Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Ki-67 Expression by Immunohistochemistry and Quantitative Real-Time Polymerase Chain Reaction as Predictor of Clinical Response to Neoadjuvant Chemotherapy in Locally Advanced Breast Cancer

Ki-67 Expression by Immunohistochemistry and Quantitative Real-Time Polymerase Chain Reaction as... Hindawi Journal of Oncology Volume 2017, Article ID 6209849, 8 pages https://doi.org/10.1155/2017/6209849 Research Article Ki-67 Expression by Immunohistochemistry and Quantitative Real-Time Polymerase Chain Reaction as Predictor of Clinical Response to Neoadjuvant Chemotherapy in Locally Advanced Breast Cancer 1 2 1 1 Prihantono Prihantono, Mochammad Hatta, Christian Binekada, Daniel Sampepajung, 1 3 1 4 Haryasena Haryasena, Berti Nelwan, Andi Asadul Islam, and Andi Nilawati Usman Department of Surgery, Faculty of Medicine, Hasanuddin University, Makassar, Indonesia Biology Molecular and Immunology Laboratory, Faculty of Medicine, Hasanuddin University, Makassar, Indonesia Department of Pathology Anatomy, Faculty of Medicine, Hasanuddin University, Makassar, Indonesia Halal Center, Faculty of Public Health, Hasanuddin University, Makassar, Indonesia Correspondence should be addressed to Andi Nilawati Usman; nilawatiandi@gmail.com Received 12 December 2016; Revised 2 March 2017; Accepted 27 July 2017; Published 31 October 2017 Academic Editor: Subodh Kumar Copyright © 2017 Prihantono Prihantono et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background. Chemotherapy has become a standard of treatment in managing breast cancer. To achieve proper treatment for the right patients, the predictive marker is needed. Ki-67 is a biomarker of proliferation for solid tumor. Studies mentioned association of Ki-67 expression with chemotherapy response. eTh study aims are to evaluate whether Ki-67 expression detected by immunohistochemistry (IHC) and quantitative real-time polymerase chain reaction (qRT-PCR) may predict clinical response to neoadjuvant chemotherapy in breast cancer. Methods. This study utilized a longitudinal study. IHC and qRT-PCR methods were used for detection of Ki-67 expression. Chemotherapy response was calculated using RECIST. Data were analyzed with Chi-square and Wilcoxon’s test. Results. er Th e were 48 subjects in this study. Analysis of Ki-67 expression with chemotherapy response has a significant correlation with 𝑝 = 0.025 (<0.05), OR: 1.69, confidence interval (95% CI) 1.022–2.810. Analysis of Ki-67 mRNA expression with chemotherapy response has a significant correlation 𝑝 = 0.002 (<0.05), OR: 6.85, confidence interval (95% CI) 1.064–44.193. Detection of Ki-67 expression using IHC and qRT-PCR has similar results,𝑝 = 0.012 (<0.05). Conclusion.These results suggest that Ki-67 expression detected by both IHC and qRT-PCR is considered to be a predictor of clinical response to neoadjuvant chemotherapy in locally advanced breast cancer. 1. Introduction [4]. An ideal biomarker must differentiate tumor response towards certain chemotherapy agent before chemotherapy Breast cancer is cancer with the highest incidence in Indone- procedure is done so that we can avoid unnecessary therapy sia, with an incidence of 18.6 patients in 100,000 people annu- and toxic effect of the regiment [5]. Finding a biomarker ally [1]. Most of the patients came in advanced stages, 63% which may predict chemotherapy response for breast cancer were in stage III and stage IV by the time they were diagnosed was still a challenge [6]. [2]. Neoadjuvant chemotherapy has become a standard in Ki-67 is a core protein which was expressed in G1, S, G2, managing locally advanced breast cancer [3]. andMphaseandhasbeenassignedasasolidtumorprolifera- Patients that have the same breast cancer stage and tion marker. Tumor proliferation activity shown with a Ki-67 chemotherapy regiment may not have the same result. To give overexpression in breast cancer is related to poor prognosis precise chemotherapy regimens, we need a predictive marker and also is predictive of neoadjuvant chemotherapy response 2 Journal of Oncology [7]. The rate in Ki-67 relative proportion can be observed PBS. Block endogenous peroxidase by immersing slides in along chemotherapy and correlates with clinical and patho- 0.3% H2O2 solution for 30 minutes at room temperature. logical response in breast cancer [8]. Wash slides in PBS. Blocking normal horse serum was done Breast cancer is a heterogenic disease, based on gene by dripping a solution of 1% normal horse serum and letting it expression profile or breast cancer immunohistochemistry, stand at room temperature for 30 minutes. Wash slides with divided into several subtypes, that is, Luminal A, Luminal PBS. Drip slides with primary antibody AE 1/3; enter them B, Her-2, and triple negative. Every subtype has a different into the humid incubation chamber to be incubated in the response and aggressiveness toward systemic therapy. St. room overnight. Wash slides with PBS 3 times, each for 5 Galen consensus (2011) approved that the kind of subtype minutes. Drip slides with secondary antibody solution, for 60 influences the breast cancer chemotherapy response [9, 10]. minutes at room temperature. Wash slides with PBS 3 times, Because of the importance of predictive marker in man- each for 5 minutes. Drip slides with a solution of polymer- aging breast cancer and lack of data about Ki-67 expression antibody-peroxidase complex, and incubate them at room in Indonesia, we are interested in evaluating the relationship temperature for 30 minutes. Wash slides with PBS 3 times, of Ki-67 expression detected by IHC and qRT-PCR in breast each for 5 minutes. Drip slides with DAB solution. Incubate cancer tissue prior to chemotherapy with chemotherapy them at room temperature. Counterstain with hematoxylin. response in breast cancer patients in Makassar Indonesia. Dehydrate in graded alcohol 70%, 80%, 90%, 95%, and 100%, respectively, for 3 minutes. Immerse the slides in Xylol 2x, each for 10 minutes. Mount and cover them with a glass deck. 2. Material and Methods eTh results are obtained after the sample is checked by a light 2.1. Material. We acquired samples from breast cancer microscope up to10×40 magnification [13, 14]. patients who received chemotherapy in Surgical Oncology Department of Wahidin Sudirohusodo Hospital, Makassar, 2.4. Immunohistochemistry Interpretation. Staining intensity from October 2014 until September 2015. eTh inclusion and percentage of positive nuclei are recorded after manually criteria were women with locally advanced breast can- segmenting tumor from the stroma. Tumors with ER/PR cer and invasive ductal carcinoma and women receiving Remmele scores greater than 3 or positive nuclei greater cyclophosphamide-doxorubicin-5FU [11] regimen. than 1% were considered hormone receptor-positive [13]. We performed clinicopathology data collection which When membrane staining is observed in>10% of tumor cells, involved age and grading. Then we performed immunohisto- Her2 is positive, and if less than 10% membrane staining is chemistry panel examination of ER, PR, Her2, and Ki-67. We observed then Her2 is negative. Ki-67 is negative if there is also detect Ki-67 expression using qRT-PCR. Chemotherapy less than 14% of nuclei staining and positive if≥14% [13, 15]. response was measured clinically by using a caliper, at the moment before starting the 1st cycle of chemotherapy and 2.5. Nucleic Acid Isolation. Extraction of nucleic acid from three weeks aeft r the 3rd cycle of chemotherapy. Data were breast cancer tissue was performed using diatom guani- collected, managed, analyzed, and presented in table and dinium isothiocyanate (GuSCN) method. The sample volume narration form, and then we compared them with the result of about 100 ug/ul breast cancer tissue was added to 900 mL of other studies. of “L6” solution which consists of 120 g guanidinium thio- cyanate (GuSCN) (Fluka Chemie AG, Buchs, Switzerland, 2.2. Clinical Response Criteria. Clinical response in this study cat number 50 990), 100 ml of 0.1 M Tris-HCl, pH 6.4, 22 ml is classified into two categories: nonresponsive, according to 0.2 M ethylenediaminetetraacetate (EDTA), pH 8.0, and 2.6 g RECIST, that is, stable disease or progressive disease, which Triton X-100 (Packard, Instruments) with a na fi l concen- is den fi ed as reduced tumor size < 30%, the size of the tration of 50 mM Tris-HCl, 5 M GuSCN, 20 mM EDTA, tumor remaining the same, increase of the tumor size, or and 0.1% Triton X-100. en Th 20 mL diatom suspension was discovering a new tumor; responsive, according to RECIST, added which consists of 50 ml of H2O and 500 mL of 32% that is, complete response or partial response which is defined (w/v) “Celite” (“diatoms”) (Jansen Chimica, Beerse, Belgium, as disappearance of tumor mass or at least the reduction of 10.846.79). 20 mL suspension of this diatom can bind 10 ug tumorsizebyupto30%andnonewtumors. DNA tissue, and it is then vortexed and centrifuged in 1.5 ml Eppendorf tube with a speed of 13,000 rpm for 15 seconds. 2.3. Immunohistochemical Staining. Immunohistochemical eTh supernatant was discarded, and the sediment was washed staining technique is employing polymer-based methods. eTh with “L2” solution consisting of 120 g GuSCN in 100 ml of primary antibodies and dilutions were used (DakoCytoma- 0.1M Tris-HCl, pH 6.4, by adding 1ml of “L2” solution. tion, Glostrup, Denmark): ER (clone 1D5, 1 : 100), PR (clone Furthermore, vortexing and centrifugation at 13,000 rpm for PgR636, 1 : 100), and Ki-67 (MIB-1, 1 : 200) [12, 13]. Paraffin 15 seconds were performed; then wash the sediment 2 times blocks are cut with a thickness of 4–6 microns and placed in with an “L2” solution, followed by washing with 1 ml of 70% a special glass slide coated poly-L-lysine. Deparaffinize slides ethanol 2 times and 1 ml acetone. The result is then heated in in Xylol solution 2x, every 15 minutes. Rehydrate slides in a water bath at a temperature of 56 Cfor10 minutes. eTh n alcohol-rise 100%, 95%, 90%, 80%, and 70%, respectively, for 60 mL solution of “TE” was added which consists of 1 mM 5 minutes, then drain. Heat-induced antigen retrieval (HIER): EDTA in 10 mM Tris-HCl, pH 8.0; then vortexing is done insert slides in a solution of citric acid 0.01 pH 6.0; heat in and centrifugation is continued at a speed of 13,000 rpm for microwave for 10 minutes, and then chill. Wash slides with 2 minutes. en Th the solution was incubated in the oven for Journal of Oncology 3 10 minutes at a temperature of 56 C. Then vortexing and Table 1: Patient characteristics. centrifugation for 30 seconds at a speed of 13,000 rpm were Characteristics Number (%) 𝑝 value conducted, and the supernatant was taken. eTh supernatant Age from this process will result in nucleotide extraction and was ∘ ≤50 27 (56.3) stored at−800 C before PCR analysis [16, 17]. 0.076 >50 21 (43.8) Grade 2.6. Expression mRNA Ki67 by Real-Time PCR. Detection Low grade 8 (16.7) of mRNA expression of Ki-67 was done according to Real- 0.057 Moderate 26 (54.2) time PCR method previously described by Mitas, 2001, and High grade 14 (29.2) Potemski, 2006. The process of oligonucleotide primers was Subtype specific for the gene, that is, housekeeping gene GAPDH (internal control). Detection of mRNA Ki-67 gene was Luminal A 10 (20.8) performed using specific primers forward and reverse PCR Luminal B 20 (41.7) 0.131 protocols: Ki-67 forward: TCCTTTGGTGGGCACCTAA- Her2 14 (29.2) GACCTG and Ki-67 reverse: TGATGGTTGAGGTCGTTC- Triple negative 4 (8.3) CTTGATG. Cycle RT-PCR for Ki-67 was 94 Cfor3minutes; Ki-67 (SD) ∘ ∘ 94 C for 30 seconds, 38 cycles; and the next step is PCR: 51 C Positive 26 (54.2) for 30 seconds. Also, specific primers of housekeeping genes 0.025 Negative 22 (45.8) used GAPDH forward: TGAGTGCTGTCTCCATGTTTGA Mean of tumor size (SD) and GAPDH reverse: TCTGCTCCCCACCTCTAAGTTG. QRT-PCR used qRT-PCR Green Master Mix Kit, one stage. Before chemotherapy 12.60 (0.40) ∗∗ 0.031 This protocol was optimized for instrument MX4000. Pro- After chemotherapy 08.06 (0.20) tocolwas adjusted by usingtheinstrument by changing the ∗ ∗∗ Chi Square statistical test; Wilcoxon’s statistical test; SD = standard dye dilution based on the instruction manual and following deviation. the recommended instrument factory for RT-PCR cycle program. Passive reference dye was included in the reaction diluted Dr. Wahidin Sudirohusodo aer ft lengthy discussion and eval- 1 : 500. The solution containing the dye was kept away from uation, with a registration number 1659/H4.8.4.5.31/PP36- light, diluted2xbySYBRGreen QRT-PCRMasterMix,and KOMETIK/2015. stayed on the ice. Following the initial melting master mix, the unused portion is stored at 40 Cwiththefollowingnote: avoid repeating freeze-liquid cycles. Reaction experiment 3. Results was prepared by adding the following components. Make a 3.1. Characteristics of Respondents. The research was done in mixture of reagents to the reaction using some components the period from October 2014 to September 2015; subjects such as thefollowing:themixtureofreagentstotakea were breast cancer patients who met the inclusion-exclusion final volume of 25 mL (including experimental RNA), 12.5 mL criteria. Of all samples collected, 48 samples were examined of 2x SYBR Green QRT-PCR master mix plus × mL of by immunohistochemistry method and 30 samples were early primary (optimized concentration) plus nuclease—free tested by qRT-PCR examination. Characteristics of patients PCR—therateofthe primaryendmLH2 × (optimized were all presented with clinical stage III A and stage III concentration), 0,375 mL reference dye solution from step 1 B at the time of initial diagnosis: 30 patients (62.5%) who (optional), and 1.0 mL of RT/RNase enzyme mixture 50𝜇l were responsive to neoadjuvant chemotherapy and 18 patients totalblockswithareaction volume canalsobeused. eTh (37.5%) who were nonresponsive. Breast cancer patient char- reaction was mixed gently so as not to form bubbles (do acteristics are shown in Table 1. not rotate), and then the mixture is distributed to a test tube experiment by adding𝑥 mL RNA in each of the test tube experiments. eTh reaction was mixed gently so as not 3.2. A Representative of Microphotographs of ER, PR, HER2, to form bubbles (not rotated). Reactions were centrifuged and Ki67 Immunostaining in Invasive Ductal Carcinoma. briefly, and the reaction was placed in the instrument, and the eTh representation of microphotographs of ER, PR, HER2, PCR program is ready to run using real-time PCR machine and Ki67 immunostaining of this research is shown in (CFX Connect System, Bio-Rad Laboratories, real-time PCR Figure 1. Microphotographs show nuclei staining in tumors 96-well 0,1 ml, USA). Each sample was measured in triplicate with ER/PR positive, membrane staining in Her2 positive, [17–19]. and nuclei staining in the Ki-67 positive. 2.7. Statistical Analysis. Data was analyzed using SPSS (Sta- 3.3. Amplicfi ation Curve, Melting Peak, and Melting Curve tistical Package for Social Sciences). Samples were analyzed of mRNA Ki67 in Invasive Ductal Carcinoma Detected Using using Chi Square and Wilcoxon’s test.Thisstudyhasanethical qRT-PCR. Figures 2 and 3 show amplicfi ation curve, melting approval from Health Research Ethics Committee of Medical peak, and melting curve of mRNA Ki67 in invasive ductal Faculty of Hasanuddin University, RSPTN UH, dan RSUP carcinoma detected using qRT-PCR. 4 Journal of Oncology ER− ER+ PR− PR+ HER2− HER2+ Ki67− Ki67+ Figure 1: Microphotographs of ER, PR, HER2, and Ki67 immunostaining in invasive ductal carcinoma. 7000 7000 6000 6000 04 10 20 30004 10 20 300 Cycles Cycles Figure 2: Amplification curve of Ki-67 mRNA expression. RFU RFU Journal of Oncology 5 Melting Peak Melting Curve 60 70 80 90 100 60 70 80 90 100 Temperature (Celsius) Temperature (Celsius) Figure 3: Melting peak and melting curve of Ki-67 mRNA expression. Table 2: Relation of Ki-67 expression with chemotherapy response Table 3: Relationships between Ki-67 mRNA expression with in breast cancer. chemotherapy response in breast cancer. Chemotherapy response Chemotherapy response Ki-67 expression Total Ki-67 mRNA expression Total Responsive Nonresponsive Responsive Nonresponsive Positive 20 (76.9%) 6 (23.1%) 26 (100%) High 16 (76.2%) 5 (23.8%) 21 (100%) Negative 10 (45.5%) 12 (54.5%) 22 (100%) Low 1 (11.1%) 8 (88.9%) 9 (100%) Total 30 (62.5%) 18 (37.5%) 48 (100%) Total 17 (56.7%) 13 (43.3%) 30 (100%) Chi-square𝜒 =5.035;df=1;𝑝=0.025 (𝑝>0 ,05). Chi-square𝜒 =10.866;df=1;𝑝=0.002 (𝑝<0.05). Table 4: Relationship between Ki-67 expression by immunohisto- 3.4. Relation of Ki-67 Expression with Neoadjuvant Chemo- chemistryand Ki-67mRNAexpressiondetectedbyqRT-PCR. therapy Response. To find out whether the Ki-67 expression has a relationship with clinical response to neoadjuvant Ki-67 mRNA expression Ki-67 expression Total chemotherapy in breast cancer, we used bivariate analysis, High Low which can be seen in Table 2. Positive 15 (88.2%) 2 (11.8%) 17 (100%) Analysis of Ki-67 expression detected by immunohis- Negative 6 (46.2%) 7 (53.8%) 13 (100%) tochemistry found that positive Ki-67 expression tends to Total 21 (70%) 9 (30%) 48 (100%) be responsive to neoadjuvant chemotherapy 20 (76.9%) and Spearman’s𝑝=0.012 (𝑝>0 ,05). negative Ki-67 expression tends to be nonresponsive to neoadjuvant chemotherapy 12 (54.5%); there were statistically significant differences with 𝑝 value = 0.025 (𝑝<0.05). This and low level of Ki-67 mRNA expression tends to be non- result suggests that Ki-67 expression detected by immuno- histochemistry may predict clinical response to neoadjuvant responsive to neoadjuvant chemotherapy, 8 (88.9%). There chemotherapy in locally advanced breast cancer. were statistically significant differences with 𝑝 value = 0.002 (𝑝<0.05). This result suggests that Ki-67 mRNA expression detected by qRT-PCR may predict clinical response to neoad- 3.5. Relation of Ki-67 mRNA Expression with Neoadjuvant juvant chemotherapy in locally advanced breast cancer. Chemotherapy Response. Based on qRT-PCR examination, we foundthatthemeanvalueofKi-67 mRNA expression was11.241±1.971. We determine Ki-67 mRNA expression 3.6. Relationship between Ki-67 Expression with Neoadjuvant cut-off point as 9.235, using receiver operating characteristics Chemotherapy Response. To find out whether Ki-67 expres- curve (ROC). en Th Ki-67 mRNA expression was categorized sion by immunohistochemistry has a relationship with Ki-67 as high level if it was≥9.235 and low level< 9.235. mRNA expression detected by qRT-PCR, we used bivariate To find out whether Ki-67 mRNA expression has a rela- analysis,which canbeseeninTable4. tionship with clinical response to neoadjuvant chemotherapy Analysis of Ki-67 expression by immunohistochemistry in breast cancer, we used bivariate analysis, which can be seen and qRT-PCR found that a high level of Ki-67 mRNA expres- in Table 3. sion tends to have positive Ki-67 expression, 15 (88.2%), Analysis of Ki-67 mRNA expression detected by qRT- and low level of Ki-67 mRNA expression tends to have PCR found that a high level of Ki-67 mRNA expression tends negative Ki-67 expression, 7 (53.8%). er Th e were statistically to be responsive to neoadjuvant chemotherapy, 16 (76.2%), significant differences with 𝑝 value = 0.012 (𝑝 < 0.05). This −d(2&5)/dT RFU (10 ) 6 Journal of Oncology Table 5: Multivariate regression analysis for predictive factors. of 23 (8.7%), Her2(+): 4 out of 18 (22.2%), and triple negative: 10 out of 41 (24.4%) (𝑝=0.041)[22].Horimoto et al.’sstudy Variable OR 95% CI 𝑝 mentioned that Luminal B – Her2(−)patientwhoreceived Age 2.553 0.018–1.508 0.110 chemotherapy had a pathological complete response rate 35% Grading 0.063 0.158–4.160 0.802 which is related to disease-free survival [23, 24]. Subtype 0.528 0.134–2.516 0.468 Proliferation activity has prognostic information. Mea- Ki-67 (IHC) 0.133 0.124–20.969 0.716 surement of proliferation activity using Ki-67 detected by IHC is still controversy [25]; whether Ki-67 scores have much Ki-67 mRNA Expression 4.385 1.206–286.53 0.036 ∗ prognostic information and could predict the benefit of the Binary logistic regression analysis. addition of cytotoxic chemotherapy is still a question [25–27]. Several studies had investigated Ki-67 prognostic signif- icance in breast cancer. eTh study shows that Ki-67 over- result suggests that Ki-67 mRNA expression detected by qRT- expression correlates with disease-free survival and overall PCR and Ki-67 expression using IHC have similar results. survival [22, 28–30]. However, a patient with high prolifer- ation rate has a better response toward chemotherapy [8, 29]. 3.7. Multivariate Analysis. Multivariate binary logistic regres- Furthermore, this marker may help the screening of patient sion analysis was used to determine independent predictors who might not get any advantage from chemotherapy: those of clinical response to neoadjuvant chemotherapy in locally who have Her2 positive and negative hormonal receptor and advanced breast cancer. Data shown in Table 5 revealed that low proliferation tumor [8, 22, 29]. Ki67 mRNA expression was an independent predictor for Studies revealed that Ki-67 protein expression correlates neoadjuvant chemotherapy in locally advanced breast cancer with response to chemotherapy. High Ki-67 proliferation rate (OR, 4.385; CI, 1.206–286.53;𝑝=0.036). was predictive of a higher probability of complete patholog- ical response [26]. Fasching et al. investigated Ki-67 by IHC 4. Discussion of 552 patients and found that Ki-67 expression with 13% cut- From this study, we collectedvariableages: theyoungestwas off could predict complete pathological response with 94% 29 years old and the oldest was 74 years old, with a median sensitivity and 36% specificity [13, 29]. Kim et al. found that age of 46 years old, and the most populated age found was in Ki-67 expression with cutoff value 25% in breast cancer tissue is a predictor of neoadjuvant chemotherapy response. Ki-67 the 4th decade, as many as 40.5%. Globally, breast cancer patient< 50 years old is 33% of the is also a predictive factor for complete pathological response population; meanwhile, in Asia-Pacific, it is 42%, in South- in ER-negative and HER2-positive breast cancer patients East Asia it is 47%, and, in Australia, it is 21%. SEER data in [31]. Wang et al. found that Ki-67 independently correlated Americashowedbreastthatcanceriscommonin55–64-year- with complete pathological response and clinical response, old group of age, with a median age of 61 years old [20]. grades, and node status. Reduction of Ki-67 expression aer ft Several kinds of literature mentioned that generally the neoadjuvant chemotherapy was observed in patients with a ageofbreastcancerpatient is youngerinAsiathaninEurope relatively better response [32]. Research of Ki-67 expression measured using quantitative immunouo fl rescence automated and America. This difference possibly is caused by lifestyle factors, diet pattern, or the existence of certain gene which is quantitative analysis (AQUA) technology found that high relatedtoracesothatthe dieff renceinage occurred [20]. Ki-67 levels are a predictor of neoadjuvant chemotherapy response [33]. From the study, data obtained are as follow low grade 16.7%, moderate grade 54.2%, and high-grade 29.2%. In our previous study, we found an insignicfi ant cor- Histopathology grading is a particular prognostic factor. relation between expression of mRNA Ki-67 baseline with Some newest studies confirm the importance of histopa- chemotherapy response. But, chemotherapy cause decrease thology grading as a predictive and prognostic factor in in mRNA expression of Ki-67. eTh rate of Ki-67 mRNA breast cancer. Engstrøm et al.’s study showed in the rst fi five expression has a significant correlation with clinical response years, grade 2 and 3 breast cancer had a poorer prognosis to chemotherapy [17, 34]. than grade 1 [21, 22]. Several studies have found that changes before and after therapy in Ki-67 are a strong and independent predictor of Breast cancer subtype is influencing chemotherapy response. Rouzier et al.’s study showed that a complete patho- disease-free time and survival rate [13, 35, 36]. The expression logic response rate in Basal-like subtype is as much as 45% before and aer ft chemotherapy can be a significant indepen- dent predictor of the overall survival in multivariate analysis. and Her2 is as much as 45%; meanwhile luminal had a patho- logical complete response rate of 6% and no complete patho- For this reason, nowadays, tumor response on neoadjuvant logical response rate in normal-like subtype [23]. Luangdilok chemotherapy tryout is evaluated with the examination of et al.’s study mentioned that complete pathological response immunohistochemistry Ki-67 [37]. in triple-negative subtype was 19.2% and Her2 was 24.2%. Tumors with Ki-67 mRNA expression were examined by qRT-PCR associated with disease-free survival and overall Meanwhile, Luminal A was 4.4%, and Luminal B was 9.7% [22]. A study of 102 breast cancer patients obtained complete survival of patients treated with adjuvant chemotherapy pathological response in 16 (15.7%) patients. Pathological regimens. eTh results showed that the tumor with a high level of KI67 mRNA expression might be valuable for adjuvant complete response that is appropriate with dieff rent subtypes is as follows:LuminalA:0outof20(0%),LuminalB:2out therapy using docetaxel [38]. Journal of Oncology 7 Studies found that high mRNA expression of Ki-67 was [7] R.L.Jones,J.Salter,R.A’Hern etal., “ep Th rognosticsignif- icance of Ki67 before and aeft r neoadjuvant chemotherapy in associated with a higher rate of the complete pathological breast cancer,” Breast Cancer Research and Treatment,vol.116, response (36.4%) compared with low levels mRNA Ki-67 no. 1, pp. 53–68, 2009. (5.8%). mRNA expression of Ki-67 is a predictor of the [8] R.Burcombe,G.D.Wilson,M.Dowsettetal.,“Evaluationof achievement of complete pathological response and better Ki-67 proliferation and apoptotic index before, during and aer ft than Ki-67 expression which was detected by immunohisto- neoadjuvant chemotherapy for primary breast cancer,” Breast chemistry [39]. Ki-67 mRNA expression level is more objec- Cancer Research,vol.8,no.3, articleR31,2006. tive and highly reproducible quantification of proliferation [9] A.Goldhirsch,W. C. Wood,A.S.Coates, R. D.Gelber,B. activity and more meaningful than Ki-67 protein expression Th urlima ¨ nn, and H.-J. Senn, “Strategies for subtypes-dealing by immunohistochemistry, either by visual scoring or by with the diversity of breast cancer: highlights of the St Gallen quantitative image analysis [17, 39]. international expert consensus on the primary therapy of early breast cancer 2011,” Annals of Oncology,vol.22,no.8,pp. 1736– 5. Conclusion 1747, 2011. [10] A. Goldhirsch, E. P. Winer, A. Coates, R. Gelber, M. Piccart- These results suggest that Ki-67 expression detected by both Gebhart, B. Th urlima ¨ nn et al., “Personalizing the treatment of IHC and qRT-PCR is considered to be predictor of clinical women with early breast cancer: highlights of the St Gallen response to neoadjuvant chemotherapy in locally advanced International Expert Consensus on the Primary Therapy of breast cancer. This result also suggests that Ki-67 mRNA Early Breast Cancer 2013,” Annals of Oncology,vol.24, no.9,pp. 2206–2223, 2013. expression detected by qRT-PCR and Ki-67 expression using IHC have similar results. [11] G. Gasparini, M. Barbareschi, C. Doglioni et al., “Expression of bcl-2 protein predicts efficacy of adjuvant treatments of operable node-positive breast cancer,” Clinical Cancer Research, Conflicts of Interest vol. 1, no. 2, pp. 189–198, 1995. [12] M. E. H. Hammond, D. F. Hayes, M. Dowsett, D. C. Allred, ea Th uthorshavenoconflictsofinteresttodeclare. K. L. Hagerty, S. Badve et al., “American Society of Clinical Oncology/College of American Pathologists guideline recom- Acknowledgments mendations for immunohistochemical testing of estrogen and progesterone receptors in breast cancer (unabridged version),” eTh authors very gratefully thank all breast cancer patients Archives of Pathology & Laboratory Medicine,vol.134,no.4, pp. who were willing to be a respondent in this study. e48–e72, 2010. [13] H.-P. Sinn, A. Schneeweiss, M. Keller et al., “Comparison of immunohistochemistry with PCR for assessment of ER, PR, References and Ki-67 and prediction of pathological complete response in [1] M. Wahidin, R. Noviani, S. Hermawan, V. Andriani, A. Ardian, breast cancer,” BMC Cancer,vol.17,no.1,article124,2017. and H. Djarir, “Population-based cancer registration in Indone- [14] E. Luporsi, F. Andre, ´ F. Spyratos et al., “Ki-67: Level of evidence sia,” Asian Pacicfi Journal of Cancer Prevention,vol.13, no.4,pp. and methodological considerations for its role in the clinical 1709-1710, 2012. management of breast cancer: Analytical and critical review,” [2] C.H.Ng,N.BhooPathy,N.A.Taibetal.,“Comparisonofbreast Breast Cancer Research and Treatment,vol.132,no.3, pp.895– cancer in Indonesia and Malaysia—a clinico-pathological study 915, 2012. between dharmais cancer centre Jakarta and university Malaya [15] N.Iqbal andN.Iqbal,“HumanEpidermal GrowthFactor medical centre, Kuala Lumpur,” Asian Pacific Journal of Cancer Receptor 2 (HER2) in cancers: overexpression and therapeutic Prevention, vol. 12, no. 11, pp. 2943–2946, 2011. implications,” Molecular Biology International,vol.2014, pp.1–9, [3] M. Kaufmann, G. N. Hortobagyi, A. Goldhirsch et al., “Rec- ommendations from an international expert panel on the use [16] R. Boom,C.J.A.Sol,M.M.M.Salimans, C.L. Jansen,P.M. of neoadjuvant (primary) systemic treatment of operable breast E. Wertheim-Van Dillen, and J. van der Noordaa, “Rapid and cancer: an update,” JournalofClinicalOncology,vol.24,no.12, simple method for purification of nucleic acids,” Journal of pp.1940–1949,2006. Clinical Microbiology,vol.28,no.3,pp.495–503,1990. [4] G. Fountzilas, U. Dafni, M. Bobos et al., “Evaluation of the prog- [17] P. Prihantono, “Profile of mRNA expression of Ki-67 in breast nostic role of centromere 17 gain and HER2/topoisomerase ca ncer patients pre- and post- chemotherapy,” American Journal II alpha gene status and protein expression in patients with of Clinical and Experimental Medicine, vol. 5, no. 1, p. 10, 2017. breast cancer treated with anthracycline-containing adjuvant [18] M. Mitas, K. Mikhitarian, C. Walters et al., “Quantitative real- chemotherapy: Pooled analysis of two Hellenic Cooperative time RT-PCR detection of breast cancer micrometastasis using Oncology Group (HeCOG) phase III trials,” BMC Cancer,vol. a multigene marker panel,” International Journal of Cancer,vol. 13, article 163, 2013. 93,no.2, pp.162–171,2001. [5] R. M. Connolly and V. Stearns, “Current approaches for neoad- [19] P. Potemski, E. Pluciennik, A. K. Bednarek et al., “Ki-67 juvant chemotherapy in breast cancer,” European Journal of expression in operable breast cancer: a comparative study of Pharmacology,vol.717,no.1-3, pp.58–66,2013. immunostaining and a real-time RT-PCR assay,” Pathology- Research and Practice,vol.202,no. 7,pp.491–495,2006. [6] L. Santarpia, Y. Qi, K. Stemke-Hale et al., “Mutation profiling identifies numerous rare drug targets and distinct mutation [20] N.Howlader,A.Noone,M.Krapcho,N.Neyman, R. Aminou, patterns in different clinical subtypes of breast cancers,” Breast W. Waldron et al., SEER Cancer Statistics Review, 1975–2008, Cancer Research and Treatment,vol.134,no.1,pp.333–343,2012. National Cancer Institute, Bethesda, Md, USA, 2011. 8 Journal of Oncology [21] M. J. Engstrøm, S. Opdahl, A. I. Hagen et al., “Molecular sub- [35] M. Colozza, E. Azambuja, F. Cardoso, C. Sotiriou, D. Larsimont, types, histopathological grade and survival in a historic cohort and M. J. Piccart, “Proliferative markers as prognostic and of breast cancer patients,” Breast Cancer Research and Treat- predictive tools in early breast cancer: where are we now?” ment,vol.140,no.3, pp.463–473,2013. Annals of Oncology,vol.16, no.11, pp.1723–1739,2005. [36] R. Nishimura, T. Osako, Y. Okumura, M. Hayashi, and N. [22] S. Luangdilok, N. Samarnthai, and K. Korphaisarn, “Associ- ation between pathological complete response and outcome Arima, “Clinical significance of Ki-67 in neoadjuvant chemo- therapy for primary breast cancer as a predictor for chemosen- following neoadjuvant chemotherapy in locally advanced breast sitivity and for prognosis,” Breast Cancer,vol.17,no.4,pp.269– cancer patients,” Journal of Breast Cancer,vol.17, no.4,pp. 376– 275, 2010. 385, 2014. [37] N. Niikura, T. Iwamoto, S. Masuda et al., “Immunohistochem- [23] R. Rouzier, C. M. Perou, W. F. Symmans et al., “Breast cancer ical Ki67 labeling index has similar proliferation predictive molecular subtypes respond differently to preoperative chemo- power to various gene signatures in breast cancer,” Cancer therapy,” Clinical Cancer Research, vol. 11, no. 16, pp. 5678–5685, Science,vol.103,no.8, pp.1508–1512,2012. [38] R. M. Wirtz, H. Sihto, J. Isola et al., “Biological subtyping of early [24] Y.Horimoto,A.Arakawa,M.Tanabeetal.,“Ki67expression breast cancer: a study comparing RT-qPCR with immunohisto- and the effect of neo-adjuvant chemotherapy on luminal HER2- chemistry,” Breast Cancer Research and Treatment,vol.157,no. negative breast cancer,” BMC Cancer,p.550,2014. 3,pp.437–446,2016. [25] A. S. Coates, E. P. Winer, A. Goldhirsch et al., “Tailoring ther- [39] F. Marme, A. Schneeweiss, J. Aigner et al., “Abstract P3-06- apies—improving the management of early breast cancer: St 08: Ki-67 mRNA as a predictor for response to neoadjuvant Gallen International Expert Consensus on the Primary Therapy chemotherapy in primary breast cancer,” Cancer Research,vol. of Early Breast Cancer 2015,” Annals of Oncology,vol.26, no.8, 72,no.24,2014. pp.1533–1546,2015. [26] E. De Azambuja, F. Cardoso, G. De Castro et al., “Ki-67 as prognostic marker in early breast cancer: a meta-analysis of published studies involving 12,155 patients,” British Journal of Cancer,vol.96,no.10,pp.1504–1513,2007. [27] C.Criscitiello,D.Disalvatore,M.DeLaurentiisetal.,“High Ki-67 score is indicative of a greater benefit from adjuvant chemotherapy when added to endocrine therapy in Luminal B HER2 negative and node-positive breast cancer,” The Breast ,vol. 23,no. 1,pp.69–75,2013. [28] R. Haque, S. A. Ahmed, G. Inzhakova et al., “Impact of breast cancer subtypes and treatment on survival: an analysis spanning two decades,” Cancer Epidemiology, Biomarkers & Prevention, vol.21,no.10,pp. 1848–1855,2012. [29] P. A. Fasching, K. Heusinger, L. Haeberle et al., “Ki67, chem- otherapy response, and prognosis in breast cancer patients receiving neoadjuvant treatment,” BMC Cancer, vol. 11, article 486, 2011. [30] E.C.Inwald,M.Klinkhammer-Schalke,F.Hofstad ¨ ter et al., “Ki- 67 is a prognostic parameter in breast cancer patients: Results of a large population-based cohort of a cancer registry,” Breast Cancer Research and Treatment,vol.139,no. 2,pp.539–552, [31] K. I. Kim, K. H. Lee, T. R. Kim, Y. S. Chun, T. H. Lee, and H. K. Park, “Ki-67 as a predictor of response to neoadjuvant chemotherapy in breast cancer patients,” Journal of Breast Cancer,vol.17, no.1,pp. 40–46,2014. [32] R.-X. Wang, S. Chen, X. Jin, and Z.-M. Shao, “Value of Ki- 67 expression in triple-negative breast cancer before and aer ft neoadjuvant chemotherapy with weekly paclitaxel plus carbo- platin,” Scienticfi Reports , vol. 6, Article ID 30091, 2016. [33] J. R. Brown, M. P. Digiovanna, B. Killelea, D. R. Lannin, and D. L. Rimm, “Quantitative assessment Ki-67 score for prediction of response to neoadjuvant chemotherapy in breast cancer,” Laboratory Investigation, vol. 94, no. 1, pp. 98–106, 2014. [34] P. Prihantono, The Role of mRNA Expression of TOP2A, BCL- 2 and Ki-67 as Predictors of Clinical Response for Neoadju- vant Chemotherapy using Cyclophosphamide-Adriamicin-5FU (CAF) Regimen in Locally Advanced Breast Cancer,Universitas Hasanuddin, Makassar, Indonesia, 2017, http://repository.unhas .ac.id/handle/123456789/25175. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Oncology Pubmed Central

Ki-67 Expression by Immunohistochemistry and Quantitative Real-Time Polymerase Chain Reaction as Predictor of Clinical Response to Neoadjuvant Chemotherapy in Locally Advanced Breast Cancer

Loading next page...
 
/lp/pubmed-central/ki-67-expression-by-immunohistochemistry-and-quantitative-real-time-ILbQ90lmcQ

References (38)

Publisher
Pubmed Central
Copyright
Copyright © 2017 Prihantono Prihantono et al.
ISSN
1687-8450
eISSN
1687-8469
DOI
10.1155/2017/6209849
Publisher site
See Article on Publisher Site

Abstract

Hindawi Journal of Oncology Volume 2017, Article ID 6209849, 8 pages https://doi.org/10.1155/2017/6209849 Research Article Ki-67 Expression by Immunohistochemistry and Quantitative Real-Time Polymerase Chain Reaction as Predictor of Clinical Response to Neoadjuvant Chemotherapy in Locally Advanced Breast Cancer 1 2 1 1 Prihantono Prihantono, Mochammad Hatta, Christian Binekada, Daniel Sampepajung, 1 3 1 4 Haryasena Haryasena, Berti Nelwan, Andi Asadul Islam, and Andi Nilawati Usman Department of Surgery, Faculty of Medicine, Hasanuddin University, Makassar, Indonesia Biology Molecular and Immunology Laboratory, Faculty of Medicine, Hasanuddin University, Makassar, Indonesia Department of Pathology Anatomy, Faculty of Medicine, Hasanuddin University, Makassar, Indonesia Halal Center, Faculty of Public Health, Hasanuddin University, Makassar, Indonesia Correspondence should be addressed to Andi Nilawati Usman; nilawatiandi@gmail.com Received 12 December 2016; Revised 2 March 2017; Accepted 27 July 2017; Published 31 October 2017 Academic Editor: Subodh Kumar Copyright © 2017 Prihantono Prihantono et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background. Chemotherapy has become a standard of treatment in managing breast cancer. To achieve proper treatment for the right patients, the predictive marker is needed. Ki-67 is a biomarker of proliferation for solid tumor. Studies mentioned association of Ki-67 expression with chemotherapy response. eTh study aims are to evaluate whether Ki-67 expression detected by immunohistochemistry (IHC) and quantitative real-time polymerase chain reaction (qRT-PCR) may predict clinical response to neoadjuvant chemotherapy in breast cancer. Methods. This study utilized a longitudinal study. IHC and qRT-PCR methods were used for detection of Ki-67 expression. Chemotherapy response was calculated using RECIST. Data were analyzed with Chi-square and Wilcoxon’s test. Results. er Th e were 48 subjects in this study. Analysis of Ki-67 expression with chemotherapy response has a significant correlation with 𝑝 = 0.025 (<0.05), OR: 1.69, confidence interval (95% CI) 1.022–2.810. Analysis of Ki-67 mRNA expression with chemotherapy response has a significant correlation 𝑝 = 0.002 (<0.05), OR: 6.85, confidence interval (95% CI) 1.064–44.193. Detection of Ki-67 expression using IHC and qRT-PCR has similar results,𝑝 = 0.012 (<0.05). Conclusion.These results suggest that Ki-67 expression detected by both IHC and qRT-PCR is considered to be a predictor of clinical response to neoadjuvant chemotherapy in locally advanced breast cancer. 1. Introduction [4]. An ideal biomarker must differentiate tumor response towards certain chemotherapy agent before chemotherapy Breast cancer is cancer with the highest incidence in Indone- procedure is done so that we can avoid unnecessary therapy sia, with an incidence of 18.6 patients in 100,000 people annu- and toxic effect of the regiment [5]. Finding a biomarker ally [1]. Most of the patients came in advanced stages, 63% which may predict chemotherapy response for breast cancer were in stage III and stage IV by the time they were diagnosed was still a challenge [6]. [2]. Neoadjuvant chemotherapy has become a standard in Ki-67 is a core protein which was expressed in G1, S, G2, managing locally advanced breast cancer [3]. andMphaseandhasbeenassignedasasolidtumorprolifera- Patients that have the same breast cancer stage and tion marker. Tumor proliferation activity shown with a Ki-67 chemotherapy regiment may not have the same result. To give overexpression in breast cancer is related to poor prognosis precise chemotherapy regimens, we need a predictive marker and also is predictive of neoadjuvant chemotherapy response 2 Journal of Oncology [7]. The rate in Ki-67 relative proportion can be observed PBS. Block endogenous peroxidase by immersing slides in along chemotherapy and correlates with clinical and patho- 0.3% H2O2 solution for 30 minutes at room temperature. logical response in breast cancer [8]. Wash slides in PBS. Blocking normal horse serum was done Breast cancer is a heterogenic disease, based on gene by dripping a solution of 1% normal horse serum and letting it expression profile or breast cancer immunohistochemistry, stand at room temperature for 30 minutes. Wash slides with divided into several subtypes, that is, Luminal A, Luminal PBS. Drip slides with primary antibody AE 1/3; enter them B, Her-2, and triple negative. Every subtype has a different into the humid incubation chamber to be incubated in the response and aggressiveness toward systemic therapy. St. room overnight. Wash slides with PBS 3 times, each for 5 Galen consensus (2011) approved that the kind of subtype minutes. Drip slides with secondary antibody solution, for 60 influences the breast cancer chemotherapy response [9, 10]. minutes at room temperature. Wash slides with PBS 3 times, Because of the importance of predictive marker in man- each for 5 minutes. Drip slides with a solution of polymer- aging breast cancer and lack of data about Ki-67 expression antibody-peroxidase complex, and incubate them at room in Indonesia, we are interested in evaluating the relationship temperature for 30 minutes. Wash slides with PBS 3 times, of Ki-67 expression detected by IHC and qRT-PCR in breast each for 5 minutes. Drip slides with DAB solution. Incubate cancer tissue prior to chemotherapy with chemotherapy them at room temperature. Counterstain with hematoxylin. response in breast cancer patients in Makassar Indonesia. Dehydrate in graded alcohol 70%, 80%, 90%, 95%, and 100%, respectively, for 3 minutes. Immerse the slides in Xylol 2x, each for 10 minutes. Mount and cover them with a glass deck. 2. Material and Methods eTh results are obtained after the sample is checked by a light 2.1. Material. We acquired samples from breast cancer microscope up to10×40 magnification [13, 14]. patients who received chemotherapy in Surgical Oncology Department of Wahidin Sudirohusodo Hospital, Makassar, 2.4. Immunohistochemistry Interpretation. Staining intensity from October 2014 until September 2015. eTh inclusion and percentage of positive nuclei are recorded after manually criteria were women with locally advanced breast can- segmenting tumor from the stroma. Tumors with ER/PR cer and invasive ductal carcinoma and women receiving Remmele scores greater than 3 or positive nuclei greater cyclophosphamide-doxorubicin-5FU [11] regimen. than 1% were considered hormone receptor-positive [13]. We performed clinicopathology data collection which When membrane staining is observed in>10% of tumor cells, involved age and grading. Then we performed immunohisto- Her2 is positive, and if less than 10% membrane staining is chemistry panel examination of ER, PR, Her2, and Ki-67. We observed then Her2 is negative. Ki-67 is negative if there is also detect Ki-67 expression using qRT-PCR. Chemotherapy less than 14% of nuclei staining and positive if≥14% [13, 15]. response was measured clinically by using a caliper, at the moment before starting the 1st cycle of chemotherapy and 2.5. Nucleic Acid Isolation. Extraction of nucleic acid from three weeks aeft r the 3rd cycle of chemotherapy. Data were breast cancer tissue was performed using diatom guani- collected, managed, analyzed, and presented in table and dinium isothiocyanate (GuSCN) method. The sample volume narration form, and then we compared them with the result of about 100 ug/ul breast cancer tissue was added to 900 mL of other studies. of “L6” solution which consists of 120 g guanidinium thio- cyanate (GuSCN) (Fluka Chemie AG, Buchs, Switzerland, 2.2. Clinical Response Criteria. Clinical response in this study cat number 50 990), 100 ml of 0.1 M Tris-HCl, pH 6.4, 22 ml is classified into two categories: nonresponsive, according to 0.2 M ethylenediaminetetraacetate (EDTA), pH 8.0, and 2.6 g RECIST, that is, stable disease or progressive disease, which Triton X-100 (Packard, Instruments) with a na fi l concen- is den fi ed as reduced tumor size < 30%, the size of the tration of 50 mM Tris-HCl, 5 M GuSCN, 20 mM EDTA, tumor remaining the same, increase of the tumor size, or and 0.1% Triton X-100. en Th 20 mL diatom suspension was discovering a new tumor; responsive, according to RECIST, added which consists of 50 ml of H2O and 500 mL of 32% that is, complete response or partial response which is defined (w/v) “Celite” (“diatoms”) (Jansen Chimica, Beerse, Belgium, as disappearance of tumor mass or at least the reduction of 10.846.79). 20 mL suspension of this diatom can bind 10 ug tumorsizebyupto30%andnonewtumors. DNA tissue, and it is then vortexed and centrifuged in 1.5 ml Eppendorf tube with a speed of 13,000 rpm for 15 seconds. 2.3. Immunohistochemical Staining. Immunohistochemical eTh supernatant was discarded, and the sediment was washed staining technique is employing polymer-based methods. eTh with “L2” solution consisting of 120 g GuSCN in 100 ml of primary antibodies and dilutions were used (DakoCytoma- 0.1M Tris-HCl, pH 6.4, by adding 1ml of “L2” solution. tion, Glostrup, Denmark): ER (clone 1D5, 1 : 100), PR (clone Furthermore, vortexing and centrifugation at 13,000 rpm for PgR636, 1 : 100), and Ki-67 (MIB-1, 1 : 200) [12, 13]. Paraffin 15 seconds were performed; then wash the sediment 2 times blocks are cut with a thickness of 4–6 microns and placed in with an “L2” solution, followed by washing with 1 ml of 70% a special glass slide coated poly-L-lysine. Deparaffinize slides ethanol 2 times and 1 ml acetone. The result is then heated in in Xylol solution 2x, every 15 minutes. Rehydrate slides in a water bath at a temperature of 56 Cfor10 minutes. eTh n alcohol-rise 100%, 95%, 90%, 80%, and 70%, respectively, for 60 mL solution of “TE” was added which consists of 1 mM 5 minutes, then drain. Heat-induced antigen retrieval (HIER): EDTA in 10 mM Tris-HCl, pH 8.0; then vortexing is done insert slides in a solution of citric acid 0.01 pH 6.0; heat in and centrifugation is continued at a speed of 13,000 rpm for microwave for 10 minutes, and then chill. Wash slides with 2 minutes. en Th the solution was incubated in the oven for Journal of Oncology 3 10 minutes at a temperature of 56 C. Then vortexing and Table 1: Patient characteristics. centrifugation for 30 seconds at a speed of 13,000 rpm were Characteristics Number (%) 𝑝 value conducted, and the supernatant was taken. eTh supernatant Age from this process will result in nucleotide extraction and was ∘ ≤50 27 (56.3) stored at−800 C before PCR analysis [16, 17]. 0.076 >50 21 (43.8) Grade 2.6. Expression mRNA Ki67 by Real-Time PCR. Detection Low grade 8 (16.7) of mRNA expression of Ki-67 was done according to Real- 0.057 Moderate 26 (54.2) time PCR method previously described by Mitas, 2001, and High grade 14 (29.2) Potemski, 2006. The process of oligonucleotide primers was Subtype specific for the gene, that is, housekeeping gene GAPDH (internal control). Detection of mRNA Ki-67 gene was Luminal A 10 (20.8) performed using specific primers forward and reverse PCR Luminal B 20 (41.7) 0.131 protocols: Ki-67 forward: TCCTTTGGTGGGCACCTAA- Her2 14 (29.2) GACCTG and Ki-67 reverse: TGATGGTTGAGGTCGTTC- Triple negative 4 (8.3) CTTGATG. Cycle RT-PCR for Ki-67 was 94 Cfor3minutes; Ki-67 (SD) ∘ ∘ 94 C for 30 seconds, 38 cycles; and the next step is PCR: 51 C Positive 26 (54.2) for 30 seconds. Also, specific primers of housekeeping genes 0.025 Negative 22 (45.8) used GAPDH forward: TGAGTGCTGTCTCCATGTTTGA Mean of tumor size (SD) and GAPDH reverse: TCTGCTCCCCACCTCTAAGTTG. QRT-PCR used qRT-PCR Green Master Mix Kit, one stage. Before chemotherapy 12.60 (0.40) ∗∗ 0.031 This protocol was optimized for instrument MX4000. Pro- After chemotherapy 08.06 (0.20) tocolwas adjusted by usingtheinstrument by changing the ∗ ∗∗ Chi Square statistical test; Wilcoxon’s statistical test; SD = standard dye dilution based on the instruction manual and following deviation. the recommended instrument factory for RT-PCR cycle program. Passive reference dye was included in the reaction diluted Dr. Wahidin Sudirohusodo aer ft lengthy discussion and eval- 1 : 500. The solution containing the dye was kept away from uation, with a registration number 1659/H4.8.4.5.31/PP36- light, diluted2xbySYBRGreen QRT-PCRMasterMix,and KOMETIK/2015. stayed on the ice. Following the initial melting master mix, the unused portion is stored at 40 Cwiththefollowingnote: avoid repeating freeze-liquid cycles. Reaction experiment 3. Results was prepared by adding the following components. Make a 3.1. Characteristics of Respondents. The research was done in mixture of reagents to the reaction using some components the period from October 2014 to September 2015; subjects such as thefollowing:themixtureofreagentstotakea were breast cancer patients who met the inclusion-exclusion final volume of 25 mL (including experimental RNA), 12.5 mL criteria. Of all samples collected, 48 samples were examined of 2x SYBR Green QRT-PCR master mix plus × mL of by immunohistochemistry method and 30 samples were early primary (optimized concentration) plus nuclease—free tested by qRT-PCR examination. Characteristics of patients PCR—therateofthe primaryendmLH2 × (optimized were all presented with clinical stage III A and stage III concentration), 0,375 mL reference dye solution from step 1 B at the time of initial diagnosis: 30 patients (62.5%) who (optional), and 1.0 mL of RT/RNase enzyme mixture 50𝜇l were responsive to neoadjuvant chemotherapy and 18 patients totalblockswithareaction volume canalsobeused. eTh (37.5%) who were nonresponsive. Breast cancer patient char- reaction was mixed gently so as not to form bubbles (do acteristics are shown in Table 1. not rotate), and then the mixture is distributed to a test tube experiment by adding𝑥 mL RNA in each of the test tube experiments. eTh reaction was mixed gently so as not 3.2. A Representative of Microphotographs of ER, PR, HER2, to form bubbles (not rotated). Reactions were centrifuged and Ki67 Immunostaining in Invasive Ductal Carcinoma. briefly, and the reaction was placed in the instrument, and the eTh representation of microphotographs of ER, PR, HER2, PCR program is ready to run using real-time PCR machine and Ki67 immunostaining of this research is shown in (CFX Connect System, Bio-Rad Laboratories, real-time PCR Figure 1. Microphotographs show nuclei staining in tumors 96-well 0,1 ml, USA). Each sample was measured in triplicate with ER/PR positive, membrane staining in Her2 positive, [17–19]. and nuclei staining in the Ki-67 positive. 2.7. Statistical Analysis. Data was analyzed using SPSS (Sta- 3.3. Amplicfi ation Curve, Melting Peak, and Melting Curve tistical Package for Social Sciences). Samples were analyzed of mRNA Ki67 in Invasive Ductal Carcinoma Detected Using using Chi Square and Wilcoxon’s test.Thisstudyhasanethical qRT-PCR. Figures 2 and 3 show amplicfi ation curve, melting approval from Health Research Ethics Committee of Medical peak, and melting curve of mRNA Ki67 in invasive ductal Faculty of Hasanuddin University, RSPTN UH, dan RSUP carcinoma detected using qRT-PCR. 4 Journal of Oncology ER− ER+ PR− PR+ HER2− HER2+ Ki67− Ki67+ Figure 1: Microphotographs of ER, PR, HER2, and Ki67 immunostaining in invasive ductal carcinoma. 7000 7000 6000 6000 04 10 20 30004 10 20 300 Cycles Cycles Figure 2: Amplification curve of Ki-67 mRNA expression. RFU RFU Journal of Oncology 5 Melting Peak Melting Curve 60 70 80 90 100 60 70 80 90 100 Temperature (Celsius) Temperature (Celsius) Figure 3: Melting peak and melting curve of Ki-67 mRNA expression. Table 2: Relation of Ki-67 expression with chemotherapy response Table 3: Relationships between Ki-67 mRNA expression with in breast cancer. chemotherapy response in breast cancer. Chemotherapy response Chemotherapy response Ki-67 expression Total Ki-67 mRNA expression Total Responsive Nonresponsive Responsive Nonresponsive Positive 20 (76.9%) 6 (23.1%) 26 (100%) High 16 (76.2%) 5 (23.8%) 21 (100%) Negative 10 (45.5%) 12 (54.5%) 22 (100%) Low 1 (11.1%) 8 (88.9%) 9 (100%) Total 30 (62.5%) 18 (37.5%) 48 (100%) Total 17 (56.7%) 13 (43.3%) 30 (100%) Chi-square𝜒 =5.035;df=1;𝑝=0.025 (𝑝>0 ,05). Chi-square𝜒 =10.866;df=1;𝑝=0.002 (𝑝<0.05). Table 4: Relationship between Ki-67 expression by immunohisto- 3.4. Relation of Ki-67 Expression with Neoadjuvant Chemo- chemistryand Ki-67mRNAexpressiondetectedbyqRT-PCR. therapy Response. To find out whether the Ki-67 expression has a relationship with clinical response to neoadjuvant Ki-67 mRNA expression Ki-67 expression Total chemotherapy in breast cancer, we used bivariate analysis, High Low which can be seen in Table 2. Positive 15 (88.2%) 2 (11.8%) 17 (100%) Analysis of Ki-67 expression detected by immunohis- Negative 6 (46.2%) 7 (53.8%) 13 (100%) tochemistry found that positive Ki-67 expression tends to Total 21 (70%) 9 (30%) 48 (100%) be responsive to neoadjuvant chemotherapy 20 (76.9%) and Spearman’s𝑝=0.012 (𝑝>0 ,05). negative Ki-67 expression tends to be nonresponsive to neoadjuvant chemotherapy 12 (54.5%); there were statistically significant differences with 𝑝 value = 0.025 (𝑝<0.05). This and low level of Ki-67 mRNA expression tends to be non- result suggests that Ki-67 expression detected by immuno- histochemistry may predict clinical response to neoadjuvant responsive to neoadjuvant chemotherapy, 8 (88.9%). There chemotherapy in locally advanced breast cancer. were statistically significant differences with 𝑝 value = 0.002 (𝑝<0.05). This result suggests that Ki-67 mRNA expression detected by qRT-PCR may predict clinical response to neoad- 3.5. Relation of Ki-67 mRNA Expression with Neoadjuvant juvant chemotherapy in locally advanced breast cancer. Chemotherapy Response. Based on qRT-PCR examination, we foundthatthemeanvalueofKi-67 mRNA expression was11.241±1.971. We determine Ki-67 mRNA expression 3.6. Relationship between Ki-67 Expression with Neoadjuvant cut-off point as 9.235, using receiver operating characteristics Chemotherapy Response. To find out whether Ki-67 expres- curve (ROC). en Th Ki-67 mRNA expression was categorized sion by immunohistochemistry has a relationship with Ki-67 as high level if it was≥9.235 and low level< 9.235. mRNA expression detected by qRT-PCR, we used bivariate To find out whether Ki-67 mRNA expression has a rela- analysis,which canbeseeninTable4. tionship with clinical response to neoadjuvant chemotherapy Analysis of Ki-67 expression by immunohistochemistry in breast cancer, we used bivariate analysis, which can be seen and qRT-PCR found that a high level of Ki-67 mRNA expres- in Table 3. sion tends to have positive Ki-67 expression, 15 (88.2%), Analysis of Ki-67 mRNA expression detected by qRT- and low level of Ki-67 mRNA expression tends to have PCR found that a high level of Ki-67 mRNA expression tends negative Ki-67 expression, 7 (53.8%). er Th e were statistically to be responsive to neoadjuvant chemotherapy, 16 (76.2%), significant differences with 𝑝 value = 0.012 (𝑝 < 0.05). This −d(2&5)/dT RFU (10 ) 6 Journal of Oncology Table 5: Multivariate regression analysis for predictive factors. of 23 (8.7%), Her2(+): 4 out of 18 (22.2%), and triple negative: 10 out of 41 (24.4%) (𝑝=0.041)[22].Horimoto et al.’sstudy Variable OR 95% CI 𝑝 mentioned that Luminal B – Her2(−)patientwhoreceived Age 2.553 0.018–1.508 0.110 chemotherapy had a pathological complete response rate 35% Grading 0.063 0.158–4.160 0.802 which is related to disease-free survival [23, 24]. Subtype 0.528 0.134–2.516 0.468 Proliferation activity has prognostic information. Mea- Ki-67 (IHC) 0.133 0.124–20.969 0.716 surement of proliferation activity using Ki-67 detected by IHC is still controversy [25]; whether Ki-67 scores have much Ki-67 mRNA Expression 4.385 1.206–286.53 0.036 ∗ prognostic information and could predict the benefit of the Binary logistic regression analysis. addition of cytotoxic chemotherapy is still a question [25–27]. Several studies had investigated Ki-67 prognostic signif- icance in breast cancer. eTh study shows that Ki-67 over- result suggests that Ki-67 mRNA expression detected by qRT- expression correlates with disease-free survival and overall PCR and Ki-67 expression using IHC have similar results. survival [22, 28–30]. However, a patient with high prolifer- ation rate has a better response toward chemotherapy [8, 29]. 3.7. Multivariate Analysis. Multivariate binary logistic regres- Furthermore, this marker may help the screening of patient sion analysis was used to determine independent predictors who might not get any advantage from chemotherapy: those of clinical response to neoadjuvant chemotherapy in locally who have Her2 positive and negative hormonal receptor and advanced breast cancer. Data shown in Table 5 revealed that low proliferation tumor [8, 22, 29]. Ki67 mRNA expression was an independent predictor for Studies revealed that Ki-67 protein expression correlates neoadjuvant chemotherapy in locally advanced breast cancer with response to chemotherapy. High Ki-67 proliferation rate (OR, 4.385; CI, 1.206–286.53;𝑝=0.036). was predictive of a higher probability of complete patholog- ical response [26]. Fasching et al. investigated Ki-67 by IHC 4. Discussion of 552 patients and found that Ki-67 expression with 13% cut- From this study, we collectedvariableages: theyoungestwas off could predict complete pathological response with 94% 29 years old and the oldest was 74 years old, with a median sensitivity and 36% specificity [13, 29]. Kim et al. found that age of 46 years old, and the most populated age found was in Ki-67 expression with cutoff value 25% in breast cancer tissue is a predictor of neoadjuvant chemotherapy response. Ki-67 the 4th decade, as many as 40.5%. Globally, breast cancer patient< 50 years old is 33% of the is also a predictive factor for complete pathological response population; meanwhile, in Asia-Pacific, it is 42%, in South- in ER-negative and HER2-positive breast cancer patients East Asia it is 47%, and, in Australia, it is 21%. SEER data in [31]. Wang et al. found that Ki-67 independently correlated Americashowedbreastthatcanceriscommonin55–64-year- with complete pathological response and clinical response, old group of age, with a median age of 61 years old [20]. grades, and node status. Reduction of Ki-67 expression aer ft Several kinds of literature mentioned that generally the neoadjuvant chemotherapy was observed in patients with a ageofbreastcancerpatient is youngerinAsiathaninEurope relatively better response [32]. Research of Ki-67 expression measured using quantitative immunouo fl rescence automated and America. This difference possibly is caused by lifestyle factors, diet pattern, or the existence of certain gene which is quantitative analysis (AQUA) technology found that high relatedtoracesothatthe dieff renceinage occurred [20]. Ki-67 levels are a predictor of neoadjuvant chemotherapy response [33]. From the study, data obtained are as follow low grade 16.7%, moderate grade 54.2%, and high-grade 29.2%. In our previous study, we found an insignicfi ant cor- Histopathology grading is a particular prognostic factor. relation between expression of mRNA Ki-67 baseline with Some newest studies confirm the importance of histopa- chemotherapy response. But, chemotherapy cause decrease thology grading as a predictive and prognostic factor in in mRNA expression of Ki-67. eTh rate of Ki-67 mRNA breast cancer. Engstrøm et al.’s study showed in the rst fi five expression has a significant correlation with clinical response years, grade 2 and 3 breast cancer had a poorer prognosis to chemotherapy [17, 34]. than grade 1 [21, 22]. Several studies have found that changes before and after therapy in Ki-67 are a strong and independent predictor of Breast cancer subtype is influencing chemotherapy response. Rouzier et al.’s study showed that a complete patho- disease-free time and survival rate [13, 35, 36]. The expression logic response rate in Basal-like subtype is as much as 45% before and aer ft chemotherapy can be a significant indepen- dent predictor of the overall survival in multivariate analysis. and Her2 is as much as 45%; meanwhile luminal had a patho- logical complete response rate of 6% and no complete patho- For this reason, nowadays, tumor response on neoadjuvant logical response rate in normal-like subtype [23]. Luangdilok chemotherapy tryout is evaluated with the examination of et al.’s study mentioned that complete pathological response immunohistochemistry Ki-67 [37]. in triple-negative subtype was 19.2% and Her2 was 24.2%. Tumors with Ki-67 mRNA expression were examined by qRT-PCR associated with disease-free survival and overall Meanwhile, Luminal A was 4.4%, and Luminal B was 9.7% [22]. A study of 102 breast cancer patients obtained complete survival of patients treated with adjuvant chemotherapy pathological response in 16 (15.7%) patients. Pathological regimens. eTh results showed that the tumor with a high level of KI67 mRNA expression might be valuable for adjuvant complete response that is appropriate with dieff rent subtypes is as follows:LuminalA:0outof20(0%),LuminalB:2out therapy using docetaxel [38]. Journal of Oncology 7 Studies found that high mRNA expression of Ki-67 was [7] R.L.Jones,J.Salter,R.A’Hern etal., “ep Th rognosticsignif- icance of Ki67 before and aeft r neoadjuvant chemotherapy in associated with a higher rate of the complete pathological breast cancer,” Breast Cancer Research and Treatment,vol.116, response (36.4%) compared with low levels mRNA Ki-67 no. 1, pp. 53–68, 2009. (5.8%). mRNA expression of Ki-67 is a predictor of the [8] R.Burcombe,G.D.Wilson,M.Dowsettetal.,“Evaluationof achievement of complete pathological response and better Ki-67 proliferation and apoptotic index before, during and aer ft than Ki-67 expression which was detected by immunohisto- neoadjuvant chemotherapy for primary breast cancer,” Breast chemistry [39]. Ki-67 mRNA expression level is more objec- Cancer Research,vol.8,no.3, articleR31,2006. tive and highly reproducible quantification of proliferation [9] A.Goldhirsch,W. C. Wood,A.S.Coates, R. D.Gelber,B. activity and more meaningful than Ki-67 protein expression Th urlima ¨ nn, and H.-J. Senn, “Strategies for subtypes-dealing by immunohistochemistry, either by visual scoring or by with the diversity of breast cancer: highlights of the St Gallen quantitative image analysis [17, 39]. international expert consensus on the primary therapy of early breast cancer 2011,” Annals of Oncology,vol.22,no.8,pp. 1736– 5. Conclusion 1747, 2011. [10] A. Goldhirsch, E. P. Winer, A. Coates, R. Gelber, M. Piccart- These results suggest that Ki-67 expression detected by both Gebhart, B. Th urlima ¨ nn et al., “Personalizing the treatment of IHC and qRT-PCR is considered to be predictor of clinical women with early breast cancer: highlights of the St Gallen response to neoadjuvant chemotherapy in locally advanced International Expert Consensus on the Primary Therapy of breast cancer. This result also suggests that Ki-67 mRNA Early Breast Cancer 2013,” Annals of Oncology,vol.24, no.9,pp. 2206–2223, 2013. expression detected by qRT-PCR and Ki-67 expression using IHC have similar results. [11] G. Gasparini, M. Barbareschi, C. Doglioni et al., “Expression of bcl-2 protein predicts efficacy of adjuvant treatments of operable node-positive breast cancer,” Clinical Cancer Research, Conflicts of Interest vol. 1, no. 2, pp. 189–198, 1995. [12] M. E. H. Hammond, D. F. Hayes, M. Dowsett, D. C. Allred, ea Th uthorshavenoconflictsofinteresttodeclare. K. L. Hagerty, S. Badve et al., “American Society of Clinical Oncology/College of American Pathologists guideline recom- Acknowledgments mendations for immunohistochemical testing of estrogen and progesterone receptors in breast cancer (unabridged version),” eTh authors very gratefully thank all breast cancer patients Archives of Pathology & Laboratory Medicine,vol.134,no.4, pp. who were willing to be a respondent in this study. e48–e72, 2010. [13] H.-P. Sinn, A. Schneeweiss, M. Keller et al., “Comparison of immunohistochemistry with PCR for assessment of ER, PR, References and Ki-67 and prediction of pathological complete response in [1] M. Wahidin, R. Noviani, S. Hermawan, V. Andriani, A. Ardian, breast cancer,” BMC Cancer,vol.17,no.1,article124,2017. and H. Djarir, “Population-based cancer registration in Indone- [14] E. Luporsi, F. Andre, ´ F. Spyratos et al., “Ki-67: Level of evidence sia,” Asian Pacicfi Journal of Cancer Prevention,vol.13, no.4,pp. and methodological considerations for its role in the clinical 1709-1710, 2012. management of breast cancer: Analytical and critical review,” [2] C.H.Ng,N.BhooPathy,N.A.Taibetal.,“Comparisonofbreast Breast Cancer Research and Treatment,vol.132,no.3, pp.895– cancer in Indonesia and Malaysia—a clinico-pathological study 915, 2012. between dharmais cancer centre Jakarta and university Malaya [15] N.Iqbal andN.Iqbal,“HumanEpidermal GrowthFactor medical centre, Kuala Lumpur,” Asian Pacific Journal of Cancer Receptor 2 (HER2) in cancers: overexpression and therapeutic Prevention, vol. 12, no. 11, pp. 2943–2946, 2011. implications,” Molecular Biology International,vol.2014, pp.1–9, [3] M. Kaufmann, G. N. Hortobagyi, A. Goldhirsch et al., “Rec- ommendations from an international expert panel on the use [16] R. Boom,C.J.A.Sol,M.M.M.Salimans, C.L. Jansen,P.M. of neoadjuvant (primary) systemic treatment of operable breast E. Wertheim-Van Dillen, and J. van der Noordaa, “Rapid and cancer: an update,” JournalofClinicalOncology,vol.24,no.12, simple method for purification of nucleic acids,” Journal of pp.1940–1949,2006. Clinical Microbiology,vol.28,no.3,pp.495–503,1990. [4] G. Fountzilas, U. Dafni, M. Bobos et al., “Evaluation of the prog- [17] P. Prihantono, “Profile of mRNA expression of Ki-67 in breast nostic role of centromere 17 gain and HER2/topoisomerase ca ncer patients pre- and post- chemotherapy,” American Journal II alpha gene status and protein expression in patients with of Clinical and Experimental Medicine, vol. 5, no. 1, p. 10, 2017. breast cancer treated with anthracycline-containing adjuvant [18] M. Mitas, K. Mikhitarian, C. Walters et al., “Quantitative real- chemotherapy: Pooled analysis of two Hellenic Cooperative time RT-PCR detection of breast cancer micrometastasis using Oncology Group (HeCOG) phase III trials,” BMC Cancer,vol. a multigene marker panel,” International Journal of Cancer,vol. 13, article 163, 2013. 93,no.2, pp.162–171,2001. [5] R. M. Connolly and V. Stearns, “Current approaches for neoad- [19] P. Potemski, E. Pluciennik, A. K. Bednarek et al., “Ki-67 juvant chemotherapy in breast cancer,” European Journal of expression in operable breast cancer: a comparative study of Pharmacology,vol.717,no.1-3, pp.58–66,2013. immunostaining and a real-time RT-PCR assay,” Pathology- Research and Practice,vol.202,no. 7,pp.491–495,2006. [6] L. Santarpia, Y. Qi, K. Stemke-Hale et al., “Mutation profiling identifies numerous rare drug targets and distinct mutation [20] N.Howlader,A.Noone,M.Krapcho,N.Neyman, R. Aminou, patterns in different clinical subtypes of breast cancers,” Breast W. Waldron et al., SEER Cancer Statistics Review, 1975–2008, Cancer Research and Treatment,vol.134,no.1,pp.333–343,2012. National Cancer Institute, Bethesda, Md, USA, 2011. 8 Journal of Oncology [21] M. J. Engstrøm, S. Opdahl, A. I. Hagen et al., “Molecular sub- [35] M. Colozza, E. Azambuja, F. Cardoso, C. Sotiriou, D. Larsimont, types, histopathological grade and survival in a historic cohort and M. J. Piccart, “Proliferative markers as prognostic and of breast cancer patients,” Breast Cancer Research and Treat- predictive tools in early breast cancer: where are we now?” ment,vol.140,no.3, pp.463–473,2013. Annals of Oncology,vol.16, no.11, pp.1723–1739,2005. [36] R. Nishimura, T. Osako, Y. Okumura, M. Hayashi, and N. [22] S. Luangdilok, N. Samarnthai, and K. Korphaisarn, “Associ- ation between pathological complete response and outcome Arima, “Clinical significance of Ki-67 in neoadjuvant chemo- therapy for primary breast cancer as a predictor for chemosen- following neoadjuvant chemotherapy in locally advanced breast sitivity and for prognosis,” Breast Cancer,vol.17,no.4,pp.269– cancer patients,” Journal of Breast Cancer,vol.17, no.4,pp. 376– 275, 2010. 385, 2014. [37] N. Niikura, T. Iwamoto, S. Masuda et al., “Immunohistochem- [23] R. Rouzier, C. M. Perou, W. F. Symmans et al., “Breast cancer ical Ki67 labeling index has similar proliferation predictive molecular subtypes respond differently to preoperative chemo- power to various gene signatures in breast cancer,” Cancer therapy,” Clinical Cancer Research, vol. 11, no. 16, pp. 5678–5685, Science,vol.103,no.8, pp.1508–1512,2012. [38] R. M. Wirtz, H. Sihto, J. Isola et al., “Biological subtyping of early [24] Y.Horimoto,A.Arakawa,M.Tanabeetal.,“Ki67expression breast cancer: a study comparing RT-qPCR with immunohisto- and the effect of neo-adjuvant chemotherapy on luminal HER2- chemistry,” Breast Cancer Research and Treatment,vol.157,no. negative breast cancer,” BMC Cancer,p.550,2014. 3,pp.437–446,2016. [25] A. S. Coates, E. P. Winer, A. Goldhirsch et al., “Tailoring ther- [39] F. Marme, A. Schneeweiss, J. Aigner et al., “Abstract P3-06- apies—improving the management of early breast cancer: St 08: Ki-67 mRNA as a predictor for response to neoadjuvant Gallen International Expert Consensus on the Primary Therapy chemotherapy in primary breast cancer,” Cancer Research,vol. of Early Breast Cancer 2015,” Annals of Oncology,vol.26, no.8, 72,no.24,2014. pp.1533–1546,2015. [26] E. De Azambuja, F. Cardoso, G. De Castro et al., “Ki-67 as prognostic marker in early breast cancer: a meta-analysis of published studies involving 12,155 patients,” British Journal of Cancer,vol.96,no.10,pp.1504–1513,2007. [27] C.Criscitiello,D.Disalvatore,M.DeLaurentiisetal.,“High Ki-67 score is indicative of a greater benefit from adjuvant chemotherapy when added to endocrine therapy in Luminal B HER2 negative and node-positive breast cancer,” The Breast ,vol. 23,no. 1,pp.69–75,2013. [28] R. Haque, S. A. Ahmed, G. Inzhakova et al., “Impact of breast cancer subtypes and treatment on survival: an analysis spanning two decades,” Cancer Epidemiology, Biomarkers & Prevention, vol.21,no.10,pp. 1848–1855,2012. [29] P. A. Fasching, K. Heusinger, L. Haeberle et al., “Ki67, chem- otherapy response, and prognosis in breast cancer patients receiving neoadjuvant treatment,” BMC Cancer, vol. 11, article 486, 2011. [30] E.C.Inwald,M.Klinkhammer-Schalke,F.Hofstad ¨ ter et al., “Ki- 67 is a prognostic parameter in breast cancer patients: Results of a large population-based cohort of a cancer registry,” Breast Cancer Research and Treatment,vol.139,no. 2,pp.539–552, [31] K. I. Kim, K. H. Lee, T. R. Kim, Y. S. Chun, T. H. Lee, and H. K. Park, “Ki-67 as a predictor of response to neoadjuvant chemotherapy in breast cancer patients,” Journal of Breast Cancer,vol.17, no.1,pp. 40–46,2014. [32] R.-X. Wang, S. Chen, X. Jin, and Z.-M. Shao, “Value of Ki- 67 expression in triple-negative breast cancer before and aer ft neoadjuvant chemotherapy with weekly paclitaxel plus carbo- platin,” Scienticfi Reports , vol. 6, Article ID 30091, 2016. [33] J. R. Brown, M. P. Digiovanna, B. Killelea, D. R. Lannin, and D. L. Rimm, “Quantitative assessment Ki-67 score for prediction of response to neoadjuvant chemotherapy in breast cancer,” Laboratory Investigation, vol. 94, no. 1, pp. 98–106, 2014. [34] P. Prihantono, The Role of mRNA Expression of TOP2A, BCL- 2 and Ki-67 as Predictors of Clinical Response for Neoadju- vant Chemotherapy using Cyclophosphamide-Adriamicin-5FU (CAF) Regimen in Locally Advanced Breast Cancer,Universitas Hasanuddin, Makassar, Indonesia, 2017, http://repository.unhas .ac.id/handle/123456789/25175.

Journal

Journal of OncologyPubmed Central

Published: Oct 31, 2017

There are no references for this article.