Get 20M+ Full-Text Papers For Less Than $1.50/day. Subscribe now for You or Your Team.

Learn More →

Clostridium novyi-NT can cause regression of orthotopically implanted glioblastomas in rats

Clostridium novyi-NT can cause regression of orthotopically implanted glioblastomas in rats www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No.8 Clostridium novyi-NT can cause regression of orthotopically implanted glioblastomas in rats 1,* 1,* 1 1 Verena Staedtke , Ren-Yuan Bai , Weiyun Sun , Judy Huang , Kathleen Kazuko 3 1 1 2 2 Kibler , Betty M. Tyler , Gary L. Gallia , Kenneth Kinzler , Bert Vogelstein , Shibin 2 1 Zhou and Gregory J. Riggins Department of Neurology and Neurosurgery, Sidney Kimmel Cancer Center, Johns Hopkins University School of Medicine, Baltimore, MD, USA Department of Oncology, Sidney Kimmel Cancer Center, Johns Hopkins University School of Medicine, Baltimore, MD, USA Department of Pediatrics-Anesthesiology, Baylor College of Medicine, Houston, TX, USA These authors contributed equally to this work Correspondence to: Gregory J. Riggins, email: griggin1@jhmi.edu Keywords: Clostridium novyi-NT, bacterial therapy, glioblastoma multiforme, stroke Received: February 11, 2015 Accepted: February 12, 2015 Published: March 18, 2015 This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. AbstrAct Glioblastoma (GBM) is a highly aggressive primary brain tumor that is especially difficult to treat. The tumor’s ability to withstand hypoxia leads to enhanced cancer cell survival and therapy resistance, but also yields a microenvironment that is in many aspects unique within the human body, thus offering potential therapeutic opportunities. The spore-forming anaerobic bacterium Clostridium novyi-NT (C. novyi- NT) has the ability to propagate in tumor-generated hypoxia, leading to oncolysis. Here, we show that intravenously injected spores of C. novyi-NT led to dramatic tumor destructions and significant survival increases in implanted, intracranial syngeneic F98 and human xenograft 060919 rat GBM models. C. novyi-NT germination was specific and confined to the neoplasm, with sparing of the normal brain parenchyma. All animals tolerated the bacteriolytic treatment, but edema and increased intracranial pressure could quickly be lethal if not monitored and medically managed with hydration and antibiotics. These results provide pre-clinical data supporting the development of this therapeutic approach for the treatment of patients with GBM. surgical excision due to the tumor’s invasiveness as well IntroductIon as insufficient drug delivery to the remaining tumor cells [3]. Approximately 3% of all cancer deaths are attributed Unlike hematological cancers, most solid tumors and to primary brain tumors [1]. Among those, glioblastoma in particular GBM rapidly outgrow their vascular supply multiforme (GBM), a grade IV astrocytoma arising from and develop tumor hypoxia, complicating treatment with the glial tissue, is the most common (65%) and deadly traditional cancer therapies [4].The poor tumor vascular primary brain malignancy [1]. As the “multiforme” supply inevitably limits the delivery of systemically component implies, GBM exhibits large variability at the administered chemotherapeutic drugs and reduces the histopathological level, with extensive necrotic regions effectiveness of radiotherapy [5]. Tumor hypoxia has a intermixed with cell proliferation and infiltration [2]. central role in tumor metabolism, progression, metastasis, GBMs are one of the most difficult cancer types to treat, and immune evasion [4]. Though conceptually a promising with a 5-year survival rate of less than 5% [1]. This is target, a means to successfully utilize tumor hypoxia so despite >600 clinical trials and multi-mode treatments has not yet been achieved. Previous efforts focusing on that include surgical resection, local delivery of BCNU molecular targeting with small molecules has had only (Gliadel wafers), and concurrent chemoradiotherapy with limited success [6]. temozolomide (TMZ) followed by adjuvant TMZ. Reasons Another approach to exploit the hypoxic nature of for treatment failure are complex and include incomplete www.impactjournals.com/oncotarget 5536 Oncotarget the tumor environment involves anaerobic bacteria. The approach should be developed further. oncolytic ability of bacteria has been recognized since the early 1800s, as exemplified by the development of results Coley’s vaccine [7]. Various species of Clostridium, Salmonella, Escherichia, Bifidobacterium and Listeria have all been considered for this purpose [8]. One more I.V. injected C. novyi-nt spores increase survival recently recognized species is Clostridium novyi, which in rodent glioblastoma models in its therapeutic form is devoid of the lethal alpha toxin gene, termed C. novyi-NT [9]. C. novyi is a highly mobile, To assess the potential value of C. novyi-NT spore-forming bacterium that is exquisitely sensitive to bacteriolytic therapy for intracranial malignancies, we oxygen. As an obligate anerobe, vegetative forms cannot used two different rodent orthotopic GBM models. survive in oxygen and bacterial spores can only germinate Both models were highly invasive and known to form in hypoxic conditions [10]. Previous studies showed that intratumoral necrosis as well as hypoxia in rodents (Fig. a single dose of C. novyi-NT spores injected intravenously 1A-L), characteristics found in their human counterparts. in syngeneic tumor-bearing animals often led to localized The GBM neurosphere cell line 060919 was grown tumor necrosis and oncolysis, leading to cures in up to from a surgically resected GBM in serum-free media [13]. one-third of treated animals, without excessive toxicity 060916 cells were implanted intracranially and allowed to [11, 12]. grown until day 25 when the rats were injected with 3x10 In this work we show that treatment of GBM- C. novyi-NT spores via tail vein. Therapy with C. novyi- bearing animals with C. novyi-NT spores results in NT resulted in a significant overall survival improvement localized germination, tumor destruction and a significant and one long-term surviving rat of 10 that were treated survival benefit. These encouraging results suggest that the Figure 1: Histological characterization of the intracranial human xenograft 060919 and syngeneic rat F98 GbM models. 060919 and F98 GBM were collected, paraffin-embedded and sectioned for H&E, TUNEL and HIF-1α staining at 28 and 18 days after tumor implantation respectively. (A-D) Anatomical view and histology by H&E of 060919 GBM. Tumors are characterized by a highly invasive growth pattern invasion (black arrowhead; A, B), intratumoral hemorrhages (C), giant cells (green arrowhead; C) and necrotic regions intermixed with cell proliferation (D), closely resembling human disease. (E) TUNEL staining of 060919 GBM. (F) HIF-α staining of 060919 GBM. (G-J) Anatomical view and histology by H&E of syngeneic F98 GBM. Similar to the human 060919 xenograft, syngeneic F98 GBM are highly infiltrative (black arrowhead; G, H) with intratumoral hemorrhages (H), extensive areas of necrosis (I, J) and pseudopalisidation (J). (K) TUNEL staining of F98 GBM. (L) HIF-α staining of F98 GBM. Abbreviations: T: Tumor. N: Necrosis. H: Hemorrhage. B: Brain. Black arrowhead: invasions. Green arrowhead: giant cells. www.impactjournals.com/oncotarget 5537 Oncotarget (Fig. 2A). Bacterial germination began within 12 hours reduction, and fully recovered (Fig. 2E). Animals with after injection and was florid by 24 hours, as evidenced by ICPs of >45 mmHg did not respond to medical therapy the presence of many vegetative bacteria on histological and subsequently died. sections of the tumor. Successful tumor lysis was evident To determine whether these results could be by the dramatic decline in luciferase signal (>90%) in the reproduced in an immune-competent rodent model, first 48 hours and the rapid reduction of circulating human we used F98 cells that were originally produced by DNA, both of which served as indicators of tumor burden IV administration of N-ethyl-N-nitrosourea, a highly (Fig. 2B-D). potent mutagen, into pregnant Fisher F344 rats that are Commonly observed side effects of bacteriolytic refractory to a number of chemotherapeutics. Treatment therapy included lethargy, brain edema and increased of this aggressive intracerebral tumor with C. novyi- intracranial pressure (ICP). We found that increased NT significantly prolonged survival (Fig. 3A). Similar ICP was a major cause of death if not detected early to the 060919 model, a dramatic reduction in luciferase and treated aggressively with steroids and antibiotics. activity was present 48 hours after treatment compared Animals with ICPs ≤ 40 mmHg readily responded to to the untreated controls (Fig. 3B, C). However, tumor medical management, measured by an immediate ICP eradication was incomplete, particularly in the less Figure 2: C. novyi-nt increases survival in intracranial 060919 GbM xenograft model. (A) Kaplan-Meier curve of 060919 xenografts treated with a single dose of 3x10 IV injected C. novyi-NT spores at day 25. C. novyi-NT treatment increased survival by 26 days (a 90% increase) and for one animal treatment resulted in long-term survival. (B) Athymic rats implanted with 060919 cells expressing firefly luciferase were injected with 50 mg/kg luciferin and evaluated via Xenogen before and after the treatment with C. novyi-NT spores. Clostridial treatment led to a dramatic reduction in the luciferase signal (>90%) in the first 48 hours, which along with the h-LINE1 served as an indicator for a favorable treatment response. (C) Total luciferase counts of C. novyi-NT-treated and untreated animals are displayed. (D) Tumor burden was monitored via h-LINE1 content in the peripheral blood. A decrease in h-LINE1 or absence thereof correlated with decreased tumor burden and subsequent increased survival. (E) Intracranial 060919 glioblastoma-bearing athymic rats were monitored daily for changes in the intracranial pressure during bacteriolytic therapy using an intraventricular ICP measurement device. During bacteriolytic treatment ICP increased significantly and required medical treatment with steroids (10 mg/kg) and antibiotics (doxycycline 50 mg/kg). Animals with ICPs of ≤ 40 mmHg (*) responded well to medical management with a prompt ICP reduction and recovery, whereas animals with ICP values of >45 mmHg died (†). www.impactjournals.com/oncotarget 5538 Oncotarget hypoxic tumor rim, and tumors eventually regrew. combination with liposomal doxorubicin has Histological analysis of brain sections of both high- synergistic effects grade glioma models revealed that bacterial germination was precisely localized to the tumor and involved the Though the effect of C. novyi-NT treatment is tumor body as well as distant tumor satellites, while the dramatic, long-term survival is rarely achieved and normal brain parenchyma was unaffected (Fig. 4A, B, hence, a combination with other complementary D, E). Within tumors, vegetative bacterial distribution chemotherapeutic agents could prove useful. For was not random; it was strictly co-localized with TUNEL this purpose, we first determined the half-maximal positive tumor cells (red) (Fig. 4C, F). Importantly, inhibitory concentrations (IC ) of seven commonly used germination was not limited to the larger tumor mass and chemotherapeutic agents of F98 cells in vitro. The most extended to stem-like protrusions from the main tumor, potent proved to be doxorubicin, a DNA intercalating as well as microscopic distant tumor satellites and tumor substance, with an IC of 0.14μM (Fig. 5A). A liposomal vessels (Fig. 4B, E). Bacterial infection was accompanied formulation of doxorubicin (Lip-DXR) has previously by a striking accumulation of host inflammatory cells, been reported to enhance the anti-tumor efficacy of C. predominantly neutrophils at the periphery, presumably novyi-NT and may act as a depot for sustainable drug limiting bacterial spread (Fig. 4G, H). release [14]. In the syngeneic F98 GBM model, the combination of Lip-DXR and C. novyi-NT increased the survival modestly compared to C. novyi-NT alone (Fig. 5B). Tumors treated with C. novyi-NT spores plus Lip- Figure 3: C. novyi-nt increases survival in syngeneic intracranial F98 GbM model. (A) Kaplan-Meier curve of syngeneic F98 GBM bearing Fisher rats treated with a single dose of 3x10 IV injected C. novyi-NT spores at day 15. Bacterial treatment led to a 42% survival extension. (B) Fisher rats implanted with F98 cells expressing firefly luciferase were injected with 50mg/kg luciferin and evaluated via Xenogen before and after the treatment with C. novyi-NT spores. Similar to the results for 060919, we found a >90% reduction in the luciferase signal, an indicator for successful tumor lysis by C. novyi-NT. (C) Total luciferase counts of C. novyi-NT-treated and untreated animals are displayed. www.impactjournals.com/oncotarget 5539 Oncotarget 8 DXR had improved tumor clearance, as exemplified by Subsequently, 3x10 green-fluorescently labeled C. novyi- the lower number of viable tumor cells, particularly in the NT spores were injected into the tail vein and the animals periphery (Fig. 5C, D). observed for 5 days. Histopathological examination of the brains on day 5 demonstrated that, while the rats had large cerebral infarcts with extensive areas of necrosis, there C. novyi-NT germination is specific to tumor was no histopathological or molecular-biologic evidence generated hypoxia and necrosis of bacterial colonization within or surrounding the lesions. C. novyi-NT spores (but not germinated bacteria) To determine if C. novyi-NT germination is specific were found in the necrotic areas of the stroke, formally to tumor associated hypoxia and necrosis, we established demonstrating that the absence of bacterial germination a cerebral ischemic rat middle cerebral artery occlusion was not caused by the failure of spore delivery (Fig. 7A, stroke model. A large middle cerebral artery (MCA) B). infarct was created in normal athymic rats by transiently To prove that a sufficient degree of hypoxic injury occluding the MCA while ligating the right internal carotid was achieved in the stoke model, sections were stained artery for 2 hours, thereby decreasing MCA blood flow by with HIF-1α via immunofluorescence. HIF-1α is a key 70-90% (Fig. 6A, B). TTC and HIF-1α staining confirmed component of the cells’ response to hypoxia, and the the infarction and hypoxia in the brain (Fig. 6C). oxygen-labile HIF-1α protein is known to be induced in Figure 4: Micrographs of tumoral C. novyi-nt germination in human 060919 and syngeneic F98 GbM models. (A-C) Anatomical view and histology of 060919 GBM treated with C. novyi-NT. (B) Gram stained brain sections revealed that vegetative C. novyi–NT bacteria are precisely confined to the tumor (black arrowhead) and in satellite microinvasions of neoplastic cells (green arrowhead) but not in normal brain parenchyma. (C) Immunofluorescence staining for DAPI stained nuclei blue, TUNEL (red) and vegetative C. novyi-NT (green) in 060919 bearing rats were evaluated by confocal laser microscopy. C. novyi-NT co-localized with TUNEL positive tumor cells. (D-F) Anatomical view and histology of syngeneic F98 GBM treated with C. novyi-NT. (E) Similarly to 060919, vegetative C. novyi–NT bacteria are exclusively localized to the tumor (black arrowhead) as well as neoplastic vessels (green arrowhead). (F) C. novyi antibody stained vegetative bacteria were visualized in TUNEL positive tumor regions, but not in that of TUNEL negative cells. (G, H) C. novyi-NT induces a potent local host-inflammatory response in 060919 (G) and F98 (H) bearing animal. Brains were examined 24-48h after systemic injection of C. novyi-NT. A ring of leukocytes, stained by CD45, surrounded the tumor and restrained the infection (C. novyi-NT in green). DAPI is shown in blue. Abbreviations: S: Satellite microinvasions. V: Neoplastic vessel. www.impactjournals.com/oncotarget 5540 Oncotarget Figure 5: combination of C. novyi-nt with liposomal doxorubicin improves the clearance of the tumor rim in syngeneic F98 GbM model. (A) The half-maximal inhibitory concentrations (IC ) levels of seven chemotherapeutics including temozolomide (TMZ) in F98 cells are shown. Doxorubicin appears to be superior with an IC of 0.14 μM. (B) Kaplan-Meier survival curve of F98 GBM treated with a combination of Lip-DXR (5 mg/kg) and C. novyi-NT spores. The addition of Lip-DXR extended the survival by 10% compared to C. novyi-NT alone. Lip-DXR alone had no effect on the survival. (C, D) H&E and gram staining of the brain sections. Histologic examination revealed that rats undergoing combination therapy with C. novyi-NT spores plus Lip-DXR had lower amounts of remaining viable tumor seen on H&E sections (D) when compared to C. novyi-NT alone where larger portions of viable tumor (T) were noted, particularly in the periphery as indicated in the sections (C). Figure 6: The intraluminal filament rat MCAO stroke model. (A) Structural diagram of the vascular structures in the rat brain. The monofilament was inserted into the internal carotid artery (ICA) and advanced to the origin of the MCA, as indicated by the thick red line. This resulted in an ischemic infarction in the MCA territory (grey line). (B) Photograph taking during MCAO microsurgery showing the placement of the 4-0 nylon filament. (C) Representative coronal brain slices were taken 24 h after focal ischemia. The ischemic brain is shown on the left: TTC-stained white color indicates the infarct lesion, and red color represents normal tissue. As a comparison, the normal brain (right) did not have any white regions upon TTC staining. Following, H&E staining of the same brain illustrated the pattern of ischemic damage. There was massive immunoreactivity for HIF-1α, a marker for hypoxia, in cells of the infarcted region. There was no immunoreactivity to HIF-1α in normal brain tissue (right). www.impactjournals.com/oncotarget 5541 Oncotarget the central nervous system after focal ischemia caused by opportunity. Anaerobic bacteria have evolved to thrive in tumors or strokes [15]. The numbers of HIF-1α positive the hypoxic environment and fortuitously some possess cells in the necrotic regions of tumors and strokes were several key features that make them ideal anti-tumor similar, while bacterial germination was only evident in agents [8]. The toxin-deleted strain C. novyi-NT appears the tumors (Fig. 7A). to be particularly promising because: 1) bacteria germinate specifically in tumor-generated hypoxia but not in hypoxia generated by stroke (Fig. 6) or myocardial infarctions dIscussIon [12], (2) cytotoxicity is limited to the tumor while sparing adjacent normal tissues, and (3) vegetative C. novyi-NT Despite progress in the understanding, diagnosis and are highly mobile, rapidly infecting the entire tumor. A therapy of brain cancers, GBM remains a lethal disease. single intravenous injection of C. novyi-NT spores into Complete surgical excision is nearly always impossible glioma-bearing rats resulted in florid germination C. as a result of local infiltration and anatomical limitations, novyi-NT’s tumor-specificity is probably a result of the thus leading inevitably to tumor relapse [16]. Attempts fact that hypoxia-driven necrosis in cancers may generate to target common genetic defects in GBM have failed to a steeper oxygen pressure gradient (dynamic hypoxia) provide long-term survival and have not replaced non- compared to infarcted tissues (static hypoxia) with higher targeted approaches with chemotherapy and radiation oxygen pressures [18]. [17]. Here, we investigated if spore-forming bacterium Although the blood–brain barrier (BBB) normally C. novyi-NT targeting the cancer’s hypoxia might be protects the central nervous system from invading technically feasible and beneficial in preclinical models microorganisms, brain tumors or other inflammatory of GBM. conditions can compromise its integrity and result in Hypoxia is a critical aspect of glioblastoma biology local breakdown of the BBB. This along with the fragile and the development of resistance to chemotherapy and and leaky tumor vasculature manifesting in intratumoral radiotherapy [4]. Though this hypoxic state represents a hemorrhages can favor C. novyi-NT spore accumulation in major therapeutic challenge, it also provides a potential Figure 7: C. novyi-nt germinates in tumor hypoxia but not in non-malignant hypoxic tissue. (A) Shown are sections of a brain with an ischemic stroke (left) and a F98 rat glioma (right). Both lesions, the stroke and brain tumor, have strong immunoreactivity for HIF-1α (red). However, despite the presence of C. novyi-NT spores (green, white arrow) in areas of the ischemic infarct, they did not germinate, as indicated by the absence of green staining. Spores in tumoral hypoxia were able to germinate (green) and co-localized with hypoxia- positive tumor cells. DAPI is shown in blue. (B) Consistent with the immunofluorescent data, PCR confirmed that vegetative bacteria were only present in the glioma but not in the infarct, although C. novyi-NT spores were found in both lesions. www.impactjournals.com/oncotarget 5542 Oncotarget the brain tumor bed. In addition, systemically administered basic fibroblast growth factor (PeproTech), and 4 μg/mL C. novyi-NT spores could use the ‘Trojan horse’ method of heparin (Stem Cell Technologies). Rat F98 glioma cell line entry by traveling in leukocytes. In this scenario C. novyi- was maintained in Dulbecco’s Modified Eagle Medium NT spores are ingested by leukocytes where they remain (DMEM) supplemented with 10% fetal bovine serum dormant and once the infected leukocytes pass through (FBS) and antibiotics. Both cell lines, 060910 and F98, the BBB, the spores escape as shown with Clostridium were transfected with a luciferase construct via lentivirus difficile [19]. (0609191-luc, F98-luc). With the advances in synthetic biology, there is a renewed interest in bacterial therapies for cancer [8]. brain tumor models Though the use of an attenuated strain of C. novyi (i.e., C. novyi-NT) reduces treatment-related toxicity, safety 6-week-old female F344 Fisher rats (weight 100- remains the major hurdle in clinical use [20]. In our study, 150 gram) and athymic nude rats were purchased from the majority of rats treated with C. novyi-NT developed the National Cancer Institute (Bethesda, MD). For lethargy and signs of increased intracranial pressure due the implantation procedure, rats were anesthetized via to local inflammation-driven edema that were medically intraperitoneal (i.p) injection composed of ketamine manageable with the use of steroids and antibiotics, hydrochloride (75 mg/kg; 100 mg/mL; ketamine HCl; but the dangers of treating rats with intracranial tumors Abbot Laboratories), xylazine (7.5 mg/kg; 100 mg/ were evident. Similar observations were made by Diaz mL; Xyla-ject; Phoenix Pharmaceutical), and ethanol using tumor-bearing mice and rabbits, where edema and (14.25%) in a sterile 0.9% NaCl solution. Following, reversible inflammatory changes in the spleen, liver and 500,000 human GBM 060919 neurosphere cells infected adrenal glands were observed during spore treatment [12]. with luciferase lentivirus were stereotactically implanted Most recently, Roberts reported a study in which ten pet into the right frontal lobe located 3 mm lateral and 2 dogs with spontaneous soft-tissue sarcomas treated with mm anterior to the bregma of athymic rats as previously intratumoral injections of C. novyi-NT spores developed described [23]. 20,000 F98-luc cells were stereotactically local edema and abscesses that required antibiotics or implanted into F344 Fisher rats using the same parameters. surgical excision of the infected tissues [21]. The tumors were allowed to grow until day 25 (060919) Truly effective cancer therapy will indubitably or 15 (F98), when 3x10 C. novyi-NT spores, produced require a combination of multiple treatment modalities. as previously described [9], were injected into the tail Intravenous administration of C. novyi-NT enhances the vein. In addition, a subset of animals received liposomal effect of chemotherapy, particularly of hypoxia-enhancing doxorubicin (Doxil, Lip-DXR, Janssen, Titusville, NJ), 5 agents, and radiation [11]. Consistent with those data, mg/kg i.p. at the time of spore injection. Pre- and post- treatment with C. novyi-NT and liposomal doxorubicin treatment tumor sizes were assessed with a Xenogen resulted in a slightly increased survival benefit due to instrument after intraperitoneal injection of 50mg/ enhanced cytotoxicity [14]. It could also be valuable to kg D-luciferin potassium salt per rat. During the first combine C. novyi-NT with immune-checkpoint inhibitors. two days of bacterial therapy, rats were placed on 10 It has been demonstrated that long-term response to mg/kg/day dexamethasone i.p. to minimize the risk of C. novyi-NT involves an immunologic T-cell based postoperative edema. Control rats were stereotactically recognition that likely includes tumor antigens [22]. injected with the same volume of phosphate-buffered In summary, bacteriolytic therapy with the anaerobic saline (PBS) and treated with dexamethasone (10 mg/ spore forming bacterium C. novyi-NT is capable of kg per day) for the first 2 days. Animals were observed precisely localizing to tumors and mediating robust daily for any signs of deterioration, lethargy, neurotoxicity, tumoricidal activity with manageable side effects in two or pain in accordance with the Johns Hopkins Animal highly aggressive GBM models. The results provide a Care and Use Guidelines. If symptoms of distress were rationale for continuing to develop this approach for present, supportive therapy with hydration and antibiotic potential application in humans. metronidazole (loading dose of 15 mg/kg i.p. followed by 10 mg/kg every 12 hours as maintenance) was initiated MAterIAls And MetHods and continued for a 7-day period. If symptoms persisted and/or resulted in debilitation, moribund animals were euthanized according to protocol. The anti-tumor efficacy cell lines and tissue culture of C. novyi-NT treatment was assessed with Kaplan- Meier survival curves, Xenogen results, and the degree of tumor burden on post-mortem brain sections. For the Human GBM neurosphere line 060919 was grown latter purpose, brains were harvested post-mortem, placed in NeuroCult NS-A basal medium containing NeuroCult in formalin, and embedded in paraffin for additional NS-A proliferation supplements (Stem Cell Technologies), pathological studies. Gram-stained slides, counter-stained 20 ng/mL epidermal growth factor (PeproTech), 10 ng/mL with safranin, and H&E-slides were prepared according to www.impactjournals.com/oncotarget 5543 Oncotarget routine histopathologic practices. First-strand cDNA was synthesized from total RNA using random oligonucleotides as primers and the SuperScript First-Strand Synthesis System (Invitrogen). Synthesized Intracranial Pressure (IcP) measurement cDNA was then used for a nested PCR to detect C. novyi-NT’s growth phase specific genes. The first run Intracranial pressure was measured with an used primer pair (CCATAGCAATAAATCTTCCCTC intraventricular catheter in athymic nude rats. In brief, a and CATCTAAGCTTGAAACGTGTAG) targeting burrhole was drilled 1 mm posterior and 1 mm lateral to NT01CX2304, an indicator for vegetative bacteria, as the bregma. Subsequently, a 2.5 mm long probe modified well as primer pair (GCTAGTAAATGTGGATTTACTCC from a G20 needle by shortening the shaft and removing and ATTTCAGATGGTTCTGTGGTAG) targeting the plastic adaptor was inserted into the right lateral NT01CX2376, a marker for spores [16]. In the second ventricle and glued to the skull. For measurements, a PE10 run primer pair (CTCTTAATACCTCTTTCCCTTC and catheter was attached to the G20 needle, flashed with GTGTTTGTCATATGCTACTTCC) for NT01CX2304 normal saline and connected with a Life Scope 6 pressure and (CCTGGTAGTAACTCTGAAGTTA and monitor (Nihon Kohden Corporation). The monitor was GTGGTAGGTTCAAATCTACCAA) for NT01CX2376 reset to zero before attaching to the probe. were used. All PCR products were checked in 1.5% (wt/ vol) agarose electrophoresis with 1× Tris-borate-EDTA Stroke model (TBE) buffer, stained with ethidium bromide (0.2 μg/mL). DNA bands were detected under UV light. The intraluminal filament model of middle cerebral Human LINE-1 (hLINE-1) quantification artery occlusion (MCAO) was used to induce focal ischemic injury to the brain in athymic nude rats [24]. Briefly, after anesthetization a laser-Doppler flow (LDF) hLINE-1 was quantified in the blood from tumor- probe was placed on the skull of the nude rat to monitor bearing athymic nude rats to monitor the tumor burden the perfusion. To induce a right-sided ischemic stroke, the as described [27]. Briefly, approximately 50 µl of blood right common carotid artery (CCA) was exposed through were collected at various time points and DNA was a submandibular midline incision. Then, the proximal purified according to the instructions of the Qiagen DNA end of the CCA was temporarily ligated and a 4-0 nylon purification kit (Qiagen, Valencia, CA). Quantitative PCR monofilament was inserted into the internal carotid artery employed 0.5 μL of 10 μmol/L forward primer FWD (ICA) and advanced past the CCA bifurcation to the 5′-TCACTCAAAGCCGCTCAACTAC-3′ (IDT DNA; origin of the MCA. After two hours, reperfusion of the desalted, 25 nmol scale), 0.5 μL of 10 μmol/L reverse right MCA was achieved by withdrawal of the filament primer REV 5′-TCTGCCTTCATTTCGTTATGTACC-3′ and release of the CCA ligature. Animals were allowed (IDT DNA; desalted, 25 nmol scale) and the following to recover for 24 hours before 3x10 FITC-fluorescent cycling conditions (iCycler, Biorad): (94°C, 2 min) × 1, C. novyi-NT spores, produced as described by Diaz [12], (94°C, 10 s; 67°C, 15 s; 70°C, 15 s) × 3, (94°C, 10 s; were injected into the tail vein. Animals were sacrificed 64°C, 15 s; 70°C, 15 s) × 3, (94°C, 10 s; 61°C, 15 s; 70°C, after 5 days. Post-mortem, brains were removed and 15 s) × 3, (94°C, 10 s; 59°C, 15 s; 70°C, 15 s) × 35. incubated with 2,3,5-triphenyltetrazolium chloride (TTC) for 30 minutes to visualize the hypoxic areas as described Histological staining [25]. Additionally, brains were embedded in paraffin for further histological analyses. Post-mortem brains were fixed with 10% buffered formalin and paraffin-embedded. For histological analysis, nested Pcr for detection of vegetative forms of sections were deparaffinized with xylene, and rehydrated c. novyi-nt from brains in a graded ethanol series. 75 mg of fresh lesional brain tissue was harvested tunel staining from sacrificed animals with strokes or GBM. The preparation of the tissue followed previous reports by TdT-mediated dUTP nick end labeling was Bettegowda [26]. RNA was prepared by homogenization performed using the DeadEnd™ TUNEL system, of the dissected tissue in a glass homogenizer containing according to the manufacturer’s instructions (Promega, a ten-fold volume of ice-cold RNAwiz buffer (Ambion) Madison, WI). followed by 12-cycle homogenization with Zirconia beads (Biospec) for 10 min at 4 °C to ensure disruption of the spores. RNA was isolated using the RNA Total Kit (Promega) and quantified with a UV spectrophotometer. www.impactjournals.com/oncotarget 5544 Oncotarget tumors,” issued 24 December 2013 (K.W.K., B.V.). The Immunohistochemistry/Immunofluorescence other authors declare no competing interests. Immunohistochemical and immunofluorescence Author contributions experiments were carried out as previously described [28]. Briefly, non-specific binding sites were blocked by incubation with 10% goat serum in PBS for 1 h at room V.S., R-Y.B., G.J.R., K.W.K., B.V., and S.Z. temperature. The following primary antibodies were designed the study. V.S., R-Y.B., J.H., W.S., K.K.K., used: HIF-1 alpha (Abcam), CD45 (Abcam), C. novyi- and B.M.T. generated data. V.S., R-Y.B., G.J.R., G.L.G., NT antibody [22]. Omission of the primary antibody K.W.K., B.V., and S.Z. analyzed data. V.S., R-Y.B., served as the negative control. For immunohistochemical B.V. and G.J.R. wrote the draft manuscript. All authors detection, HRP-linked anti-rabbit or anti-mouse approved the final manuscript. secondary antibodies were used (EnVision™ kit, DAKO). Visualization with DAB was performed according to reFerences the manufacturer’s instructions (DAKO, Carpinteria, CA). For immunofluorescence detection the following 1. Dolecek TA, Propp JM, Stroup NE, & Kruchko C. secondary antibodies were applied: anti-rabbit Alexa CBTRUS statistical report: primary brain and central 488 or anti-mouse Alexa 594 (Invitrogen). Sections were nervous system tumors diagnosed in the United States in counterstained with 4′,6-diamidino-2-phenylindole (DAPI, 2005-2009. Neuro-oncology. 2012; 14 Suppl 5:v1-49. Vector Laboratories), and examined under the microscope. 2. Bai RY, Staedtke V, & Riggins GJ. Molecular targeting of glioblastoma: Drug discovery and therapies. Trends in statistical analysis molecular medicine. 2011; 17(6):301-312. 3. Tanaka S, Louis DN, Curry WT, Batchelor TT, & Dietrich Results are presented as a mean value ± standard J. Diagnostic and therapeutic avenues for glioblastoma: deviation. P values were determined by a Mantel-Cox no longer a dead end? Nature reviews. Clinical oncology. test and P values < 0.05 were deemed as statistically 2013; 10(1):14-26. significant. Data were analyzed by GraphPad Prism, 4. Bertout JA, Patel SA, & Simon MC. The impact of O2 version 5.0. availability on human cancer. Nature reviews. Cancer. 2008; 8(12):967-975. FundInG 5. Horsman MR, Mortensen LS, Petersen JB, Busk M, & Overgaard J. Imaging hypoxia to improve radiotherapy This work was supported by BioMed Valley outcome. Nature reviews. Clinical oncology. 2012; Discoveries Inc., Children’s Cancer Foundation (CCF), 9(12):674-687. the Virginia and D.K. Ludwig Fund for Cancer Research, 6. Wilson WR & Hay MP. Targeting hypoxia in cancer Voices Against Brain Cancer, NIH CA062924 (S.Z.), and therapy. Nature reviews. Cancer. 2011; 11(6):393-410. National Institute of Neurological Disorders and Stroke 7. Coley WB. The Treatment of Inoperable Sarcoma by R25NS065729 (V.S.). Bacterial Toxins (the Mixed Toxins of the Streptococcus erysipelas and the Bacillus prodigiosus). Proceedings of the conFlIcts oF Interest Royal Society of Medicine. 1910; 3(Surg Sect):1-48. 8. Forbes NS. Engineering the perfect (bacterial) cancer Under a licensing agreement between BioMed therapy. Nature reviews. Cancer. 2010; 10(11):785-794. Valley Discoveries Inc. and the Johns Hopkins University, 9. Dang LH, Bettegowda C, Huso DL, Kinzler KW, & K.W.K., B.V., and S.Z. are entitled to a share of royalties Vogelstein B. Combination bacteriolytic therapy for the received by the University on sales of products described treatment of experimental tumors. Proceedings of the in this article. Patents related to this work: WO2005039491 National Academy of Sciences of the United States of A3 “Certain improved combination bacteriolytic therapy America. 2001; 98(26):15155-15160. for the treatment of tumors,” issued 23 June 2005 (K.W.K., 10. Wells CL & Wilkins TD. Clostridia: Sporeforming B.V.); US20110311500 A1 “Improved combination Anaerobic Bacilli. Medical Microbiology, ed Baron bacteriolytic therapy for the treatment of tumors,” issued SGalveston (TX), 4th Ed. 1996. 30 June 2005 (K.W.K., B.V.); US8007782 B2 “Using 11. Dang LH, Bettegowda C, Agrawal N, Cheong I, Huso D, spores of anaerobic bacteria and microtubule stabilization Frost P, Loganzo F, Greenberger L, Barkoczy J, Pettit GR, antitumor agents; destroying tumors,” issued 30 August Smith AB 3rd, Gurulingappa H, Khan S, et al. Targeting 2011 (K.W.K., B.V.); US20110250258 “Tumor-specific vascular and avascular compartments of tumors with C. delivery of therapeutic agents via liposomase,” issued 13 novyi-NT and anti-microtubule agents. Cancer biology & October 2011 (K.W.K., B.V., and S.Z.); US8613917 B2 therapy. 2004; 3(3):326-337. “Combination bacteriolytic therapy for the treatment of www.impactjournals.com/oncotarget 5545 Oncotarget 12. Diaz LA, Jr., Cheong I, Foss CA, Zhang X, Peters BA, 24. Huang J, Kim LJ, Poisik A, Pinsky DJ, Connolly ES Jr. Agrawal N, Bettegowda C, Karim B, Liu G, Khan K, Huang Titration of postischemic cerebral hypoperfusion by X, Kohli M, Dang LH, et al. Pharmacologic and toxicologic variation of ischemic severity in a murine model of stroke. evaluation of C. novyi-NT spores. Toxicological sciences: Neurosurgery. 1999; 45(2):328-33. an official journal of the Society of Toxicology. 2005; 25. Popp A, Jaenisch N, Witte OW, & Frahm C. Identification 88(2):562-575. of ischemic regions in a rat model of stroke. PloS one. 13. Siu IM, Tyler BM, Chen JX, Eberhart CG, Thomale UW, 2009; 4(3):e4764. Olivi A, Jallo GI, Riggins GJ, Gallia GL. Establishment 26. Bettegowda C, Huang X, Lin J, Cheong I, Kohli M, Szabo of a human glioblastoma stemlike brainstem rodent tumor SA, Zhang X, Diaz LA Jr, Velculescu VE, Parmigiani model. Journal of neurosurgery: Pediatrics. 2010; 6(1):92- G, Kinzler KW, Vogelstein B, Zhou S. The genome and transcriptomes of the anti-tumor agent Clostridium novyi- 14. Cheong I, Huang X, Bettegowda C, Diaz LA Jr, Kinzler NT. Nature biotechnology. 2006; 24(12):1573-1580. KW, Zhou S, Vogelstein B. A bacterial protein enhances 27. Rago C, Huso DL, Diehl F, Karim B, Liu G, Papadopoulos the release and efficacy of liposomal cancer drugs. Science. N, Samuels Y, Velculescu VE, Vogelstein B, Kinzler KW, 2006; 314(5803):1308-1311. Diaz LA Jr. Serial assessment of human tumor burdens in 15. Sharp FR & Bernaudin M. HIF1 and oxygen sensing in the mice by the analysis of circulating DNA. Cancer research. brain. Nature reviews. Neuroscience. 2004; 5(6):437-448. 2007; 67(19):9364-9370. 16. Lacroix M, Abi-Said D, Fourney DR, Gokaslan ZL, Shi 28. Bai RY, Staedtke V, Lidov HG, Eberhart CG, & Riggins W, DeMonte F, Lang FF, McCutcheon IE, Hassenbusch GJ. OTX2 represses myogenic and neuronal differentiation SJ, Holland E, Hess K, Michael C, Miller D, et al. A in medulloblastoma cells. Cancer research. 2012; multivariate analysis of 416 patients with glioblastoma 72(22):5988-6001. multiforme: prognosis, extent of resection, and survival. Journal of neurosurgery. 2001; 95(2):190-198. 17. Garraway LA & Janne PA. Circumventing cancer drug resistance in the era of personalized medicine. Cancer discovery. 2012; 2(3):214-226. 18. Linkermann A, Stockwell BR, Krautwald S, & Anders HJ. Regulated cell death and inflammation: an auto- amplification loop causes organ failure. Nature reviews. Immunology. 2014; 14(11):759-767. 19. Paredes-Sabja D, Cofre-Araneda G, Brito-Silva C, Pizarro- Guajardo M, Sarker MR. Clostridium difficile spore- macrophage interactions: spore survival. PLoS one. 2012; 7(8):e43635. 20. Bette P, Frevert J, Mauler F, Suttorp N, & Habermann E. Pharmacological and biochemical studies of cytotoxicity of Clostridium novyi type A alpha-toxin. Infection and immunity. 1989; 57(8):2507-2513. 21. Roberts NJ, Zhang L, Janku F, Collins A, Bai RY, Staedtke V, Rusk AW, Tung D, Miller M, Roix J, Khanna KV, Murthy R, Benjamin RS, et al. Intratumoral injection of Clostridium novyi-NT spores induces antitumor responses. Science translational medicine. 2014; 6(249):249ra111. 22. Agrawal N, Bettegowda C, Cheong I, Geschwind JF, Drake CG, Hipkiss EL, Tatsumi M, Dang LH, Diaz LA Jr, Pomper M, Abusedera M, Wahl RL, Kinzler KW, et al. Bacteriolytic therapy can generate a potent immune response against experimental tumors. Proceedings of the National Academy of Sciences of the United States of America. 2004; 101(42):15172-15177. 23. Bai RY, Staedtke V, Aprhys CM, Gallia GL, & Riggins GJ. Antiparasitic mebendazole shows survival benefit in 2 preclinical models of glioblastoma multiforme. Neuro- oncology. 2011; 13(9):974-982. www.impactjournals.com/oncotarget 5546 Oncotarget http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Oncotarget Pubmed Central

Clostridium novyi-NT can cause regression of orthotopically implanted glioblastomas in rats

Loading next page...
 
/lp/pubmed-central/clostridium-novyi-nt-can-cause-regression-of-orthotopically-implanted-BWH0dewFgu

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Pubmed Central
Copyright
Copyright: © 2015 Staedtke et al.
eISSN
1949-2553
Publisher site
See Article on Publisher Site

Abstract

www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No.8 Clostridium novyi-NT can cause regression of orthotopically implanted glioblastomas in rats 1,* 1,* 1 1 Verena Staedtke , Ren-Yuan Bai , Weiyun Sun , Judy Huang , Kathleen Kazuko 3 1 1 2 2 Kibler , Betty M. Tyler , Gary L. Gallia , Kenneth Kinzler , Bert Vogelstein , Shibin 2 1 Zhou and Gregory J. Riggins Department of Neurology and Neurosurgery, Sidney Kimmel Cancer Center, Johns Hopkins University School of Medicine, Baltimore, MD, USA Department of Oncology, Sidney Kimmel Cancer Center, Johns Hopkins University School of Medicine, Baltimore, MD, USA Department of Pediatrics-Anesthesiology, Baylor College of Medicine, Houston, TX, USA These authors contributed equally to this work Correspondence to: Gregory J. Riggins, email: griggin1@jhmi.edu Keywords: Clostridium novyi-NT, bacterial therapy, glioblastoma multiforme, stroke Received: February 11, 2015 Accepted: February 12, 2015 Published: March 18, 2015 This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. AbstrAct Glioblastoma (GBM) is a highly aggressive primary brain tumor that is especially difficult to treat. The tumor’s ability to withstand hypoxia leads to enhanced cancer cell survival and therapy resistance, but also yields a microenvironment that is in many aspects unique within the human body, thus offering potential therapeutic opportunities. The spore-forming anaerobic bacterium Clostridium novyi-NT (C. novyi- NT) has the ability to propagate in tumor-generated hypoxia, leading to oncolysis. Here, we show that intravenously injected spores of C. novyi-NT led to dramatic tumor destructions and significant survival increases in implanted, intracranial syngeneic F98 and human xenograft 060919 rat GBM models. C. novyi-NT germination was specific and confined to the neoplasm, with sparing of the normal brain parenchyma. All animals tolerated the bacteriolytic treatment, but edema and increased intracranial pressure could quickly be lethal if not monitored and medically managed with hydration and antibiotics. These results provide pre-clinical data supporting the development of this therapeutic approach for the treatment of patients with GBM. surgical excision due to the tumor’s invasiveness as well IntroductIon as insufficient drug delivery to the remaining tumor cells [3]. Approximately 3% of all cancer deaths are attributed Unlike hematological cancers, most solid tumors and to primary brain tumors [1]. Among those, glioblastoma in particular GBM rapidly outgrow their vascular supply multiforme (GBM), a grade IV astrocytoma arising from and develop tumor hypoxia, complicating treatment with the glial tissue, is the most common (65%) and deadly traditional cancer therapies [4].The poor tumor vascular primary brain malignancy [1]. As the “multiforme” supply inevitably limits the delivery of systemically component implies, GBM exhibits large variability at the administered chemotherapeutic drugs and reduces the histopathological level, with extensive necrotic regions effectiveness of radiotherapy [5]. Tumor hypoxia has a intermixed with cell proliferation and infiltration [2]. central role in tumor metabolism, progression, metastasis, GBMs are one of the most difficult cancer types to treat, and immune evasion [4]. Though conceptually a promising with a 5-year survival rate of less than 5% [1]. This is target, a means to successfully utilize tumor hypoxia so despite >600 clinical trials and multi-mode treatments has not yet been achieved. Previous efforts focusing on that include surgical resection, local delivery of BCNU molecular targeting with small molecules has had only (Gliadel wafers), and concurrent chemoradiotherapy with limited success [6]. temozolomide (TMZ) followed by adjuvant TMZ. Reasons Another approach to exploit the hypoxic nature of for treatment failure are complex and include incomplete www.impactjournals.com/oncotarget 5536 Oncotarget the tumor environment involves anaerobic bacteria. The approach should be developed further. oncolytic ability of bacteria has been recognized since the early 1800s, as exemplified by the development of results Coley’s vaccine [7]. Various species of Clostridium, Salmonella, Escherichia, Bifidobacterium and Listeria have all been considered for this purpose [8]. One more I.V. injected C. novyi-nt spores increase survival recently recognized species is Clostridium novyi, which in rodent glioblastoma models in its therapeutic form is devoid of the lethal alpha toxin gene, termed C. novyi-NT [9]. C. novyi is a highly mobile, To assess the potential value of C. novyi-NT spore-forming bacterium that is exquisitely sensitive to bacteriolytic therapy for intracranial malignancies, we oxygen. As an obligate anerobe, vegetative forms cannot used two different rodent orthotopic GBM models. survive in oxygen and bacterial spores can only germinate Both models were highly invasive and known to form in hypoxic conditions [10]. Previous studies showed that intratumoral necrosis as well as hypoxia in rodents (Fig. a single dose of C. novyi-NT spores injected intravenously 1A-L), characteristics found in their human counterparts. in syngeneic tumor-bearing animals often led to localized The GBM neurosphere cell line 060919 was grown tumor necrosis and oncolysis, leading to cures in up to from a surgically resected GBM in serum-free media [13]. one-third of treated animals, without excessive toxicity 060916 cells were implanted intracranially and allowed to [11, 12]. grown until day 25 when the rats were injected with 3x10 In this work we show that treatment of GBM- C. novyi-NT spores via tail vein. Therapy with C. novyi- bearing animals with C. novyi-NT spores results in NT resulted in a significant overall survival improvement localized germination, tumor destruction and a significant and one long-term surviving rat of 10 that were treated survival benefit. These encouraging results suggest that the Figure 1: Histological characterization of the intracranial human xenograft 060919 and syngeneic rat F98 GbM models. 060919 and F98 GBM were collected, paraffin-embedded and sectioned for H&E, TUNEL and HIF-1α staining at 28 and 18 days after tumor implantation respectively. (A-D) Anatomical view and histology by H&E of 060919 GBM. Tumors are characterized by a highly invasive growth pattern invasion (black arrowhead; A, B), intratumoral hemorrhages (C), giant cells (green arrowhead; C) and necrotic regions intermixed with cell proliferation (D), closely resembling human disease. (E) TUNEL staining of 060919 GBM. (F) HIF-α staining of 060919 GBM. (G-J) Anatomical view and histology by H&E of syngeneic F98 GBM. Similar to the human 060919 xenograft, syngeneic F98 GBM are highly infiltrative (black arrowhead; G, H) with intratumoral hemorrhages (H), extensive areas of necrosis (I, J) and pseudopalisidation (J). (K) TUNEL staining of F98 GBM. (L) HIF-α staining of F98 GBM. Abbreviations: T: Tumor. N: Necrosis. H: Hemorrhage. B: Brain. Black arrowhead: invasions. Green arrowhead: giant cells. www.impactjournals.com/oncotarget 5537 Oncotarget (Fig. 2A). Bacterial germination began within 12 hours reduction, and fully recovered (Fig. 2E). Animals with after injection and was florid by 24 hours, as evidenced by ICPs of >45 mmHg did not respond to medical therapy the presence of many vegetative bacteria on histological and subsequently died. sections of the tumor. Successful tumor lysis was evident To determine whether these results could be by the dramatic decline in luciferase signal (>90%) in the reproduced in an immune-competent rodent model, first 48 hours and the rapid reduction of circulating human we used F98 cells that were originally produced by DNA, both of which served as indicators of tumor burden IV administration of N-ethyl-N-nitrosourea, a highly (Fig. 2B-D). potent mutagen, into pregnant Fisher F344 rats that are Commonly observed side effects of bacteriolytic refractory to a number of chemotherapeutics. Treatment therapy included lethargy, brain edema and increased of this aggressive intracerebral tumor with C. novyi- intracranial pressure (ICP). We found that increased NT significantly prolonged survival (Fig. 3A). Similar ICP was a major cause of death if not detected early to the 060919 model, a dramatic reduction in luciferase and treated aggressively with steroids and antibiotics. activity was present 48 hours after treatment compared Animals with ICPs ≤ 40 mmHg readily responded to to the untreated controls (Fig. 3B, C). However, tumor medical management, measured by an immediate ICP eradication was incomplete, particularly in the less Figure 2: C. novyi-nt increases survival in intracranial 060919 GbM xenograft model. (A) Kaplan-Meier curve of 060919 xenografts treated with a single dose of 3x10 IV injected C. novyi-NT spores at day 25. C. novyi-NT treatment increased survival by 26 days (a 90% increase) and for one animal treatment resulted in long-term survival. (B) Athymic rats implanted with 060919 cells expressing firefly luciferase were injected with 50 mg/kg luciferin and evaluated via Xenogen before and after the treatment with C. novyi-NT spores. Clostridial treatment led to a dramatic reduction in the luciferase signal (>90%) in the first 48 hours, which along with the h-LINE1 served as an indicator for a favorable treatment response. (C) Total luciferase counts of C. novyi-NT-treated and untreated animals are displayed. (D) Tumor burden was monitored via h-LINE1 content in the peripheral blood. A decrease in h-LINE1 or absence thereof correlated with decreased tumor burden and subsequent increased survival. (E) Intracranial 060919 glioblastoma-bearing athymic rats were monitored daily for changes in the intracranial pressure during bacteriolytic therapy using an intraventricular ICP measurement device. During bacteriolytic treatment ICP increased significantly and required medical treatment with steroids (10 mg/kg) and antibiotics (doxycycline 50 mg/kg). Animals with ICPs of ≤ 40 mmHg (*) responded well to medical management with a prompt ICP reduction and recovery, whereas animals with ICP values of >45 mmHg died (†). www.impactjournals.com/oncotarget 5538 Oncotarget hypoxic tumor rim, and tumors eventually regrew. combination with liposomal doxorubicin has Histological analysis of brain sections of both high- synergistic effects grade glioma models revealed that bacterial germination was precisely localized to the tumor and involved the Though the effect of C. novyi-NT treatment is tumor body as well as distant tumor satellites, while the dramatic, long-term survival is rarely achieved and normal brain parenchyma was unaffected (Fig. 4A, B, hence, a combination with other complementary D, E). Within tumors, vegetative bacterial distribution chemotherapeutic agents could prove useful. For was not random; it was strictly co-localized with TUNEL this purpose, we first determined the half-maximal positive tumor cells (red) (Fig. 4C, F). Importantly, inhibitory concentrations (IC ) of seven commonly used germination was not limited to the larger tumor mass and chemotherapeutic agents of F98 cells in vitro. The most extended to stem-like protrusions from the main tumor, potent proved to be doxorubicin, a DNA intercalating as well as microscopic distant tumor satellites and tumor substance, with an IC of 0.14μM (Fig. 5A). A liposomal vessels (Fig. 4B, E). Bacterial infection was accompanied formulation of doxorubicin (Lip-DXR) has previously by a striking accumulation of host inflammatory cells, been reported to enhance the anti-tumor efficacy of C. predominantly neutrophils at the periphery, presumably novyi-NT and may act as a depot for sustainable drug limiting bacterial spread (Fig. 4G, H). release [14]. In the syngeneic F98 GBM model, the combination of Lip-DXR and C. novyi-NT increased the survival modestly compared to C. novyi-NT alone (Fig. 5B). Tumors treated with C. novyi-NT spores plus Lip- Figure 3: C. novyi-nt increases survival in syngeneic intracranial F98 GbM model. (A) Kaplan-Meier curve of syngeneic F98 GBM bearing Fisher rats treated with a single dose of 3x10 IV injected C. novyi-NT spores at day 15. Bacterial treatment led to a 42% survival extension. (B) Fisher rats implanted with F98 cells expressing firefly luciferase were injected with 50mg/kg luciferin and evaluated via Xenogen before and after the treatment with C. novyi-NT spores. Similar to the results for 060919, we found a >90% reduction in the luciferase signal, an indicator for successful tumor lysis by C. novyi-NT. (C) Total luciferase counts of C. novyi-NT-treated and untreated animals are displayed. www.impactjournals.com/oncotarget 5539 Oncotarget 8 DXR had improved tumor clearance, as exemplified by Subsequently, 3x10 green-fluorescently labeled C. novyi- the lower number of viable tumor cells, particularly in the NT spores were injected into the tail vein and the animals periphery (Fig. 5C, D). observed for 5 days. Histopathological examination of the brains on day 5 demonstrated that, while the rats had large cerebral infarcts with extensive areas of necrosis, there C. novyi-NT germination is specific to tumor was no histopathological or molecular-biologic evidence generated hypoxia and necrosis of bacterial colonization within or surrounding the lesions. C. novyi-NT spores (but not germinated bacteria) To determine if C. novyi-NT germination is specific were found in the necrotic areas of the stroke, formally to tumor associated hypoxia and necrosis, we established demonstrating that the absence of bacterial germination a cerebral ischemic rat middle cerebral artery occlusion was not caused by the failure of spore delivery (Fig. 7A, stroke model. A large middle cerebral artery (MCA) B). infarct was created in normal athymic rats by transiently To prove that a sufficient degree of hypoxic injury occluding the MCA while ligating the right internal carotid was achieved in the stoke model, sections were stained artery for 2 hours, thereby decreasing MCA blood flow by with HIF-1α via immunofluorescence. HIF-1α is a key 70-90% (Fig. 6A, B). TTC and HIF-1α staining confirmed component of the cells’ response to hypoxia, and the the infarction and hypoxia in the brain (Fig. 6C). oxygen-labile HIF-1α protein is known to be induced in Figure 4: Micrographs of tumoral C. novyi-nt germination in human 060919 and syngeneic F98 GbM models. (A-C) Anatomical view and histology of 060919 GBM treated with C. novyi-NT. (B) Gram stained brain sections revealed that vegetative C. novyi–NT bacteria are precisely confined to the tumor (black arrowhead) and in satellite microinvasions of neoplastic cells (green arrowhead) but not in normal brain parenchyma. (C) Immunofluorescence staining for DAPI stained nuclei blue, TUNEL (red) and vegetative C. novyi-NT (green) in 060919 bearing rats were evaluated by confocal laser microscopy. C. novyi-NT co-localized with TUNEL positive tumor cells. (D-F) Anatomical view and histology of syngeneic F98 GBM treated with C. novyi-NT. (E) Similarly to 060919, vegetative C. novyi–NT bacteria are exclusively localized to the tumor (black arrowhead) as well as neoplastic vessels (green arrowhead). (F) C. novyi antibody stained vegetative bacteria were visualized in TUNEL positive tumor regions, but not in that of TUNEL negative cells. (G, H) C. novyi-NT induces a potent local host-inflammatory response in 060919 (G) and F98 (H) bearing animal. Brains were examined 24-48h after systemic injection of C. novyi-NT. A ring of leukocytes, stained by CD45, surrounded the tumor and restrained the infection (C. novyi-NT in green). DAPI is shown in blue. Abbreviations: S: Satellite microinvasions. V: Neoplastic vessel. www.impactjournals.com/oncotarget 5540 Oncotarget Figure 5: combination of C. novyi-nt with liposomal doxorubicin improves the clearance of the tumor rim in syngeneic F98 GbM model. (A) The half-maximal inhibitory concentrations (IC ) levels of seven chemotherapeutics including temozolomide (TMZ) in F98 cells are shown. Doxorubicin appears to be superior with an IC of 0.14 μM. (B) Kaplan-Meier survival curve of F98 GBM treated with a combination of Lip-DXR (5 mg/kg) and C. novyi-NT spores. The addition of Lip-DXR extended the survival by 10% compared to C. novyi-NT alone. Lip-DXR alone had no effect on the survival. (C, D) H&E and gram staining of the brain sections. Histologic examination revealed that rats undergoing combination therapy with C. novyi-NT spores plus Lip-DXR had lower amounts of remaining viable tumor seen on H&E sections (D) when compared to C. novyi-NT alone where larger portions of viable tumor (T) were noted, particularly in the periphery as indicated in the sections (C). Figure 6: The intraluminal filament rat MCAO stroke model. (A) Structural diagram of the vascular structures in the rat brain. The monofilament was inserted into the internal carotid artery (ICA) and advanced to the origin of the MCA, as indicated by the thick red line. This resulted in an ischemic infarction in the MCA territory (grey line). (B) Photograph taking during MCAO microsurgery showing the placement of the 4-0 nylon filament. (C) Representative coronal brain slices were taken 24 h after focal ischemia. The ischemic brain is shown on the left: TTC-stained white color indicates the infarct lesion, and red color represents normal tissue. As a comparison, the normal brain (right) did not have any white regions upon TTC staining. Following, H&E staining of the same brain illustrated the pattern of ischemic damage. There was massive immunoreactivity for HIF-1α, a marker for hypoxia, in cells of the infarcted region. There was no immunoreactivity to HIF-1α in normal brain tissue (right). www.impactjournals.com/oncotarget 5541 Oncotarget the central nervous system after focal ischemia caused by opportunity. Anaerobic bacteria have evolved to thrive in tumors or strokes [15]. The numbers of HIF-1α positive the hypoxic environment and fortuitously some possess cells in the necrotic regions of tumors and strokes were several key features that make them ideal anti-tumor similar, while bacterial germination was only evident in agents [8]. The toxin-deleted strain C. novyi-NT appears the tumors (Fig. 7A). to be particularly promising because: 1) bacteria germinate specifically in tumor-generated hypoxia but not in hypoxia generated by stroke (Fig. 6) or myocardial infarctions dIscussIon [12], (2) cytotoxicity is limited to the tumor while sparing adjacent normal tissues, and (3) vegetative C. novyi-NT Despite progress in the understanding, diagnosis and are highly mobile, rapidly infecting the entire tumor. A therapy of brain cancers, GBM remains a lethal disease. single intravenous injection of C. novyi-NT spores into Complete surgical excision is nearly always impossible glioma-bearing rats resulted in florid germination C. as a result of local infiltration and anatomical limitations, novyi-NT’s tumor-specificity is probably a result of the thus leading inevitably to tumor relapse [16]. Attempts fact that hypoxia-driven necrosis in cancers may generate to target common genetic defects in GBM have failed to a steeper oxygen pressure gradient (dynamic hypoxia) provide long-term survival and have not replaced non- compared to infarcted tissues (static hypoxia) with higher targeted approaches with chemotherapy and radiation oxygen pressures [18]. [17]. Here, we investigated if spore-forming bacterium Although the blood–brain barrier (BBB) normally C. novyi-NT targeting the cancer’s hypoxia might be protects the central nervous system from invading technically feasible and beneficial in preclinical models microorganisms, brain tumors or other inflammatory of GBM. conditions can compromise its integrity and result in Hypoxia is a critical aspect of glioblastoma biology local breakdown of the BBB. This along with the fragile and the development of resistance to chemotherapy and and leaky tumor vasculature manifesting in intratumoral radiotherapy [4]. Though this hypoxic state represents a hemorrhages can favor C. novyi-NT spore accumulation in major therapeutic challenge, it also provides a potential Figure 7: C. novyi-nt germinates in tumor hypoxia but not in non-malignant hypoxic tissue. (A) Shown are sections of a brain with an ischemic stroke (left) and a F98 rat glioma (right). Both lesions, the stroke and brain tumor, have strong immunoreactivity for HIF-1α (red). However, despite the presence of C. novyi-NT spores (green, white arrow) in areas of the ischemic infarct, they did not germinate, as indicated by the absence of green staining. Spores in tumoral hypoxia were able to germinate (green) and co-localized with hypoxia- positive tumor cells. DAPI is shown in blue. (B) Consistent with the immunofluorescent data, PCR confirmed that vegetative bacteria were only present in the glioma but not in the infarct, although C. novyi-NT spores were found in both lesions. www.impactjournals.com/oncotarget 5542 Oncotarget the brain tumor bed. In addition, systemically administered basic fibroblast growth factor (PeproTech), and 4 μg/mL C. novyi-NT spores could use the ‘Trojan horse’ method of heparin (Stem Cell Technologies). Rat F98 glioma cell line entry by traveling in leukocytes. In this scenario C. novyi- was maintained in Dulbecco’s Modified Eagle Medium NT spores are ingested by leukocytes where they remain (DMEM) supplemented with 10% fetal bovine serum dormant and once the infected leukocytes pass through (FBS) and antibiotics. Both cell lines, 060910 and F98, the BBB, the spores escape as shown with Clostridium were transfected with a luciferase construct via lentivirus difficile [19]. (0609191-luc, F98-luc). With the advances in synthetic biology, there is a renewed interest in bacterial therapies for cancer [8]. brain tumor models Though the use of an attenuated strain of C. novyi (i.e., C. novyi-NT) reduces treatment-related toxicity, safety 6-week-old female F344 Fisher rats (weight 100- remains the major hurdle in clinical use [20]. In our study, 150 gram) and athymic nude rats were purchased from the majority of rats treated with C. novyi-NT developed the National Cancer Institute (Bethesda, MD). For lethargy and signs of increased intracranial pressure due the implantation procedure, rats were anesthetized via to local inflammation-driven edema that were medically intraperitoneal (i.p) injection composed of ketamine manageable with the use of steroids and antibiotics, hydrochloride (75 mg/kg; 100 mg/mL; ketamine HCl; but the dangers of treating rats with intracranial tumors Abbot Laboratories), xylazine (7.5 mg/kg; 100 mg/ were evident. Similar observations were made by Diaz mL; Xyla-ject; Phoenix Pharmaceutical), and ethanol using tumor-bearing mice and rabbits, where edema and (14.25%) in a sterile 0.9% NaCl solution. Following, reversible inflammatory changes in the spleen, liver and 500,000 human GBM 060919 neurosphere cells infected adrenal glands were observed during spore treatment [12]. with luciferase lentivirus were stereotactically implanted Most recently, Roberts reported a study in which ten pet into the right frontal lobe located 3 mm lateral and 2 dogs with spontaneous soft-tissue sarcomas treated with mm anterior to the bregma of athymic rats as previously intratumoral injections of C. novyi-NT spores developed described [23]. 20,000 F98-luc cells were stereotactically local edema and abscesses that required antibiotics or implanted into F344 Fisher rats using the same parameters. surgical excision of the infected tissues [21]. The tumors were allowed to grow until day 25 (060919) Truly effective cancer therapy will indubitably or 15 (F98), when 3x10 C. novyi-NT spores, produced require a combination of multiple treatment modalities. as previously described [9], were injected into the tail Intravenous administration of C. novyi-NT enhances the vein. In addition, a subset of animals received liposomal effect of chemotherapy, particularly of hypoxia-enhancing doxorubicin (Doxil, Lip-DXR, Janssen, Titusville, NJ), 5 agents, and radiation [11]. Consistent with those data, mg/kg i.p. at the time of spore injection. Pre- and post- treatment with C. novyi-NT and liposomal doxorubicin treatment tumor sizes were assessed with a Xenogen resulted in a slightly increased survival benefit due to instrument after intraperitoneal injection of 50mg/ enhanced cytotoxicity [14]. It could also be valuable to kg D-luciferin potassium salt per rat. During the first combine C. novyi-NT with immune-checkpoint inhibitors. two days of bacterial therapy, rats were placed on 10 It has been demonstrated that long-term response to mg/kg/day dexamethasone i.p. to minimize the risk of C. novyi-NT involves an immunologic T-cell based postoperative edema. Control rats were stereotactically recognition that likely includes tumor antigens [22]. injected with the same volume of phosphate-buffered In summary, bacteriolytic therapy with the anaerobic saline (PBS) and treated with dexamethasone (10 mg/ spore forming bacterium C. novyi-NT is capable of kg per day) for the first 2 days. Animals were observed precisely localizing to tumors and mediating robust daily for any signs of deterioration, lethargy, neurotoxicity, tumoricidal activity with manageable side effects in two or pain in accordance with the Johns Hopkins Animal highly aggressive GBM models. The results provide a Care and Use Guidelines. If symptoms of distress were rationale for continuing to develop this approach for present, supportive therapy with hydration and antibiotic potential application in humans. metronidazole (loading dose of 15 mg/kg i.p. followed by 10 mg/kg every 12 hours as maintenance) was initiated MAterIAls And MetHods and continued for a 7-day period. If symptoms persisted and/or resulted in debilitation, moribund animals were euthanized according to protocol. The anti-tumor efficacy cell lines and tissue culture of C. novyi-NT treatment was assessed with Kaplan- Meier survival curves, Xenogen results, and the degree of tumor burden on post-mortem brain sections. For the Human GBM neurosphere line 060919 was grown latter purpose, brains were harvested post-mortem, placed in NeuroCult NS-A basal medium containing NeuroCult in formalin, and embedded in paraffin for additional NS-A proliferation supplements (Stem Cell Technologies), pathological studies. Gram-stained slides, counter-stained 20 ng/mL epidermal growth factor (PeproTech), 10 ng/mL with safranin, and H&E-slides were prepared according to www.impactjournals.com/oncotarget 5543 Oncotarget routine histopathologic practices. First-strand cDNA was synthesized from total RNA using random oligonucleotides as primers and the SuperScript First-Strand Synthesis System (Invitrogen). Synthesized Intracranial Pressure (IcP) measurement cDNA was then used for a nested PCR to detect C. novyi-NT’s growth phase specific genes. The first run Intracranial pressure was measured with an used primer pair (CCATAGCAATAAATCTTCCCTC intraventricular catheter in athymic nude rats. In brief, a and CATCTAAGCTTGAAACGTGTAG) targeting burrhole was drilled 1 mm posterior and 1 mm lateral to NT01CX2304, an indicator for vegetative bacteria, as the bregma. Subsequently, a 2.5 mm long probe modified well as primer pair (GCTAGTAAATGTGGATTTACTCC from a G20 needle by shortening the shaft and removing and ATTTCAGATGGTTCTGTGGTAG) targeting the plastic adaptor was inserted into the right lateral NT01CX2376, a marker for spores [16]. In the second ventricle and glued to the skull. For measurements, a PE10 run primer pair (CTCTTAATACCTCTTTCCCTTC and catheter was attached to the G20 needle, flashed with GTGTTTGTCATATGCTACTTCC) for NT01CX2304 normal saline and connected with a Life Scope 6 pressure and (CCTGGTAGTAACTCTGAAGTTA and monitor (Nihon Kohden Corporation). The monitor was GTGGTAGGTTCAAATCTACCAA) for NT01CX2376 reset to zero before attaching to the probe. were used. All PCR products were checked in 1.5% (wt/ vol) agarose electrophoresis with 1× Tris-borate-EDTA Stroke model (TBE) buffer, stained with ethidium bromide (0.2 μg/mL). DNA bands were detected under UV light. The intraluminal filament model of middle cerebral Human LINE-1 (hLINE-1) quantification artery occlusion (MCAO) was used to induce focal ischemic injury to the brain in athymic nude rats [24]. Briefly, after anesthetization a laser-Doppler flow (LDF) hLINE-1 was quantified in the blood from tumor- probe was placed on the skull of the nude rat to monitor bearing athymic nude rats to monitor the tumor burden the perfusion. To induce a right-sided ischemic stroke, the as described [27]. Briefly, approximately 50 µl of blood right common carotid artery (CCA) was exposed through were collected at various time points and DNA was a submandibular midline incision. Then, the proximal purified according to the instructions of the Qiagen DNA end of the CCA was temporarily ligated and a 4-0 nylon purification kit (Qiagen, Valencia, CA). Quantitative PCR monofilament was inserted into the internal carotid artery employed 0.5 μL of 10 μmol/L forward primer FWD (ICA) and advanced past the CCA bifurcation to the 5′-TCACTCAAAGCCGCTCAACTAC-3′ (IDT DNA; origin of the MCA. After two hours, reperfusion of the desalted, 25 nmol scale), 0.5 μL of 10 μmol/L reverse right MCA was achieved by withdrawal of the filament primer REV 5′-TCTGCCTTCATTTCGTTATGTACC-3′ and release of the CCA ligature. Animals were allowed (IDT DNA; desalted, 25 nmol scale) and the following to recover for 24 hours before 3x10 FITC-fluorescent cycling conditions (iCycler, Biorad): (94°C, 2 min) × 1, C. novyi-NT spores, produced as described by Diaz [12], (94°C, 10 s; 67°C, 15 s; 70°C, 15 s) × 3, (94°C, 10 s; were injected into the tail vein. Animals were sacrificed 64°C, 15 s; 70°C, 15 s) × 3, (94°C, 10 s; 61°C, 15 s; 70°C, after 5 days. Post-mortem, brains were removed and 15 s) × 3, (94°C, 10 s; 59°C, 15 s; 70°C, 15 s) × 35. incubated with 2,3,5-triphenyltetrazolium chloride (TTC) for 30 minutes to visualize the hypoxic areas as described Histological staining [25]. Additionally, brains were embedded in paraffin for further histological analyses. Post-mortem brains were fixed with 10% buffered formalin and paraffin-embedded. For histological analysis, nested Pcr for detection of vegetative forms of sections were deparaffinized with xylene, and rehydrated c. novyi-nt from brains in a graded ethanol series. 75 mg of fresh lesional brain tissue was harvested tunel staining from sacrificed animals with strokes or GBM. The preparation of the tissue followed previous reports by TdT-mediated dUTP nick end labeling was Bettegowda [26]. RNA was prepared by homogenization performed using the DeadEnd™ TUNEL system, of the dissected tissue in a glass homogenizer containing according to the manufacturer’s instructions (Promega, a ten-fold volume of ice-cold RNAwiz buffer (Ambion) Madison, WI). followed by 12-cycle homogenization with Zirconia beads (Biospec) for 10 min at 4 °C to ensure disruption of the spores. RNA was isolated using the RNA Total Kit (Promega) and quantified with a UV spectrophotometer. www.impactjournals.com/oncotarget 5544 Oncotarget tumors,” issued 24 December 2013 (K.W.K., B.V.). The Immunohistochemistry/Immunofluorescence other authors declare no competing interests. Immunohistochemical and immunofluorescence Author contributions experiments were carried out as previously described [28]. Briefly, non-specific binding sites were blocked by incubation with 10% goat serum in PBS for 1 h at room V.S., R-Y.B., G.J.R., K.W.K., B.V., and S.Z. temperature. The following primary antibodies were designed the study. V.S., R-Y.B., J.H., W.S., K.K.K., used: HIF-1 alpha (Abcam), CD45 (Abcam), C. novyi- and B.M.T. generated data. V.S., R-Y.B., G.J.R., G.L.G., NT antibody [22]. Omission of the primary antibody K.W.K., B.V., and S.Z. analyzed data. V.S., R-Y.B., served as the negative control. For immunohistochemical B.V. and G.J.R. wrote the draft manuscript. All authors detection, HRP-linked anti-rabbit or anti-mouse approved the final manuscript. secondary antibodies were used (EnVision™ kit, DAKO). Visualization with DAB was performed according to reFerences the manufacturer’s instructions (DAKO, Carpinteria, CA). For immunofluorescence detection the following 1. Dolecek TA, Propp JM, Stroup NE, & Kruchko C. secondary antibodies were applied: anti-rabbit Alexa CBTRUS statistical report: primary brain and central 488 or anti-mouse Alexa 594 (Invitrogen). Sections were nervous system tumors diagnosed in the United States in counterstained with 4′,6-diamidino-2-phenylindole (DAPI, 2005-2009. Neuro-oncology. 2012; 14 Suppl 5:v1-49. Vector Laboratories), and examined under the microscope. 2. Bai RY, Staedtke V, & Riggins GJ. Molecular targeting of glioblastoma: Drug discovery and therapies. Trends in statistical analysis molecular medicine. 2011; 17(6):301-312. 3. Tanaka S, Louis DN, Curry WT, Batchelor TT, & Dietrich Results are presented as a mean value ± standard J. Diagnostic and therapeutic avenues for glioblastoma: deviation. P values were determined by a Mantel-Cox no longer a dead end? Nature reviews. Clinical oncology. test and P values < 0.05 were deemed as statistically 2013; 10(1):14-26. significant. Data were analyzed by GraphPad Prism, 4. Bertout JA, Patel SA, & Simon MC. The impact of O2 version 5.0. availability on human cancer. Nature reviews. Cancer. 2008; 8(12):967-975. FundInG 5. Horsman MR, Mortensen LS, Petersen JB, Busk M, & Overgaard J. Imaging hypoxia to improve radiotherapy This work was supported by BioMed Valley outcome. Nature reviews. Clinical oncology. 2012; Discoveries Inc., Children’s Cancer Foundation (CCF), 9(12):674-687. the Virginia and D.K. Ludwig Fund for Cancer Research, 6. Wilson WR & Hay MP. Targeting hypoxia in cancer Voices Against Brain Cancer, NIH CA062924 (S.Z.), and therapy. Nature reviews. Cancer. 2011; 11(6):393-410. National Institute of Neurological Disorders and Stroke 7. Coley WB. The Treatment of Inoperable Sarcoma by R25NS065729 (V.S.). Bacterial Toxins (the Mixed Toxins of the Streptococcus erysipelas and the Bacillus prodigiosus). Proceedings of the conFlIcts oF Interest Royal Society of Medicine. 1910; 3(Surg Sect):1-48. 8. Forbes NS. Engineering the perfect (bacterial) cancer Under a licensing agreement between BioMed therapy. Nature reviews. Cancer. 2010; 10(11):785-794. Valley Discoveries Inc. and the Johns Hopkins University, 9. Dang LH, Bettegowda C, Huso DL, Kinzler KW, & K.W.K., B.V., and S.Z. are entitled to a share of royalties Vogelstein B. Combination bacteriolytic therapy for the received by the University on sales of products described treatment of experimental tumors. Proceedings of the in this article. Patents related to this work: WO2005039491 National Academy of Sciences of the United States of A3 “Certain improved combination bacteriolytic therapy America. 2001; 98(26):15155-15160. for the treatment of tumors,” issued 23 June 2005 (K.W.K., 10. Wells CL & Wilkins TD. Clostridia: Sporeforming B.V.); US20110311500 A1 “Improved combination Anaerobic Bacilli. Medical Microbiology, ed Baron bacteriolytic therapy for the treatment of tumors,” issued SGalveston (TX), 4th Ed. 1996. 30 June 2005 (K.W.K., B.V.); US8007782 B2 “Using 11. Dang LH, Bettegowda C, Agrawal N, Cheong I, Huso D, spores of anaerobic bacteria and microtubule stabilization Frost P, Loganzo F, Greenberger L, Barkoczy J, Pettit GR, antitumor agents; destroying tumors,” issued 30 August Smith AB 3rd, Gurulingappa H, Khan S, et al. Targeting 2011 (K.W.K., B.V.); US20110250258 “Tumor-specific vascular and avascular compartments of tumors with C. delivery of therapeutic agents via liposomase,” issued 13 novyi-NT and anti-microtubule agents. Cancer biology & October 2011 (K.W.K., B.V., and S.Z.); US8613917 B2 therapy. 2004; 3(3):326-337. “Combination bacteriolytic therapy for the treatment of www.impactjournals.com/oncotarget 5545 Oncotarget 12. Diaz LA, Jr., Cheong I, Foss CA, Zhang X, Peters BA, 24. Huang J, Kim LJ, Poisik A, Pinsky DJ, Connolly ES Jr. Agrawal N, Bettegowda C, Karim B, Liu G, Khan K, Huang Titration of postischemic cerebral hypoperfusion by X, Kohli M, Dang LH, et al. Pharmacologic and toxicologic variation of ischemic severity in a murine model of stroke. evaluation of C. novyi-NT spores. Toxicological sciences: Neurosurgery. 1999; 45(2):328-33. an official journal of the Society of Toxicology. 2005; 25. Popp A, Jaenisch N, Witte OW, & Frahm C. Identification 88(2):562-575. of ischemic regions in a rat model of stroke. PloS one. 13. Siu IM, Tyler BM, Chen JX, Eberhart CG, Thomale UW, 2009; 4(3):e4764. Olivi A, Jallo GI, Riggins GJ, Gallia GL. Establishment 26. Bettegowda C, Huang X, Lin J, Cheong I, Kohli M, Szabo of a human glioblastoma stemlike brainstem rodent tumor SA, Zhang X, Diaz LA Jr, Velculescu VE, Parmigiani model. Journal of neurosurgery: Pediatrics. 2010; 6(1):92- G, Kinzler KW, Vogelstein B, Zhou S. The genome and transcriptomes of the anti-tumor agent Clostridium novyi- 14. Cheong I, Huang X, Bettegowda C, Diaz LA Jr, Kinzler NT. Nature biotechnology. 2006; 24(12):1573-1580. KW, Zhou S, Vogelstein B. A bacterial protein enhances 27. Rago C, Huso DL, Diehl F, Karim B, Liu G, Papadopoulos the release and efficacy of liposomal cancer drugs. Science. N, Samuels Y, Velculescu VE, Vogelstein B, Kinzler KW, 2006; 314(5803):1308-1311. Diaz LA Jr. Serial assessment of human tumor burdens in 15. Sharp FR & Bernaudin M. HIF1 and oxygen sensing in the mice by the analysis of circulating DNA. Cancer research. brain. Nature reviews. Neuroscience. 2004; 5(6):437-448. 2007; 67(19):9364-9370. 16. Lacroix M, Abi-Said D, Fourney DR, Gokaslan ZL, Shi 28. Bai RY, Staedtke V, Lidov HG, Eberhart CG, & Riggins W, DeMonte F, Lang FF, McCutcheon IE, Hassenbusch GJ. OTX2 represses myogenic and neuronal differentiation SJ, Holland E, Hess K, Michael C, Miller D, et al. A in medulloblastoma cells. Cancer research. 2012; multivariate analysis of 416 patients with glioblastoma 72(22):5988-6001. multiforme: prognosis, extent of resection, and survival. Journal of neurosurgery. 2001; 95(2):190-198. 17. Garraway LA & Janne PA. Circumventing cancer drug resistance in the era of personalized medicine. Cancer discovery. 2012; 2(3):214-226. 18. Linkermann A, Stockwell BR, Krautwald S, & Anders HJ. Regulated cell death and inflammation: an auto- amplification loop causes organ failure. Nature reviews. Immunology. 2014; 14(11):759-767. 19. Paredes-Sabja D, Cofre-Araneda G, Brito-Silva C, Pizarro- Guajardo M, Sarker MR. Clostridium difficile spore- macrophage interactions: spore survival. PLoS one. 2012; 7(8):e43635. 20. Bette P, Frevert J, Mauler F, Suttorp N, & Habermann E. Pharmacological and biochemical studies of cytotoxicity of Clostridium novyi type A alpha-toxin. Infection and immunity. 1989; 57(8):2507-2513. 21. Roberts NJ, Zhang L, Janku F, Collins A, Bai RY, Staedtke V, Rusk AW, Tung D, Miller M, Roix J, Khanna KV, Murthy R, Benjamin RS, et al. Intratumoral injection of Clostridium novyi-NT spores induces antitumor responses. Science translational medicine. 2014; 6(249):249ra111. 22. Agrawal N, Bettegowda C, Cheong I, Geschwind JF, Drake CG, Hipkiss EL, Tatsumi M, Dang LH, Diaz LA Jr, Pomper M, Abusedera M, Wahl RL, Kinzler KW, et al. Bacteriolytic therapy can generate a potent immune response against experimental tumors. Proceedings of the National Academy of Sciences of the United States of America. 2004; 101(42):15172-15177. 23. Bai RY, Staedtke V, Aprhys CM, Gallia GL, & Riggins GJ. Antiparasitic mebendazole shows survival benefit in 2 preclinical models of glioblastoma multiforme. Neuro- oncology. 2011; 13(9):974-982. www.impactjournals.com/oncotarget 5546 Oncotarget

Journal

OncotargetPubmed Central

Published: Mar 18, 2015

There are no references for this article.