Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

KRAS and BRAF Mutations in 203 Esophageal Squamous Cell Carcinomas: Pyrosequencing Technology and Literature Review

KRAS and BRAF Mutations in 203 Esophageal Squamous Cell Carcinomas: Pyrosequencing Technology and... Ann Surg Oncol (2013) 20:S485–S491 DOI 10.1245/s10434-012-2819-z O R I G IN AL ARTI CL E – TRAN SLATIO NA L R ESEA RCH AN D B IOM A RK ERS KRAS and BRAF Mutations in 203 Esophageal Squamous Cell Carcinomas: Pyrosequencing Technology and Literature Review Hironobu Shigaki, MD, Yoshifumi Baba, MD, PhD, Masayuki Watanabe, MD, PhD, FACS, Keisuke Miyake, MSc, Asuka Murata, MD, Shiro Iwagami, MD, PhD, Takatsugu Ishimoto, MD, PhD, Masaaki Iwatsuki, MD, PhD, Naoya Yoshida, MD, PhD, and Hideo Baba, MD, PhD, FACS Department of Gastroenterological Surgery, Graduate School of Medical Science, Kumamoto University, Kumamoto, Japan ABSTRACT Conclusions. These results suggest that KRAS and BRAF Background. Epidermal growth factor receptor (EGFR) mutations play a limited role in the development of ESCC signaling is one of the most promising targets for molec- and that mutation analysis is not useful as a screening test ular-targeted therapies in esophageal squamous cell for sensitivity to anti-EGFR therapy in ESCC. carcinoma (ESCC). Thus, the molecular diagnosis of KRAS and BRAF mutations is clinically important in therapeutic decision making. However, the frequency of KRAS and Esophageal squamous cell carcinoma (ESCC) is the BRAF mutations in ESCCs remains inconclusive because major histological type of esophageal cancer in East Asian of the limited sample sizes of previous studies (all countries and is one of the most aggressive malignant N B 80). Pyrosequencing is a nonelectrophoretic nucleo- tumors. Despite remarkable advances in multimodal tide extension sequencing technology that can be used for therapies, patient prognosis remains poor, even for those mutation testing. 2–5 whose carcinomas have been completely resected. The Methods. The frequency of KRAS and BRAF mutations limited improvement in treatment outcomes by conven- was examined using a nonbiased database of 203 resected tional therapies urged us to seek innovative strategies for ESCCs and a high-throughput pyrosequencing assay. treating ESCC, especially those that are molecularly tar- Results. The validity of the KRAS pyrosequencing method geted. One of the most promising targets is the inhibition of was initially demonstrated by detection of all 4 types of KRAS the epidermal growth factor receptor (EGFR) by mono- mutations [c.35G[T(codon 12GGT[GTT), c.35G[A clonal antibodies (e.g., cetuximab, panitumumab) or small (codon 12 GGT[GAT), c.34G[T (codon12GGT[TGT), molecule tyrosine kinase inhibitors (e.g., erlotinib, gefiti- c.38G[A mutation(codon 13GGC[GAC)], which had been 6–10 nib). The EGFR signal transduction network plays a previously diagnosed using Scorpion-ARMS technology, in 9 crucial role in multiple tumorigenic processes, contributing colon cancer tissues (9 of 9; 100 %). Similar results were to cell-cycle progression, angiogenesis, metastasis, and demonstrated for BRAF mutational status in 3 colon cancer protection of the cancer cell from apoptosis. Mutations in cell lines (HCT116, Colo201, and HT29), which were vali- the Kirsten Ras 1 (KRAS) and V-Raf Murine Sarcoma Viral dated by Sanger dideoxy sequencing. Subsequently, the KRAS Oncogene Homolog B1 (BRAF) genes may be predictive of mutation was found to be extremely rare (1 of 203; 0.5 %), and response to drugs directly linked to the EGFR path- the BRAF mutation was absent (0 of 203; 0 %), in the dataset 12–14 way. Thus, molecular diagnosis of these mutations is of 203 ESCCs. increasingly important in making therapeutic decisions. Several previous studies have examined the frequency of KRAS and BRAF mutations in ESCCs; however, they were The Author(s) 2012. This article is published with open access all limited by small sample sizes (all N B 80) (Table 1), at Springerlink.com 8,15–20 yielding inconclusive results. First Received: 14 October 2012; Pyrosequencing is a nonelectrophoretic nucleotide Published Online: 30 December 2012 extension sequencing technology for various applications, H. Baba, MD, PhD, FACS 21–24 including mutation testing of tumors. This technology e-mail: hdobaba@kumamoto-u.ac.jp S486 H. Shigaki et al. TABLE 1 Studies on KRAS Study Sample Methods Mutation Codons and BRAF mutations in ESCC size detected N (%) examined Studies on KRAS mutations in ESCC Ma et al. 35 Pyrosequencing 2 (5.7 %) Codons 12–13 Liu et al. 50 Pyrosequencing 6 (12 %) Codons 12–13 Lorenzen et al. 37 Direct sequencing 0 (0 %) Codons 12–13 Hollstein et al. 16 Direct sequencing 0 (0 %) Codons 12–13 Victor et al. 27 PCR and oligomer hybridization assay 0 (0 %) Codons 12–13 Hollstein et al. 25 PCR and oligomer hybridization assay 0 (0 %) Codons 12–13 Present study 203 Pyrosequencing 1 (0.5 %) Codons 12–13 Studies on BRAF mutations in ESCC Ma et al. 35 Pyrosequencing 0 (0 %) Codon 600 Maeng et al. 80 OncoMap 1 (1.2 %) Codon 600 Present study 203 Pyrosequencing 0 (0 %) Codon 600 has several advantages. First, it has higher sensitivity than p.Gly12Val), c.35G[A(codon 12GGT[GAT; p.Gly12Asp), classical Sanger dideoxy sequencing. Sanger dideoxy c.34G[T(codon 12 GGT[TGT; p.Gly12Cys), and c.38G[A sequencing needs more than 20 % of tumor load in a speci- mutation (codon 13 GGC[GAC; p.Gly13Asp)], which had men to render a reliable result, while pyrosequencing can been already diagnosed by Scorpion-ARMS technology, were render a reliable result with a tumor load of 5 %. Second, also included in this study to validate the pyrosequencing pyrosequencing is faster than Sanger dideoxy sequencing. method for the detection of KRAS mutations. Third, pyrosequencing is more cost effective. Collectively, pyrosequencing is a useful method in molecular diagnostics Genomic DNA Extraction 25,26 and large-scale epidemiological studies. Therefore, in the present study, KRAS and BRAF One pathologist marked the tumor areas on slides mutations were screened using a nonbiased database of 203 stained with hematoxylin-eosin. Genomic DNA was ESCCs and pyrosequencing technology. extracted from tumor lesions enriched with neoplastic cells, without adjacent normal tissue, using an FFPE kit (Qiagen, Valencia, CA). DNA was also extracted from 3 cell lines: PATIENTS AND METHODS Colo201 and HT29 with the BRAF mutation c.1799T[A (p.V600E), and HCT116 with wild-type BRAF using a Study Subjects 28,29 QIAmp DNA mini kit (Qiagen, Valencia, CA). DNA was stored at -20 C before use. A total of 217 consecutive patients with ESCC who were undergoing curative resection at Kumamoto Univer- sity Hospital between April 2005 and December 2010 were Whole Genome Amplification enrolled in this study. There were 13 patients excluded because of the unavailability of adequate tissue samples. Whole genome amplification (WGA) is a useful tech- We initially quantified KRAS and BRAF mutation in 204 nique for preserving original study material for many cancer specimens and obtained valid results in 203 cases different assays and for future studies. In WGA, genomic (99.5 %). Thus, 203 ESCCs were finally included in this DNA is amplified by polymerase chain reaction (PCR) study. Tumor staging was done by the American Joint using primers consisting of a random sequence of 15 Committee on Cancer Staging Manual (7th edition). nucleotides. Each PCR mix contained 40 pmol of the Written informed consent was obtained from each subject, random primers, 1.0 nmol each of dNTP, 2.0 mmol/L and the institutional review board of Kumamoto University MgCl2, 19 PCR buffer (Applied Biosystems, Foster City, CA), 0.25 U of AmpliTaq Gold 360 (Applied Biosystems), approved the study procedures. A total of 9 patients with colon cancers harboring 4 dif- and 5 ll of template DNA solution in a total volume of 50 ll. PCR conditions consisted of initial denaturation at ferent KRAS mutations [c.35G[T (codon12GGT[GTT; KRAS and BRAF in Esophageal Cancer S487 95 C for 10 min; 50 cycles of 95 C for 60 s, annealing RESULTS (37 C for 2 min), ramping from 37 to 55 C (0.1 C/s), 55 C for 2 min, and 68 C for 30 s; and a final extension Clinical Data at 72 C for 7 min. A summary of the clinical characteristics of the patients Pyrosequencing for KRAS and BRAF Mutations is given in Table 2. In this cohort, the 5-year overall sur- vival rates of patients treated by esophagectomy were Pyrosequencing technology has been shown to reliably 83.9 % for stage I, 59.7 % for stage II, and 36.7 % for stage III. These rates are similar to those from the detect KRAS mutations with 100 % analytic sensitivity and specificity, even when the proportion of mutant alleles is as low ‘‘Comprehensive Registry of Esophageal Cancer in Japan’’ as 10 %. PCR amplification primers for pyrosequencing tar- (79.5 % for stage I, 58.9 % for stage II, and 39.8 % for geted for KRAS (codons 12, 13), BRAF (codon 600) were: stage III), which supports the absence of bias in our KRAS-F, forward, 5 -NNNGGCCTGCTGAAAATGACT database. 0 0 GAA-3 ; and KRAS-R, reverse biotinylated primer, 5 -TTA GCTGTATCGTCAAGGCACTCT-3 ; and BRAF-F, for- Validation of the Pyrosequencing Assay for KRAS ward biotinylated primer, 5 -CAGTAAAAATAGGTGATTT Mutation Detection 0 0 TG-3 ; and BRAF-R reverse, 5 -TCCAGACAACTGTTCAA ACTGA-3 . Each PCR mix contained the forward and reverse We first examined the validity of the pyrosequencing primers (20 pmol each), 1.0 nmol of each dNTP with dUTP, method using eleven colon cancer tissues harboring 4 different KRAS mutations [c.35G[T (codon12GGT[GTT; p.Gly12- 2 mmol/L MgCl2, 19 PCR buffer, 1.25 U of AmpliTaq Gold 360, 0.5 U of AmpErase UNG and 5 ll of template WGA Val), c.35G[A(codon 12GGT[GAT; p.Gly12Asp), product in a total volume of 50 ll. PCR condition consisted of c.34G[T(codon 12 GGT[TGT; p.Gly12Cys), and c.38G[A initial denaturation at 50 C (10 min) for AmpErase UNG; mutation (codon 13 GGC[GAC; p.Gly13Asp)]. These initial denaturation at 94 C (10 min) for AmpliTaq Gold 360; mutations had already been diagnosed by the sensitive Scor- 50 cycles of 95 C (30 s), annealing (30 s; 55 C for BRAF, pion-ARMS technology [i.e., Amplification Refractory 57 C for KRAS), and 72 C (30 s); and a final extension at Mutation System incorporating a unique bifunctional flores- 72 C (7 min). The PCR products were electrophoresed cent primer/probe molecule (Scorpion)]. As shown in through an agarose gel to confirm successful amplification of Table 3, all 4 types of mutations could be detected using the the 82-bp (KRAS) and the 80-bp PCR (BRAF)product. pyrosequencing technology (11 of 11, 100 %) (Fig. 1), which KRAS and BRAF pyrosequencing was performed using the demonstrated that the method was reliable for the detection of KRAS mutations in tumors. PyroMark Q24 System (Qiagen, Valencia, CA) according to the manufacturer’s instructions (Fig. 1 for KRAS; Fig. 2 for BRAF). All forward sequencing results were confirmed by KRAS Mutation in ESCC reverse sequencing. In the KRAS pyrosequencing assay, the presence of a mutation was routinely confirmed by 3 different Pyrosequence analysis of KRAS codon 12 and 13 sequencing primers and by the creation of the frameshifted mutations was successful for 203 of 204 (99.5 %) ESCC open reading frame of the mutant sequence relative to a wild- paraffin-embedded tissues. Among the 203 ESCCs, only 1 type sequence in a program. The primer KRAS-PF1 (5 - case harbored a KRAS mutation [c.34G[T (codon 12 TGTGGTAGTTGGAGCTG-3 ; pyrosequencing nucleotide GGT[TGT; p.Gly12Cys)]. This mutation was also diag- dispensation order, ACTGATCG ATCGATCGATCGATC nosed by the Scorpion-ARMS technology (data not GATCG) could detect the c.35G[T(codon12GTT) and shown). This result showed that the frequency of KRAS c.35G[A (codon 12 GAT) mutations. The primer KRAS-PF2 mutations in ESCC was extremely low. 0 0 (5 -TGTGGTAGTTGGAGCT-3 ; pyrosequencing nucleo- tide dispensation order, ATCGATCGATCGATCGATCG Validation of Pyrosequencing Assay for BRAF ATCATCG) could detect the c.34G[T (codon 12 TGT) Mutation Detection mutation. The primer KRAS-PF3 (5 -TGGTAGTTGGAGC TGGT-3 ; pyrosequencing nucleotide dispensation order, To validate our BRAF pyrosequencing assay, both py- GATGCATGCATGCATGCATGCATGCATGC) could rosequencing and Sanger dideoxy sequencing were detect the c.34G[A (codon 13 GAC) mutation. In the BRAF performed on the same set of DNA samples from 3 colon pyrosequencing assay, the primer was 5 -CACTCCATC cancer cell lines (HCT116, Colo201, and HT29). HCT116 GAGATTTC-3 , and the pyrosequencing nucleotide dispen- possesses wild-type BRAF, and Colo201 and HT29 harbors sation order was CTGCATGCATGCTGCA. a BRAF mutation [c.1799T[A (p.V600E)]. In Sanger S488 H. Shigaki et al. FIG. 1 Pyrograms of wild-type and mutant KRAS in colorectal carcinoma. a Wild-type codon 12 detected by the KRAS-PF1 primer. b c.35GT (codon 12 GTT) mutation detected by the KRAS- PF1 primer. c c.35GA (codon 12 GAT) mutation detected by the KRAS-PF1 primer. d Wild-type codon 12 detected by the KRAS- b PF2 primer. e c.34GT (codon 12 TGT) mutation detected by the KRAS-PF2 primer. f Wild-type codon 13 detected by the KRAS- PF3 primer. g c.38GA (codon 13 GAC) mutation detected by the KRAS-PF3 primer. Arrows indicate the presence of mutant alleles dideoxy sequencing, HCT116 showed was homozygous (Fig. 2). Among all 3 cell lines, pyrosequencing gave the wild-type for the BRAF gene, and HT29 and COLO201 same results as Sanger sequencing for BRAF mutational were shown to be heterozygous BRAF V600E mutants status (Fig. 2). KRAS and BRAF in Esophageal Cancer S489 FIG. 2 Detection of BRAF V600E in colon cancer cell lines by pyrosequencing (right panel). The pyrosequencing nucleotide dis- dideoxy sequencing and pyrosequencing; detection of homozygous pensation order is shown below each pyrogram. The numerical wild type (HCT116), heterozygous mutant (HT29, COLO201). BRAF position for each nucleotide is indicated at the top. Arrows indicate V600E variants identified by dideoxy sequencing (left panel) and the presence of mutant alleles Furthermore, the BRAF mutation could be detected in ESCCs. In addition, the BRAF mutation was absent in paraffin-embedded tissues of colon cancer that had been ESCC tumors. previously diagnosed by Sanger dideoxy sequencing. Col- Pyrosequencing is a nonelectrophoretic nucleotide lectively, these preliminary experiments supported the extension sequencing technology that can be used for 21–24 validity of the pyrosequencing method for the detection of mutation detection in tumors. Pyrosequencing offers a BRAF mutation in paraffin-embedded specimens. higher sensitivity than classical Sanger dideoxy sequencing for the detection of KRAS mutations. In addition, because BRAF Mutation in ESCC of its simplicity and cost effectiveness, pyrosequencing represents a potentially useful method in molecular diag- The mutational status in BRAF exon 15 (V600E) was nostics and epidemiological studies, particularly in the 25,26 examined in 204 ESCCs, and valid results were obtained in setting of large-scale projects and clinical assays. 203 tissues (99.5 %). All 203 ESCCs were wild-type at Mutations in the KRAS gene occur early in the devel- codon 600 in BRAF exon 15. opment of several types of cancers. Commonly restricted to codon 12 and 13 in exon 2, these mutations cause DISCUSSION impaired GTPase activity and result in a continual stimulus for cellular proliferation. They have been found in more KRAS and BRAF mutational status could represent a than 40 % of colorectal cancers, 90 % of pancreatic car- predictive marker for anti-EGFR therapies; therefore, bet- cinomas, and 33 % of non-small-cell lung carcinomas. ter understanding of the incidence of these mutations is Importantly, KRAS mutation status has recently become an important. However, the frequency of KRAS and BRAF important biomarker when identifying resistance to anti- EGFR therapy. Several previous studies have examined the mutations in ESCCs remains inconclusive because of the 8,15–20 limited sample sizes of previous studies. The validity frequency of KRAS mutations in ESCCs; only 2 studies (N = 35 and 50) showed the presence of KRAS mutations of the pyrosequencing method for detecting KRAS and BRAF mutations was initially demonstrated using colon in ESCCs; however, others have demonstrated the absence 8,15–19 of KRAS mutation in ESCCs. Unfortunately, all cancer cell lines and colon cancer tissues harboring KRAS and BRAF mutations. Thereafter, KRAS mutations were previous studies were limited by small sample sizes (N B 80). It should be noted that small studies are more shown to be extremely rare in a database of more than 200 S490 H. Shigaki et al. TABLE 2 Patient characteristics more likely to be published. As a result, large studies are less prone to publication bias than small studies. Publishing Clinical characteristics Total (N) null data from well-powered studies are important because All cases 203 publishing significant results from small underpowered Mean age ± SD 66.8 ± 9.24 studies also leads to publication bias. In this respect, our Sex finding that KRAS mutations are extremely rare in a non- Male 178 (87.7 %) biased database of more than 200 ESCCs may have Female 25 (12.3 %) considerable implications. Preoperative treatment The BRAF gene encodes a serine/threonine kinase of the Present 68 (33.5 %) RAS RAF MEK MAPK signaling pathway and is mutated in a variety of cancer types. The V600E point mutation in Absent 135 (66.5 %) exon 15 of the BRAF gene has been shown to be associated Cancer location with insensitivity to antigrowth signals, cell-cycle dysregu- Upper thoracic 31 (15.3 %) lation, tumor invasion and metastasis, escape from Middle thoracic 105 (51.7 %) apoptosis, unlimited replicative potential and angiogenesis, Lower thoracic 58 (28.6 %) and can be used as a predictive biomarker for BRAF-targeted Esophagogastric junction 9 (4.4 %) therapy. In addition, the prognostic role of the BRAF muta- Stage 34–37 tion has been emphasized in several types of cancers. I (IA, IB) 76 (37.4 %) However, the incidence of the BRAF mutation in ESCC II (IIA, IIB) 65 (32.0 %) remains less clear. One study showed the absence of a BRAF III (IIIA, IIIB, IIIC) 62 (30.5 %) mutation in 35 ESCCs, and the other showed that only 1 Lymph node metastasis tumor harbored a BRAF mutation among 80 ESCC tumors. Positive 94 (46.3 %) In this study, the BRAF mutation was absent in 203 ESCCs. Negative 109 (53.7 %) In summary, KRAS mutations were extremely rare, and Histological grade the BRAF mutation was absent in a nonbiased database of G1 83 (40.9 %) 203 ESCCs. This suggests that KRAS and BRAF mutations G2 82 (40.4 %) play a limited role in the development of ESCC and that G3–4 28 (13.8 %) mutation analysis is not useful as a predictive marker for sensitivity to anti-EGFR therapy in ESCC. TABLE 3 Comparative analysis of Scorpion-ARMS and pyrose- ACKNOWLEDGMENT This work was supported in part by the quencing for detection of KRAS mutation in 9 colorectal carcinoma Japan Society for the Promotion of Science (JSPS) Grant-in-Aid for tissues Scientific Research, Grant No. 23591941. KRAS Results of Results of Concordance OPEN ACCESS This article is distributed under the terms of the mutation Scorpion-ARMS pyrosequencing rate Creative Commons Attribution License which permits any use, dis- type (n) (n) tribution, and reproduction in any medium, provided the original author(s) and the source are credited. Codon12 3 3 100 % (3/3) GAT Codon12 2 2 100 % (2/2) GTG REFERENCES Codon12 2 2 100 % (2/2) TGT 1. Enzinger PC, Mayer RJ. Esophageal cancer. N Engl J Med. 2003;349:2241–52. Codon13 2 2 100 % (2/2) 2. Thallinger CM, Raderer M, Hejna M. Esophageal cancer: a GAC critical evaluation of systemic second-line therapy. J Clin Oncol. Total 9 9 100 % (9/9) 2011;29:4709–14. 3. Stahl M. Is there any role for surgery in the multidisciplinary treatment of esophageal cancer? Ann Oncol. 2010;21(Suppl prone to ‘‘publication bias’’ than large studies. The phe- 7):vii283–5. nomenon of publication bias occurs because studies with 4. Chen WH, Chao YK, Chang HK, Tseng CK, Wu YC, Liu YH, null findings (e.g., absence of KRAS mutation in tumors) et al. Long-term outcomes following neoadjuvant chemoradio- therapy in patients with clinical T2N0 esophageal squamous cell have a higher likelihood of being unwritten and unpub- carcinoma. Dis Esophagus. 2012;25:250–5. lished compared with those with significant results (e.g., 5. Pantling AZ, Gossage JA, Mamidanna R, Newman G, Robinson presence of KRAS mutation in tumors). Compared with A, Manifold DK, et al. Outcomes from chemoradiotherapy for small studies with null data, large studies with null data are patients with esophageal cancer. Dis Esophagus. 2011;24:172–6. KRAS and BRAF in Esophageal Cancer S491 6. Martini M, Vecchione L, Siena S, Tejpar S, Bardelli A. Targeted 22. Ogino S, Kawasaki T, Brahmandam M, Yan L, Cantor M, therapies: how personal should we go? Nat Rev Clin Oncol. Namgyal C, et al. Sensitive sequencing method for KRAS 2011;9:87–97. mutation detection by Pyrosequencing. J Mol Diagn. 2005;7: 7. McNamara MJ, Adelstein DJ. Current developments in the 413–21. management of locally advanced esophageal cancer. Curr Oncol 23. Shen S, Qin D. Pyrosequencing data analysis software: a useful Rep. 2012;14:342–9. tool for EGFR, KRAS, and BRAF mutation analysis. Diagn 8. Lorenzen S, Schuster T, Porschen R, Al-Batran SE, Hofheinz R, Pathol. 2012;7:56. Thuss-Patience P, et al. Cetuximab plus cisplatin-5-fluorouracil 24. Chen DC, Saarela J, Nuotio I, Jokiaho A, Peltonen L, Palotie A. versus cisplatin-5-fluorouracil alone in first-line metastatic squa- Comparison of GenFlex Tag array and Pyrosequencing in SNP mous cell carcinoma of the esophagus: a randomized phase II study genotyping. J Mol Diagn. 2003;5:243–9. of the Arbeitsgemeinschaft Internistische Onkologie. Ann Oncol. 25. Imamura Y, Morikawa T, Liao X, Lochhead P, Kuchiba A, 2009;20:1667–73. Yamauchi M, et al. Specific mutations in KRAS codons 12 and 9. Ilson DH, Kelsen D, Shah M, Schwartz G, Levine DA, Boyd J, 13, and patient prognosis in 1075 BRAF wild-type colorectal et al. A phase 2 trial of erlotinib in patients with previously cancers. Clin Cancer Res. 2012;18:4753–63. treated squamous cell and adenocarcinoma of the esophagus. 26. Ogino S, Meyerhardt JA, Irahara N, Niedzwiecki D, Hollis D, Cancer. 2011;117:1409–14. Saltz LB, et al. KRAS mutation in stage III colon cancer and 10. Adelstein DJ, Rodriguez CP, Rybicki LA, Ives DI, Rice TW. A clinical outcome following intergroup trial CALGB 89803. Clin phase II trial of gefitinib for recurrent or metastatic cancer of the Cancer Res. 2009;15:7322–9. esophagus or gastroesophageal junction. Invest New Drugs. 27. Rice TW, Blackstone EH, Rusch VW. 7th edition of the AJCC 2010;30:1684–9. Cancer Staging Manual: esophagus and esophagogastric junction. 11. Han W, Lo HW. Landscape of EGFR signaling network in human Ann Surg Oncol. 2010;17:1721–4. cancers: biology and therapeutic response in relation to receptor 28. Brandi G, Tavolari S, De Rosa F, Di Girolamo S, Agostini V, subcellular locations. Cancer Lett. 2012;318:124–34. Barbera MA, et al. Antitumoral efficacy of the protease inhibitor 12. Walther A, Johnstone E, Swanton C, Midgley R, Tomlinson I, gabexate mesilate in colon cancer cells harbouring KRAS, BRAF Kerr D. Genetic prognostic and predictive markers in colorectal and PIK3CA mutations. PLoS One. 2012;7:e41347. cancer. Nat Rev Cancer. 2009;9:489–99. 29. Wang H, Daouti S, Li WH, Wen Y, Rizzo C, Higgins B, et al. 13. Garnett MJ, Marais R. Guilty as charged: B-RAF is a human Identification of the MEK1(F129L) activating mutation as a oncogene. Cancer Cell. 2004;6:313–9. potential mechanism of acquired resistance to MEK inhibition in 14. De Roock W, De Vriendt V, Normanno N, Ciardiello F, Tejpar S. human cancers carrying the B-RafV600E mutation. Cancer Res. KRAS, BRAF, PIK3CA, and PTEN mutations: implications for 2011;71:5535–45. targeted therapies in metastatic colorectal cancer. Lancet Oncol. 30. Ozawa S, Tachimori Y, Baba H, Fujishiro M, Matsubara H, 2011;12:594–603. Numasaki H, et al. Comprehensive registry of esophageal cancer 15. Ma H, Xue Y, Li C, Zhang J, Ren Z. A preliminary study on in Japan, 2004. Esophagus. 2012;9:75–98. K-ras, EGFR, and B-raf mutations of esophageal squamous cell 31. Loriot Y, Mordant P, Deutsch E, Olaussen KA, Soria JC. Are carcinoma. Chinese-German. J Clin Oncol. 2011;10:497–501. RAS mutations predictive markers of resistance to standard 16. Liu QW, Fu JH, Luo KJ, Yang HX, Wang JY, Hu Y, et al. chemotherapy? Nat Rev Clin Oncol. 2009;6:528–34. Identification of EGFR and KRAS mutations in Chinese patients 32. Adjei AA. Blocking oncogenic Ras signaling for cancer therapy. with esophageal squamous cell carcinoma. Dis Esophagus. 2011. J Natl Cancer Inst. 2001;93:1062–74. doi:10.1111/j.1442-2050.2010.01155.x. [Epub ahead of print]. 33. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, 17. Hollstein MC, Peri L, Mandard AM, Welsh JA, Montesano R, et al. Mutations of the BRAF gene in human cancer. Nature. Metcalf RA, et al. Genetic analysis of human esophageal tumors 2002;417:949–54. from two high incidence geographic areas: frequent p53 base 34. Ogino S, Shima K, Meyerhardt JA, McCleary NJ, Ng K, Hollis substitutions and absence of ras mutations. Cancer Res. 1991; D, et al. Predictive and prognostic roles of BRAF mutation in 51:4102–6. stage III colon cancer: results from intergroup trial CALGB 18. Victor T, Du Toit R, Jordaan AM, Bester AJ, van Helden PD. No 89803. Clin Cancer Res. 2012;18:890–900. evidence for point mutations in codons 12, 13, and 61 of the ras 35. Ogino S, Nosho K, Kirkner GJ, Kawasaki T, Meyerhardt JA, gene in a high-incidence area for esophageal and gastric cancers. Loda M, et al. CpG island methylator phenotype, microsatellite Cancer Res. 1990;50:4911–4. instability, BRAF mutation and clinical outcome in colon cancer. 19. Hollstein MC, Smits AM, Galiana C, Yamasaki H, Bos JL, Gut. 2009;58:90–6. Mandard A, et al. Amplification of epidermal growth factor 36. Grisham RN, Iyer G, Garg K, Delair D, Hyman DM, Zhou Q, receptor gene but no evidence of ras mutations in primary human et al. BRAF Mutation is associated with early stage disease and esophageal cancers. Cancer Res. 1988;48:5119–23. improved outcome in patients with low-grade serous ovarian 20. Maeng CH, Lee J, van Hummelen P, Park SH, Palescandolo E, cancer. Cancer. 2012. doi:10.1002/cncr.27782. [Epub ahead of Jang J, et al. High-throughput genotyping in metastatic esopha- print]. geal squamous cell carcinoma identifies phosphoinositide-3- 37. Moreau S, Saiag P, Aegerter P, Bosset D, Longvert C, Helias- kinase and BRAF mutations. PLoS One. 2012;7:e41655. Rodzewicz Z, et al. Prognostic value of BRAF (V600) mutations 21. Fakhrai-Rad H, Pourmand N, Ronaghi M. Pyrosequencing: an in melanoma patients after resection of metastatic lymph nodes. accurate detection platform for single nucleotide polymorphisms. Ann Surg Oncol. 2012;19:4314–21. Hum Mutat. 2002;19:479–85. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Annals of Surgical Oncology Pubmed Central

KRAS and BRAF Mutations in 203 Esophageal Squamous Cell Carcinomas: Pyrosequencing Technology and Literature Review

Loading next page...
 
/lp/pubmed-central/kras-and-braf-mutations-in-203-esophageal-squamous-cell-carcinomas-KUhEZQ5cms

References (41)

Publisher
Pubmed Central
Copyright
© The Author(s) 2012
ISSN
1068-9265
eISSN
1534-4681
DOI
10.1245/s10434-012-2819-z
Publisher site
See Article on Publisher Site

Abstract

Ann Surg Oncol (2013) 20:S485–S491 DOI 10.1245/s10434-012-2819-z O R I G IN AL ARTI CL E – TRAN SLATIO NA L R ESEA RCH AN D B IOM A RK ERS KRAS and BRAF Mutations in 203 Esophageal Squamous Cell Carcinomas: Pyrosequencing Technology and Literature Review Hironobu Shigaki, MD, Yoshifumi Baba, MD, PhD, Masayuki Watanabe, MD, PhD, FACS, Keisuke Miyake, MSc, Asuka Murata, MD, Shiro Iwagami, MD, PhD, Takatsugu Ishimoto, MD, PhD, Masaaki Iwatsuki, MD, PhD, Naoya Yoshida, MD, PhD, and Hideo Baba, MD, PhD, FACS Department of Gastroenterological Surgery, Graduate School of Medical Science, Kumamoto University, Kumamoto, Japan ABSTRACT Conclusions. These results suggest that KRAS and BRAF Background. Epidermal growth factor receptor (EGFR) mutations play a limited role in the development of ESCC signaling is one of the most promising targets for molec- and that mutation analysis is not useful as a screening test ular-targeted therapies in esophageal squamous cell for sensitivity to anti-EGFR therapy in ESCC. carcinoma (ESCC). Thus, the molecular diagnosis of KRAS and BRAF mutations is clinically important in therapeutic decision making. However, the frequency of KRAS and Esophageal squamous cell carcinoma (ESCC) is the BRAF mutations in ESCCs remains inconclusive because major histological type of esophageal cancer in East Asian of the limited sample sizes of previous studies (all countries and is one of the most aggressive malignant N B 80). Pyrosequencing is a nonelectrophoretic nucleo- tumors. Despite remarkable advances in multimodal tide extension sequencing technology that can be used for therapies, patient prognosis remains poor, even for those mutation testing. 2–5 whose carcinomas have been completely resected. The Methods. The frequency of KRAS and BRAF mutations limited improvement in treatment outcomes by conven- was examined using a nonbiased database of 203 resected tional therapies urged us to seek innovative strategies for ESCCs and a high-throughput pyrosequencing assay. treating ESCC, especially those that are molecularly tar- Results. The validity of the KRAS pyrosequencing method geted. One of the most promising targets is the inhibition of was initially demonstrated by detection of all 4 types of KRAS the epidermal growth factor receptor (EGFR) by mono- mutations [c.35G[T(codon 12GGT[GTT), c.35G[A clonal antibodies (e.g., cetuximab, panitumumab) or small (codon 12 GGT[GAT), c.34G[T (codon12GGT[TGT), molecule tyrosine kinase inhibitors (e.g., erlotinib, gefiti- c.38G[A mutation(codon 13GGC[GAC)], which had been 6–10 nib). The EGFR signal transduction network plays a previously diagnosed using Scorpion-ARMS technology, in 9 crucial role in multiple tumorigenic processes, contributing colon cancer tissues (9 of 9; 100 %). Similar results were to cell-cycle progression, angiogenesis, metastasis, and demonstrated for BRAF mutational status in 3 colon cancer protection of the cancer cell from apoptosis. Mutations in cell lines (HCT116, Colo201, and HT29), which were vali- the Kirsten Ras 1 (KRAS) and V-Raf Murine Sarcoma Viral dated by Sanger dideoxy sequencing. Subsequently, the KRAS Oncogene Homolog B1 (BRAF) genes may be predictive of mutation was found to be extremely rare (1 of 203; 0.5 %), and response to drugs directly linked to the EGFR path- the BRAF mutation was absent (0 of 203; 0 %), in the dataset 12–14 way. Thus, molecular diagnosis of these mutations is of 203 ESCCs. increasingly important in making therapeutic decisions. Several previous studies have examined the frequency of KRAS and BRAF mutations in ESCCs; however, they were The Author(s) 2012. This article is published with open access all limited by small sample sizes (all N B 80) (Table 1), at Springerlink.com 8,15–20 yielding inconclusive results. First Received: 14 October 2012; Pyrosequencing is a nonelectrophoretic nucleotide Published Online: 30 December 2012 extension sequencing technology for various applications, H. Baba, MD, PhD, FACS 21–24 including mutation testing of tumors. This technology e-mail: hdobaba@kumamoto-u.ac.jp S486 H. Shigaki et al. TABLE 1 Studies on KRAS Study Sample Methods Mutation Codons and BRAF mutations in ESCC size detected N (%) examined Studies on KRAS mutations in ESCC Ma et al. 35 Pyrosequencing 2 (5.7 %) Codons 12–13 Liu et al. 50 Pyrosequencing 6 (12 %) Codons 12–13 Lorenzen et al. 37 Direct sequencing 0 (0 %) Codons 12–13 Hollstein et al. 16 Direct sequencing 0 (0 %) Codons 12–13 Victor et al. 27 PCR and oligomer hybridization assay 0 (0 %) Codons 12–13 Hollstein et al. 25 PCR and oligomer hybridization assay 0 (0 %) Codons 12–13 Present study 203 Pyrosequencing 1 (0.5 %) Codons 12–13 Studies on BRAF mutations in ESCC Ma et al. 35 Pyrosequencing 0 (0 %) Codon 600 Maeng et al. 80 OncoMap 1 (1.2 %) Codon 600 Present study 203 Pyrosequencing 0 (0 %) Codon 600 has several advantages. First, it has higher sensitivity than p.Gly12Val), c.35G[A(codon 12GGT[GAT; p.Gly12Asp), classical Sanger dideoxy sequencing. Sanger dideoxy c.34G[T(codon 12 GGT[TGT; p.Gly12Cys), and c.38G[A sequencing needs more than 20 % of tumor load in a speci- mutation (codon 13 GGC[GAC; p.Gly13Asp)], which had men to render a reliable result, while pyrosequencing can been already diagnosed by Scorpion-ARMS technology, were render a reliable result with a tumor load of 5 %. Second, also included in this study to validate the pyrosequencing pyrosequencing is faster than Sanger dideoxy sequencing. method for the detection of KRAS mutations. Third, pyrosequencing is more cost effective. Collectively, pyrosequencing is a useful method in molecular diagnostics Genomic DNA Extraction 25,26 and large-scale epidemiological studies. Therefore, in the present study, KRAS and BRAF One pathologist marked the tumor areas on slides mutations were screened using a nonbiased database of 203 stained with hematoxylin-eosin. Genomic DNA was ESCCs and pyrosequencing technology. extracted from tumor lesions enriched with neoplastic cells, without adjacent normal tissue, using an FFPE kit (Qiagen, Valencia, CA). DNA was also extracted from 3 cell lines: PATIENTS AND METHODS Colo201 and HT29 with the BRAF mutation c.1799T[A (p.V600E), and HCT116 with wild-type BRAF using a Study Subjects 28,29 QIAmp DNA mini kit (Qiagen, Valencia, CA). DNA was stored at -20 C before use. A total of 217 consecutive patients with ESCC who were undergoing curative resection at Kumamoto Univer- sity Hospital between April 2005 and December 2010 were Whole Genome Amplification enrolled in this study. There were 13 patients excluded because of the unavailability of adequate tissue samples. Whole genome amplification (WGA) is a useful tech- We initially quantified KRAS and BRAF mutation in 204 nique for preserving original study material for many cancer specimens and obtained valid results in 203 cases different assays and for future studies. In WGA, genomic (99.5 %). Thus, 203 ESCCs were finally included in this DNA is amplified by polymerase chain reaction (PCR) study. Tumor staging was done by the American Joint using primers consisting of a random sequence of 15 Committee on Cancer Staging Manual (7th edition). nucleotides. Each PCR mix contained 40 pmol of the Written informed consent was obtained from each subject, random primers, 1.0 nmol each of dNTP, 2.0 mmol/L and the institutional review board of Kumamoto University MgCl2, 19 PCR buffer (Applied Biosystems, Foster City, CA), 0.25 U of AmpliTaq Gold 360 (Applied Biosystems), approved the study procedures. A total of 9 patients with colon cancers harboring 4 dif- and 5 ll of template DNA solution in a total volume of 50 ll. PCR conditions consisted of initial denaturation at ferent KRAS mutations [c.35G[T (codon12GGT[GTT; KRAS and BRAF in Esophageal Cancer S487 95 C for 10 min; 50 cycles of 95 C for 60 s, annealing RESULTS (37 C for 2 min), ramping from 37 to 55 C (0.1 C/s), 55 C for 2 min, and 68 C for 30 s; and a final extension Clinical Data at 72 C for 7 min. A summary of the clinical characteristics of the patients Pyrosequencing for KRAS and BRAF Mutations is given in Table 2. In this cohort, the 5-year overall sur- vival rates of patients treated by esophagectomy were Pyrosequencing technology has been shown to reliably 83.9 % for stage I, 59.7 % for stage II, and 36.7 % for stage III. These rates are similar to those from the detect KRAS mutations with 100 % analytic sensitivity and specificity, even when the proportion of mutant alleles is as low ‘‘Comprehensive Registry of Esophageal Cancer in Japan’’ as 10 %. PCR amplification primers for pyrosequencing tar- (79.5 % for stage I, 58.9 % for stage II, and 39.8 % for geted for KRAS (codons 12, 13), BRAF (codon 600) were: stage III), which supports the absence of bias in our KRAS-F, forward, 5 -NNNGGCCTGCTGAAAATGACT database. 0 0 GAA-3 ; and KRAS-R, reverse biotinylated primer, 5 -TTA GCTGTATCGTCAAGGCACTCT-3 ; and BRAF-F, for- Validation of the Pyrosequencing Assay for KRAS ward biotinylated primer, 5 -CAGTAAAAATAGGTGATTT Mutation Detection 0 0 TG-3 ; and BRAF-R reverse, 5 -TCCAGACAACTGTTCAA ACTGA-3 . Each PCR mix contained the forward and reverse We first examined the validity of the pyrosequencing primers (20 pmol each), 1.0 nmol of each dNTP with dUTP, method using eleven colon cancer tissues harboring 4 different KRAS mutations [c.35G[T (codon12GGT[GTT; p.Gly12- 2 mmol/L MgCl2, 19 PCR buffer, 1.25 U of AmpliTaq Gold 360, 0.5 U of AmpErase UNG and 5 ll of template WGA Val), c.35G[A(codon 12GGT[GAT; p.Gly12Asp), product in a total volume of 50 ll. PCR condition consisted of c.34G[T(codon 12 GGT[TGT; p.Gly12Cys), and c.38G[A initial denaturation at 50 C (10 min) for AmpErase UNG; mutation (codon 13 GGC[GAC; p.Gly13Asp)]. These initial denaturation at 94 C (10 min) for AmpliTaq Gold 360; mutations had already been diagnosed by the sensitive Scor- 50 cycles of 95 C (30 s), annealing (30 s; 55 C for BRAF, pion-ARMS technology [i.e., Amplification Refractory 57 C for KRAS), and 72 C (30 s); and a final extension at Mutation System incorporating a unique bifunctional flores- 72 C (7 min). The PCR products were electrophoresed cent primer/probe molecule (Scorpion)]. As shown in through an agarose gel to confirm successful amplification of Table 3, all 4 types of mutations could be detected using the the 82-bp (KRAS) and the 80-bp PCR (BRAF)product. pyrosequencing technology (11 of 11, 100 %) (Fig. 1), which KRAS and BRAF pyrosequencing was performed using the demonstrated that the method was reliable for the detection of KRAS mutations in tumors. PyroMark Q24 System (Qiagen, Valencia, CA) according to the manufacturer’s instructions (Fig. 1 for KRAS; Fig. 2 for BRAF). All forward sequencing results were confirmed by KRAS Mutation in ESCC reverse sequencing. In the KRAS pyrosequencing assay, the presence of a mutation was routinely confirmed by 3 different Pyrosequence analysis of KRAS codon 12 and 13 sequencing primers and by the creation of the frameshifted mutations was successful for 203 of 204 (99.5 %) ESCC open reading frame of the mutant sequence relative to a wild- paraffin-embedded tissues. Among the 203 ESCCs, only 1 type sequence in a program. The primer KRAS-PF1 (5 - case harbored a KRAS mutation [c.34G[T (codon 12 TGTGGTAGTTGGAGCTG-3 ; pyrosequencing nucleotide GGT[TGT; p.Gly12Cys)]. This mutation was also diag- dispensation order, ACTGATCG ATCGATCGATCGATC nosed by the Scorpion-ARMS technology (data not GATCG) could detect the c.35G[T(codon12GTT) and shown). This result showed that the frequency of KRAS c.35G[A (codon 12 GAT) mutations. The primer KRAS-PF2 mutations in ESCC was extremely low. 0 0 (5 -TGTGGTAGTTGGAGCT-3 ; pyrosequencing nucleo- tide dispensation order, ATCGATCGATCGATCGATCG Validation of Pyrosequencing Assay for BRAF ATCATCG) could detect the c.34G[T (codon 12 TGT) Mutation Detection mutation. The primer KRAS-PF3 (5 -TGGTAGTTGGAGC TGGT-3 ; pyrosequencing nucleotide dispensation order, To validate our BRAF pyrosequencing assay, both py- GATGCATGCATGCATGCATGCATGCATGC) could rosequencing and Sanger dideoxy sequencing were detect the c.34G[A (codon 13 GAC) mutation. In the BRAF performed on the same set of DNA samples from 3 colon pyrosequencing assay, the primer was 5 -CACTCCATC cancer cell lines (HCT116, Colo201, and HT29). HCT116 GAGATTTC-3 , and the pyrosequencing nucleotide dispen- possesses wild-type BRAF, and Colo201 and HT29 harbors sation order was CTGCATGCATGCTGCA. a BRAF mutation [c.1799T[A (p.V600E)]. In Sanger S488 H. Shigaki et al. FIG. 1 Pyrograms of wild-type and mutant KRAS in colorectal carcinoma. a Wild-type codon 12 detected by the KRAS-PF1 primer. b c.35GT (codon 12 GTT) mutation detected by the KRAS- PF1 primer. c c.35GA (codon 12 GAT) mutation detected by the KRAS-PF1 primer. d Wild-type codon 12 detected by the KRAS- b PF2 primer. e c.34GT (codon 12 TGT) mutation detected by the KRAS-PF2 primer. f Wild-type codon 13 detected by the KRAS- PF3 primer. g c.38GA (codon 13 GAC) mutation detected by the KRAS-PF3 primer. Arrows indicate the presence of mutant alleles dideoxy sequencing, HCT116 showed was homozygous (Fig. 2). Among all 3 cell lines, pyrosequencing gave the wild-type for the BRAF gene, and HT29 and COLO201 same results as Sanger sequencing for BRAF mutational were shown to be heterozygous BRAF V600E mutants status (Fig. 2). KRAS and BRAF in Esophageal Cancer S489 FIG. 2 Detection of BRAF V600E in colon cancer cell lines by pyrosequencing (right panel). The pyrosequencing nucleotide dis- dideoxy sequencing and pyrosequencing; detection of homozygous pensation order is shown below each pyrogram. The numerical wild type (HCT116), heterozygous mutant (HT29, COLO201). BRAF position for each nucleotide is indicated at the top. Arrows indicate V600E variants identified by dideoxy sequencing (left panel) and the presence of mutant alleles Furthermore, the BRAF mutation could be detected in ESCCs. In addition, the BRAF mutation was absent in paraffin-embedded tissues of colon cancer that had been ESCC tumors. previously diagnosed by Sanger dideoxy sequencing. Col- Pyrosequencing is a nonelectrophoretic nucleotide lectively, these preliminary experiments supported the extension sequencing technology that can be used for 21–24 validity of the pyrosequencing method for the detection of mutation detection in tumors. Pyrosequencing offers a BRAF mutation in paraffin-embedded specimens. higher sensitivity than classical Sanger dideoxy sequencing for the detection of KRAS mutations. In addition, because BRAF Mutation in ESCC of its simplicity and cost effectiveness, pyrosequencing represents a potentially useful method in molecular diag- The mutational status in BRAF exon 15 (V600E) was nostics and epidemiological studies, particularly in the 25,26 examined in 204 ESCCs, and valid results were obtained in setting of large-scale projects and clinical assays. 203 tissues (99.5 %). All 203 ESCCs were wild-type at Mutations in the KRAS gene occur early in the devel- codon 600 in BRAF exon 15. opment of several types of cancers. Commonly restricted to codon 12 and 13 in exon 2, these mutations cause DISCUSSION impaired GTPase activity and result in a continual stimulus for cellular proliferation. They have been found in more KRAS and BRAF mutational status could represent a than 40 % of colorectal cancers, 90 % of pancreatic car- predictive marker for anti-EGFR therapies; therefore, bet- cinomas, and 33 % of non-small-cell lung carcinomas. ter understanding of the incidence of these mutations is Importantly, KRAS mutation status has recently become an important. However, the frequency of KRAS and BRAF important biomarker when identifying resistance to anti- EGFR therapy. Several previous studies have examined the mutations in ESCCs remains inconclusive because of the 8,15–20 limited sample sizes of previous studies. The validity frequency of KRAS mutations in ESCCs; only 2 studies (N = 35 and 50) showed the presence of KRAS mutations of the pyrosequencing method for detecting KRAS and BRAF mutations was initially demonstrated using colon in ESCCs; however, others have demonstrated the absence 8,15–19 of KRAS mutation in ESCCs. Unfortunately, all cancer cell lines and colon cancer tissues harboring KRAS and BRAF mutations. Thereafter, KRAS mutations were previous studies were limited by small sample sizes (N B 80). It should be noted that small studies are more shown to be extremely rare in a database of more than 200 S490 H. Shigaki et al. TABLE 2 Patient characteristics more likely to be published. As a result, large studies are less prone to publication bias than small studies. Publishing Clinical characteristics Total (N) null data from well-powered studies are important because All cases 203 publishing significant results from small underpowered Mean age ± SD 66.8 ± 9.24 studies also leads to publication bias. In this respect, our Sex finding that KRAS mutations are extremely rare in a non- Male 178 (87.7 %) biased database of more than 200 ESCCs may have Female 25 (12.3 %) considerable implications. Preoperative treatment The BRAF gene encodes a serine/threonine kinase of the Present 68 (33.5 %) RAS RAF MEK MAPK signaling pathway and is mutated in a variety of cancer types. The V600E point mutation in Absent 135 (66.5 %) exon 15 of the BRAF gene has been shown to be associated Cancer location with insensitivity to antigrowth signals, cell-cycle dysregu- Upper thoracic 31 (15.3 %) lation, tumor invasion and metastasis, escape from Middle thoracic 105 (51.7 %) apoptosis, unlimited replicative potential and angiogenesis, Lower thoracic 58 (28.6 %) and can be used as a predictive biomarker for BRAF-targeted Esophagogastric junction 9 (4.4 %) therapy. In addition, the prognostic role of the BRAF muta- Stage 34–37 tion has been emphasized in several types of cancers. I (IA, IB) 76 (37.4 %) However, the incidence of the BRAF mutation in ESCC II (IIA, IIB) 65 (32.0 %) remains less clear. One study showed the absence of a BRAF III (IIIA, IIIB, IIIC) 62 (30.5 %) mutation in 35 ESCCs, and the other showed that only 1 Lymph node metastasis tumor harbored a BRAF mutation among 80 ESCC tumors. Positive 94 (46.3 %) In this study, the BRAF mutation was absent in 203 ESCCs. Negative 109 (53.7 %) In summary, KRAS mutations were extremely rare, and Histological grade the BRAF mutation was absent in a nonbiased database of G1 83 (40.9 %) 203 ESCCs. This suggests that KRAS and BRAF mutations G2 82 (40.4 %) play a limited role in the development of ESCC and that G3–4 28 (13.8 %) mutation analysis is not useful as a predictive marker for sensitivity to anti-EGFR therapy in ESCC. TABLE 3 Comparative analysis of Scorpion-ARMS and pyrose- ACKNOWLEDGMENT This work was supported in part by the quencing for detection of KRAS mutation in 9 colorectal carcinoma Japan Society for the Promotion of Science (JSPS) Grant-in-Aid for tissues Scientific Research, Grant No. 23591941. KRAS Results of Results of Concordance OPEN ACCESS This article is distributed under the terms of the mutation Scorpion-ARMS pyrosequencing rate Creative Commons Attribution License which permits any use, dis- type (n) (n) tribution, and reproduction in any medium, provided the original author(s) and the source are credited. Codon12 3 3 100 % (3/3) GAT Codon12 2 2 100 % (2/2) GTG REFERENCES Codon12 2 2 100 % (2/2) TGT 1. Enzinger PC, Mayer RJ. Esophageal cancer. N Engl J Med. 2003;349:2241–52. Codon13 2 2 100 % (2/2) 2. Thallinger CM, Raderer M, Hejna M. Esophageal cancer: a GAC critical evaluation of systemic second-line therapy. J Clin Oncol. Total 9 9 100 % (9/9) 2011;29:4709–14. 3. Stahl M. Is there any role for surgery in the multidisciplinary treatment of esophageal cancer? Ann Oncol. 2010;21(Suppl prone to ‘‘publication bias’’ than large studies. The phe- 7):vii283–5. nomenon of publication bias occurs because studies with 4. Chen WH, Chao YK, Chang HK, Tseng CK, Wu YC, Liu YH, null findings (e.g., absence of KRAS mutation in tumors) et al. Long-term outcomes following neoadjuvant chemoradio- therapy in patients with clinical T2N0 esophageal squamous cell have a higher likelihood of being unwritten and unpub- carcinoma. Dis Esophagus. 2012;25:250–5. lished compared with those with significant results (e.g., 5. Pantling AZ, Gossage JA, Mamidanna R, Newman G, Robinson presence of KRAS mutation in tumors). Compared with A, Manifold DK, et al. Outcomes from chemoradiotherapy for small studies with null data, large studies with null data are patients with esophageal cancer. Dis Esophagus. 2011;24:172–6. KRAS and BRAF in Esophageal Cancer S491 6. Martini M, Vecchione L, Siena S, Tejpar S, Bardelli A. Targeted 22. Ogino S, Kawasaki T, Brahmandam M, Yan L, Cantor M, therapies: how personal should we go? Nat Rev Clin Oncol. Namgyal C, et al. Sensitive sequencing method for KRAS 2011;9:87–97. mutation detection by Pyrosequencing. J Mol Diagn. 2005;7: 7. McNamara MJ, Adelstein DJ. Current developments in the 413–21. management of locally advanced esophageal cancer. Curr Oncol 23. Shen S, Qin D. Pyrosequencing data analysis software: a useful Rep. 2012;14:342–9. tool for EGFR, KRAS, and BRAF mutation analysis. Diagn 8. Lorenzen S, Schuster T, Porschen R, Al-Batran SE, Hofheinz R, Pathol. 2012;7:56. Thuss-Patience P, et al. Cetuximab plus cisplatin-5-fluorouracil 24. Chen DC, Saarela J, Nuotio I, Jokiaho A, Peltonen L, Palotie A. versus cisplatin-5-fluorouracil alone in first-line metastatic squa- Comparison of GenFlex Tag array and Pyrosequencing in SNP mous cell carcinoma of the esophagus: a randomized phase II study genotyping. J Mol Diagn. 2003;5:243–9. of the Arbeitsgemeinschaft Internistische Onkologie. Ann Oncol. 25. Imamura Y, Morikawa T, Liao X, Lochhead P, Kuchiba A, 2009;20:1667–73. Yamauchi M, et al. Specific mutations in KRAS codons 12 and 9. Ilson DH, Kelsen D, Shah M, Schwartz G, Levine DA, Boyd J, 13, and patient prognosis in 1075 BRAF wild-type colorectal et al. A phase 2 trial of erlotinib in patients with previously cancers. Clin Cancer Res. 2012;18:4753–63. treated squamous cell and adenocarcinoma of the esophagus. 26. Ogino S, Meyerhardt JA, Irahara N, Niedzwiecki D, Hollis D, Cancer. 2011;117:1409–14. Saltz LB, et al. KRAS mutation in stage III colon cancer and 10. Adelstein DJ, Rodriguez CP, Rybicki LA, Ives DI, Rice TW. A clinical outcome following intergroup trial CALGB 89803. Clin phase II trial of gefitinib for recurrent or metastatic cancer of the Cancer Res. 2009;15:7322–9. esophagus or gastroesophageal junction. Invest New Drugs. 27. Rice TW, Blackstone EH, Rusch VW. 7th edition of the AJCC 2010;30:1684–9. Cancer Staging Manual: esophagus and esophagogastric junction. 11. Han W, Lo HW. Landscape of EGFR signaling network in human Ann Surg Oncol. 2010;17:1721–4. cancers: biology and therapeutic response in relation to receptor 28. Brandi G, Tavolari S, De Rosa F, Di Girolamo S, Agostini V, subcellular locations. Cancer Lett. 2012;318:124–34. Barbera MA, et al. Antitumoral efficacy of the protease inhibitor 12. Walther A, Johnstone E, Swanton C, Midgley R, Tomlinson I, gabexate mesilate in colon cancer cells harbouring KRAS, BRAF Kerr D. Genetic prognostic and predictive markers in colorectal and PIK3CA mutations. PLoS One. 2012;7:e41347. cancer. Nat Rev Cancer. 2009;9:489–99. 29. Wang H, Daouti S, Li WH, Wen Y, Rizzo C, Higgins B, et al. 13. Garnett MJ, Marais R. Guilty as charged: B-RAF is a human Identification of the MEK1(F129L) activating mutation as a oncogene. Cancer Cell. 2004;6:313–9. potential mechanism of acquired resistance to MEK inhibition in 14. De Roock W, De Vriendt V, Normanno N, Ciardiello F, Tejpar S. human cancers carrying the B-RafV600E mutation. Cancer Res. KRAS, BRAF, PIK3CA, and PTEN mutations: implications for 2011;71:5535–45. targeted therapies in metastatic colorectal cancer. Lancet Oncol. 30. Ozawa S, Tachimori Y, Baba H, Fujishiro M, Matsubara H, 2011;12:594–603. Numasaki H, et al. Comprehensive registry of esophageal cancer 15. Ma H, Xue Y, Li C, Zhang J, Ren Z. A preliminary study on in Japan, 2004. Esophagus. 2012;9:75–98. K-ras, EGFR, and B-raf mutations of esophageal squamous cell 31. Loriot Y, Mordant P, Deutsch E, Olaussen KA, Soria JC. Are carcinoma. Chinese-German. J Clin Oncol. 2011;10:497–501. RAS mutations predictive markers of resistance to standard 16. Liu QW, Fu JH, Luo KJ, Yang HX, Wang JY, Hu Y, et al. chemotherapy? Nat Rev Clin Oncol. 2009;6:528–34. Identification of EGFR and KRAS mutations in Chinese patients 32. Adjei AA. Blocking oncogenic Ras signaling for cancer therapy. with esophageal squamous cell carcinoma. Dis Esophagus. 2011. J Natl Cancer Inst. 2001;93:1062–74. doi:10.1111/j.1442-2050.2010.01155.x. [Epub ahead of print]. 33. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, 17. Hollstein MC, Peri L, Mandard AM, Welsh JA, Montesano R, et al. Mutations of the BRAF gene in human cancer. Nature. Metcalf RA, et al. Genetic analysis of human esophageal tumors 2002;417:949–54. from two high incidence geographic areas: frequent p53 base 34. Ogino S, Shima K, Meyerhardt JA, McCleary NJ, Ng K, Hollis substitutions and absence of ras mutations. Cancer Res. 1991; D, et al. Predictive and prognostic roles of BRAF mutation in 51:4102–6. stage III colon cancer: results from intergroup trial CALGB 18. Victor T, Du Toit R, Jordaan AM, Bester AJ, van Helden PD. No 89803. Clin Cancer Res. 2012;18:890–900. evidence for point mutations in codons 12, 13, and 61 of the ras 35. Ogino S, Nosho K, Kirkner GJ, Kawasaki T, Meyerhardt JA, gene in a high-incidence area for esophageal and gastric cancers. Loda M, et al. CpG island methylator phenotype, microsatellite Cancer Res. 1990;50:4911–4. instability, BRAF mutation and clinical outcome in colon cancer. 19. Hollstein MC, Smits AM, Galiana C, Yamasaki H, Bos JL, Gut. 2009;58:90–6. Mandard A, et al. Amplification of epidermal growth factor 36. Grisham RN, Iyer G, Garg K, Delair D, Hyman DM, Zhou Q, receptor gene but no evidence of ras mutations in primary human et al. BRAF Mutation is associated with early stage disease and esophageal cancers. Cancer Res. 1988;48:5119–23. improved outcome in patients with low-grade serous ovarian 20. Maeng CH, Lee J, van Hummelen P, Park SH, Palescandolo E, cancer. Cancer. 2012. doi:10.1002/cncr.27782. [Epub ahead of Jang J, et al. High-throughput genotyping in metastatic esopha- print]. geal squamous cell carcinoma identifies phosphoinositide-3- 37. Moreau S, Saiag P, Aegerter P, Bosset D, Longvert C, Helias- kinase and BRAF mutations. PLoS One. 2012;7:e41655. Rodzewicz Z, et al. Prognostic value of BRAF (V600) mutations 21. Fakhrai-Rad H, Pourmand N, Ronaghi M. Pyrosequencing: an in melanoma patients after resection of metastatic lymph nodes. accurate detection platform for single nucleotide polymorphisms. Ann Surg Oncol. 2012;19:4314–21. Hum Mutat. 2002;19:479–85.

Journal

Annals of Surgical OncologyPubmed Central

Published: Dec 30, 2012

There are no references for this article.