0091  2.8226  IFNB1  NM_001003923  interferon beta  0.0109  2.7857  CYCS  NM_001129970  cytochrome c, somatic  0.0041  2.5381  PSMC5  XM_001925501  proteasome (prosome, macropain) 26S subunit, ATPase, 5  0.0001  2.5314  TDRD1  XM_001927041  tudor domain-containing protein 1-like  0.0350  2.4912  TNF  NM_214022  tumor necrosis factor  0.0008  2.4013  FCAR  NM_001123112  Fc fragment of IgA, receptor for  0.0474  2.3783  IL8  NM_213867  interleukin 8  0.0134  2.3620  ATM  NM_001123080  ataxia telangiectasia mutated  0.0388  2.2134  SH2B3  XM_001929523  SH2B adaptor protein 3  0.0048  2.1362  PVRL1  NM_001001262  poliovirus receptor-related 1 (herpesvirus entry mediator C)  0.0362  2.0915  TXNRD1  NM_214154  thioredoxin reductase 1  0.0124  2.0607  CSF2  NM_214118  colony stimulating factor 2 (granulocyte-macrophage)  0.0007  2.1500  ANG  NM_001044573  angiogenin  0.0380  2.0878  CCL24  NM_001161434  chemokine ligand 24-like protein  0.0183  2.0400  CCDC99  XM_003134063  coiled-coil domain containing 99  0.0467  2.0403  ADCYAP1  NM_001001544  adenylate cyclase activating polypeptide 1 (pituitary)  0.0298  2.0058  GBP2  NM_001128474  guanylate binding protein 2, interferon-inducible  0.0103  1.9568  AATK  XM_003357943  apoptosis-associated tyrosine kinase  0.0416  1.9276  GAL  NM_214234  galanin prepropeptide  0.0117  1.9151  TBK1  NM_001105292  TANK-binding kinase 1  0.0262  1.9134  BAD  XM_003122573  bcl2 antagonist of cell death-like  0.0000  1.8911  PSMA4  NM_001244468  proteasome (prosome, macropain) subunit, alpha type, 4  0.0126  1.8909  PSMB3  NM_001144902  proteasome (prosome, macropain) subunit, beta type, 3  0.0176  1.8866  SMN1  NM_001130735  survival of motor neuron 1, telomeric  0.0015  1.8325  TIAM1  XM_003132751  T-lymphoma invasion and metastasis-inducing protein 1-like  0.0214  1.8163  PF4  XM_003126161  platelet factor 4-like  0.0350  1.8076  ANAPC1  XM_003124813  anaphase promoting complex subunit 1  0.0040  1.7896  ERH  NM_001185163  enhancer of rudimentary homolog (Drosophila)  0.0033  1.7437  MTBP  XM_001924836  Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104 kDa  0.0204  1.7202  TRIM35  XM_001928380  tripartite motif containing 35  0.0060  1.6604  0ITGB2  NM_213908  integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)  0.0119  1.6589  RIPK1  XM_003128161  receptor (TNFRSF)-interacting serine-threonine kinase 1  0.0000  1.6500  TCF19  NM_001167591  transcription factor 19  0.0475  1.6466  PSMB8  NM_213935.1  proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)  0.0400  1.6410  IFI30  NM_001131046  interferon, gamma-inducible protein 30  0.0155  1.6241  LCP1  XM_001929138  lymphocyte cytosolic protein 1 (L-plastin)  0.0116  1.6210  BMP7  NM_001105290  bone morphogenetic protein 7  0.0138  1.6040  TIMP1  NM_213857  TIMP metallopeptidase inhibitor 1  0.0049  1.6002  IRF8  NM_001252427  interferon regulatory factor 8  0.0301  1.5952  PPP3CC  XM_003483381  protein phosphatase 3, catalytic subunit, gamma isozyme, transcript variant 2  0.0010  1.5800  SFRS5  XM_003360745  serine/arginine-rich splicing factor 5  0.0354  1.5752  PSMA3  XM_001927990  multicatalytic proteinase subunit K  0.0003  1.5319  Caspase-10  NM_001161640  caspase 10, apoptosis-related cysteine peptidase  0.0100  1.5300  VAV2  XM_001927141  vav 2 guanine nucleotide exchange factor  0.0020  1.5200  CDKN3  NM_214320  cyclin-dependent kinase inhibitor 3  0.0489  1.5057  CCAR1  XM_001928522  cell division cycle and apoptosis regulator 1  0.0390  1.5007  Gene  NCBI no.  Description  P-value  Fold change  CYP1A1  NM_214412  cytochrome P450 1A1  0.0009  21.4000  NOS2  NM_001143690  nitric oxide synthase 2, inducible  0.0066  8.1900  CSTB  NM_001097496  cystatin B (stefin B)  0.0029  7.2817  TEX11  XM_003484125  testis expressed 11  0.0121  3.7868  NFATC2  NM_001113452  nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2  0.0357  3.5955  AREG  NM_214376  amphiregulin  0.0038  3.4800  LIFR-beta  U97364  leukemia inhibitory factor receptor beta  0.0091  2.8226  IFNB1  NM_001003923  interferon beta  0.0109  2.7857  CYCS  NM_001129970  cytochrome c, somatic  0.0041  2.5381  PSMC5  XM_001925501  proteasome (prosome, macropain) 26S subunit, ATPase, 5  0.0001  2.5314  TDRD1  XM_001927041  tudor domain-containing protein 1-like  0.0350  2.4912  TNF  NM_214022  tumor necrosis factor  0.0008  2.4013  FCAR  NM_001123112  Fc fragment of IgA, receptor for  0.0474  2.3783  IL8  NM_213867  interleukin 8  0.0134  2.3620  ATM  NM_001123080  ataxia telangiectasia mutated  0.0388  2.2134  SH2B3  XM_001929523  SH2B adaptor protein 3  0.0048  2.1362  PVRL1  NM_001001262  poliovirus receptor-related 1 (herpesvirus entry mediator C)  0.0362  2.0915  TXNRD1  NM_214154  thioredoxin reductase 1  0.0124  2.0607  CSF2  NM_214118  colony stimulating factor 2 (granulocyte-macrophage)  0.0007  2.1500  ANG  NM_001044573  angiogenin  0.0380  2.0878  CCL24  NM_001161434  chemokine ligand 24-like protein  0.0183  2.0400  CCDC99  XM_003134063  coiled-coil domain containing 99  0.0467  2.0403  ADCYAP1  NM_001001544  adenylate cyclase activating polypeptide 1 (pituitary)  0.0298  2.0058  GBP2  NM_001128474  guanylate binding protein 2, interferon-inducible  0.0103  1.9568  AATK  XM_003357943  apoptosis-associated tyrosine kinase  0.0416  1.9276  GAL  NM_214234  galanin prepropeptide  0.0117  1.9151  TBK1  NM_001105292  TANK-binding kinase 1  0.0262  1.9134  BAD  XM_003122573  bcl2 antagonist of cell death-like  0.0000  1.8911  PSMA4  NM_001244468  proteasome (prosome, macropain) subunit, alpha type, 4  0.0126  1.8909  PSMB3  NM_001144902  proteasome (prosome, macropain) subunit, beta type, 3  0.0176  1.8866  SMN1  NM_001130735  survival of motor neuron 1, telomeric  0.0015  1.8325  TIAM1  XM_003132751  T-lymphoma invasion and metastasis-inducing protein 1-like  0.0214  1.8163  PF4  XM_003126161  platelet factor 4-like  0.0350  1.8076  ANAPC1  XM_003124813  anaphase promoting complex subunit 1  0.0040  1.7896  ERH  NM_001185163  enhancer of rudimentary homolog (Drosophila)  0.0033  1.7437  MTBP  XM_001924836  Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104 kDa  0.0204  1.7202  TRIM35  XM_001928380  tripartite motif containing 35  0.0060  1.6604  0ITGB2  NM_213908  integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)  0.0119  1.6589  RIPK1  XM_003128161  receptor (TNFRSF)-interacting serine-threonine kinase 1  0.0000  1.6500  TCF19  NM_001167591  transcription factor 19  0.0475  1.6466  PSMB8  NM_213935.1  proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)  0.0400  1.6410  IFI30  NM_001131046  interferon, gamma-inducible protein 30  0.0155  1.6241  LCP1  XM_001929138  lymphocyte cytosolic protein 1 (L-plastin)  0.0116  1.6210  BMP7  NM_001105290  bone morphogenetic protein 7  0.0138  1.6040  TIMP1  NM_213857  TIMP metallopeptidase inhibitor 1  0.0049  1.6002  IRF8  NM_001252427  interferon regulatory factor 8  0.0301  1.5952  PPP3CC  XM_003483381  protein phosphatase 3, catalytic subunit, gamma isozyme, transcript variant 2  0.0010  1.5800  SFRS5  XM_003360745  serine/arginine-rich splicing factor 5  0.0354  1.5752  PSMA3  XM_001927990  multicatalytic proteinase subunit K  0.0003  1.5319  Caspase-10  NM_001161640  caspase 10, apoptosis-related cysteine peptidase  0.0100  1.5300  VAV2  XM_001927141  vav 2 guanine nucleotide exchange factor  0.0020  1.5200  CDKN3  NM_214320  cyclin-dependent kinase inhibitor 3  0.0489  1.5057  CCAR1  XM_001928522  cell division cycle and apoptosis regulator 1  0.0390  1.5007  1NCBI = National Center for Biotechnology Information. View Large Table 3. Fold changes and P-values for the downregulated cellular process-related genes in weaned pigs versus suckling pigs Gene  NCBI1 no.  Description  P-value  Fold change  FOXO3  NM_001135959  forkhead box O3  0.0097  0.6333  RRAGC  XM_003127801  Ras-related GTP binding C  0.0415  0.6239  MACF1  XM_003127807  microtubule-actin crosslinking factor 1, transcript variant 1  0.0017  0.6237  ACVR1  XM_001927798  activin A receptor, type I  0.0143  0.6210  SOS2  XM_001925014  son of sevenless homolog 2 (Drosophila)  0.0000  0.6200  SMAD4  NM_214072  SMAD family member 4  0.0374  0.6050  NEUROD1  XM_003359578  neurogenic differentiation 1  0.0393  0.6026  ESR1  NM_214220  estrogen receptor 1  0.0208  0.5824  EXO1  XM_003130555  exonuclease 1  0.0289  0.5713  ALB  NM_001005208  albumin  0.0100  0.5700  TXNIP  NM_214313.2  thioredoxin interacting protein  0.0196  0.5622  C8B  NM_001097451  complement component 8, beta polypeptide  0.0171  0.5570  NOTCH2  XM_003481477  notch 2  0.0039  0.5542  CTNNBL1  HQ403605  catenin beta-like 1 protein  0.0097  0.5500  LTA  NM_214453  lymphotoxin alpha (tumor necrosis factor superfamily, member 1)  0.0119  0.5400  VEGFA  NM_214084  vascular endothelial growth factor A  0.0144  0.5293  HORMAD1  NM_001194981  HORMA domain containing 1  0.0171  0.5065  MMD  NM_001044595  monocyte to macrophage differentiation-associated  0.0219  0.5029  c-JUN  NM_213880  c-jun oncogene  0.0129  0.4329  CCK  NM_214237  cholecystokinin  0.0164  0.4281  CDC23  NM_001267826  cell division cycle 23 homolog (S. cerevisiae)  0.0482  0.4112  CCR6  DQ991099  chemokine (C-C motif) receptor 6  0.0163  0.3474  STRADB  XM_003133587  STE20-related kinase adaptor beta  0.0274  0.3407  E2F5  XM_001924905  E2F transcription factor 5-like  0.0148  0.3162  GPX2  NM_001115136  glutathione peroxidase 2 (gastrointestinal)  0.0285  0.2244  PHGDH  NM_001123162  phosphoglycerate dehydrogenase  0.0343  0.2134  F12  NM_214242  coagulation factor XII (Hageman factor)  0.0471  0.0952  Gene  NCBI1 no.  Description  P-value  Fold change  FOXO3  NM_001135959  forkhead box O3  0.0097  0.6333  RRAGC  XM_003127801  Ras-related GTP binding C  0.0415  0.6239  MACF1  XM_003127807  microtubule-actin crosslinking factor 1, transcript variant 1  0.0017  0.6237  ACVR1  XM_001927798  activin A receptor, type I  0.0143  0.6210  SOS2  XM_001925014  son of sevenless homolog 2 (Drosophila)  0.0000  0.6200  SMAD4  NM_214072  SMAD family member 4  0.0374  0.6050  NEUROD1  XM_003359578  neurogenic differentiation 1  0.0393  0.6026  ESR1  NM_214220  estrogen receptor 1  0.0208  0.5824  EXO1  XM_003130555  exonuclease 1  0.0289  0.5713  ALB  NM_001005208  albumin  0.0100  0.5700  TXNIP  NM_214313.2  thioredoxin interacting protein  0.0196  0.5622  C8B  NM_001097451  complement component 8, beta polypeptide  0.0171  0.5570  NOTCH2  XM_003481477  notch 2  0.0039  0.5542  CTNNBL1  HQ403605  catenin beta-like 1 protein  0.0097  0.5500  LTA  NM_214453  lymphotoxin alpha (tumor necrosis factor superfamily, member 1)  0.0119  0.5400  VEGFA  NM_214084  vascular endothelial growth factor A  0.0144  0.5293  HORMAD1  NM_001194981  HORMA domain containing 1  0.0171  0.5065  MMD  NM_001044595  monocyte to macrophage differentiation-associated  0.0219  0.5029  c-JUN  NM_213880  c-jun oncogene  0.0129  0.4329  CCK  NM_214237  cholecystokinin  0.0164  0.4281  CDC23  NM_001267826  cell division cycle 23 homolog (S. cerevisiae)  0.0482  0.4112  CCR6  DQ991099  chemokine (C-C motif) receptor 6  0.0163  0.3474  STRADB  XM_003133587  STE20-related kinase adaptor beta  0.0274  0.3407  E2F5  XM_001924905  E2F transcription factor 5-like  0.0148  0.3162  GPX2  NM_001115136  glutathione peroxidase 2 (gastrointestinal)  0.0285  0.2244  PHGDH  NM_001123162  phosphoglycerate dehydrogenase  0.0343  0.2134  F12  NM_214242  coagulation factor XII (Hageman factor)  0.0471  0.0952  1NCBI = National Center for Biotechnology Information. View Large Table 3. Fold changes and P-values for the downregulated cellular process-related genes in weaned pigs versus suckling pigs Gene  NCBI1 no.  Description  P-value  Fold change  FOXO3  NM_001135959  forkhead box O3  0.0097  0.6333  RRAGC  XM_003127801  Ras-related GTP binding C  0.0415  0.6239  MACF1  XM_003127807  microtubule-actin crosslinking factor 1, transcript variant 1  0.0017  0.6237  ACVR1  XM_001927798  activin A receptor, type I  0.0143  0.6210  SOS2  XM_001925014  son of sevenless homolog 2 (Drosophila)  0.0000  0.6200  SMAD4  NM_214072  SMAD family member 4  0.0374  0.6050  NEUROD1  XM_003359578  neurogenic differentiation 1  0.0393  0.6026  ESR1  NM_214220  estrogen receptor 1  0.0208  0.5824  EXO1  XM_003130555  exonuclease 1  0.0289  0.5713  ALB  NM_001005208  albumin  0.0100  0.5700  TXNIP  NM_214313.2  thioredoxin interacting protein  0.0196  0.5622  C8B  NM_001097451  complement component 8, beta polypeptide  0.0171  0.5570  NOTCH2  XM_003481477  notch 2  0.0039  0.5542  CTNNBL1  HQ403605  catenin beta-like 1 protein  0.0097  0.5500  LTA  NM_214453  lymphotoxin alpha (tumor necrosis factor superfamily, member 1)  0.0119  0.5400  VEGFA  NM_214084  vascular endothelial growth factor A  0.0144  0.5293  HORMAD1  NM_001194981  HORMA domain containing 1  0.0171  0.5065  MMD  NM_001044595  monocyte to macrophage differentiation-associated  0.0219  0.5029  c-JUN  NM_213880  c-jun oncogene  0.0129  0.4329  CCK  NM_214237  cholecystokinin  0.0164  0.4281  CDC23  NM_001267826  cell division cycle 23 homolog (S. cerevisiae)  0.0482  0.4112  CCR6  DQ991099  chemokine (C-C motif) receptor 6  0.0163  0.3474  STRADB  XM_003133587  STE20-related kinase adaptor beta  0.0274  0.3407  E2F5  XM_001924905  E2F transcription factor 5-like  0.0148  0.3162  GPX2  NM_001115136  glutathione peroxidase 2 (gastrointestinal)  0.0285  0.2244  PHGDH  NM_001123162  phosphoglycerate dehydrogenase  0.0343  0.2134  F12  NM_214242  coagulation factor XII (Hageman factor)  0.0471  0.0952  Gene  NCBI1 no.  Description  P-value  Fold change  FOXO3  NM_001135959  forkhead box O3  0.0097  0.6333  RRAGC  XM_003127801  Ras-related GTP binding C  0.0415  0.6239  MACF1  XM_003127807  microtubule-actin crosslinking factor 1, transcript variant 1  0.0017  0.6237  ACVR1  XM_001927798  activin A receptor, type I  0.0143  0.6210  SOS2  XM_001925014  son of sevenless homolog 2 (Drosophila)  0.0000  0.6200  SMAD4  NM_214072  SMAD family member 4  0.0374  0.6050  NEUROD1  XM_003359578  neurogenic differentiation 1  0.0393  0.6026  ESR1  NM_214220  estrogen receptor 1  0.0208  0.5824  EXO1  XM_003130555  exonuclease 1  0.0289  0.5713  ALB  NM_001005208  albumin  0.0100  0.5700  TXNIP  NM_214313.2  thioredoxin interacting protein  0.0196  0.5622  C8B  NM_001097451  complement component 8, beta polypeptide  0.0171  0.5570  NOTCH2  XM_003481477  notch 2  0.0039  0.5542  CTNNBL1  HQ403605  catenin beta-like 1 protein  0.0097  0.5500  LTA  NM_214453  lymphotoxin alpha (tumor necrosis factor superfamily, member 1)  0.0119  0.5400  VEGFA  NM_214084  vascular endothelial growth factor A  0.0144  0.5293  HORMAD1  NM_001194981  HORMA domain containing 1  0.0171  0.5065  MMD  NM_001044595  monocyte to macrophage differentiation-associated  0.0219  0.5029  c-JUN  NM_213880  c-jun oncogene  0.0129  0.4329  CCK  NM_214237  cholecystokinin  0.0164  0.4281  CDC23  NM_001267826  cell division cycle 23 homolog (S. cerevisiae)  0.0482  0.4112  CCR6  DQ991099  chemokine (C-C motif) receptor 6  0.0163  0.3474  STRADB  XM_003133587  STE20-related kinase adaptor beta  0.0274  0.3407  E2F5  XM_001924905  E2F transcription factor 5-like  0.0148  0.3162  GPX2  NM_001115136  glutathione peroxidase 2 (gastrointestinal)  0.0285  0.2244  PHGDH  NM_001123162  phosphoglycerate dehydrogenase  0.0343  0.2134  F12  NM_214242  coagulation factor XII (Hageman factor)  0.0471  0.0952  1NCBI = National Center for Biotechnology Information. View Large Gene Ontology Category Analysis The functional annotations of the differentially expressed genes were classified in terms of biological process with SAS tools for the overrepresentation of specific GO terms. The results are expressed as bar charts and are shown in Fig. 1. The differentially expressed genes enriched in biological processes were mainly involved in cellular processes, biological regulation, metabolic processes, the regulation of biological processes, and so on (Fig. 1A). In particular, the genes associated with cellular processes (Fig. 1B) mainly related to cell communication, cell adhesion, cell death, cellular component organization, cell cycle, and cellular metabolic processes were highly enriched among the differentially expressed genes, which indicated an active cellular process in the enterocytes of weaned pigs. Figure 1. View largeDownload slide Functional category of differentially expressed transcripts induced by weaning in pigs. (A) Gene ontology (GO) biological processes for significantly differentially expressed genes. (B) Gene ontology categories of cellular processes. P value < 0.05 and false discovery rate < 0.05 were used as thresholds to select significant GO categories. Figure 1. View largeDownload slide Functional category of differentially expressed transcripts induced by weaning in pigs. (A) Gene ontology (GO) biological processes for significantly differentially expressed genes. (B) Gene ontology categories of cellular processes. P value < 0.05 and false discovery rate < 0.05 were used as thresholds to select significant GO categories. Kyoto Encyclopedia of Genes and Genomes Pathway Analyses As shown in Table 4, by using the KEGG database, the significant pathways were found to mainly contain cellular process (cell growth and death, cell communication, and cell motility), signal transduction (MAPK signaling pathway and Jak-STAT signaling pathway), signaling molecules and interaction, and several pathways associated with the immune response (chemokine signaling pathway, Toll-like receptor signaling pathway, T cell receptor signaling pathway, B cell receptor signaling pathway, and natural killer cell-mediated cytotoxicity). Among these pathways, cellular processes may play an important role in the jejunum after weaning. Table 4. Top Kyoto Encyclopedia of Genes and Genomes pathways enriched with differentially expressed genes induced by weaning Associated terms  Pathway name1  Hits  FDR2  P-value  Cell communication  Focal adhesion  14  0.0000  0.0000  Cell growth and death  Cell cycle  5  0.0011  0.0420    Apoptosis  10  0.0000  0.0000  Cell motility  Regulation of actin cytoskeleton  7  0.0002  0.0024  Development  Axon guidance  8  0.0001  0.0007  Signal transduction  Wnt signaling pathway  6  0.0001  0.0018    TGF-beta signaling pathway  7  0.0001  0.0003    MAPK signaling pathway  10  0.0000  0.0001    Jak-STAT signaling pathway  8  0.0000  0.0001    ErbB signaling pathway  5  0.0001  0.0009    VEGF signaling pathway  6  0.0000  0.0001    Phosphatidylinositol signaling system  3  0.0009  0.0265  Immune system  Chemokine signaling pathway  12  0.0000  0.0000    Leukocyte transendothelial migration  5  0.0002  0.0034    Antigen processing and presentation  3  0.0012  0.0389    Toll-like receptor signaling pathway  8  0.0000  0.0000    T cell receptor signaling pathway  10  0.0000  0.0000    B cell receptor signaling pathway  8  0.0000  0.0000    Hematopoietic cell lineage  4  0.0003  0.0067    Natural killer cell mediated cytotoxicity  9  0.0000  0.0000    Fc epsilon RI signaling pathway  6  0.0000  0.0001  Lipid Metabolism  Glycerophospholipid metabolism  3  0.0010  0.0291    Ether lipid metabolism  2  0.0012  0.0361  Amino Acid Metabolism  Tryptophan metabolism  3  0.0003  0.0051    Glycine, serine and threonine metabolism  2  0.0010  0.0292  Translation  Ribosome  4  0.0003  0.0067    Aminoacyl-tRNA biosynthesis  3  0.0003  0.0054  Folding, sorting, and degradation  Ubiquitin mediated proteolysis  6  0.0001  0.0012    Proteasome  4  0.0001  0.0008  Endocrine system  Insulin signaling pathway  6  0.0001  0.0011    Progesterone-mediated oocyte maturation  3  0.0012  0.0358    PPAR signaling pathway  4  0.0002  0.0030    Adipocytokine signaling pathway  4  0.0002  0.0027  Signaling molecules and interaction  Cytokine-cytokine receptor interaction  16  0.0000  0.0000    Neuroactive ligand-receptor interaction  7  0.0006  0.0173    Cell adhesion molecules  6  0.0001  0.0010    ECM-receptor interaction  6  0.0000  0.0001  Associated terms  Pathway name1  Hits  FDR2  P-value  Cell communication  Focal adhesion  14  0.0000  0.0000  Cell growth and death  Cell cycle  5  0.0011  0.0420    Apoptosis  10  0.0000  0.0000  Cell motility  Regulation of actin cytoskeleton  7  0.0002  0.0024  Development  Axon guidance  8  0.0001  0.0007  Signal transduction  Wnt signaling pathway  6  0.0001  0.0018    TGF-beta signaling pathway  7  0.0001  0.0003    MAPK signaling pathway  10  0.0000  0.0001    Jak-STAT signaling pathway  8  0.0000  0.0001    ErbB signaling pathway  5  0.0001  0.0009    VEGF signaling pathway  6  0.0000  0.0001    Phosphatidylinositol signaling system  3  0.0009  0.0265  Immune system  Chemokine signaling pathway  12  0.0000  0.0000    Leukocyte transendothelial migration  5  0.0002  0.0034    Antigen processing and presentation  3  0.0012  0.0389    Toll-like receptor signaling pathway  8  0.0000  0.0000    T cell receptor signaling pathway  10  0.0000  0.0000    B cell receptor signaling pathway  8  0.0000  0.0000    Hematopoietic cell lineage  4  0.0003  0.0067    Natural killer cell mediated cytotoxicity  9  0.0000  0.0000    Fc epsilon RI signaling pathway  6  0.0000  0.0001  Lipid Metabolism  Glycerophospholipid metabolism  3  0.0010  0.0291    Ether lipid metabolism  2  0.0012  0.0361  Amino Acid Metabolism  Tryptophan metabolism  3  0.0003  0.0051    Glycine, serine and threonine metabolism  2  0.0010  0.0292  Translation  Ribosome  4  0.0003  0.0067    Aminoacyl-tRNA biosynthesis  3  0.0003  0.0054  Folding, sorting, and degradation  Ubiquitin mediated proteolysis  6  0.0001  0.0012    Proteasome  4  0.0001  0.0008  Endocrine system  Insulin signaling pathway  6  0.0001  0.0011    Progesterone-mediated oocyte maturation  3  0.0012  0.0358    PPAR signaling pathway  4  0.0002  0.0030    Adipocytokine signaling pathway  4  0.0002  0.0027  Signaling molecules and interaction  Cytokine-cytokine receptor interaction  16  0.0000  0.0000    Neuroactive ligand-receptor interaction  7  0.0006  0.0173    Cell adhesion molecules  6  0.0001  0.0010    ECM-receptor interaction  6  0.0000  0.0001  1TGF = Transforming growth factor; MAPK = Mitogen-activated protein kinases; Jak = Janus kinase; STAT = signal transducer and activator of transcription; VEGF = vascular endothelial growth factor; Fc epsilon RI = Fc epsilon response induction; PPAR = Peroxisome Proliferator Activatived Receptors; ECM = extracellular matrix. 2FDR = false discovery rate. View Large Table 4. Top Kyoto Encyclopedia of Genes and Genomes pathways enriched with differentially expressed genes induced by weaning Associated terms  Pathway name1  Hits  FDR2  P-value  Cell communication  Focal adhesion  14  0.0000  0.0000  Cell growth and death  Cell cycle  5  0.0011  0.0420    Apoptosis  10  0.0000  0.0000  Cell motility  Regulation of actin cytoskeleton  7  0.0002  0.0024  Development  Axon guidance  8  0.0001  0.0007  Signal transduction  Wnt signaling pathway  6  0.0001  0.0018    TGF-beta signaling pathway  7  0.0001  0.0003    MAPK signaling pathway  10  0.0000  0.0001    Jak-STAT signaling pathway  8  0.0000  0.0001    ErbB signaling pathway  5  0.0001  0.0009    VEGF signaling pathway  6  0.0000  0.0001    Phosphatidylinositol signaling system  3  0.0009  0.0265  Immune system  Chemokine signaling pathway  12  0.0000  0.0000    Leukocyte transendothelial migration  5  0.0002  0.0034    Antigen processing and presentation  3  0.0012  0.0389    Toll-like receptor signaling pathway  8  0.0000  0.0000    T cell receptor signaling pathway  10  0.0000  0.0000    B cell receptor signaling pathway  8  0.0000  0.0000    Hematopoietic cell lineage  4  0.0003  0.0067    Natural killer cell mediated cytotoxicity  9  0.0000  0.0000    Fc epsilon RI signaling pathway  6  0.0000  0.0001  Lipid Metabolism  Glycerophospholipid metabolism  3  0.0010  0.0291    Ether lipid metabolism  2  0.0012  0.0361  Amino Acid Metabolism  Tryptophan metabolism  3  0.0003  0.0051    Glycine, serine and threonine metabolism  2  0.0010  0.0292  Translation  Ribosome  4  0.0003  0.0067    Aminoacyl-tRNA biosynthesis  3  0.0003  0.0054  Folding, sorting, and degradation  Ubiquitin mediated proteolysis  6  0.0001  0.0012    Proteasome  4  0.0001  0.0008  Endocrine system  Insulin signaling pathway  6  0.0001  0.0011    Progesterone-mediated oocyte maturation  3  0.0012  0.0358    PPAR signaling pathway  4  0.0002  0.0030    Adipocytokine signaling pathway  4  0.0002  0.0027  Signaling molecules and interaction  Cytokine-cytokine receptor interaction  16  0.0000  0.0000    Neuroactive ligand-receptor interaction  7  0.0006  0.0173    Cell adhesion molecules  6  0.0001  0.0010    ECM-receptor interaction  6  0.0000  0.0001  Associated terms  Pathway name1  Hits  FDR2  P-value  Cell communication  Focal adhesion  14  0.0000  0.0000  Cell growth and death  Cell cycle  5  0.0011  0.0420    Apoptosis  10  0.0000  0.0000  Cell motility  Regulation of actin cytoskeleton  7  0.0002  0.0024  Development  Axon guidance  8  0.0001  0.0007  Signal transduction  Wnt signaling pathway  6  0.0001  0.0018    TGF-beta signaling pathway  7  0.0001  0.0003    MAPK signaling pathway  10  0.0000  0.0001    Jak-STAT signaling pathway  8  0.0000  0.0001    ErbB signaling pathway  5  0.0001  0.0009    VEGF signaling pathway  6  0.0000  0.0001    Phosphatidylinositol signaling system  3  0.0009  0.0265  Immune system  Chemokine signaling pathway  12  0.0000  0.0000    Leukocyte transendothelial migration  5  0.0002  0.0034    Antigen processing and presentation  3  0.0012  0.0389    Toll-like receptor signaling pathway  8  0.0000  0.0000    T cell receptor signaling pathway  10  0.0000  0.0000    B cell receptor signaling pathway  8  0.0000  0.0000    Hematopoietic cell lineage  4  0.0003  0.0067    Natural killer cell mediated cytotoxicity  9  0.0000  0.0000    Fc epsilon RI signaling pathway  6  0.0000  0.0001  Lipid Metabolism  Glycerophospholipid metabolism  3  0.0010  0.0291    Ether lipid metabolism  2  0.0012  0.0361  Amino Acid Metabolism  Tryptophan metabolism  3  0.0003  0.0051    Glycine, serine and threonine metabolism  2  0.0010  0.0292  Translation  Ribosome  4  0.0003  0.0067    Aminoacyl-tRNA biosynthesis  3  0.0003  0.0054  Folding, sorting, and degradation  Ubiquitin mediated proteolysis  6  0.0001  0.0012    Proteasome  4  0.0001  0.0008  Endocrine system  Insulin signaling pathway  6  0.0001  0.0011    Progesterone-mediated oocyte maturation  3  0.0012  0.0358    PPAR signaling pathway  4  0.0002  0.0030    Adipocytokine signaling pathway  4  0.0002  0.0027  Signaling molecules and interaction  Cytokine-cytokine receptor interaction  16  0.0000  0.0000    Neuroactive ligand-receptor interaction  7  0.0006  0.0173    Cell adhesion molecules  6  0.0001  0.0010    ECM-receptor interaction  6  0.0000  0.0001  1TGF = Transforming growth factor; MAPK = Mitogen-activated protein kinases; Jak = Janus kinase; STAT = signal transducer and activator of transcription; VEGF = vascular endothelial growth factor; Fc epsilon RI = Fc epsilon response induction; PPAR = Peroxisome Proliferator Activatived Receptors; ECM = extracellular matrix. 2FDR = false discovery rate. View Large Confirmation of Microarray Findings with Quantitative Real-Time PCR To independently confirm the microarray results, qRT-PCR was performed on samples from the weaned and the suckling pigs that had been exposed to the same experimental conditions that were used in the microarray assay. The relative expression levels of 8 differentially expressed genes, ATM, cytochrome c, somatic (CYCS), nuclear factor of activated T cells (NFATC2), E2F5, NOS2, Smad4, IL-8, and TNF were assayed. As shown in Table 5, we found that apoptosis-related genes (CYCS, IL-8, TNF, NOS2, and ATM) and a transcription factor (NFATC2) were upregulated but that cell cycle control-related genes (E2F5 and Smad4) were downregulated. After weaning, higher expression levels of CYCS (P < 0.01), TNF (P < 0.05), NOS2 (P < 0.05), ATM (P < 0.05), and NFATC2 (P < 0.05) were detected in weaned pigs compared with suckling pigs. No significant differences in IL-8 and Smad4 gene expression were observed between the weaned and the suckling pigs by qRT-PCR (P > 0.05). Expression of E2F5 was lower (P < 0.05) in weaned pigs than suckling pigs. The results showed that the altered expression of these 8 genes identified by qRT-PCR was consistent with the microarray results (Table 5) although the extent of the changes as measured by the 2 methods did not match exactly due to the different nature of the procedures. The data could indicate that the results from the microarray analysis are good indicators of overall changes in gene expression. Table 5. Validation of the microarray data by quantitative real-time PCR (qRT-PCR) analysis of 8 representative genes   Microarray results  qRT-PCR results2    Gene name1  P-value  Fold change  P-value  Fold change  Regulation  CYCS  **  2.5381  **  8.4623  Up  TNF  **  2.4013  *  4.5948  Up  NOS2  **  8.1900  *  15.5500  Up  NFATC2  **  3.5955  *  9.6463  Up  IL-8  *  2.3620  #  3.0000  Up  ATM  *  2.2134  *  4.2100  Up  Smad4  *  0.6050  #  0.4475  Down  E2F5  *  0.3162  *  0.4310  Down    Microarray results  qRT-PCR results2    Gene name1  P-value  Fold change  P-value  Fold change  Regulation  CYCS  **  2.5381  **  8.4623  Up  TNF  **  2.4013  *  4.5948  Up  NOS2  **  8.1900  *  15.5500  Up  NFATC2  **  3.5955  *  9.6463  Up  IL-8  *  2.3620  #  3.0000  Up  ATM  *  2.2134  *  4.2100  Up  Smad4  *  0.6050  #  0.4475  Down  E2F5  *  0.3162  *  0.4310  Down  1NOS2 = nitric oxide synthase 2, inducible; CYCS = cytochrome c, somatic; NAFTC2 = nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2; ATM = ataxia telangiectasia mutated; TNF = tumor necrosis factor; IL-8 = interleukin 8; Smad4 = SMAD family member 4; E2F5 = E2F transcription factor 5-like. 2The qRT-PCR expression column gives the relative expression of the selected genes in weaning pigs compared with the suckling pigs after normalization against the expression of the housekeeping genes β-actin and beta-2-microglobulin. *P < 0.05; **P < 0.01; #P > 0.05. View Large Table 5. Validation of the microarray data by quantitative real-time PCR (qRT-PCR) analysis of 8 representative genes   Microarray results  qRT-PCR results2    Gene name1  P-value  Fold change  P-value  Fold change  Regulation  CYCS  **  2.5381  **  8.4623  Up  TNF  **  2.4013  *  4.5948  Up  NOS2  **  8.1900  *  15.5500  Up  NFATC2  **  3.5955  *  9.6463  Up  IL-8  *  2.3620  #  3.0000  Up  ATM  *  2.2134  *  4.2100  Up  Smad4  *  0.6050  #  0.4475  Down  E2F5  *  0.3162  *  0.4310  Down    Microarray results  qRT-PCR results2    Gene name1  P-value  Fold change  P-value  Fold change  Regulation  CYCS  **  2.5381  **  8.4623  Up  TNF  **  2.4013  *  4.5948  Up  NOS2  **  8.1900  *  15.5500  Up  NFATC2  **  3.5955  *  9.6463  Up  IL-8  *  2.3620  #  3.0000  Up  ATM  *  2.2134  *  4.2100  Up  Smad4  *  0.6050  #  0.4475  Down  E2F5  *  0.3162  *  0.4310  Down  1NOS2 = nitric oxide synthase 2, inducible; CYCS = cytochrome c, somatic; NAFTC2 = nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2; ATM = ataxia telangiectasia mutated; TNF = tumor necrosis factor; IL-8 = interleukin 8; Smad4 = SMAD family member 4; E2F5 = E2F transcription factor 5-like. 2The qRT-PCR expression column gives the relative expression of the selected genes in weaning pigs compared with the suckling pigs after normalization against the expression of the housekeeping genes β-actin and beta-2-microglobulin. *P < 0.05; **P < 0.01; #P > 0.05. View Large Signaling Network of Cellular Processes The differentially expressed genes involved in significant pathways were analyzed for their possible interactions, and the networks of genes involved in cellular processes were established using the KEGG database. Based on the results of the genomewide expression analysis between the weaned and the suckling pigs and the information of these selected genes linked to cell cycle machinery from online databases, the network of these selected genes was constructed and is shown in Fig. 2. Weaning leads to cell cycle arrest in the G0/G1 phase through the inhibition of E2F5 and the Smad4-dependent pathway and the activation of ATM and the CYCS-dependent apoptosis-related pathway. Weaning also induced increased gene expression of inflammatory factors (IL-8 and TNF), which inhibit the immune response. Figure 2. View largeDownload slide The signaling network of cell cycle processes caused by weaning stress in pigs. The relationships between genes and biological processes are indicated by lines, which represent positive promotion with a black arrow end and dotted lines indicating indirect effects. NOS2 = nitric oxide synthase 2, inducible; CYCS = cytochrome c, somatic; ATM = ataxia telangiectasia mutated; TNF = tumor necrosis factor; IL-8 = interleukin 8; Smad4 = SMAD family member 4; E2F5 = E2F transcription factor 5-like; c-JUN = c-jun oncogene; P53 = tumor protein 53; BAD = bcl2 antagonist of cell death-like; MAP3K14 = mitogen-activated protein kinase kinase kinase 14. Figure 2. View largeDownload slide The signaling network of cell cycle processes caused by weaning stress in pigs. The relationships between genes and biological processes are indicated by lines, which represent positive promotion with a black arrow end and dotted lines indicating indirect effects. NOS2 = nitric oxide synthase 2, inducible; CYCS = cytochrome c, somatic; ATM = ataxia telangiectasia mutated; TNF = tumor necrosis factor; IL-8 = interleukin 8; Smad4 = SMAD family member 4; E2F5 = E2F transcription factor 5-like; c-JUN = c-jun oncogene; P53 = tumor protein 53; BAD = bcl2 antagonist of cell death-like; MAP3K14 = mitogen-activated protein kinase kinase kinase 14. DISCUSSION Microarray analysis has been used to detect genomewide perturbations during various treatments and is particularly useful for screening the genes involved in specific biological processes of interest, such as diseases and responses to environmental stimuli. In the present study, we successfully identified 445 genes that were differentially expressed between the suckling and the weaned pigs. With the SAS, the differentially expressed genes displayed 2 main trends in weaned pigs, and these genes are critical in metabolic and cellular process pathways. These genes will likely contribute to our further research in weaned pigs. To our knowledge, no genomewide changes have been reported in weaned pigs. Such insight may lead to new rational approaches for preventing gastrointestinal dysfunction from weaning. Wang et al. (2008) selected 39 genes of known function that were differentially expressed, including 21 upregulated and 18 downregulated genes in the jejunum of 28-d-old weaned pigs compared with age-matched suckling pigs, and also proved that weaning increases oxidative stress but decreases cell proliferation in the gut. When compared with the genes presented herein, no differentially expressed genes were found to be in common between the 2 studies. The very different transcriptional profiles between the 2 experiments are likely due to the different microarray assays and the different ages of the weaned pigs that were used. We previously reported that weaned pigs showed extensive apoptosis in the jejunum (Zhu et al., 2013). Apoptosis can be triggered by many different cellular stimuli, including various types of stress and damage, and can lead to the dysfunction of cell survival mechanisms. Accordingly, in the present study, the cellular process-related pathways were most important to our research goals. We identified a group of cell death- and cell cycle-related genes with expression levels that were significantly different, suggesting that they may have important effects in the regulation of apoptosis and, consequently, in the pathogenesis of weaning-induced intestinal dysfunction. Among these genes, tumor suppressors such as caspase-10 and CYCs were substantially upregulated as were proto-oncogenes such as ATM. Expression levels of the cell cycle control-associated genes Smad4 and E2F5 were downregulated in response to weaning. The transforming growth factor-β signaling pathway is involved in a variety of biological processes, including cell proliferation, apoptosis, and cell cycle control (Siegel and Massague, 2003; Heldin et al., 2009). The Smad4 gene functions as a key tumor suppressor, which plays a crucial role in the downstream regulation of transforming growth factor-β signaling (Nakao et al., 1997). The loss of Smad4 could initiate tumor development and invasion (Takaku et al., 1998). The inactivation of the Smad4 gene also correlates with the abrogation of transforming growth factor-β-induced growth inhibition and cell cycle arrest (Lee and Bae, 2002). The Smad4 gene also has an essential role in anti-inflammation under pathological conditions (Meng et al., 2012). Haploinsufficiency of Smad4 can augment the susceptibility of acute colitis inflammation in mammals (Szigeti et al., 2012). Deletion of Smad4 from skin can result in delayed wound healing and enhanced inflammation-associated carcinogenesis (Owens et al., 2010). In the present study, the loss of Smad4 might contribute to increased intestinal inflammation susceptibility in weaned pigs. As a member of the E2F transcription factor family, E2F5 binds to the promoters of the target genes involved in cell cycle control and consequently regulates the expression of these genes (Chen et al., 2009). The overexpression of E2F5 induces the uncontrolled proliferation of cells in diverse cancers, and E2F5 knockdown seems to arrest the cell cycle at the G0/Gl phase (Jiang et al., 2011). In addition, the deregulated expression of E2F family member genes could induce both inappropriate S phase entry and apoptosis (Shan and Lee, 1994). Here, the downregulation of E2F5 likely indicates that the cell cycle of enterocytes was blocked at G0/Gl after weaning treatment. Furthermore, a balance between cell proliferation and death is required for tissue homeostasis. Proliferation and apoptosis are tightly coupled and linked by cell cycle regulators (Vermeulen et al., 2003). The cell cycle is controlled by various positive and negative regulators, such as the E2F family of transcription factors and the tumor suppressor protein p53. The E2F proteins are implicated in promoting S phase of the cell cycle whereas the tumor suppressor protein p53 is a negative regulator of cell growth, which has the potential to prevent the release of E2F, arrest cells in G1 phase, and thereby prevent entry into S phase and induce apoptotic death (Harper et al., 1993; Ko and Prives, 1996). Evidence has shown that p53 specifically inhibits E2F5 transcription (Vaishnav and Pant, 1999). We also previously observed the upregulation of p53 in weaned pigs (Zhu et al., 2012). Hence, it seems that weaning induces cell cycle arrest via p53-dependent pathways. Connections between the cell cycle and cell death have long been noted. Many apoptotic stimuli can induce cell cycle arrest before cell death, thereby affecting both apoptotic and cell cycle machinery. It has been reported that, under some circumstances, p53 can also induce apoptosis in response to stress stimuli (Vaseva and Moll, 2009). There are 2 main apoptotic pathways: the intrinsic (mitochondrial) and the extrinsic (death receptor) pathway. As a proapoptotic member of the Bcl-2 family, the Bcl-2 antagonist of cell death-like (BAD) regulates apoptotic mitochondrial events through the regulation of cytochrome c release from the mitochondria via the alteration of mitochondrial membrane permeability (Zha et al., 1996). Tumor suppressor protein p53 has a critical role in the regulation of the Bcl-2 family (Vaseva and Moll, 2009). The induction of the extrinsic apoptotic pathway involves the stimulation of death receptors belonging to the tumor necrosis factor receptor family, such as Fas and TNF-α (Locksley et al., 2001). The cell death signal mediates the cleavage of the proapoptotic factors that go on to inflict mitochondrial damage and result in cytochrome c release (Sundararajan et al., 2001). Additionally, TNF is an important mediator of inflammation. It not only induces its own secretion but also stimulates the production of other inflammatory cytokines and chemokines, such as IL-6 and IL-8 (Williams et al., 2008). In the present study, we detected changes in the expression of genes associated with the regulation of cell apoptosis including the upregulated proapoptotic genes CYCs, caspase-10, and BAD and the upregulation of the inflammatory cytokine genes TNF and IL-8 in weaned pigs, supporting our previous work on the effects of weaning-induced apoptosis in pigs (Zhu et al., 2013). All of the gene expression changes seem to be consistent with our previous finding that weaning increases apoptosis, and both of the mitochondria-mediated and Fas-mediated apoptosis pathways were activated (Zhu et al., 2013). Here, we confirmed this observation and improved this approach. Furthermore, NO, as a member of the reactive oxygen species, has been implicated in cell damage, apoptosis, and cell necrosis due to its direct oxidizing effects on DNA, lipids, and proteins (Calcerrada et al., 2011). The intracellular damage caused by NO was mainly due to the oxidization of DNA, which interfered with DNA repair and caused posttranslational modifications (Jaiswal et al., 2001). The normal cellular response to DNA damage results in the accumulation of p53, which in turn induces cell cycle arrest or apoptosis, thus imposing a delay on cell cycle progression and control of DNA repair and replication (Forrester et al., 1996). In mammals, NO is exclusively synthesized by NO synthases (NOS), which exist in 3 major isoforms: neuronal NOS, inducible NOS, and endothelial NOS (Messmer and Brune, 1996). Among these, the expression of NO synthase 2 (NOS2) is inducible when its activity is triggered under stress conditions (Lowenstein and Padalko, 2004). In the present study, weaning stress also increased NOS2 expression, which might be responsible for the increased generation of NO and H2O2 in the sera of the weaned pigs (Zhu et al., 2012). In addition, DNA damage induces several cellular responses including checkpoint activity, DNA repair, and triggering of the apoptotic pathways. The cellular response to stress is initiated by the activation of the ATM protein kinases, key players in the activation of cell cycle checkpoints in response to stress-induced DNA double strand breaks. Once ATM is activated, it can regulate the G1/S cell cycle checkpoint through p53 phosphorylation and can then induce p21 to inhibit cyclin kinase activity. The cells then either progress from G1 to S phase or apoptosis is triggered (Banin et al., 1998; Abraham, 2001). Moreover, ATM activation is also important for the initiation of DNA end resection, allowing time for DNA repair and cell survival (Rotman and Shiloh, 1999). Here, we observed an upregulation of ATM in weaned pigs, which likely indicates that weaning not only induces cell cycle arrest but also initiates the mechanism of DNA repair. In addition, NFATC2, as a member of the nuclear factor of activated T cells (NFAT) family, plays a positive role in modulating the calcineurin-NFAT interaction (Ortega-Perez et al., 2005). The suppression of NFATC2 mRNA promotes cell growth and proliferation (Vieira et al., 2012). The loss of both NFATC2 and calcineurin Aα in mice enhanced the expression of cyclin-dependent kinase 4 (a cell cycle control related gene), indicating that the calcineurin-NFAT signaling pathway has a negative role in cell cycle progression (Baksh et al., 2002). Inhibiting calcineurin-NFAT pathway activation in megakaryocytes decreases apoptosis by suppressing the expression of proapoptotic Fas ligand (Arabanian et al., 2012). Here, the upregulation of NFATC2 in weaned pigs might indicate an inhibition of epithelial cell proliferation induced by weaning stress. In weaned pigs, a decreased crypt cell proliferation index and increased villus cell apoptosis were observed in weaned pigs challenged with lipopolysaccharide (Liu et al., 2008). Wang et al. (2008) also found decreased cell proliferation- and differentiation-related gene expression, in weaned pigs, and dietary additives could increase the crypt cell proliferation (Jiang et al., 2000; Liu et al., 2008). However, weaning also induced obvious villus shedding, villus shortening, and crypt hyperplasia (Cera et al., 1988). Here, the crypt hyperplasia seems to contradict the reduced cell proliferation in weaned pigs. The dynamic process of epithelial cell turnover is a function of the rates of cell proliferation, migration, differentiation, and apoptosis. In the small intestine, cell proliferation begins at the bottom of intestinal crypts, where the stem cells give rise to progenitor cells. During migration toward the villus tip, progenitor cells differentiate into goblet cells, enterocytes, or enteroendocrine cells. Then, the intestinal cells undergo apoptosis and shed into the gut lumen after 3 d of functional differentiation, thus balancing the continuous production of new cells (Bullen et al., 2006). To some degree, decreased cell proliferation and increased apoptosis may be the main mechanisms responsible for intestinal mucosal injury (Sukhotnik et al., 2005; Liu et al., 2008). However, more work is needed to understand the exact mechanisms of crypt hyperplasia and epithelial cell proliferation in weaned pigs. In conclusion, the work reported herein suggests that weaning induces cell cycle arrest, enhances apoptosis, and inhibits epithelial cell proliferation, which may provide insight into the mechanism of weaning stress in a postweaning study. The observed differential mechanism of cell death induced by weaning provides a potential new direction for exploring the role of the cell cycle in weaned pigs as well as p53-dependent apoptosis in weaning treatment with antioxidants. LITERATURE CITED Abraham R. T 2001. Cell cycle checkpoint signaling through the ATM and ATR kinases. Genes Dev.  15: 2177– 2196. Google Scholar CrossRef Search ADS PubMed  Arabanian L. S. Kujawski S. Habermann I. Ehninger G. Kiani A. 2012. Regulation of fas/fas ligand-mediated apoptosis by nuclear factor of activated T cells in megakaryocytes. Br. J. Haematol.  156: 523– 534. Google Scholar CrossRef Search ADS PubMed  Baksh S. Widlund H. R. Frazer-Abel A. A. Du J. Fosmire S. Fisher D. E. DeCaprio J. A. Modiano J. F. Burakoff S. J. 2002. NFATC2–mediated repression of cyclin-dependent kinase 4 expression. Mol. Cell  10: 1071– 1081. Google Scholar CrossRef Search ADS PubMed  Banin S. Moyal L. Shieh S. Taya Y. Anderson C. W. Chessa L. Smorodinsky N. I. Prives C. Reiss Y. Shiloh Y. Ziv Y. 1998. Enhanced phosphorylation of p53 by ATM in response to DNA damage. Science  281: 1674– 1677. Google Scholar CrossRef Search ADS PubMed  Boudry G. Peron V. Le Huerou-Luron I. Lalles J. P. Seve B. 2004. Weaning induces both transient and long-lasting modifications of absorptive, secretory, and barrier properties of piglet intestine. J. Nutr.  134: 2256– 2262. Google Scholar CrossRef Search ADS PubMed  Bullen T. F. Forrest S. Campbell F. Dodson A. R. Hershman M. J. Pritchard D. M. Turner J. R. Montrose M. H. Watson A. J. 2006. Characterization of epithelial cell shedding from human small intestine. Lab. Invest.  86: 1052– 1063. Google Scholar CrossRef Search ADS PubMed  Calcerrada P. Peluffo G. Radi R. 2011. Nitric oxide-derived oxidants with a focus on peroxynitrite: Molecular targets, cellular responses and therapeutic implications. Curr. Pharm. Des.  17: 3905– 3932. Google Scholar CrossRef Search ADS PubMed  Cera K. Mahan D. Cross R. Reinhart G. Whitmoyer R. 1988. Effect of age, weaning and postweaning diet on small intestinal growth and jejunal morphology in young swine. J. Anim. Sci.  66: 574– 584. Google Scholar CrossRef Search ADS PubMed  Chen H. Z. Tsai S. Y. Leone G. 2009. Emerging roles of E2Fs in cancer: An exit from cell cycle control. Nat. Rev. Cancer  9: 785– 797. Google Scholar CrossRef Search ADS PubMed  Cummins A. G. Thompson F. M. 2002. Effect of breast milk and weaning on epithelial growth of the small intestine in humans. Gut  51: 748– 754. Google Scholar CrossRef Search ADS PubMed  Dvorak B. McWilliam D. L. Williams C. S. Dominguez J. A. Machen N. W. McCuskey R. S. Philipps A. F. 2000. Artificial formula induces precocious maturation of the small intestine of artificially reared suckling rats. J. Pediatr. Gastroenterol. Nutr.  31: 162– 169. Google Scholar CrossRef Search ADS PubMed  Forrester K. Ambs S. Lupold S. E. Kapust R. B. Spillare E. A. Weinberg W. C. Felley-Bosco E. Wang X. W. Geller D. A. Zeng T. E. Billiar T. R. Harris C. C. 1996. Nitric oxide-induced p53 accumulation and regulation of inducible nitric oxide synthase expression by wild-type p53. Proc. Natl. Acad. Sci. USA  93: 2442– 2447. Google Scholar CrossRef Search ADS   Harper J. W. Adami G. R. Wei N. Keyomarsi K. Elledge S. J. 1993. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell  75: 805– 816. Google Scholar CrossRef Search ADS PubMed  Heird W. C. Schwarz S. M. Hansen I. H. 1984. Colostrum-induced enteric mucosal growth in beagle puppies. Pediatr. Res.  18: 512– 515. Google Scholar CrossRef Search ADS PubMed  Heldin C. H. Landstrom M. Moustakas A. 2009. Mechanism of TGF-beta signaling to growth arrest, apoptosis, and epithelial-mesenchymal transition. Curr. Opin. Cell Biol.  21: 166– 176. Google Scholar CrossRef Search ADS PubMed  Jaiswal M. LaRusso N. F. Gores G. J. 2001. Nitric oxide in gastrointestinal epithelial cell carcinogenesis: Linking inflammation to oncogenesis. Am. J. Physiol. Gastrointest. Liver Physiol.  281: G626– G634. Google Scholar CrossRef Search ADS PubMed  Jiang R. Chang X. Stoll B. Fan M. Z. Arthington J. Weaver E. Campbell J. Burrin D. G. 2000. Dietary plasma protein reduces small intestinal growth and lamina propria cell density in early weaned pigs. J. Nutr.  130: 21– 26. Google Scholar CrossRef Search ADS PubMed  Jiang Y. Yim S. H. Xu H. D. Jung S. H. Yang S. Y. Hu H. J. Jung C. K. Chung Y. J. 2011. A potential oncogenic role of the commonly observed E2F5 overexpression in hepatocellular carcinoma. World J. Gastroenterol.  17: 470– 477. Google Scholar CrossRef Search ADS PubMed  Ko L. J. Prives C. 1996. p53: Puzzle and paradigm. Genes Dev.  10: 1054– 1072. Google Scholar CrossRef Search ADS PubMed  Lecce J. G 1986. Diarrhea: The nemesis of the artificially reared, early weaned piglet and a strategy for defense. J. Anim. Sci.  63: 1307– 1313. Google Scholar CrossRef Search ADS PubMed  Lee K. Y. Bae S. C. 2002. TGF-beta-dependent cell growth arrest and apoptosis. J. Biochem. Mol. Biol.  35: 47– 53. Google Scholar PubMed  Liu Y. Huang J. Hou Y. Zhu H. Zhao S. Ding B. Yin Y. Yi G. Shi J. Fan W. 2008. Dietary arginine supplementation alleviates intestinal mucosal disruption induced by Escherichia coli lipopolysaccharide in weaned pigs. Br. J. Nutr.  100: 552– 560. Google Scholar CrossRef Search ADS PubMed  Livak K. J. Schmittgen T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods  25: 402– 408. Google Scholar CrossRef Search ADS PubMed  Locksley R. M. Killeen N. Lenardo M. J. 2001. The TNF and TNF receptor superfamilies: Integrating mammalian biology. Cell  104: 487– 501. Google Scholar CrossRef Search ADS PubMed  Lowenstein C. J. Padalko E. 2004. iNOS (NOS2) at a glance. J. Cell Sci.  117: 2865– 2867. Google Scholar CrossRef Search ADS PubMed  Meng X. M. Huang X. R. Xiao J. Chung A. C. Qin W. Chen H. Y. Lan H. Y. 2012. Disruption of Smad4 impairs TGF-beta/Smad3 and Smad7 transcriptional regulation during renal inflammation and fibrosis in vivo and in vitro. Kidney Int.  81: 266– 279. Google Scholar CrossRef Search ADS PubMed  Messmer U. K. Brune B. 1996. Nitric oxide-induced apoptosis: P53-dependent and p53-independent signalling pathways. Biochem. J.  319: 299– 305. Google Scholar CrossRef Search ADS PubMed  Nakao A. Imamura T. Souchelnytskyi S. Kawabata M. Ishisaki A. Oeda E. Tamaki K. Hanai J. Heldin C. Miyazono K. 1997. TGF-β receptor-mediated signalling through Smad2, Smad3 and Smad4. EMBO J.  16: 5353– 5362. Google Scholar CrossRef Search ADS PubMed  Ortega-Perez I. Cano E. Were F. Villar M. Vazquez J. Redondo J. M. 2005. c-Jun N-terminal kinase (JNK) positively regulates NFATc2 transactivation through phosphorylation within the N-terminal regulatory domain. J. Biol. Chem.  280: 20867– 20878. Google Scholar CrossRef Search ADS PubMed  Owens P. Engelking E. Han G. Haeger S. M. Wang X. J. 2010. Epidermal Smad4 deletion results in aberrant wound healing. Am. J. Pathol.  176: 122– 133. Google Scholar CrossRef Search ADS PubMed  Rotman G. Shiloh Y. 1999. ATM: A mediator of multiple responses to genotoxic stress. Oncogene  18: 6135– 6144. Google Scholar CrossRef Search ADS PubMed  Shan B. Lee W. H. 1994. Deregulated expression of E2F-1 induces S-phase entry and leads to apoptosis. Mol. Cell. Biol.  14: 8166– 8173. Google Scholar CrossRef Search ADS PubMed  Siegel P. M. Massague J. 2003. Cytostatic and apoptotic actions of TGF-beta in homeostasis and cancer. Nat. Rev. Cancer  3: 807– 821. Google Scholar CrossRef Search ADS PubMed  Smith M. W. Peacock M. A. 1980. Anomalous replacement of foetal enterocytes in the neonatal pig. Proc. R. Soc. Lond. B Biol. Sci.  206: 411– 420. Google Scholar CrossRef Search ADS   Sukhotnik I. Helou H. Mogilner J. Lurie M. Bernsteyn A. Coran A. G. Shiloni E. 2005. Oral arginine improves intestinal recovery following ischemia-reperfusion injury in rat. Pediatr. Surg. Int.  21: 191– 196. Google Scholar CrossRef Search ADS PubMed  Sundararajan R. Cuconati A. Nelson D. White E. 2001. Tumor necrosis factor-alpha induces Bax-Bak interaction and apoptosis, which is inhibited by adenovirus E1B 19K. J. Biol. Chem.  276: 45120– 45127. Google Scholar CrossRef Search ADS PubMed  Szigeti R. Pangas S. A. Nagy-Szakal D. Dowd S. E. Shulman R. J. Olive A. P. Popek E. J. Finegold M. J. Kellermayer R. 2012. SMAD4 haploinsufficiency associates with augmented colonic inflammation in select humans and mice. Ann. Clin. Lab. Sci.  42: 401– 408. Google Scholar PubMed  Takaku K. Oshima M. Miyoshi H. Matsui M. Seldin M. F. Taketo M. M. 1998. Intestinal tumorigenesis in compound mutant mice of both Dpc4 (Smad4) and Apc genes. Cell  92: 645– 656. Google Scholar CrossRef Search ADS PubMed  Vaishnav Y. N. Pant V. 1999. Differential regulation of E2F transcription factors by p53 tumor suppressor protein. DNA Cell Biol.  18: 911– 922. Google Scholar CrossRef Search ADS PubMed  Vaseva A. V. Moll U. M. 2009. The mitochondrial p53 pathway. Biochim. Biophys. Acta  1787: 414– 420. Vermeulen K. Berneman Z. N. Van Bockstaele D. R. 2003. Cell cycle and apoptosis. Cell Prolif.  36: 165– 175. Google Scholar CrossRef Search ADS PubMed  Vieira L. Vaz A. Matos P. Ambrosio A. P. Nogueira M. Marques B. Pereira A. M. Jordan P. da Silva M. G. 2012. Three-way translocation (X;20;16)(p11;q13;q23) in essential thrombocythemia implicates NFATC2 in dysregulation of CSF2 expression and megakaryocyte proliferation. Genes Chromosomes Cancer  51: 1093– 1108. Google Scholar CrossRef Search ADS PubMed  Wang J. J. Chen L. X. Li P. Li X. L. Zhou H. J. Wang F. L. Li D. F. Yin Y. L. Wu G. Y. 2008. Gene expression is altered in piglet small intestine by weaning and dietary glutamine supplementation. J. Nutr.  138: 1025– 1032. Google Scholar CrossRef Search ADS PubMed  Williams L. M. Lali F. Willetts K. Balague C. Godessart N. Brennan F. Feldmann M. Foxwell B. M. 2008. Rac mediates TNF-induced cytokine production via modulation of NF-kappaB. Mol. Immunol.  45: 2446– 2454. Google Scholar CrossRef Search ADS PubMed  Zabielski R. Godlewski M. M. Guilloteau P. 2008. Control of development of gastrointestinal system in neonates. J. Physiol. Pharmacol.  59( Suppl. 1): 35– 54. Google Scholar PubMed  Zha J. Harada H. Yang E. Jockel J. Korsmeyer S. J. 1996. Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14–3-3 not BCL-X(L). Cell  87: 619– 628. Google Scholar CrossRef Search ADS PubMed  Zhu L. H. Cai X. Guo Q. Chen X. L. Zhu S. W. Xu J. X. 2013. Effect of N-acetyl cysteine on enterocyte apoptosis and intracellular signalling pathways' response to oxidative stress in weaned piglets. Br. J. Nutr.  110: 1938– 1947. Google Scholar CrossRef Search ADS PubMed  Zhu L. H. Zhao K. L. Chen X. L. Xu J. X. 2012. Impact of weaning and an antioxidant blend on intestinal barrier function and antioxidant status in pigs. J. Anim. Sci.  90: 2581– 2589. Google Scholar CrossRef Search ADS PubMed  Footnotes 1 This study was supported financially by the National Natural Science Foundation of China (grant no. 30972103) and the Students' Innovation Foundation of Shanghai Jiaotong University (grant no. z-150-005). American Society of Animal Science

Journal

Journal of Animal ScienceOxford University Press

Published: Mar 1, 2014

There are no references for this article.