Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

The Sucrose Transporter Gene Family in Rice

The Sucrose Transporter Gene Family in Rice Abstract In this paper we report the identification, cloning and expression analysis of four putative sucrose transporter (SUT) genes from rice, designated OsSUT2, 3, 4 and 5. Three of the four genes were identified through extensive searches of the recently published draft sequence of the rice genome. Along with the previously reported OsSUT1 we propose that these five genes comprise the rice SUT gene family. Complementary DNA clones were isolated for the four newly identified genes. The deduced proteins of all five SUT genes were predicted to contain 12 membrane-spanning helices and a domain highly conserved throughout all known plant SUTs, suggesting the four additional OsSUT genes encode functional SUTs. Reverse transcription-PCR analysis was performed in order to investigate the expression pattern of each member of the SUT family in rice. A differing but overlapping expression pattern was observed for each member of the SUT family at different stages through plant development. These results, together with the structural variations apparent from the deduced protein sequences, suggest that the five SUTs possess diverse roles in both sink and source tissues. We also discuss the classification and evolution of the rice SUT gene family, using a comparison of the gene structures and deduced amino acid sequences with other known plant SUT genes. The nucleotide sequences reported in this paper have been submitted to GenBank, EMBL under the following accession numbers: OsSUT2 mRNA, AB091672; OsSUT3 mRNA, AB071809; OsSUT4 mRNA, AB091673; OsSUT5 mRNA, AB091674; OsSUT1 gene, AF280050; OsSUT3 gene, AF419298. (Received October 21, 2002; Accepted December 18, 2002) Introduction Plant sucrose transporters (SUTs) mediate the active transport of sucrose across plasma membrane barriers in a process that is coupled to proton symport. Since sucrose is the major carbohydrate translocated through the phloem in most plant species, the sucrose/H+ symporters are thought to play important roles in mediating carbon partitioning in plants, for example apoplastic phloem loading in leaves, transport of sucrose into and/or out of temporary storage sinks such as stem tissue and post-phloem transport of sucrose into sink tissue such as seeds. Over the last decade, genes encoding SUT proteins have been isolated from a wide range of both monocot and dicot plant species. For many of these species, two or more SUT genes have been reported (see reviews of Lemoine 2000, Williams et al. 2000). In Arabidopsisthaliana, for example, five SUT genes have been functionally characterised by expression in yeast cells (Sauer and Stolz 1994, Meyer et al. 2000, Schulze et al. 2000, Weise et al. 2000, Ludwig et al. 2000), and in addition four further putative SUT sequences are found in public databases. In potato and tomato, three SUT genes with different characteristics in sucrose transport are known to exist (Riesmeier et al. 1993, Barker et al. 2000, Weise et al. 2000). Based on phylogenetic analysis of deduced peptide sequences, these dicot SUTs have been classified into three groups, SUT1-, SUT2- and SUT4-type (Barker et al. 2000, Weise et al. 2000). However, it is not fully understood whether each type of SUT has a different physiological role in dicot species. The first SUT gene to be identified in a monocot species was that from rice, OsSUT1 (Hirose et al. 1997). In that paper, the sucrose transport activity of the OsSUT1 protein was demonstrated using a heterologous expression system with yeast cells. Since then SUT1 orthologues have been identified from other cereal species, maize (Aoki et al. 1999), barley (Weschke et al. 2000) and wheat (Aoki et al. 2002). These SUT1 proteins share more than 80% identity in the primary sequences. Weschke et al. (2000) also identified a second SUT gene in barley, HvSUT2. The deduced peptide sequence of HvSUT2 shows 47% identity to that of HvSUT1. HvSUT2 was shown to code an active SUT by functional expression in yeast, and to have a different expression pattern in barley to that of HvSUT1. More recently, we have isolated cDNA and genomic clones for a putative SUT gene from rice designated OsSUT3 (GenBank accession numbers AB071809 and AF419298, respectively). In a phylogenetic tree analysis based on deduced amino acid sequences of cereal SUTs, OsSUT3 is clearly separated from both the cereal SUT1 group and HvSUT2. From these observations, the question arises as to how many SUT genes are present in the genome of cereal plant species. To provide insight into this problem we have searched the recently published rice genome sequence. The draft sequence of the genome of indica subspecies, determined by a shotgun sequencing strategy, has been estimated to cover 92.0% of the gene-containing regions in the genome (Yu et al. 2002). By comparing translated sequences of the rice genome with known SUT sequences, three genes were identified as encoding putative SUT proteins. We propose that these three genes in addition to the previously isolated OsSUT1 and OsSUT3 comprise the rice SUT gene family. In this report, the five SUT genes are compared in terms of deduced amino acid sequences, exon/intron structures and expression patterns in rice plants. Results Identification of members of the rice SUT gene family Table 1 summarises the results of the TBLASTN searches of the rice genome carried out with the known SUT sequences from rice, OsSUT1, and barley, HvSUT2. For each of the queries, five contiguous DNA sequences (Contigs) were listed as the best hits with E-values lower than 10–15. Contigs #6294 and #10073 contained DNA sequences identical with the genomic sequences of OsSUT1 and OsSUT3, respectively, both of which we had previously isolated from an indica rice cultivar. Contig #394 contained translated sequences 90% similar to HvSUT2. In Contigs #5025 and #245, several translated sequences were separately picked up showing 43–99% similarity to the OsSUT1 sequences. This suggested that these two Contigs contained SUT genes consisting of a number of exons, as seen in OsSUT1 and OsSUT3. These similarities to the query sequences allowed predictions to be made as to the positions of initiation codons, termination codons, and exon/intron borders, and as a result cDNA and peptide sequences were deduced. The putative SUT gene found in Contig #394 was designated as OsSUT2 as the predicted protein showed 80% identity to HvSUT2. Takeda et al. (2001) reported a putative SUT gene in rice and termed it OsSUT2. However, in the phylogenetic tree presented in that paper their deduced OsSUT2 amino acid sequence was clearly distinct from that of HvSUT2. Furthermore, the OsSUT2 clone isolated by Takeda et al. (2001), was later found to be identical to the OsSUT3 gene that we had previously isolated and submitted to GenBank (J. Yamaguchi, personal communication). In order to maintain consistency in the naming of cereal SUT genes, we propose that OsSUT2, as identified and cloned in this work, should be termed so as the orthologue of HvSUT2. The putative SUT genes in Contigs #5025 and #245 were designated OsSUT4 and OsSUT5, respectively. Analysis of the deduced amino acid sequences predicted from the putative SUT genes, OsSUT2, 3, 4 and 5, revealed that they all contained a region that is highly conserved in known functional plant SUT genes, including OsSUT1 (Fig. 1). This domain includes the first membrane spanning helix, the following extracellular loop, the second membrane spanning helix and the next cytoplasmic loop. Lu and Bush (1998) have shown, by site-directed mutagenesis of the Arabidopsis AtSUC1 protein, that a conserved histidine residue in the extracellular loop is responsible for sucrose binding in the transport process. This histidine residue was also found to be present in all of the putative OsSUT peptides (Fig. 1). The high conservation at the amino acid level with known plant SUTs is evidence that OsSUT2, 3, 4 and 5 may all encode functional SUT proteins. In addition to the five Contigs detailed above, four further short Contigs were also listed in the TBLASTN search with considerably low E-values for SUT (Table 1). These Contigs contained translated sequences corresponding to the highly conserved region of plant SUTs. However, the functionally important histidine residue and many of other conserved amino acid residues were substituted by other residues (Fig. 1). It seems unlikely that these genomic sequences are a part of other SUT genes. Are all five SUT genes expressed in rice? While five separate sequences with high homology to SUTs are present in the rice genome, only OsSUT1, 2 and 3 can be found in public expressed sequence tag (EST) databases (results not shown). To further explore expression of the putative SUT genes in rice, reverse transcription-PCR (RT-PCR) experiments were conducted using primers designed to be specific for OsSUT2, 4 and 5. The positions of the gene-specific primers used are shown in Fig. 2. Total RNA, isolated from rice panicles, was reverse-transcribed, and the resultant first-strand cDNAs were used as templates for the first PCR attempt, using a primer combination L1 and the adaptor primer (L1/AP). Since no apparent products were amplified for all three genes in the initial PCRs, hemi-nested and nested PCRs were conducted using two primer combinations, L3/AP and L2/R1, respectively. The later PCRs produced single-products at the expected sizes of 300 bp and 1.7 kbp for OsSUT2, 350 bp and 2.1 kbp for OsSUT4 and 350 bp and 1.9 kbp for OsSUT5, respectively (data not shown). Sequencing verified that the amplified DNA fragments derived from the corresponding SUT genes, confirming that OsSUT2, 4 and 5 are all transcribed in rice. By assembling the sequences obtained from the PCR products, cDNA sequences for each of the three genes were determined. The structures of the cDNAs for all five genes are summarised in Fig. 2. Properties and structures of the deduced SUT proteins Table 2 summarises some properties of the five OsSUT proteins as deduced from the cDNA sequences. The OsSUT peptides differ in size, for example OsSUT4 is larger by nearly 100 amino acids than OsSUT2. Isoelectric point (pI) values were calculated to be alkaline for OsSUT1, 2 and 5, and to be neutral for OsSUT3 and 4. When compared to OsSUT1, OsSUT3 is the most similar with 78% similarity, OsSUT4 and OsSUT5 show 66% and 65% similarity respectively, whilst OsSUT2 is the most distantly related to OsSUT1 with 53% similarity. When the deduced peptide sequences are compared between two rice subspecies, indica and japonica, amino acid substitutions are found in 1, 7, 4, 4 and 3 residues in OsSUT1, 2, 3, 4 and 5, respectively. The secondary structure and membrane topology of the five OsSUT proteins was predicted using software packages directed for integral membrane proteins (results not shown). All four putative OsSUT proteins, in addition to OsSUT1, are able to form a twelve membrane-spanning α-helical structure, a structure common to plant SUT proteins (Ward et al. 1998, Lemoine 2000). The central loop between the sixth and the seventh transmembrane helices is predicted to contain 30–40 amino acid residues in all of the OsSUT proteins, except for OsSUT4, which is found to have the loop extended to approximately 90 amino acid residues. The N-terminal domains of OsSUT1, 4 and 5 are longer by 20–30 amino acids than those of OsSUT2 and 3. The topology prediction suggests that the central loop and the N- and C-termini are all cytoplasmic, as predicted for known functional plant SUTs (Ward et al. 1998). Results from these structural analyses are consistent with our hypothesis that OsSUT2, 3, 4 and 5 may encode functional SUTs. Classification of members of the OsSUT gene family To compare OsSUT proteins with other known plant SUTs based on the primary sequences, multi-sequence alignment analysis was carried out. A representative result from a CLUSTALW analysis is shown in Fig. 3 as an unrooted dendrogram. In the plant SUT protein family, OsSUT1, 3, 4 and 5 are clustered together with members of the dicot-SUT2 group, forming the Type-II subfamily. Within this subfamily OsSUT1 and the orthologues from other cereal species form the cereal (monocot) -SUT1 group, sharing at least 80% identity to one another. OsSUT3 and OsSUT5 are mapped separately in the Type-II subfamily. OsSUT4 seems to be the rice orthologue of the dicot-SUT2 proteins, sharing 58–63% identity and the common features of an extended N-terminal and central loop (Davies et al. 1999, Barker et al. 2000). OsSUT2, together with HvSUT2, is closely related to dicot-SUT4 group, forming the Type-III subfamily. Similar plant SUT groupings are also reflected in gene structure. Fig. 4 shows the exon/intron structures of the five rice SUT genes along with three Arabidopsis SUT genes for comparison. OsSUT1, 3, 4 and 5, Type-II SUT genes, are composed of 14, 10, 14 and 13 exons respectively. OsSUT3 and 5 show differing fusion/separation of exons corresponding to exons 9 to 14 in OsSUT1. OsSUT1 and 3 both have a large first intron, a feature that has also been observed in wheat TaSUT1D (Aoki et al. 2002) and tomato LeSUT2 (Barker et al. 2000). The gene structure of OsSUT4 is quite similar to that of AtSUT2 (synonymous with AtSUC3) including a short first intron. The gene structures of OsSUT2 and AtSUT4, members of the Type-III subfamily, are also similar, with the exception of the lengths of the first and last intron. There are only 3 or 4 exons in AtSUC1 and the other Arabidopsis SUT genes belonging to Type-I, in contrast to the Type-II SUT genes. RT-PCR analysis of SUT gene expression in rice plants Tissue-specific expression of the five OsSUT genes was examined by RT-PCR using specific primers for each gene (Fig. 5A). OsSUT1 mRNA accumulated to high levels in germinating seeds, source leaf sheaths and panicles, but to very low level in roots. OsSUT2 mRNA accumulated to nearly equal levels in all tissues tested. The expression patterns of OsSUT3 and 5 were found to be similar, the expression level is at its highest in sink leaves and the lowest in germinating seeds. OsSUT4 showed preferential expression in sink leaves. Since it has been shown by Northern hybridisation that OsSUT1 mRNA accumulates temporally in rice caryopses during development (Furbank et al. 2001, Hirose et al. 2002), changes in mRNA levels in developing caryopses were examined for each of five OsSUT genes by RT-PCR (Fig. 5B). Consistent with the previously obtained results, the mRNA level of OsSUT1 was very low in the early stage of seed development, increased to a maximal level at 5–7 d after flowering (DAF) and then gradually declined to a barely detectable level by 20 DAF when grain filling stage nearly terminates (Hirose et al. 2002). In contrast to OsSUT1, the other four OsSUT genes tended to be expressed immediately after flowering. OsSUT2, 4 and 5 had approximately equal levels of expression from 1 DAF to 5 or 7 DAF and then declined to nearly undetectable levels by 20 DAF. OsSUT3 too has a high level of expression from 1 to 2 DAF. However, the OsSUT3 expression declined significantly at 3 DAF, recovered at 5 and 7, and then declined again. Functional expression in yeast To demonstrate that the putative OsSUT sequences identified above encode functional sucrose transporters, full-length OsSUT1 and OsSUT3 cDNAs were expressed in the yeast strain SUSY7/ura3 (Barker et al. 2000). This strain is unable to hydrolyse exogenous sucrose but if transformed with a functional SUT, can import sucrose and hydrolyse it internally (Barker et al. 2000), allowing it to grow on media containing sucrose as the sole carbon source. Fig. 6 shows that SUSY7 transformed with empty vector (A) or an OsSUT3 in the antisense orientation (D) were unable to grow on sucrose media while the OsSUT1 (B) and OsSUT3 (C) sense constructs enabled SUSY7 to grow on sucrose alone. All four constructs grew on glucose media due to the presence of high levels of endogenous hexose transporters. Discussion The draft sequence from the indica rice genome has provided us with a powerful tool which enables searches for a gene family of known proteins to be made. By searching the genome sequence, we found three genes for putative SUTs identified here as OsSUT2, 4 and 5, which had not previously been identified by screening cDNA/genomic libraries. We concluded that OsSUT1, 2, 3, 4 and 5 comprise the SUT gene family in the rice genome. It should be noted, however, that there is still the possibility that one (or more) SUT gene(s) may exist in the remaining 8% of the genome yet to be sequenced. Completion of the rice genome sequencing project, based on clone-to-clone, chromosome-to-chromosome sequencing strategy, will provide further information on OsSUT genes, such as their loci and whether there are further members of the SUT gene family. The genomic information obtained in rice may be partly applicable to other cereal species. In fact, EST sequences homologous to OsSUT2 are found in wheat (accession No. BE403785) and maize (BI991870), and ESTs homologous to OsSUT4 are found in wheat (BE400089), barley (AV916525) and maize (BQ060179), in public databases. The similarity in gene structure between monocots and dicots in the Type-II subfamily suggests that a prototype Type-II SUT gene, consisting of a number of exons, had evolved prior to a monocot/dicot split in the evolution of angiosperms. It may be speculated that in cereal (or monocot) species, SUT genes have diverged from the prototype genes, presumably by gene duplications. Further efforts to identify SUT genes in other monocot species are required for verification of this hypothesis. As in the case of the Type-II SUT genes mentioned above, a prototype Type-III SUT gene may have appeared in a common ancestor species prior to a monocot/dicot split. No monocot SUT proteins have been found so far that correspond to the dicot-SUT1 group (Type-I subfamily). The TBLASTN search of rice genome sequence with Type-I SUT proteins resulted in the same Contigs being listed as those listed with the OsSUT1 sequence (results not shown). This type of SUT gene does not seem to be present in rice. Verification of sucrose transporter function for a variety of dicot and monocot SUT genes has been carried out using heterologous expression in yeast (reviewed by Lemoine 2000). This includes the demonstration of low but reproducible rates of sucrose uptake by OsSUT1 (Hirose et al. 1997). However, many SUT genes have proven difficult to express in vitro (Schulze et al. 2000, Weise et al. 2000). While we have successfully demonstrated complementation of the SUSY7 yeast strain with OsSUT1 and OsSUT3 (Fig. 6), we have thus far been unable to attain high rates of [14C]sucrose uptake using a variety of vectors and yeast strains. The high level of sequence similarity between the putative OsSUT genes described here and other SUT genes shown to be functional sucrose transporters, supports the hypothesis that they are indeed functional carriers. The OsSUT1 expression data is consistent with the previously reported observations (Hirose et al. 1997, Hirose et al. 1999, Hirose et al. 2002, Matsukura et al. 2000, Furbank et al. 2001, Ishimaru et al. 2001, Scofield et al. 2002). Through extensive characterisation studies including expression analysis, heterologous expression in yeast, localisation and anti-sense suppression of in vivo function, it has been shown that OsSUT1 encodes a functional SUT protein that is essential for transport of assimilate into filling rice grains (Hirose et al. 1997, Hirose et al. 2002, Furbank et al. 2001, Scofield et al. 2002). It has also been proposed that OsSUT1 is involved in transport of assimilate remobilised from starch reserves in leaf sheaths and in germinating seeds (Hirose et al. 1997, Hirose et al. 1999, Matsukura et al. 2000, Scofield et al. 2002). In germinating seeds, OsSUT1 appeared to be expressed dominantly compared with the other four SUT genes. This is consistent with the observation that anti-sense suppression lines for OsSUT1 show retarded germination (Scofield et al. 2002). The suppression lines also exhibited no visible symptoms of assimilate accumulation and no decreased activity of photosynthesis in mature leaves, suggesting that OsSUT1 has little contribution to loading photoassimilates into the phloem of source leaves (Ishimaru et al. 2001, Scofield et al. 2002). Further studies are needed to analyse expression of other SUT genes in source leaves, in order to evaluate the contribution of SUT-mediated membrane transport to phloem loading of photoassimilates in rice leaves. Expression of OsSUT3, 4 and 5 in sink rice leaf suggests that they may be important for supplying sucrose, as a carbon source for growing tissues or possibly to supply sucrose to temporary storage tissues. This is an interesting observation as in barley, sucrose unloading in sink leaf is believed to occur symplastically (Haupt et al. 2001). The role of membrane-mediated transport of sucrose has not been comprehensively studied in vegetative sink tissues such as developing leaves, starch-storing leaf-sheaths and elongating roots. Unlike the other four OsSUT genes, OsSUT2 seems to be expressed at almost equal levels in various tissues of rice plants. Similar expression pattern has been observed for HvSUT2 in barley (Weschke et al. 2000). The expression pattern might be related to the evolutionary origin of the SUT2 genes, which are structurally distant from the other members of cereal SUT gene family. For the HvSUT2 protein, a Km value of 5 mM has been reported for sucrose transport activity in yeast cells (Weschke et al. 2000). However, Km values observed for dicot-SUT4 proteins under comparable assay conditions are varied, for example, 0.5 mM for carrot DcSUT1A (Shakya and Sturm 1998) and 11.6 mM for AtSUT4 (Weise et al. 2000). It would appear that in Type-III SUT protein, structural similarity is not related to the kinetic properties of sucrose transport activity. Expression patterns of OsSUT genes in developing rice caryopses suggested that the physiological role(s) of OsSUT1 may differ from those of the other four OsSUT genes when caryopses differentiate, elongate and fill. Hirose et al. (2002) reported two stages of rice caryopsis development, an early stage from 1 to 4 DAF when the caryopsis is elongating and cell differentiation is occurring. The second stage from about 5 DAF until about 15 DAF, is where the caryopsis having reached its final length is rapidly gaining weight. OsSUT1 has been shown, in that work and also here, to be preferentially expressed during the second stage of development, i.e. during the maximal grain filling stage, and is known to mediate transport of assimilate across the aleurone cell layers into the developing endosperm (Furbank et al. 2001, Scofield et al. 2002, Hirose et al. 2002). OsSUT2, 3, 4 and 5 seem to predominantly be expressed in the first stage of development. It is possible that these genes may play a role in the transport of sucrose in the caryopsis during early development. There is some overlap in expression of the genes between the two stages, particularly for OsSUT3 and perhaps it has some role in conjunction with OsSUT1 in assimilate transport during grain filling. Localisation studies for each of the OsSUT genes may help to elucidate their function in the developing caryopsis. The differential expression patterns of the five OsSUT genes in rice plants observed in this work suggest that the SUT gene family has many roles in both source and sink tissues, and at different developmental stages. It would be helpful to produce and analyse suppression/knock-out lines, in order to fully understand the physiological roles of the SUT gene family in rice plants. It is also noteworthy that in each tissue tested, at least four OsSUT genes are apparently expressed. This overlapping expression may imply diverse roles of the five OsSUT proteins in membrane-mediated sucrose transport processes or could represent expression in different cell types. The five OsSUT proteins differ considerably in terms of the primary structure and pI value, suggesting distinct biochemical properties. The OsSUT4 protein, in particular, contains the extended central loop similar to dicot-SUT2 proteins, which show structural similarity to yeast sugar sensor proteins (Barker et al. 2000). It has been shown in the Arabidopsis SUT2 (SUC3) protein that the central loop is not necessary for sucrose transport activity, whereas the N-terminal domain has been shown to play a role in determining affinity for sucrose (Meyer et al. 2000, Schulze et al. 2000). It would be of great interest to compare the five OsSUT proteins in terms of substrate specificity and kinetic properties of transport activity. Moreover, Reinders et al. (2002) reported in potato and tomato that three functionally different SUT proteins are expressed in the same sieve element and can form homo- and hetero-oligomers in vivo, suggesting functional significance of interaction between SUT proteins. It is possible that in rice tissues the five distinct putative SUTs could function as protein complexes or interact in the plasma membranes. Materials and Methods Plant materials Rice plants (Oryzasativa L. ssp. japonica cv. Nipponbare) were grown under field conditions in plastic pots filled with the soil from the paddy field of NARC, Joetsu, Japan. Each stem was tagged on the heading day when the tip of panicles emerges from flag-leaf sheath. Each spikelet was marked on the flowering day and subsequently sampled following maturity. To obtain tissue samples from rice seedlings, seeds were germinated in water for 2 d, transplanted into soil in seedling boxes and grown for 7 d in a glasshouse. Tissue samples taken were immediately frozen in liquid nitrogen and stored at –80°C until use. Isolation of genomic clones for OsSUT1 and OsSUT3 A commercially available genomic rice library of Oryza sativa ssp. indica cv. IR36 (Clontech) was screened using a probe from the 3′ coding region of OsSUT1 (accession No. D87819), equivalent to 1303–1632 bp. A number of positive clones were identified, isolated and purified. The clones fell into two classes, depending on the strength of hybridisation to the probe. One clone from each class was selected and fully sequenced. The genomic clone hybridising very strongly to the probe was found to correspond to the OsSUT1 cDNA sequence, whilst the genomic clone with a weaker hybridisation to the probe contained a SUT-like sequence. The latter clone was found to correspond to the EST clone E0355, and was designated OsSUT3. Cloning of OsSUT3 cDNA An EST fragment E0355 (accession No. AU063776) obtained from the Rice Genome Program, Japan, was identified as having a SUT-like sequence. Further sequence analysis revealed that the 1.4-kb EST clone corresponded to a partial cDNA for a SUT-like gene that we had cloned from a rice genomic library. Since the EST clone contained the start codon but lacked the 3′ region including the stop codon, overlapping 3′ fragments were generated by 3′-Rapid Amplification of cDNA Ends (3′-RACE) PCR as following. Total RNA was isolated from whole panicles of rice plants, harvested 7–10 d after heading, using the method of Chang et al. (1993) but with the polyvinylpyrrolidone and spermidine omitted from the extraction buffer. To verify that there was no genomic DNA contamination in the RNA preparations, PCR was carried out using a primer combination that covers an intron-containing region in a rice cell-wall invertase gene (data not shown). The isolated RNA (5 µg) was reverse transcribed (SuperScript II, Life Technologies), using an oligo-dT13 primer attached to an adaptor sequence. The resultant first-strand cDNAs were used as template mixture for 3′-RACE PCR with specific primers RC3 and RC4 (Fig. 2), and the adaptor primer (AP, Table 3). By assembling the 3′-RACE product and the EST using a convenient restriction site in the overlapping region, a cDNA clone of the SUT-like gene was obtained. The gene was called OsSUT3 since it did not appear to be the rice orthologue of HvSUT2. The Rice Genome Database and computer programs Contiguous DNA sequences from rice genome were obtained from the Rice GD (http://210.83.138.53/rice/, Yu et al. 2002) and searched with homology to known SUTs, using TBLASTN algorithm. Translated sequences picked up from the Contigs were assembled and further optimised by comparing to known SUT sequences. Nucleotide sequences and deduced amino acid sequences were primarily analysed using the Wisconsin Sequence Analysis Software Package (Genetic Computer Group, Madison, WI, U.S.A.). Secondary structure and membrane topology were predicted using programs available on the web; the TMPRED (http://www.ch.embnet.org/), the TMHMM (http://www.cbs.dtu.dk/), the HMMTOP (http://www.enzim. hu/) and the WHAT (http://saier-144–37.ucsd.edu/). Multi-sequence alignment analysis was carried out using the PILEUP program of the Wisconsin package and the CLUSTALW program (http://www.genome. ad.jp/). 3′-RACE analysis and PCR-based cDNA cloning for OsSUT2, 4 and 5 For the following PCR experiments, first-strand cDNA mixture was prepared from RNA isolated from whole panicles 7–10 d after heading, as described above. Based on genomic sequences of OsSUT2, 4 and 5 found in the rice genome sequence, corresponding cDNA sequences were predicted using a gene prediction program, the RiceHMM (http://rgp.dna.affrc.go.jp/). According to the predicted cDNA sequences, three PCR primers, L1, L2 and L3 were designed for each gene by a primer-picking program Primer3 (http://www-genome.wi.mit. edu/). The initial PCR step, using the first-strand cDNA mixture, was done with primers L1 and AP. Using an aliquot of the initial PCR product as template mixture, hemi-nested (3′-RACE) PCR was performed with L3/AP primer combination to generate 3′ partial cDNA fragment, and nested PCR was performed with L2/R1, which covers coding region. The gene-specific primers used are referred to in detail in Fig. 2 and Table 3. Amplified cDNA fragments were cloned into a vector (pGEM-Teasy, Promega), and sequenced. The partial sequences obtained for each gene were assembled with overlapping region, and cDNA sequences of OsSUT2, 4 and 5 were determined. The cDNA sequences were compared with corresponding genomic sequences, and the allocation of exon/intron arrangements assumed for OsSUT2, 4 and 5 was confirmed. RT-PCR analysis of OsSUT gene expression First-strand cDNA mixtures were prepared from RNA isolated from different rice tissues. An aliquot of first-strand cDNA mixture corresponding to 12.5 ng of the total RNA was used as a template. The PCR (20 µl total volume) was done using 0.2 units of Taq polymerase (ExTaq, Takara, Kyoto, Japan). The gene-specific primers were designed to produce a 239-, 192-, 239-, 248- and 249-bp DNA fragment from OsSUT1, 2, 3, 4 and 5, respectively (Fig. 2 and Table 3). The amount of template cDNA and the number of PCR cycles were determined by preliminary experiments to ensure that amplification occurred in the linear range and allowed good quantification of the amplified products. The amplified DNA fragments (5 µl of each reaction) were separated on a 1.2% (w/v) agarose gel, transferred to nylon membrane (Hybond-N+, Amersham), hybridised with specific cDNA probes amplified from the corresponding cDNA clone, and visualized by AlkPhos Direct Labeling and Detection System (Amersham) following the manufacturer’s instructions. Heterologous expression of OsSUT in yeast Constructs were prepared that contained either OsSUT1 or OsSUT3 cDNAs cloned into the yeast shuttle vector pDR195. The SUT cDNAs contained the entire open reading frame for each SUT along with the full 3′ untranslated region and approximately 20–25 bp of the 5′ untranslated region. An additional construct was prepared in which the OsSUT3 cDNA was inserted in the anti-sense direction in to the vector as a control. These constructs were separately transformed into cells of the SUSY7/ura3 yeast strain (Barker et al. 2000), using the “Quick and Easy” TRAFO protocol (as detailed at http://www.umanitoba.ca/faculties/medicine/biochem/gietz/Quick.html). Transformed cells were plated onto media containing glucose and were incubated for several days at 30°C. Single colonies from the transformation plates were streaked out onto media plates containing either glucose or sucrose as the sole carbon source and were incubated for several days at 30°C. Cell lines transformed with either the empty pDR195 vector or the OsSUT3 anti-sense construct were used as controls. To verify that the transformed SUT-SUSY7/ura3 lines did in fact contain the SUT constructs plasmid DNA was isolated from yeast cells used in the complementation test by the method of Hoffman (1997). The plasmid DNAs were separately transformed into E. coli cells and positive colonies were selected by ampicillin resistance conferred from the pDR195 vector. Plasmid DNA was isolated from positive colonies and the presence of the various SUT constructs was confirmed by diagnostic digestion with restriction enzymes. Acknowledgments The authors thank Dr. Junji Yamaguchi for providing sequence information of his OsSUT gene. We also thank Dr. Wolf B. Frommer (University of Tübingen, Germany) for the yeast strain SUSY7/ura3, and the yeast shuttle vector pDR195. This work was supported in part by Grants-in-aid from the Ministry of Agriculture Forestry and Fisheries of Japan, Pioneer Research Project Fund (PREP-1206) to TH. The expert technical assistance of Kiiko Takatsuto is much appreciated. 3 These authors have contributed equally to this work and should be considered as joint first authors. 4 Corresponding author: Email, robert.furbank@csiro.au; Fax, +61-2-6246-5000. View largeDownload slide Fig. 1 Analysis of the Contigs listed in Table 1. Translated sequences of the Contigs are compared with the CONSENSUS sequence derived from a highly conserved region of known functional plant SUTs. Putative transmembrane domains of the SUT peptide are underlined. Numbers indicate conservative substitutions: 1 = I, L or V; 2 = F, W or Y. The functionally important and conserved histidine residue is shown in bold. Dots indicate non-conserved amino acids, and horizontal bars indicate gaps in the sequence alignments. View largeDownload slide Fig. 1 Analysis of the Contigs listed in Table 1. Translated sequences of the Contigs are compared with the CONSENSUS sequence derived from a highly conserved region of known functional plant SUTs. Putative transmembrane domains of the SUT peptide are underlined. Numbers indicate conservative substitutions: 1 = I, L or V; 2 = F, W or Y. The functionally important and conserved histidine residue is shown in bold. Dots indicate non-conserved amino acids, and horizontal bars indicate gaps in the sequence alignments. View largeDownload slide Fig. 2 Structure of the five OsSUT cDNAs. The positions of the primer sequences used for 3′-RACE-PCR and cDNA cloning are shown by solid arrows, and those for RT-PCR analysis are shown by dotted arrows. The GenBank accession number for OsSUT1 cDNA is D87819. View largeDownload slide Fig. 2 Structure of the five OsSUT cDNAs. The positions of the primer sequences used for 3′-RACE-PCR and cDNA cloning are shown by solid arrows, and those for RT-PCR analysis are shown by dotted arrows. The GenBank accession number for OsSUT1 cDNA is D87819. View largeDownload slide Fig. 3 An un-rooted dendrogram of plant SUTs, based on deduced amino acid sequences. The CLUSTALW program was used to show the relationship between the members of the OsSUT gene family (bold) and other plant SUTs. The GenBank accession numbers for the peptide sequences are Arabidopsis AtSUC1, CAA53147; AtSUC2, CAA53150; AtSUT2 (AtSUC3), AAC32907; AtSUT4, AAG09191; AtSUC5, AAG52226; carrot DcSUT1A, CAA76367; DcSUT2, CAA76369; barley HvSUT1, CAB75882; HvSUT2, CAB75881; tomato LeSUT1, CAA57726; LeSUT2, AAG12987; LeSUT4, AAG09270; tobacco NtSUT1A, CAA57727; NtSUT3, AAD34610; rice OsSUT1, BAA24071; OsSUT2, AB091672; OsSUT3, BAB68368; OsSUT4, AB091673; OsSUT5, AB091674; common plantain PmSUC1, CAA59113; PmSUC2, CAA53390; potato StSUT1, CAA48915; StSUT4, AAG25923; spinach SoSUT1, CAA47604; wheat TaSUT1D, AAM13410; grape VvSUC11, AAF08329; VvSUC12, AAF08330; VvSUC27, AAF08331; VvSUT2, AAL32020; maize ZmSUT1, BBA83501. View largeDownload slide Fig. 3 An un-rooted dendrogram of plant SUTs, based on deduced amino acid sequences. The CLUSTALW program was used to show the relationship between the members of the OsSUT gene family (bold) and other plant SUTs. The GenBank accession numbers for the peptide sequences are Arabidopsis AtSUC1, CAA53147; AtSUC2, CAA53150; AtSUT2 (AtSUC3), AAC32907; AtSUT4, AAG09191; AtSUC5, AAG52226; carrot DcSUT1A, CAA76367; DcSUT2, CAA76369; barley HvSUT1, CAB75882; HvSUT2, CAB75881; tomato LeSUT1, CAA57726; LeSUT2, AAG12987; LeSUT4, AAG09270; tobacco NtSUT1A, CAA57727; NtSUT3, AAD34610; rice OsSUT1, BAA24071; OsSUT2, AB091672; OsSUT3, BAB68368; OsSUT4, AB091673; OsSUT5, AB091674; common plantain PmSUC1, CAA59113; PmSUC2, CAA53390; potato StSUT1, CAA48915; StSUT4, AAG25923; spinach SoSUT1, CAA47604; wheat TaSUT1D, AAM13410; grape VvSUC11, AAF08329; VvSUC12, AAF08330; VvSUC27, AAF08331; VvSUT2, AAL32020; maize ZmSUT1, BBA83501. View largeDownload slide Fig. 4 Comparison of the gene structure of the five members of the OsSUT gene family. Three Arabidopsis SUT genes, AtSUC1 (accession No. AC021665), AtSUT2 (AtSUC3, AC004138) and AtSUT4 (AF175322), are also shown for comparison. Boxes represent exons. View largeDownload slide Fig. 4 Comparison of the gene structure of the five members of the OsSUT gene family. Three Arabidopsis SUT genes, AtSUC1 (accession No. AC021665), AtSUT2 (AtSUC3, AC004138) and AtSUT4 (AF175322), are also shown for comparison. Boxes represent exons. View largeDownload slide Fig. 5 Analysis of expression of the five OsSUT genes, by semi-quantitative RT-PCR. For each gene, transcript levels in different tissue samples are comparable. It is not possible to compare transcript levels between genes. The number of cycles used during the PCR amplification of each SUT gene is shown to the right. The PCR products were separated on an agarose gel, blotted to membrane and hybridized with gene-specific probes. Reproducible results were obtained from at least three independent experiments. (A) Expression patterns in different rice tissues. Germinating seeds and roots were harvested from seedlings 7 d after germination. Sink leaves, elongating flag-leaves wrapped in leaf-sheaths, were harvested from rice plants approximately 3 weeks before the heading day. Source leaves, fully expanded flag-leaves harvested from plants 1 week after heading. Sink and source leaf-sheaths from the second leaf below the flag leaf harvested from plants 1 week before and 1 week after heading, respectively (Hirose et al. 1999). Panicles, whole panicles containing developing seeds harvested from plants 7 to 10 d after heading. (B) Changes in expression levels in rice caryopses during development. Caryopses were isolated from spikelets harvested over a timecourse from 1 to 20 DAF. View largeDownload slide Fig. 5 Analysis of expression of the five OsSUT genes, by semi-quantitative RT-PCR. For each gene, transcript levels in different tissue samples are comparable. It is not possible to compare transcript levels between genes. The number of cycles used during the PCR amplification of each SUT gene is shown to the right. The PCR products were separated on an agarose gel, blotted to membrane and hybridized with gene-specific probes. Reproducible results were obtained from at least three independent experiments. (A) Expression patterns in different rice tissues. Germinating seeds and roots were harvested from seedlings 7 d after germination. Sink leaves, elongating flag-leaves wrapped in leaf-sheaths, were harvested from rice plants approximately 3 weeks before the heading day. Source leaves, fully expanded flag-leaves harvested from plants 1 week after heading. Sink and source leaf-sheaths from the second leaf below the flag leaf harvested from plants 1 week before and 1 week after heading, respectively (Hirose et al. 1999). Panicles, whole panicles containing developing seeds harvested from plants 7 to 10 d after heading. (B) Changes in expression levels in rice caryopses during development. Caryopses were isolated from spikelets harvested over a timecourse from 1 to 20 DAF. View largeDownload slide Fig. 6 Complementation of the yeast SUSY7/ura3 strain with OsSUT1 and OsSUT3. Transformed yeast lines were plated out onto media plates containing either glucose (left hand panel) or sucrose (right hand panel) as the sole carbon source and incubated at 30°C. The SUSY7/ura3 yeast cells were transformed with either A, empty pDR195 vector; B, sense OsSUT1; C, sense OsSUT3 or D, anti-sense OsSUT3 constructs. View largeDownload slide Fig. 6 Complementation of the yeast SUSY7/ura3 strain with OsSUT1 and OsSUT3. Transformed yeast lines were plated out onto media plates containing either glucose (left hand panel) or sucrose (right hand panel) as the sole carbon source and incubated at 30°C. The SUSY7/ura3 yeast cells were transformed with either A, empty pDR195 vector; B, sense OsSUT1; C, sense OsSUT3 or D, anti-sense OsSUT3 constructs. Table 1 BLAST search results for SUT genes in the draft sequence of the rice genome Query Sequence    Indica Rice Genome  Designated  OsSUT1  HvSUT2    Contig  Length  Start–Stop     (E-value)      (bp)  (nuc.#)    1×10–111  2×10–32    #6294  11189  8199–2324  OsSUT1  6×10–45  1×10–114    #394  26535  8037–4424  OsSUT2  4×10–35  1×10–15    #10073  8705  5503–(1) a  OsSUT3  1×10–33  1×10–21    #5025  12275  3601–7597  OsSUT4  5×10–33  7×10–20    #245  29912  19083–22366  OsSUT5  1×10–12  2×10–8    #69345  1082  –  –  7×10–10  2×10–7    #84482  789  –  –  3×10–7  >1    #66800  963  –  –  1×10–4  >1    #82113  972  –  –  Query Sequence    Indica Rice Genome  Designated  OsSUT1  HvSUT2    Contig  Length  Start–Stop     (E-value)      (bp)  (nuc.#)    1×10–111  2×10–32    #6294  11189  8199–2324  OsSUT1  6×10–45  1×10–114    #394  26535  8037–4424  OsSUT2  4×10–35  1×10–15    #10073  8705  5503–(1) a  OsSUT3  1×10–33  1×10–21    #5025  12275  3601–7597  OsSUT4  5×10–33  7×10–20    #245  29912  19083–22366  OsSUT5  1×10–12  2×10–8    #69345  1082  –  –  7×10–10  2×10–7    #84482  789  –  –  3×10–7  >1    #66800  963  –  –  1×10–4  >1    #82113  972  –  –  The database of contiguous DNA sequences (Contigs) was searched with the peptide sequences of two known SUTs, rice OsSUT1 and barley HvSUT2, as queries (TBLASTN). a Published Contig lacked the 3′-end of OsSUT3 gene. View Large Table 2 Comparison of OsSUT proteins as deduced from cDNA sequences   Size  pI  % similarity to    a.a.  kDa    SUT2  SUT3  SUT4  SUT5  OsSUT1  537  56.1  8.53  53  78  66  65  OsSUT2  501  53.2  9.41  –  57  54  54  OsSUT3  506  52.8  6.94    –  63  63  OsSUT4  595  63.5  7.03      –  60  OsSUT5  535  57.0  8.32        –    Size  pI  % similarity to    a.a.  kDa    SUT2  SUT3  SUT4  SUT5  OsSUT1  537  56.1  8.53  53  78  66  65  OsSUT2  501  53.2  9.41  –  57  54  54  OsSUT3  506  52.8  6.94    –  63  63  OsSUT4  595  63.5  7.03      –  60  OsSUT5  535  57.0  8.32        –  Molecular mass and pI were calculated using the PEPTIDESORT program of the Wisconsin Sequence Analysis Software Package. Values for % similarity between the sequences resulted from multi-sequence alignment analysis using the PILEUP program of the Wisconsin package. View Large Table 3 PCR primers Primer  Position a  Sequence    from  to  5′→3′  SUT1-35  1646  1664  AGTTCTGGTCGGTCAGCAT  SUT1-33  1885  1868  ACCGAGGTGGCAACAAAG  SUT3-RC3  1321  1338  CTCCCCTTCGCCGTCCTC  SUT3-RC4  1096  1114  CTGGGCATCAGCTCGTTCC  SUT3-L2  1507  1524  GCCATGGCGTCCGTGTTC  SUT3-R2  1699  1679  GCCTGCTATAGTACCCGCTCT  SUT2-L1 b  1  20  GCCAAGAGACAACCCACTCC  SUT2-L2  53  70  GCCGAGGCAAACACGAGA  SUT2-L3  1561  1581  AGGAGGAGAGGTCACCGATAA  SUT2-R1  1800  1778  CCAACATCCAATGTACAACAGCA  SUT4-L1 b      CTCTCCAAACGCCGACCAGT  SUT4-L2  1  17  CGCAGATCTCACCAAAC  SUT4-L3  1819  1838  TTTGGCTGAGCAGAACACCA  SUT4-R1  2067  2048  ATGTCATTCGGGCAGAGCTT  SUT5-L1 b      TCGCTCTCTCTCTCCCTCCTC  SUT5-L2  1  19  GTACGACGGCAATGGAGGA  SUT5-L3  1616  1636  CTAGTGCGAAACTCCATCAAA  SUT5-R1  1865  1843  AAAATATTTGGGTTTCCTGAGAT  AP      GGCCACGCGTCGACTAGTAC  Primer  Position a  Sequence    from  to  5′→3′  SUT1-35  1646  1664  AGTTCTGGTCGGTCAGCAT  SUT1-33  1885  1868  ACCGAGGTGGCAACAAAG  SUT3-RC3  1321  1338  CTCCCCTTCGCCGTCCTC  SUT3-RC4  1096  1114  CTGGGCATCAGCTCGTTCC  SUT3-L2  1507  1524  GCCATGGCGTCCGTGTTC  SUT3-R2  1699  1679  GCCTGCTATAGTACCCGCTCT  SUT2-L1 b  1  20  GCCAAGAGACAACCCACTCC  SUT2-L2  53  70  GCCGAGGCAAACACGAGA  SUT2-L3  1561  1581  AGGAGGAGAGGTCACCGATAA  SUT2-R1  1800  1778  CCAACATCCAATGTACAACAGCA  SUT4-L1 b      CTCTCCAAACGCCGACCAGT  SUT4-L2  1  17  CGCAGATCTCACCAAAC  SUT4-L3  1819  1838  TTTGGCTGAGCAGAACACCA  SUT4-R1  2067  2048  ATGTCATTCGGGCAGAGCTT  SUT5-L1 b      TCGCTCTCTCTCTCCCTCCTC  SUT5-L2  1  19  GTACGACGGCAATGGAGGA  SUT5-L3  1616  1636  CTAGTGCGAAACTCCATCAAA  SUT5-R1  1865  1843  AAAATATTTGGGTTTCCTGAGAT  AP      GGCCACGCGTCGACTAGTAC  a Nucleotide numbers relate to the OsSUT cDNA sequences submitted to the GenBank. b No sequence data was obtained in initial PCR with the L1 primer. SUT2-L1 produced an expected product in further hemi-nested PCR using L1 and R1. View Large Abbreviations AP adaptor primer Contig Contiguous DNA sequence DAF days after flowering EST expressed sequence tag RACE rapid amplification of cDNA ends RT-PCR reverse transcription-PCR SUT sucrose transporter. References Aoki, N., Hirose, T., Takahashi, S., Ono, K., Ishimaru, K. and Ohsugi, R. ( 1999) Molecular cloning and expression analysis of a gene for a sucrose transporter in maize (Zeamays L.). Plant Cell Physiol.  40: 1072–1078. Google Scholar Aoki, N., Whitfeld, P., Hoeren, F., Scofield, G., Newell, K., Patrick, J., Offler, C., Clarke, B., Rahman, S. and Furbank, R.T. ( 2002) Three sucrose transporter genes are expressed in the developing grain of hexaploid wheat. Plant Mol. Biol.  50: 453–462. Google Scholar Barker, L., Kühn, C., Weise, A., Schulz, A., Gebhardt, C., Hirner, B., Hellmann, H., Schulze, W., Ward, J.M. and Frommer, W.B. ( 2000) SUT2, a putative sucrose sensor in sieve elements. Plant Cell  12: 1153–1164. Google Scholar Chang, S., Puryear, J. and Cairney, J. ( 1993) A simplified method for isolating RNA from pine trees. Plant Mol. Biol. Rep.  11: 113–116. Google Scholar Davies, C., Wolf, T. and Robinson, S.P. ( 1999) Three putative sucrose transporters are differentially expressed in grapevine tissues. Plant Sci.  147: 93–100. Google Scholar Furbank, R.T., Scofield, G.N., Hirose, T., Wang, X.-D., Patrick, J.W. and Offler, C.E. ( 2001) Cellular localisation and function of a sucrose transporter OsSUT1 in developing rice grains. Aust. J. Plant Physiol.  28: 1187–1196. Google Scholar Haupt, S., Duncan, G.H., Holzberg, S. and Oparka, K.J. ( 2001) Evidence for symplastic phloem unloading in sink leaves of barley. Plant Physiol.  125: 209–218. Google Scholar Hirose, T., Endler, A. and Ohsugi, R. ( 1999) Gene expression of enzymes for starch and sucrose metabolism and transport in leaf sheaths of rice (Oryza sativa L.) during the heading period in relation to the sink to source transition. Plant Prod. Sci.  2: 178–183. Google Scholar Hirose, T., Imaizumi, N., Scofield, G.N., Furbank, R.T. and Ohsugi, R. ( 1997) cDNA cloning and tissue-specific expression of a gene for sucrose transporter from rice (Oryza sativa L.). Plant Cell Physiol.  38: 1389–1396. Google Scholar Hirose, T., Takano, M. and Terao, T. ( 2002) Cell wall invertase in developing rice caryopsis: molecular cloning of OsCIN1 and analysis of its expression in relation to its role in grain filling. Plant Cell Physiol.  43: 452–459. Google Scholar Hoffman, C.S. ( 1997) Preparation of yeast DNA. In Current Protocols in Molecular Biology, Vol 2, Chapter 13. Edited by Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. pp. 13.11.1–13.11.4. John Wiley and Sons, New York. Google Scholar Ishimaru, K., Hirose, T., Aoki, N., Takahashi, S., Ono, K., Yamamoto, S., Wu, J., Saji, S., Baba, T., Ugaki, M., Matsumoto, T. and Ohsugi, R. ( 2001) Antisense expression of a rice sucrose transporter OsSUT1 in rice (Oryza sativa L.). Plant Cell Physiol.  42: 1181–1185. Google Scholar Lemoine, R. ( 2000) Sucrose transporters in plants: update on function and structure. Biochim. Biophys. Acta  1465: 246–262. Google Scholar Lu, J.M.-Y. and Bush, D.R. ( 1998) His-65 in the proton-sucrose symporter is an essential amino acid whose modification with site-directed mutagenesis increases transport activity. Proc. Natl. Acad. Sci. USA  95: 9025–9030. Google Scholar Ludwig, A., Stolz, J. and Sauer, N. ( 2000) Plant sucrose-H+ symporters mediate the transport of vitamin H. Plant J.  24: 503–509. Google Scholar Matsukura, C., Saitoh, T., Hirose, T., Ohsugi, R., Perata, P. and Yamaguchi, J. ( 2000) Sugar uptake and transport in rice embryo. Expression of companion cell-specific sucrose transporter (OsSUT1) induced by sugar and light. Plant Physiol.  124: 85–93. Google Scholar Meyer, S., Melzer, M., Truernit, E., Hümmer, C., Besenbeck, R., Stadler, R. and Sauer, N. ( 2000) AtSUC3, a gene encoding a new Arabidopsis sucrose transporter, is expressed in cells adjacent to the vascular tissue and in a carpel cell layer. Plant J.  24: 869–882. Google Scholar Reinders, A., Schulze, W., Kühn, C., Barker, L., Schulz, A., Ward, J.M. and Frommer, W.B. ( 2002) Protein-protein interactions between sucrose transporters of different affinities colocalized in the same enucleate sieve element. Plant Cell  14: 1567–1577. Google Scholar Riesmeier, J.W., Hirner, B. and Frommer, W.B. ( 1993) Potato sucrose transporter expression in minor veins indicates a role in phloem loading. Plant Cell  5: 1591–1598. Google Scholar Shakya, R. and Sturm, A. ( 1998) Characterization of source- and sink-specific sucrose/H+ symporters from carrot. Plant Physiol.  118: 1473–1480. Google Scholar Sauer, N. and Stolz, J. ( 1994) SUC1 and SUC2: two sucrose transporters from Arabidopsis thaliana; expression and characterization in baker’s yeast and identification of the histidine-tagged protein. Plant J.  6: 67–77. Google Scholar Schulze, W., Weise, A., Frommer, W.B. and Ward, J.M. ( 2000) Function of the cytosolic N-terminus of sucrose transporter AtSUT2 in substrate affinity. FEBS Lett.  485: 189–194. Google Scholar Scofield, G.N., Hirose, T., Gaudron, J.A., Upadhyaya, N.M., Ohsugi, R. and Furbank, R.T. ( 2002) Antisense suppression of the rice sucrose transporter gene, OsSUT1, leads to impaired grain filling and germination but does not affect photosynthesis. Funct. Plant Biol.  29: 815–826. Google Scholar Takeda, T., Toyofuku, K., Matsukura, C. and Yamaguchi, J. ( 2001) Sugar transporters involved in flowering and grain development of rice. J. Plant Physiol.  158: 465–470. Google Scholar Ward, J.M., Kühn, C., Tegeder, M. and Frommer, W.B. ( 1998) Sucrose transport in higher plants. Int. Rev. Cytol.  178: 41–71. Google Scholar Weise, A., Barker, L., Kühn, C., Lalonde, S., Buschmann, H., Frommer, W.B. and Ward, J.M. ( 2000) A new subfamily of sucrose transporters, SUT4, with low affinity/high capacity localized in enucleate sieve elements of plants. Plant Cell  12: 1345–1355. Google Scholar Weschke, W., Panitz, R., Sauer, N., Wang, Q., Neubohn, B., Weber, H. and Wobus, U. ( 2000) Sucrose transport into barley seeds: molecular characterization of two transporters and implications for seed development and starch accumulation. Plant J.  21: 455–467. Google Scholar Williams, L.E., Lemoine, R. and Sauer, N. ( 2000) Sugar transporters in higher plants – a diversity of roles and complex regulation. Trends Plant Sci.  5: 283–290. Google Scholar Yu, J., Hu, S., Wang, J., Wong, G.K., Li, S., Liu, B., Deng, Y., Dai, L., Zhou, Y., Zhang, X., Cao, M., Liu, J., Sun, J., Tang, J., Chen, Y., Huang, X., Lin, W., Ye, C., Tong, W., Cong, L., Geng, J., Han, Y., Li, L., Li, W., Hu, G., Huang, X., Li, W., Li, J., Liu, Z., Li, L., Liu, J., Qi, Q., Liu, J., Li, L., Li, T., Wang, X., Lu, H., Wu, T., Zhu, M., Ni, P., Han, H., Dong, W., Ren, X., Feng, X., Cui, P., Li, X., Wang, H., Xu, X., Zhai, W., Xu, Z., Zhang, J., He, S., Zhang, J., Xu, J., Zhang, K., Zheng, X., Dong, J., Zeng, W., Tao, L., Ye, J., Tan, J., Ren, X., Chen, X., He, J., Liu, D., Tian, W., Tian, C., Xia, H., Bao, Q., Li, G., Gao, H., Cao, T., Wang, J., Zhao, W., Li, P., Chen, W., Wang, X., Zhang, Y., Hu, J., Wang, J., Liu, S., Yang, J., Zhang, G., Xiong, Y., Li, Z., Mao, L., Zhou, C., Zhu, Z., Chen, R., Hao, B., Zheng, W., Chen, S., Guo, W., Li, G., Liu, S., Tao, M., Wang, J., Zhu, L., Yuan, L. and Yang, H. ( 2002) A draft sequence of the rice genome (Oryzasativa L. ssp. indica). Science  296: 79–92. Google Scholar http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Plant and Cell Physiology Oxford University Press

Loading next page...
 
/lp/oxford-university-press/the-sucrose-transporter-gene-family-in-rice-kX9W0Al2ux

References (30)

Publisher
Oxford University Press
ISSN
0032-0781
eISSN
1471-9053
DOI
10.1093/pcp/pcg030
Publisher site
See Article on Publisher Site

Abstract

Abstract In this paper we report the identification, cloning and expression analysis of four putative sucrose transporter (SUT) genes from rice, designated OsSUT2, 3, 4 and 5. Three of the four genes were identified through extensive searches of the recently published draft sequence of the rice genome. Along with the previously reported OsSUT1 we propose that these five genes comprise the rice SUT gene family. Complementary DNA clones were isolated for the four newly identified genes. The deduced proteins of all five SUT genes were predicted to contain 12 membrane-spanning helices and a domain highly conserved throughout all known plant SUTs, suggesting the four additional OsSUT genes encode functional SUTs. Reverse transcription-PCR analysis was performed in order to investigate the expression pattern of each member of the SUT family in rice. A differing but overlapping expression pattern was observed for each member of the SUT family at different stages through plant development. These results, together with the structural variations apparent from the deduced protein sequences, suggest that the five SUTs possess diverse roles in both sink and source tissues. We also discuss the classification and evolution of the rice SUT gene family, using a comparison of the gene structures and deduced amino acid sequences with other known plant SUT genes. The nucleotide sequences reported in this paper have been submitted to GenBank, EMBL under the following accession numbers: OsSUT2 mRNA, AB091672; OsSUT3 mRNA, AB071809; OsSUT4 mRNA, AB091673; OsSUT5 mRNA, AB091674; OsSUT1 gene, AF280050; OsSUT3 gene, AF419298. (Received October 21, 2002; Accepted December 18, 2002) Introduction Plant sucrose transporters (SUTs) mediate the active transport of sucrose across plasma membrane barriers in a process that is coupled to proton symport. Since sucrose is the major carbohydrate translocated through the phloem in most plant species, the sucrose/H+ symporters are thought to play important roles in mediating carbon partitioning in plants, for example apoplastic phloem loading in leaves, transport of sucrose into and/or out of temporary storage sinks such as stem tissue and post-phloem transport of sucrose into sink tissue such as seeds. Over the last decade, genes encoding SUT proteins have been isolated from a wide range of both monocot and dicot plant species. For many of these species, two or more SUT genes have been reported (see reviews of Lemoine 2000, Williams et al. 2000). In Arabidopsisthaliana, for example, five SUT genes have been functionally characterised by expression in yeast cells (Sauer and Stolz 1994, Meyer et al. 2000, Schulze et al. 2000, Weise et al. 2000, Ludwig et al. 2000), and in addition four further putative SUT sequences are found in public databases. In potato and tomato, three SUT genes with different characteristics in sucrose transport are known to exist (Riesmeier et al. 1993, Barker et al. 2000, Weise et al. 2000). Based on phylogenetic analysis of deduced peptide sequences, these dicot SUTs have been classified into three groups, SUT1-, SUT2- and SUT4-type (Barker et al. 2000, Weise et al. 2000). However, it is not fully understood whether each type of SUT has a different physiological role in dicot species. The first SUT gene to be identified in a monocot species was that from rice, OsSUT1 (Hirose et al. 1997). In that paper, the sucrose transport activity of the OsSUT1 protein was demonstrated using a heterologous expression system with yeast cells. Since then SUT1 orthologues have been identified from other cereal species, maize (Aoki et al. 1999), barley (Weschke et al. 2000) and wheat (Aoki et al. 2002). These SUT1 proteins share more than 80% identity in the primary sequences. Weschke et al. (2000) also identified a second SUT gene in barley, HvSUT2. The deduced peptide sequence of HvSUT2 shows 47% identity to that of HvSUT1. HvSUT2 was shown to code an active SUT by functional expression in yeast, and to have a different expression pattern in barley to that of HvSUT1. More recently, we have isolated cDNA and genomic clones for a putative SUT gene from rice designated OsSUT3 (GenBank accession numbers AB071809 and AF419298, respectively). In a phylogenetic tree analysis based on deduced amino acid sequences of cereal SUTs, OsSUT3 is clearly separated from both the cereal SUT1 group and HvSUT2. From these observations, the question arises as to how many SUT genes are present in the genome of cereal plant species. To provide insight into this problem we have searched the recently published rice genome sequence. The draft sequence of the genome of indica subspecies, determined by a shotgun sequencing strategy, has been estimated to cover 92.0% of the gene-containing regions in the genome (Yu et al. 2002). By comparing translated sequences of the rice genome with known SUT sequences, three genes were identified as encoding putative SUT proteins. We propose that these three genes in addition to the previously isolated OsSUT1 and OsSUT3 comprise the rice SUT gene family. In this report, the five SUT genes are compared in terms of deduced amino acid sequences, exon/intron structures and expression patterns in rice plants. Results Identification of members of the rice SUT gene family Table 1 summarises the results of the TBLASTN searches of the rice genome carried out with the known SUT sequences from rice, OsSUT1, and barley, HvSUT2. For each of the queries, five contiguous DNA sequences (Contigs) were listed as the best hits with E-values lower than 10–15. Contigs #6294 and #10073 contained DNA sequences identical with the genomic sequences of OsSUT1 and OsSUT3, respectively, both of which we had previously isolated from an indica rice cultivar. Contig #394 contained translated sequences 90% similar to HvSUT2. In Contigs #5025 and #245, several translated sequences were separately picked up showing 43–99% similarity to the OsSUT1 sequences. This suggested that these two Contigs contained SUT genes consisting of a number of exons, as seen in OsSUT1 and OsSUT3. These similarities to the query sequences allowed predictions to be made as to the positions of initiation codons, termination codons, and exon/intron borders, and as a result cDNA and peptide sequences were deduced. The putative SUT gene found in Contig #394 was designated as OsSUT2 as the predicted protein showed 80% identity to HvSUT2. Takeda et al. (2001) reported a putative SUT gene in rice and termed it OsSUT2. However, in the phylogenetic tree presented in that paper their deduced OsSUT2 amino acid sequence was clearly distinct from that of HvSUT2. Furthermore, the OsSUT2 clone isolated by Takeda et al. (2001), was later found to be identical to the OsSUT3 gene that we had previously isolated and submitted to GenBank (J. Yamaguchi, personal communication). In order to maintain consistency in the naming of cereal SUT genes, we propose that OsSUT2, as identified and cloned in this work, should be termed so as the orthologue of HvSUT2. The putative SUT genes in Contigs #5025 and #245 were designated OsSUT4 and OsSUT5, respectively. Analysis of the deduced amino acid sequences predicted from the putative SUT genes, OsSUT2, 3, 4 and 5, revealed that they all contained a region that is highly conserved in known functional plant SUT genes, including OsSUT1 (Fig. 1). This domain includes the first membrane spanning helix, the following extracellular loop, the second membrane spanning helix and the next cytoplasmic loop. Lu and Bush (1998) have shown, by site-directed mutagenesis of the Arabidopsis AtSUC1 protein, that a conserved histidine residue in the extracellular loop is responsible for sucrose binding in the transport process. This histidine residue was also found to be present in all of the putative OsSUT peptides (Fig. 1). The high conservation at the amino acid level with known plant SUTs is evidence that OsSUT2, 3, 4 and 5 may all encode functional SUT proteins. In addition to the five Contigs detailed above, four further short Contigs were also listed in the TBLASTN search with considerably low E-values for SUT (Table 1). These Contigs contained translated sequences corresponding to the highly conserved region of plant SUTs. However, the functionally important histidine residue and many of other conserved amino acid residues were substituted by other residues (Fig. 1). It seems unlikely that these genomic sequences are a part of other SUT genes. Are all five SUT genes expressed in rice? While five separate sequences with high homology to SUTs are present in the rice genome, only OsSUT1, 2 and 3 can be found in public expressed sequence tag (EST) databases (results not shown). To further explore expression of the putative SUT genes in rice, reverse transcription-PCR (RT-PCR) experiments were conducted using primers designed to be specific for OsSUT2, 4 and 5. The positions of the gene-specific primers used are shown in Fig. 2. Total RNA, isolated from rice panicles, was reverse-transcribed, and the resultant first-strand cDNAs were used as templates for the first PCR attempt, using a primer combination L1 and the adaptor primer (L1/AP). Since no apparent products were amplified for all three genes in the initial PCRs, hemi-nested and nested PCRs were conducted using two primer combinations, L3/AP and L2/R1, respectively. The later PCRs produced single-products at the expected sizes of 300 bp and 1.7 kbp for OsSUT2, 350 bp and 2.1 kbp for OsSUT4 and 350 bp and 1.9 kbp for OsSUT5, respectively (data not shown). Sequencing verified that the amplified DNA fragments derived from the corresponding SUT genes, confirming that OsSUT2, 4 and 5 are all transcribed in rice. By assembling the sequences obtained from the PCR products, cDNA sequences for each of the three genes were determined. The structures of the cDNAs for all five genes are summarised in Fig. 2. Properties and structures of the deduced SUT proteins Table 2 summarises some properties of the five OsSUT proteins as deduced from the cDNA sequences. The OsSUT peptides differ in size, for example OsSUT4 is larger by nearly 100 amino acids than OsSUT2. Isoelectric point (pI) values were calculated to be alkaline for OsSUT1, 2 and 5, and to be neutral for OsSUT3 and 4. When compared to OsSUT1, OsSUT3 is the most similar with 78% similarity, OsSUT4 and OsSUT5 show 66% and 65% similarity respectively, whilst OsSUT2 is the most distantly related to OsSUT1 with 53% similarity. When the deduced peptide sequences are compared between two rice subspecies, indica and japonica, amino acid substitutions are found in 1, 7, 4, 4 and 3 residues in OsSUT1, 2, 3, 4 and 5, respectively. The secondary structure and membrane topology of the five OsSUT proteins was predicted using software packages directed for integral membrane proteins (results not shown). All four putative OsSUT proteins, in addition to OsSUT1, are able to form a twelve membrane-spanning α-helical structure, a structure common to plant SUT proteins (Ward et al. 1998, Lemoine 2000). The central loop between the sixth and the seventh transmembrane helices is predicted to contain 30–40 amino acid residues in all of the OsSUT proteins, except for OsSUT4, which is found to have the loop extended to approximately 90 amino acid residues. The N-terminal domains of OsSUT1, 4 and 5 are longer by 20–30 amino acids than those of OsSUT2 and 3. The topology prediction suggests that the central loop and the N- and C-termini are all cytoplasmic, as predicted for known functional plant SUTs (Ward et al. 1998). Results from these structural analyses are consistent with our hypothesis that OsSUT2, 3, 4 and 5 may encode functional SUTs. Classification of members of the OsSUT gene family To compare OsSUT proteins with other known plant SUTs based on the primary sequences, multi-sequence alignment analysis was carried out. A representative result from a CLUSTALW analysis is shown in Fig. 3 as an unrooted dendrogram. In the plant SUT protein family, OsSUT1, 3, 4 and 5 are clustered together with members of the dicot-SUT2 group, forming the Type-II subfamily. Within this subfamily OsSUT1 and the orthologues from other cereal species form the cereal (monocot) -SUT1 group, sharing at least 80% identity to one another. OsSUT3 and OsSUT5 are mapped separately in the Type-II subfamily. OsSUT4 seems to be the rice orthologue of the dicot-SUT2 proteins, sharing 58–63% identity and the common features of an extended N-terminal and central loop (Davies et al. 1999, Barker et al. 2000). OsSUT2, together with HvSUT2, is closely related to dicot-SUT4 group, forming the Type-III subfamily. Similar plant SUT groupings are also reflected in gene structure. Fig. 4 shows the exon/intron structures of the five rice SUT genes along with three Arabidopsis SUT genes for comparison. OsSUT1, 3, 4 and 5, Type-II SUT genes, are composed of 14, 10, 14 and 13 exons respectively. OsSUT3 and 5 show differing fusion/separation of exons corresponding to exons 9 to 14 in OsSUT1. OsSUT1 and 3 both have a large first intron, a feature that has also been observed in wheat TaSUT1D (Aoki et al. 2002) and tomato LeSUT2 (Barker et al. 2000). The gene structure of OsSUT4 is quite similar to that of AtSUT2 (synonymous with AtSUC3) including a short first intron. The gene structures of OsSUT2 and AtSUT4, members of the Type-III subfamily, are also similar, with the exception of the lengths of the first and last intron. There are only 3 or 4 exons in AtSUC1 and the other Arabidopsis SUT genes belonging to Type-I, in contrast to the Type-II SUT genes. RT-PCR analysis of SUT gene expression in rice plants Tissue-specific expression of the five OsSUT genes was examined by RT-PCR using specific primers for each gene (Fig. 5A). OsSUT1 mRNA accumulated to high levels in germinating seeds, source leaf sheaths and panicles, but to very low level in roots. OsSUT2 mRNA accumulated to nearly equal levels in all tissues tested. The expression patterns of OsSUT3 and 5 were found to be similar, the expression level is at its highest in sink leaves and the lowest in germinating seeds. OsSUT4 showed preferential expression in sink leaves. Since it has been shown by Northern hybridisation that OsSUT1 mRNA accumulates temporally in rice caryopses during development (Furbank et al. 2001, Hirose et al. 2002), changes in mRNA levels in developing caryopses were examined for each of five OsSUT genes by RT-PCR (Fig. 5B). Consistent with the previously obtained results, the mRNA level of OsSUT1 was very low in the early stage of seed development, increased to a maximal level at 5–7 d after flowering (DAF) and then gradually declined to a barely detectable level by 20 DAF when grain filling stage nearly terminates (Hirose et al. 2002). In contrast to OsSUT1, the other four OsSUT genes tended to be expressed immediately after flowering. OsSUT2, 4 and 5 had approximately equal levels of expression from 1 DAF to 5 or 7 DAF and then declined to nearly undetectable levels by 20 DAF. OsSUT3 too has a high level of expression from 1 to 2 DAF. However, the OsSUT3 expression declined significantly at 3 DAF, recovered at 5 and 7, and then declined again. Functional expression in yeast To demonstrate that the putative OsSUT sequences identified above encode functional sucrose transporters, full-length OsSUT1 and OsSUT3 cDNAs were expressed in the yeast strain SUSY7/ura3 (Barker et al. 2000). This strain is unable to hydrolyse exogenous sucrose but if transformed with a functional SUT, can import sucrose and hydrolyse it internally (Barker et al. 2000), allowing it to grow on media containing sucrose as the sole carbon source. Fig. 6 shows that SUSY7 transformed with empty vector (A) or an OsSUT3 in the antisense orientation (D) were unable to grow on sucrose media while the OsSUT1 (B) and OsSUT3 (C) sense constructs enabled SUSY7 to grow on sucrose alone. All four constructs grew on glucose media due to the presence of high levels of endogenous hexose transporters. Discussion The draft sequence from the indica rice genome has provided us with a powerful tool which enables searches for a gene family of known proteins to be made. By searching the genome sequence, we found three genes for putative SUTs identified here as OsSUT2, 4 and 5, which had not previously been identified by screening cDNA/genomic libraries. We concluded that OsSUT1, 2, 3, 4 and 5 comprise the SUT gene family in the rice genome. It should be noted, however, that there is still the possibility that one (or more) SUT gene(s) may exist in the remaining 8% of the genome yet to be sequenced. Completion of the rice genome sequencing project, based on clone-to-clone, chromosome-to-chromosome sequencing strategy, will provide further information on OsSUT genes, such as their loci and whether there are further members of the SUT gene family. The genomic information obtained in rice may be partly applicable to other cereal species. In fact, EST sequences homologous to OsSUT2 are found in wheat (accession No. BE403785) and maize (BI991870), and ESTs homologous to OsSUT4 are found in wheat (BE400089), barley (AV916525) and maize (BQ060179), in public databases. The similarity in gene structure between monocots and dicots in the Type-II subfamily suggests that a prototype Type-II SUT gene, consisting of a number of exons, had evolved prior to a monocot/dicot split in the evolution of angiosperms. It may be speculated that in cereal (or monocot) species, SUT genes have diverged from the prototype genes, presumably by gene duplications. Further efforts to identify SUT genes in other monocot species are required for verification of this hypothesis. As in the case of the Type-II SUT genes mentioned above, a prototype Type-III SUT gene may have appeared in a common ancestor species prior to a monocot/dicot split. No monocot SUT proteins have been found so far that correspond to the dicot-SUT1 group (Type-I subfamily). The TBLASTN search of rice genome sequence with Type-I SUT proteins resulted in the same Contigs being listed as those listed with the OsSUT1 sequence (results not shown). This type of SUT gene does not seem to be present in rice. Verification of sucrose transporter function for a variety of dicot and monocot SUT genes has been carried out using heterologous expression in yeast (reviewed by Lemoine 2000). This includes the demonstration of low but reproducible rates of sucrose uptake by OsSUT1 (Hirose et al. 1997). However, many SUT genes have proven difficult to express in vitro (Schulze et al. 2000, Weise et al. 2000). While we have successfully demonstrated complementation of the SUSY7 yeast strain with OsSUT1 and OsSUT3 (Fig. 6), we have thus far been unable to attain high rates of [14C]sucrose uptake using a variety of vectors and yeast strains. The high level of sequence similarity between the putative OsSUT genes described here and other SUT genes shown to be functional sucrose transporters, supports the hypothesis that they are indeed functional carriers. The OsSUT1 expression data is consistent with the previously reported observations (Hirose et al. 1997, Hirose et al. 1999, Hirose et al. 2002, Matsukura et al. 2000, Furbank et al. 2001, Ishimaru et al. 2001, Scofield et al. 2002). Through extensive characterisation studies including expression analysis, heterologous expression in yeast, localisation and anti-sense suppression of in vivo function, it has been shown that OsSUT1 encodes a functional SUT protein that is essential for transport of assimilate into filling rice grains (Hirose et al. 1997, Hirose et al. 2002, Furbank et al. 2001, Scofield et al. 2002). It has also been proposed that OsSUT1 is involved in transport of assimilate remobilised from starch reserves in leaf sheaths and in germinating seeds (Hirose et al. 1997, Hirose et al. 1999, Matsukura et al. 2000, Scofield et al. 2002). In germinating seeds, OsSUT1 appeared to be expressed dominantly compared with the other four SUT genes. This is consistent with the observation that anti-sense suppression lines for OsSUT1 show retarded germination (Scofield et al. 2002). The suppression lines also exhibited no visible symptoms of assimilate accumulation and no decreased activity of photosynthesis in mature leaves, suggesting that OsSUT1 has little contribution to loading photoassimilates into the phloem of source leaves (Ishimaru et al. 2001, Scofield et al. 2002). Further studies are needed to analyse expression of other SUT genes in source leaves, in order to evaluate the contribution of SUT-mediated membrane transport to phloem loading of photoassimilates in rice leaves. Expression of OsSUT3, 4 and 5 in sink rice leaf suggests that they may be important for supplying sucrose, as a carbon source for growing tissues or possibly to supply sucrose to temporary storage tissues. This is an interesting observation as in barley, sucrose unloading in sink leaf is believed to occur symplastically (Haupt et al. 2001). The role of membrane-mediated transport of sucrose has not been comprehensively studied in vegetative sink tissues such as developing leaves, starch-storing leaf-sheaths and elongating roots. Unlike the other four OsSUT genes, OsSUT2 seems to be expressed at almost equal levels in various tissues of rice plants. Similar expression pattern has been observed for HvSUT2 in barley (Weschke et al. 2000). The expression pattern might be related to the evolutionary origin of the SUT2 genes, which are structurally distant from the other members of cereal SUT gene family. For the HvSUT2 protein, a Km value of 5 mM has been reported for sucrose transport activity in yeast cells (Weschke et al. 2000). However, Km values observed for dicot-SUT4 proteins under comparable assay conditions are varied, for example, 0.5 mM for carrot DcSUT1A (Shakya and Sturm 1998) and 11.6 mM for AtSUT4 (Weise et al. 2000). It would appear that in Type-III SUT protein, structural similarity is not related to the kinetic properties of sucrose transport activity. Expression patterns of OsSUT genes in developing rice caryopses suggested that the physiological role(s) of OsSUT1 may differ from those of the other four OsSUT genes when caryopses differentiate, elongate and fill. Hirose et al. (2002) reported two stages of rice caryopsis development, an early stage from 1 to 4 DAF when the caryopsis is elongating and cell differentiation is occurring. The second stage from about 5 DAF until about 15 DAF, is where the caryopsis having reached its final length is rapidly gaining weight. OsSUT1 has been shown, in that work and also here, to be preferentially expressed during the second stage of development, i.e. during the maximal grain filling stage, and is known to mediate transport of assimilate across the aleurone cell layers into the developing endosperm (Furbank et al. 2001, Scofield et al. 2002, Hirose et al. 2002). OsSUT2, 3, 4 and 5 seem to predominantly be expressed in the first stage of development. It is possible that these genes may play a role in the transport of sucrose in the caryopsis during early development. There is some overlap in expression of the genes between the two stages, particularly for OsSUT3 and perhaps it has some role in conjunction with OsSUT1 in assimilate transport during grain filling. Localisation studies for each of the OsSUT genes may help to elucidate their function in the developing caryopsis. The differential expression patterns of the five OsSUT genes in rice plants observed in this work suggest that the SUT gene family has many roles in both source and sink tissues, and at different developmental stages. It would be helpful to produce and analyse suppression/knock-out lines, in order to fully understand the physiological roles of the SUT gene family in rice plants. It is also noteworthy that in each tissue tested, at least four OsSUT genes are apparently expressed. This overlapping expression may imply diverse roles of the five OsSUT proteins in membrane-mediated sucrose transport processes or could represent expression in different cell types. The five OsSUT proteins differ considerably in terms of the primary structure and pI value, suggesting distinct biochemical properties. The OsSUT4 protein, in particular, contains the extended central loop similar to dicot-SUT2 proteins, which show structural similarity to yeast sugar sensor proteins (Barker et al. 2000). It has been shown in the Arabidopsis SUT2 (SUC3) protein that the central loop is not necessary for sucrose transport activity, whereas the N-terminal domain has been shown to play a role in determining affinity for sucrose (Meyer et al. 2000, Schulze et al. 2000). It would be of great interest to compare the five OsSUT proteins in terms of substrate specificity and kinetic properties of transport activity. Moreover, Reinders et al. (2002) reported in potato and tomato that three functionally different SUT proteins are expressed in the same sieve element and can form homo- and hetero-oligomers in vivo, suggesting functional significance of interaction between SUT proteins. It is possible that in rice tissues the five distinct putative SUTs could function as protein complexes or interact in the plasma membranes. Materials and Methods Plant materials Rice plants (Oryzasativa L. ssp. japonica cv. Nipponbare) were grown under field conditions in plastic pots filled with the soil from the paddy field of NARC, Joetsu, Japan. Each stem was tagged on the heading day when the tip of panicles emerges from flag-leaf sheath. Each spikelet was marked on the flowering day and subsequently sampled following maturity. To obtain tissue samples from rice seedlings, seeds were germinated in water for 2 d, transplanted into soil in seedling boxes and grown for 7 d in a glasshouse. Tissue samples taken were immediately frozen in liquid nitrogen and stored at –80°C until use. Isolation of genomic clones for OsSUT1 and OsSUT3 A commercially available genomic rice library of Oryza sativa ssp. indica cv. IR36 (Clontech) was screened using a probe from the 3′ coding region of OsSUT1 (accession No. D87819), equivalent to 1303–1632 bp. A number of positive clones were identified, isolated and purified. The clones fell into two classes, depending on the strength of hybridisation to the probe. One clone from each class was selected and fully sequenced. The genomic clone hybridising very strongly to the probe was found to correspond to the OsSUT1 cDNA sequence, whilst the genomic clone with a weaker hybridisation to the probe contained a SUT-like sequence. The latter clone was found to correspond to the EST clone E0355, and was designated OsSUT3. Cloning of OsSUT3 cDNA An EST fragment E0355 (accession No. AU063776) obtained from the Rice Genome Program, Japan, was identified as having a SUT-like sequence. Further sequence analysis revealed that the 1.4-kb EST clone corresponded to a partial cDNA for a SUT-like gene that we had cloned from a rice genomic library. Since the EST clone contained the start codon but lacked the 3′ region including the stop codon, overlapping 3′ fragments were generated by 3′-Rapid Amplification of cDNA Ends (3′-RACE) PCR as following. Total RNA was isolated from whole panicles of rice plants, harvested 7–10 d after heading, using the method of Chang et al. (1993) but with the polyvinylpyrrolidone and spermidine omitted from the extraction buffer. To verify that there was no genomic DNA contamination in the RNA preparations, PCR was carried out using a primer combination that covers an intron-containing region in a rice cell-wall invertase gene (data not shown). The isolated RNA (5 µg) was reverse transcribed (SuperScript II, Life Technologies), using an oligo-dT13 primer attached to an adaptor sequence. The resultant first-strand cDNAs were used as template mixture for 3′-RACE PCR with specific primers RC3 and RC4 (Fig. 2), and the adaptor primer (AP, Table 3). By assembling the 3′-RACE product and the EST using a convenient restriction site in the overlapping region, a cDNA clone of the SUT-like gene was obtained. The gene was called OsSUT3 since it did not appear to be the rice orthologue of HvSUT2. The Rice Genome Database and computer programs Contiguous DNA sequences from rice genome were obtained from the Rice GD (http://210.83.138.53/rice/, Yu et al. 2002) and searched with homology to known SUTs, using TBLASTN algorithm. Translated sequences picked up from the Contigs were assembled and further optimised by comparing to known SUT sequences. Nucleotide sequences and deduced amino acid sequences were primarily analysed using the Wisconsin Sequence Analysis Software Package (Genetic Computer Group, Madison, WI, U.S.A.). Secondary structure and membrane topology were predicted using programs available on the web; the TMPRED (http://www.ch.embnet.org/), the TMHMM (http://www.cbs.dtu.dk/), the HMMTOP (http://www.enzim. hu/) and the WHAT (http://saier-144–37.ucsd.edu/). Multi-sequence alignment analysis was carried out using the PILEUP program of the Wisconsin package and the CLUSTALW program (http://www.genome. ad.jp/). 3′-RACE analysis and PCR-based cDNA cloning for OsSUT2, 4 and 5 For the following PCR experiments, first-strand cDNA mixture was prepared from RNA isolated from whole panicles 7–10 d after heading, as described above. Based on genomic sequences of OsSUT2, 4 and 5 found in the rice genome sequence, corresponding cDNA sequences were predicted using a gene prediction program, the RiceHMM (http://rgp.dna.affrc.go.jp/). According to the predicted cDNA sequences, three PCR primers, L1, L2 and L3 were designed for each gene by a primer-picking program Primer3 (http://www-genome.wi.mit. edu/). The initial PCR step, using the first-strand cDNA mixture, was done with primers L1 and AP. Using an aliquot of the initial PCR product as template mixture, hemi-nested (3′-RACE) PCR was performed with L3/AP primer combination to generate 3′ partial cDNA fragment, and nested PCR was performed with L2/R1, which covers coding region. The gene-specific primers used are referred to in detail in Fig. 2 and Table 3. Amplified cDNA fragments were cloned into a vector (pGEM-Teasy, Promega), and sequenced. The partial sequences obtained for each gene were assembled with overlapping region, and cDNA sequences of OsSUT2, 4 and 5 were determined. The cDNA sequences were compared with corresponding genomic sequences, and the allocation of exon/intron arrangements assumed for OsSUT2, 4 and 5 was confirmed. RT-PCR analysis of OsSUT gene expression First-strand cDNA mixtures were prepared from RNA isolated from different rice tissues. An aliquot of first-strand cDNA mixture corresponding to 12.5 ng of the total RNA was used as a template. The PCR (20 µl total volume) was done using 0.2 units of Taq polymerase (ExTaq, Takara, Kyoto, Japan). The gene-specific primers were designed to produce a 239-, 192-, 239-, 248- and 249-bp DNA fragment from OsSUT1, 2, 3, 4 and 5, respectively (Fig. 2 and Table 3). The amount of template cDNA and the number of PCR cycles were determined by preliminary experiments to ensure that amplification occurred in the linear range and allowed good quantification of the amplified products. The amplified DNA fragments (5 µl of each reaction) were separated on a 1.2% (w/v) agarose gel, transferred to nylon membrane (Hybond-N+, Amersham), hybridised with specific cDNA probes amplified from the corresponding cDNA clone, and visualized by AlkPhos Direct Labeling and Detection System (Amersham) following the manufacturer’s instructions. Heterologous expression of OsSUT in yeast Constructs were prepared that contained either OsSUT1 or OsSUT3 cDNAs cloned into the yeast shuttle vector pDR195. The SUT cDNAs contained the entire open reading frame for each SUT along with the full 3′ untranslated region and approximately 20–25 bp of the 5′ untranslated region. An additional construct was prepared in which the OsSUT3 cDNA was inserted in the anti-sense direction in to the vector as a control. These constructs were separately transformed into cells of the SUSY7/ura3 yeast strain (Barker et al. 2000), using the “Quick and Easy” TRAFO protocol (as detailed at http://www.umanitoba.ca/faculties/medicine/biochem/gietz/Quick.html). Transformed cells were plated onto media containing glucose and were incubated for several days at 30°C. Single colonies from the transformation plates were streaked out onto media plates containing either glucose or sucrose as the sole carbon source and were incubated for several days at 30°C. Cell lines transformed with either the empty pDR195 vector or the OsSUT3 anti-sense construct were used as controls. To verify that the transformed SUT-SUSY7/ura3 lines did in fact contain the SUT constructs plasmid DNA was isolated from yeast cells used in the complementation test by the method of Hoffman (1997). The plasmid DNAs were separately transformed into E. coli cells and positive colonies were selected by ampicillin resistance conferred from the pDR195 vector. Plasmid DNA was isolated from positive colonies and the presence of the various SUT constructs was confirmed by diagnostic digestion with restriction enzymes. Acknowledgments The authors thank Dr. Junji Yamaguchi for providing sequence information of his OsSUT gene. We also thank Dr. Wolf B. Frommer (University of Tübingen, Germany) for the yeast strain SUSY7/ura3, and the yeast shuttle vector pDR195. This work was supported in part by Grants-in-aid from the Ministry of Agriculture Forestry and Fisheries of Japan, Pioneer Research Project Fund (PREP-1206) to TH. The expert technical assistance of Kiiko Takatsuto is much appreciated. 3 These authors have contributed equally to this work and should be considered as joint first authors. 4 Corresponding author: Email, robert.furbank@csiro.au; Fax, +61-2-6246-5000. View largeDownload slide Fig. 1 Analysis of the Contigs listed in Table 1. Translated sequences of the Contigs are compared with the CONSENSUS sequence derived from a highly conserved region of known functional plant SUTs. Putative transmembrane domains of the SUT peptide are underlined. Numbers indicate conservative substitutions: 1 = I, L or V; 2 = F, W or Y. The functionally important and conserved histidine residue is shown in bold. Dots indicate non-conserved amino acids, and horizontal bars indicate gaps in the sequence alignments. View largeDownload slide Fig. 1 Analysis of the Contigs listed in Table 1. Translated sequences of the Contigs are compared with the CONSENSUS sequence derived from a highly conserved region of known functional plant SUTs. Putative transmembrane domains of the SUT peptide are underlined. Numbers indicate conservative substitutions: 1 = I, L or V; 2 = F, W or Y. The functionally important and conserved histidine residue is shown in bold. Dots indicate non-conserved amino acids, and horizontal bars indicate gaps in the sequence alignments. View largeDownload slide Fig. 2 Structure of the five OsSUT cDNAs. The positions of the primer sequences used for 3′-RACE-PCR and cDNA cloning are shown by solid arrows, and those for RT-PCR analysis are shown by dotted arrows. The GenBank accession number for OsSUT1 cDNA is D87819. View largeDownload slide Fig. 2 Structure of the five OsSUT cDNAs. The positions of the primer sequences used for 3′-RACE-PCR and cDNA cloning are shown by solid arrows, and those for RT-PCR analysis are shown by dotted arrows. The GenBank accession number for OsSUT1 cDNA is D87819. View largeDownload slide Fig. 3 An un-rooted dendrogram of plant SUTs, based on deduced amino acid sequences. The CLUSTALW program was used to show the relationship between the members of the OsSUT gene family (bold) and other plant SUTs. The GenBank accession numbers for the peptide sequences are Arabidopsis AtSUC1, CAA53147; AtSUC2, CAA53150; AtSUT2 (AtSUC3), AAC32907; AtSUT4, AAG09191; AtSUC5, AAG52226; carrot DcSUT1A, CAA76367; DcSUT2, CAA76369; barley HvSUT1, CAB75882; HvSUT2, CAB75881; tomato LeSUT1, CAA57726; LeSUT2, AAG12987; LeSUT4, AAG09270; tobacco NtSUT1A, CAA57727; NtSUT3, AAD34610; rice OsSUT1, BAA24071; OsSUT2, AB091672; OsSUT3, BAB68368; OsSUT4, AB091673; OsSUT5, AB091674; common plantain PmSUC1, CAA59113; PmSUC2, CAA53390; potato StSUT1, CAA48915; StSUT4, AAG25923; spinach SoSUT1, CAA47604; wheat TaSUT1D, AAM13410; grape VvSUC11, AAF08329; VvSUC12, AAF08330; VvSUC27, AAF08331; VvSUT2, AAL32020; maize ZmSUT1, BBA83501. View largeDownload slide Fig. 3 An un-rooted dendrogram of plant SUTs, based on deduced amino acid sequences. The CLUSTALW program was used to show the relationship between the members of the OsSUT gene family (bold) and other plant SUTs. The GenBank accession numbers for the peptide sequences are Arabidopsis AtSUC1, CAA53147; AtSUC2, CAA53150; AtSUT2 (AtSUC3), AAC32907; AtSUT4, AAG09191; AtSUC5, AAG52226; carrot DcSUT1A, CAA76367; DcSUT2, CAA76369; barley HvSUT1, CAB75882; HvSUT2, CAB75881; tomato LeSUT1, CAA57726; LeSUT2, AAG12987; LeSUT4, AAG09270; tobacco NtSUT1A, CAA57727; NtSUT3, AAD34610; rice OsSUT1, BAA24071; OsSUT2, AB091672; OsSUT3, BAB68368; OsSUT4, AB091673; OsSUT5, AB091674; common plantain PmSUC1, CAA59113; PmSUC2, CAA53390; potato StSUT1, CAA48915; StSUT4, AAG25923; spinach SoSUT1, CAA47604; wheat TaSUT1D, AAM13410; grape VvSUC11, AAF08329; VvSUC12, AAF08330; VvSUC27, AAF08331; VvSUT2, AAL32020; maize ZmSUT1, BBA83501. View largeDownload slide Fig. 4 Comparison of the gene structure of the five members of the OsSUT gene family. Three Arabidopsis SUT genes, AtSUC1 (accession No. AC021665), AtSUT2 (AtSUC3, AC004138) and AtSUT4 (AF175322), are also shown for comparison. Boxes represent exons. View largeDownload slide Fig. 4 Comparison of the gene structure of the five members of the OsSUT gene family. Three Arabidopsis SUT genes, AtSUC1 (accession No. AC021665), AtSUT2 (AtSUC3, AC004138) and AtSUT4 (AF175322), are also shown for comparison. Boxes represent exons. View largeDownload slide Fig. 5 Analysis of expression of the five OsSUT genes, by semi-quantitative RT-PCR. For each gene, transcript levels in different tissue samples are comparable. It is not possible to compare transcript levels between genes. The number of cycles used during the PCR amplification of each SUT gene is shown to the right. The PCR products were separated on an agarose gel, blotted to membrane and hybridized with gene-specific probes. Reproducible results were obtained from at least three independent experiments. (A) Expression patterns in different rice tissues. Germinating seeds and roots were harvested from seedlings 7 d after germination. Sink leaves, elongating flag-leaves wrapped in leaf-sheaths, were harvested from rice plants approximately 3 weeks before the heading day. Source leaves, fully expanded flag-leaves harvested from plants 1 week after heading. Sink and source leaf-sheaths from the second leaf below the flag leaf harvested from plants 1 week before and 1 week after heading, respectively (Hirose et al. 1999). Panicles, whole panicles containing developing seeds harvested from plants 7 to 10 d after heading. (B) Changes in expression levels in rice caryopses during development. Caryopses were isolated from spikelets harvested over a timecourse from 1 to 20 DAF. View largeDownload slide Fig. 5 Analysis of expression of the five OsSUT genes, by semi-quantitative RT-PCR. For each gene, transcript levels in different tissue samples are comparable. It is not possible to compare transcript levels between genes. The number of cycles used during the PCR amplification of each SUT gene is shown to the right. The PCR products were separated on an agarose gel, blotted to membrane and hybridized with gene-specific probes. Reproducible results were obtained from at least three independent experiments. (A) Expression patterns in different rice tissues. Germinating seeds and roots were harvested from seedlings 7 d after germination. Sink leaves, elongating flag-leaves wrapped in leaf-sheaths, were harvested from rice plants approximately 3 weeks before the heading day. Source leaves, fully expanded flag-leaves harvested from plants 1 week after heading. Sink and source leaf-sheaths from the second leaf below the flag leaf harvested from plants 1 week before and 1 week after heading, respectively (Hirose et al. 1999). Panicles, whole panicles containing developing seeds harvested from plants 7 to 10 d after heading. (B) Changes in expression levels in rice caryopses during development. Caryopses were isolated from spikelets harvested over a timecourse from 1 to 20 DAF. View largeDownload slide Fig. 6 Complementation of the yeast SUSY7/ura3 strain with OsSUT1 and OsSUT3. Transformed yeast lines were plated out onto media plates containing either glucose (left hand panel) or sucrose (right hand panel) as the sole carbon source and incubated at 30°C. The SUSY7/ura3 yeast cells were transformed with either A, empty pDR195 vector; B, sense OsSUT1; C, sense OsSUT3 or D, anti-sense OsSUT3 constructs. View largeDownload slide Fig. 6 Complementation of the yeast SUSY7/ura3 strain with OsSUT1 and OsSUT3. Transformed yeast lines were plated out onto media plates containing either glucose (left hand panel) or sucrose (right hand panel) as the sole carbon source and incubated at 30°C. The SUSY7/ura3 yeast cells were transformed with either A, empty pDR195 vector; B, sense OsSUT1; C, sense OsSUT3 or D, anti-sense OsSUT3 constructs. Table 1 BLAST search results for SUT genes in the draft sequence of the rice genome Query Sequence    Indica Rice Genome  Designated  OsSUT1  HvSUT2    Contig  Length  Start–Stop     (E-value)      (bp)  (nuc.#)    1×10–111  2×10–32    #6294  11189  8199–2324  OsSUT1  6×10–45  1×10–114    #394  26535  8037–4424  OsSUT2  4×10–35  1×10–15    #10073  8705  5503–(1) a  OsSUT3  1×10–33  1×10–21    #5025  12275  3601–7597  OsSUT4  5×10–33  7×10–20    #245  29912  19083–22366  OsSUT5  1×10–12  2×10–8    #69345  1082  –  –  7×10–10  2×10–7    #84482  789  –  –  3×10–7  >1    #66800  963  –  –  1×10–4  >1    #82113  972  –  –  Query Sequence    Indica Rice Genome  Designated  OsSUT1  HvSUT2    Contig  Length  Start–Stop     (E-value)      (bp)  (nuc.#)    1×10–111  2×10–32    #6294  11189  8199–2324  OsSUT1  6×10–45  1×10–114    #394  26535  8037–4424  OsSUT2  4×10–35  1×10–15    #10073  8705  5503–(1) a  OsSUT3  1×10–33  1×10–21    #5025  12275  3601–7597  OsSUT4  5×10–33  7×10–20    #245  29912  19083–22366  OsSUT5  1×10–12  2×10–8    #69345  1082  –  –  7×10–10  2×10–7    #84482  789  –  –  3×10–7  >1    #66800  963  –  –  1×10–4  >1    #82113  972  –  –  The database of contiguous DNA sequences (Contigs) was searched with the peptide sequences of two known SUTs, rice OsSUT1 and barley HvSUT2, as queries (TBLASTN). a Published Contig lacked the 3′-end of OsSUT3 gene. View Large Table 2 Comparison of OsSUT proteins as deduced from cDNA sequences   Size  pI  % similarity to    a.a.  kDa    SUT2  SUT3  SUT4  SUT5  OsSUT1  537  56.1  8.53  53  78  66  65  OsSUT2  501  53.2  9.41  –  57  54  54  OsSUT3  506  52.8  6.94    –  63  63  OsSUT4  595  63.5  7.03      –  60  OsSUT5  535  57.0  8.32        –    Size  pI  % similarity to    a.a.  kDa    SUT2  SUT3  SUT4  SUT5  OsSUT1  537  56.1  8.53  53  78  66  65  OsSUT2  501  53.2  9.41  –  57  54  54  OsSUT3  506  52.8  6.94    –  63  63  OsSUT4  595  63.5  7.03      –  60  OsSUT5  535  57.0  8.32        –  Molecular mass and pI were calculated using the PEPTIDESORT program of the Wisconsin Sequence Analysis Software Package. Values for % similarity between the sequences resulted from multi-sequence alignment analysis using the PILEUP program of the Wisconsin package. View Large Table 3 PCR primers Primer  Position a  Sequence    from  to  5′→3′  SUT1-35  1646  1664  AGTTCTGGTCGGTCAGCAT  SUT1-33  1885  1868  ACCGAGGTGGCAACAAAG  SUT3-RC3  1321  1338  CTCCCCTTCGCCGTCCTC  SUT3-RC4  1096  1114  CTGGGCATCAGCTCGTTCC  SUT3-L2  1507  1524  GCCATGGCGTCCGTGTTC  SUT3-R2  1699  1679  GCCTGCTATAGTACCCGCTCT  SUT2-L1 b  1  20  GCCAAGAGACAACCCACTCC  SUT2-L2  53  70  GCCGAGGCAAACACGAGA  SUT2-L3  1561  1581  AGGAGGAGAGGTCACCGATAA  SUT2-R1  1800  1778  CCAACATCCAATGTACAACAGCA  SUT4-L1 b      CTCTCCAAACGCCGACCAGT  SUT4-L2  1  17  CGCAGATCTCACCAAAC  SUT4-L3  1819  1838  TTTGGCTGAGCAGAACACCA  SUT4-R1  2067  2048  ATGTCATTCGGGCAGAGCTT  SUT5-L1 b      TCGCTCTCTCTCTCCCTCCTC  SUT5-L2  1  19  GTACGACGGCAATGGAGGA  SUT5-L3  1616  1636  CTAGTGCGAAACTCCATCAAA  SUT5-R1  1865  1843  AAAATATTTGGGTTTCCTGAGAT  AP      GGCCACGCGTCGACTAGTAC  Primer  Position a  Sequence    from  to  5′→3′  SUT1-35  1646  1664  AGTTCTGGTCGGTCAGCAT  SUT1-33  1885  1868  ACCGAGGTGGCAACAAAG  SUT3-RC3  1321  1338  CTCCCCTTCGCCGTCCTC  SUT3-RC4  1096  1114  CTGGGCATCAGCTCGTTCC  SUT3-L2  1507  1524  GCCATGGCGTCCGTGTTC  SUT3-R2  1699  1679  GCCTGCTATAGTACCCGCTCT  SUT2-L1 b  1  20  GCCAAGAGACAACCCACTCC  SUT2-L2  53  70  GCCGAGGCAAACACGAGA  SUT2-L3  1561  1581  AGGAGGAGAGGTCACCGATAA  SUT2-R1  1800  1778  CCAACATCCAATGTACAACAGCA  SUT4-L1 b      CTCTCCAAACGCCGACCAGT  SUT4-L2  1  17  CGCAGATCTCACCAAAC  SUT4-L3  1819  1838  TTTGGCTGAGCAGAACACCA  SUT4-R1  2067  2048  ATGTCATTCGGGCAGAGCTT  SUT5-L1 b      TCGCTCTCTCTCTCCCTCCTC  SUT5-L2  1  19  GTACGACGGCAATGGAGGA  SUT5-L3  1616  1636  CTAGTGCGAAACTCCATCAAA  SUT5-R1  1865  1843  AAAATATTTGGGTTTCCTGAGAT  AP      GGCCACGCGTCGACTAGTAC  a Nucleotide numbers relate to the OsSUT cDNA sequences submitted to the GenBank. b No sequence data was obtained in initial PCR with the L1 primer. SUT2-L1 produced an expected product in further hemi-nested PCR using L1 and R1. View Large Abbreviations AP adaptor primer Contig Contiguous DNA sequence DAF days after flowering EST expressed sequence tag RACE rapid amplification of cDNA ends RT-PCR reverse transcription-PCR SUT sucrose transporter. References Aoki, N., Hirose, T., Takahashi, S., Ono, K., Ishimaru, K. and Ohsugi, R. ( 1999) Molecular cloning and expression analysis of a gene for a sucrose transporter in maize (Zeamays L.). Plant Cell Physiol.  40: 1072–1078. Google Scholar Aoki, N., Whitfeld, P., Hoeren, F., Scofield, G., Newell, K., Patrick, J., Offler, C., Clarke, B., Rahman, S. and Furbank, R.T. ( 2002) Three sucrose transporter genes are expressed in the developing grain of hexaploid wheat. Plant Mol. Biol.  50: 453–462. Google Scholar Barker, L., Kühn, C., Weise, A., Schulz, A., Gebhardt, C., Hirner, B., Hellmann, H., Schulze, W., Ward, J.M. and Frommer, W.B. ( 2000) SUT2, a putative sucrose sensor in sieve elements. Plant Cell  12: 1153–1164. Google Scholar Chang, S., Puryear, J. and Cairney, J. ( 1993) A simplified method for isolating RNA from pine trees. Plant Mol. Biol. Rep.  11: 113–116. Google Scholar Davies, C., Wolf, T. and Robinson, S.P. ( 1999) Three putative sucrose transporters are differentially expressed in grapevine tissues. Plant Sci.  147: 93–100. Google Scholar Furbank, R.T., Scofield, G.N., Hirose, T., Wang, X.-D., Patrick, J.W. and Offler, C.E. ( 2001) Cellular localisation and function of a sucrose transporter OsSUT1 in developing rice grains. Aust. J. Plant Physiol.  28: 1187–1196. Google Scholar Haupt, S., Duncan, G.H., Holzberg, S. and Oparka, K.J. ( 2001) Evidence for symplastic phloem unloading in sink leaves of barley. Plant Physiol.  125: 209–218. Google Scholar Hirose, T., Endler, A. and Ohsugi, R. ( 1999) Gene expression of enzymes for starch and sucrose metabolism and transport in leaf sheaths of rice (Oryza sativa L.) during the heading period in relation to the sink to source transition. Plant Prod. Sci.  2: 178–183. Google Scholar Hirose, T., Imaizumi, N., Scofield, G.N., Furbank, R.T. and Ohsugi, R. ( 1997) cDNA cloning and tissue-specific expression of a gene for sucrose transporter from rice (Oryza sativa L.). Plant Cell Physiol.  38: 1389–1396. Google Scholar Hirose, T., Takano, M. and Terao, T. ( 2002) Cell wall invertase in developing rice caryopsis: molecular cloning of OsCIN1 and analysis of its expression in relation to its role in grain filling. Plant Cell Physiol.  43: 452–459. Google Scholar Hoffman, C.S. ( 1997) Preparation of yeast DNA. In Current Protocols in Molecular Biology, Vol 2, Chapter 13. Edited by Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. pp. 13.11.1–13.11.4. John Wiley and Sons, New York. Google Scholar Ishimaru, K., Hirose, T., Aoki, N., Takahashi, S., Ono, K., Yamamoto, S., Wu, J., Saji, S., Baba, T., Ugaki, M., Matsumoto, T. and Ohsugi, R. ( 2001) Antisense expression of a rice sucrose transporter OsSUT1 in rice (Oryza sativa L.). Plant Cell Physiol.  42: 1181–1185. Google Scholar Lemoine, R. ( 2000) Sucrose transporters in plants: update on function and structure. Biochim. Biophys. Acta  1465: 246–262. Google Scholar Lu, J.M.-Y. and Bush, D.R. ( 1998) His-65 in the proton-sucrose symporter is an essential amino acid whose modification with site-directed mutagenesis increases transport activity. Proc. Natl. Acad. Sci. USA  95: 9025–9030. Google Scholar Ludwig, A., Stolz, J. and Sauer, N. ( 2000) Plant sucrose-H+ symporters mediate the transport of vitamin H. Plant J.  24: 503–509. Google Scholar Matsukura, C., Saitoh, T., Hirose, T., Ohsugi, R., Perata, P. and Yamaguchi, J. ( 2000) Sugar uptake and transport in rice embryo. Expression of companion cell-specific sucrose transporter (OsSUT1) induced by sugar and light. Plant Physiol.  124: 85–93. Google Scholar Meyer, S., Melzer, M., Truernit, E., Hümmer, C., Besenbeck, R., Stadler, R. and Sauer, N. ( 2000) AtSUC3, a gene encoding a new Arabidopsis sucrose transporter, is expressed in cells adjacent to the vascular tissue and in a carpel cell layer. Plant J.  24: 869–882. Google Scholar Reinders, A., Schulze, W., Kühn, C., Barker, L., Schulz, A., Ward, J.M. and Frommer, W.B. ( 2002) Protein-protein interactions between sucrose transporters of different affinities colocalized in the same enucleate sieve element. Plant Cell  14: 1567–1577. Google Scholar Riesmeier, J.W., Hirner, B. and Frommer, W.B. ( 1993) Potato sucrose transporter expression in minor veins indicates a role in phloem loading. Plant Cell  5: 1591–1598. Google Scholar Shakya, R. and Sturm, A. ( 1998) Characterization of source- and sink-specific sucrose/H+ symporters from carrot. Plant Physiol.  118: 1473–1480. Google Scholar Sauer, N. and Stolz, J. ( 1994) SUC1 and SUC2: two sucrose transporters from Arabidopsis thaliana; expression and characterization in baker’s yeast and identification of the histidine-tagged protein. Plant J.  6: 67–77. Google Scholar Schulze, W., Weise, A., Frommer, W.B. and Ward, J.M. ( 2000) Function of the cytosolic N-terminus of sucrose transporter AtSUT2 in substrate affinity. FEBS Lett.  485: 189–194. Google Scholar Scofield, G.N., Hirose, T., Gaudron, J.A., Upadhyaya, N.M., Ohsugi, R. and Furbank, R.T. ( 2002) Antisense suppression of the rice sucrose transporter gene, OsSUT1, leads to impaired grain filling and germination but does not affect photosynthesis. Funct. Plant Biol.  29: 815–826. Google Scholar Takeda, T., Toyofuku, K., Matsukura, C. and Yamaguchi, J. ( 2001) Sugar transporters involved in flowering and grain development of rice. J. Plant Physiol.  158: 465–470. Google Scholar Ward, J.M., Kühn, C., Tegeder, M. and Frommer, W.B. ( 1998) Sucrose transport in higher plants. Int. Rev. Cytol.  178: 41–71. Google Scholar Weise, A., Barker, L., Kühn, C., Lalonde, S., Buschmann, H., Frommer, W.B. and Ward, J.M. ( 2000) A new subfamily of sucrose transporters, SUT4, with low affinity/high capacity localized in enucleate sieve elements of plants. Plant Cell  12: 1345–1355. Google Scholar Weschke, W., Panitz, R., Sauer, N., Wang, Q., Neubohn, B., Weber, H. and Wobus, U. ( 2000) Sucrose transport into barley seeds: molecular characterization of two transporters and implications for seed development and starch accumulation. Plant J.  21: 455–467. Google Scholar Williams, L.E., Lemoine, R. and Sauer, N. ( 2000) Sugar transporters in higher plants – a diversity of roles and complex regulation. Trends Plant Sci.  5: 283–290. Google Scholar Yu, J., Hu, S., Wang, J., Wong, G.K., Li, S., Liu, B., Deng, Y., Dai, L., Zhou, Y., Zhang, X., Cao, M., Liu, J., Sun, J., Tang, J., Chen, Y., Huang, X., Lin, W., Ye, C., Tong, W., Cong, L., Geng, J., Han, Y., Li, L., Li, W., Hu, G., Huang, X., Li, W., Li, J., Liu, Z., Li, L., Liu, J., Qi, Q., Liu, J., Li, L., Li, T., Wang, X., Lu, H., Wu, T., Zhu, M., Ni, P., Han, H., Dong, W., Ren, X., Feng, X., Cui, P., Li, X., Wang, H., Xu, X., Zhai, W., Xu, Z., Zhang, J., He, S., Zhang, J., Xu, J., Zhang, K., Zheng, X., Dong, J., Zeng, W., Tao, L., Ye, J., Tan, J., Ren, X., Chen, X., He, J., Liu, D., Tian, W., Tian, C., Xia, H., Bao, Q., Li, G., Gao, H., Cao, T., Wang, J., Zhao, W., Li, P., Chen, W., Wang, X., Zhang, Y., Hu, J., Wang, J., Liu, S., Yang, J., Zhang, G., Xiong, Y., Li, Z., Mao, L., Zhou, C., Zhu, Z., Chen, R., Hao, B., Zheng, W., Chen, S., Guo, W., Li, G., Liu, S., Tao, M., Wang, J., Zhu, L., Yuan, L. and Yang, H. ( 2002) A draft sequence of the rice genome (Oryzasativa L. ssp. indica). Science  296: 79–92. Google Scholar

Journal

Plant and Cell PhysiologyOxford University Press

Published: Mar 15, 2003

There are no references for this article.