Get 20M+ Full-Text Papers For Less Than $1.50/day. Subscribe now for You or Your Team.

Learn More →

Occurrence of Thermotolerant Hartmannella vermiformis and Naegleria Spp. in Hot Springs of Ardebil Province, Northwest Iran

Occurrence of Thermotolerant Hartmannella vermiformis and Naegleria Spp. in Hot Springs of... Iranian J Parasitol: Vol. 7, No.2, 2012, pp.47-52 Iranian J Parasitol Tehran University of Medical Open access Journal at Sciences Publication http:// ijpa.tums.ac.ir Iranian Society of Parasitology http:// tums.ac.ir http:// isp.tums.ac.ir Original Article Occurrence of Thermotolerant Hartmannella vermiformis and Naegleria Spp. in Hot Springs of Ardebil Province, Northwest Iran 1 1 1 2 R Solgi , *M Niyyati , A Haghighi , E Nazemalhosseini Mojarad 1. Department of Medical Parasitology and Mycology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran 2. Research Center for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran (Received 17 Dec 2011; accepted 11 May 2012) ABSTRACT Background: Geothermal waters could be suitable niches for thermophilic free living amoebae including Naegleria and Hartmannella. Ardebil Province, northwest Iran is popular for having many hot springs for recreational and health purposes activity. The present research is the first molecular based investigation regarding the presence of Naegleria and Hartmannella in the hot springs of Ardebil Province in Iran. Methods: Overall, 30 water samples were taken from waters of thermal hot springs in Ardebil Prov- ince, Iran during 2010-2011. All collected samples were transferred to Dept. of Parasitology and Mycology, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Cultivation of concentrated water samples was performed using culture-enrichment method. Cloning of the target amoebae was obtained and morphological and molecular analysis was done using page key combined with two sets of primers, respectively. Sequence analysis and homology search was used for strains identification. Results: Of 30 water samples, 8 (26.7%) were positive for thermotolerant Vahlkampfiids and Hartmannella based on morphological characteristics of vegetative form and double walled cysts. Cloning of the target amoebae were done successfully. Sequencing of the positive isolates revealed that the strains belonged to Naegleria (N. carteri and N. spp) and H. vermiformis. Conclusion: The result highlights a need for improved filtration and disinfection and periodic monitoring of recreational thermal waters in order to prevent disease related to free- living amoebae. This is the first comprehensive molecular study of thermophilic Naegleria and Hartmannella in hot springs of Iran. Keywords: Hot springs, Hartmannella, Naegleria, Iran Corresponding author: Tel: +989122407432 E-mail: maryamniyati@yahoo.com. 47 Solgi et al.: Occurrence of Thermotolerant Hartmannella vermiformis … Introduction ree-living amoebae (FLA) including waters have been used for recreational and various families which some of them health purpose. High temperature of thermal are classified as potentially pathogenic springs is suitable factor for growth of organisms for human and animals (1, 2). The thermotolerant amoebae such as Naegleria and family Vahlkampfiidae has been found in Hartmannella (1). Indeed, the ability of these environmental sources such as fresh water, ubiquitous organisms to tolerate high soil, dust and clays (3). To date, the genera of temperatures made thermal waters favorable Naegleria, Vahlkampfia and Paravahlkampfia niches. introduced as potentially pathogenic amoebae The present research is the first molecular for human (4-6). Indeed, recent report regard- based investigation regarding the presence of ing pathogenic potential of Vahlkampfia in Iran Naegleria and Hartmannella in hotsprings of leads to more attention regarding this free-liv- Ardebil Province in Iran. The occurrence of ing organism (4). The genus Naegleria spp. these amoebae highlights the need of more consists of 30 different species, two of which monitoring of such waters and reflects peri- (N. fowleri and N. australiensis) have been de- odic surveillance of recreational hot springs in scribed as potential pathogenic organisms and Iran. they are the causative agents of fulminant meningoencephalitis (1). These amoebae are Material and Methods able to tolerate extremes of temperature and thus thermal waters could be an ideal environ- Sampling ment for Naegleria growth and survival (1, 3). Overall, 30 water samples were taken from It should be mentioned that nonpathogenic thermal hot springs in Ardebil Province, Iran Naegleria could also be an important threat for during 2010-2011. All of the cities which con- human, since these avirulent amoebae could tained recreational hot springs have included harbor pathogenic microbes and could act as in the present study such as Sarein, Meshkin Trojan horse (7). A previous research in Iran shahr, Nir, Ardebil and Givi. Briefly, 500 ml revealed the presence of vahlkampfiids in of surface water were collected from hot thermal waters of Sarein City (8), however this springs and transferred to the Department of reported study were based on only Parasitology and Mycology, School of Medi- morphological criteria. It is important to men- cine, Shahid Beheshti University of Medical tion that morphological criteria can reveal the Sciences, Iran. All hot springs included were presence of vahlkampfiids, however, molecu- used for both recreation and for health pur- lar analysis is necessary for genera identifica- poses. tion of Vahlkampfidae family (9). The family Hartmannellidae also includes Filtration, cultivation and cloning thermotolerant amoebae such as Hartmannella Samples were filtered through cellulose nitrate vermiformis. There are recent reports regarding membranes with a pore size of 1.2 µm. The the pathogenic potential of this free living or- filters were then inverted and transferred onto ganism (10). A case of mixed keratitis infec- 1% non-nutrient agar plates covered with a tion has been reported due to Acanthamoeba thin layer of autoclaved Escherichia coli. Positive and H. vermiformis (10). plates were screened for vahlkampfiids and Ardebil Province in the northwest of Iran is a Hartmannella spp. using both optical and in- famous place for having many hot springs, hot verted microscopes based on pages key (11). tubs, spas, and mineral waters. These thermal Cloning of the candidate amoebae were per- 48 Iranian J Parasitol: Vol. 7, No.2, 2012, pp.47-52 formed using culture replicates according to our previous study (12). Sequencing of the PCR products PCR amplification and gel electrophoresis PCR-products were submitted to sequencing Amoebae were harvested from plates and using an ABI 3130X automatic sequencer at washed using phosphate-buffered saline (PBS the Research Center for Gastroenterology and pH 7). DNA Extraction was performed using Liver Diseases, Shahid Beheshti University of the Instagene matrix (Chelex; Biorad). Briefly, Medical Sciences, Tehran. Homolgy analysis approximately 1000 cells were incubated with of the obtained sequences with genes in the 50 µl Chelex. Incubation was done at 56 C gene data bank was done using BLAST soft- for 20 min. Additional incubation were per- ware from the National Center for formed for 10 min using boiling water. DNA Biotechnology Information (NCBI) site. The pellet was obtained by centrifuging the sam- highest homology and query overage was the ples at 10 000 g for 5 min and the supernatant base of strains identification. was used as the DNA template for PCR reac- tion. Modified phenol-chloroform methods Results were performed for DNA extraction of cysts Overall, out of 30 water samples, 8 (26.7 %) according to our previous study (12). were positive for vahlkampfiids and The PCR reaction was performed in 30 µl Hartmannellidae family based on morphology Ampliqone (Taq DNA Polymerase Master characteristics. Temperatures and pH of ther- Mix Red, Denmark) as a readymade mixture. mal springs were ranged from 41-53 C and Briefly, 25 µl of master mix with 5 ng DNA 4.90-7, respectively (Table 1). Vahlkmapfiids templates and 20 pmol primers were com- identification was based on spherical double bined to achieve a volume of 30 µl. Two sets wall cysts and temporarily branched tropho- of primers were used for identification of zoites (Fig. 1). Hartmannella were also characte- vahlkampfiids and Hartmannella spp. The first rized using morphological criteria including set was ITS primers which were able to detect small spherical or ovoid cyst shape and outer Naegleria spp. and they are designed to obtain wall of some were separated (Fig. 1). The tro- a 400-430 bp PCR product (13). The se- phozoite form was limax containing one small quences of ITS primers were: forward nucleolus. Cloning of the candidate amoebae 5’GAACCTGCGTAGGGATCATTT 3’ and were done successfully after 2 months. reverse primer ITS2 5’ A 400 bp and 800 bp PCR products were ob- TTTCTTTTCCTCCCCTTATTA 3’. The sec- tained for vahlkampfiids and Hartmannella, re- ond set was a primers which could amplify a spectively (Fig. 2). Sequence analysis of the fragment of 18s rRNA gene of Hartmannella PCR products revealed that the three (12, 14). The sequences were: forward 5’GCT vahlkampfiid amoebae belonged to the Naegle- CCA ATA GCG TAT ATT AA 3’ and revers ria genera (Isolates: HSS1, HSN1, HSM1). Ba- 5’ AGA AAG AGC TAT CAA TCT GT 3’. sic local alignment search tool (BLAST) Each PCR cycling condition included 35 cy- showed that one of strains had a high homol- cles of denaturation at 94 C for 1 min, fol- ogy to N. carteri (Accession number: lowed by 35 repetition cycles at 94 C for 35 s, AM167887.1). Moreover, all of the Hartman- annealing at 56 C for 45 s, and extension at nella isolates detected in the present study were 72 C for 1 min. identified as H. vermiformis. Gel electrophoresis were performed to detect Nucleotide sequence accession numbers were PCR products using 1.5% agarose gel stained deposited in the GenBank database (accession with a solution of ethidium bromide (25 mg number: JQ023590-JQ023597). ml-1) and examined under UV illumination. 49 Solgi et al.: Occurrence of Thermotolerant Hartmannella vermiformis … Fig. 1: (A) Light micrograph of Naegleria cysts in non-nutrient agar x400 (B) Light micrograph of Hartmannella vermiformis cysts in non-nutrient agar x400 Table 1: Location and distribution of Free- living Naegleria and Hartmannella in hot springs of Ardebil province, Iran Code Locality Water type pH Tem Genus Accession (°C) number HSS1 Sarein bicarbonate 6.15 46 Naegleria JQ023595 spring (N. carteri) HSS5 Sarein bicarbonate 6.28 41 Hartmannella JQ023592 spring vermiformis HSS9 Sarein bicarbonate 7.00 42.0 Hartmannella JQ023591 spring vermiformis HSS3 Sarein bicarbonate 6.07 43.50 Hartmannella JQ023590 spring vermiformis HSM1 Meshkin Sulfur spring 4.90 45.1 Hartmannella JQ023593 shahr vermiformis HSM1 Meshkin Sulfur spring 4.90 45.1 Naegleria spp. JQ023596 shahr HSM2 Meshkin bicarbonate 6.39 48.2 Hartmannella JQ023594 shahr spring vermiformis HSN1 Nir Sodium 6.18 53 Naegleria spp. JQ023597 chloride *HSS: Hot springs Sarein/HSM: Hot spring Meshkin shahr/HSN: Hot spring Nir 800 bp Fig. 2: PCR products of the isolated strains (Hartmannella spp. and Naegleria spp.) from hot springs of Ardebil province, Iran 50 Iranian J Parasitol: Vol. 7, No.2, 2012, pp.47-52 Discussion The present study is the first molecular genic free living amoebae must consider as a identification of FLA belonging to the Naegle- carrier of pathogenic microbes (18). It should ria spp. and H. vermiformis in hot springs of be noted that in one springs we have identi- Iran. Presence of potentially pathogenic FLA fied mixed (isolates: HSM1) amoebae belong- could be a serious hazard for people using ing to Hartmannella and Naegleria. Filtration of such waters. It is important to mention that this contaminated spring was not adequate for some of thermal waters in this region are used decontamination of water. for recovery of eye trauma. Therefore, the In conclusion, the result of the present study occurrence of H. vermiformis in thermal waters highlights an urgent need for improved filtra- could lead to the exposure of high risk people tion and disinfection and periodic monitoring to thermotolerant amoebae. Recent reports of thermal waters in order to prevent disease reflect the pathogenic potential of H. vermi- related to thermotolerant free living amoebae. formis for human cornea (10, 15). This is in agreement with Lorenzo et al. (2007) study Acknowledgments who revealed the presence of mixed keratitis infection due to Acanthamoeba and Hartmannella The corresponding author was supported by a (10). Hartmannella amoebae are also considered Research Grant from the National Elites as suitable hosts for pathogenic microorgan- Foundation for distinguished Young Assistant isms including Legionella pneumophila and Professors. The present research was funded Pseudomonas (16). Previous researches stated by the project # 89-01-91-7574 from the Sha- that Hartmannellid amoebae are an important hid Beheshti University of Medical Sciences, growth factor for L. pneumophila (16). Indeed, Tehran. The authors declare that they have no various factors including the ability of conflicts of interest. Hartmannella to grow at temperatures above 40 C and the isolation of this thermotolerant References amoebae from amoebic keratitis patients emphasize that Hartmannella could be a poten- 1. Visvesvara GS, Moura H, Schuster FL. tial pathogen for human (10). Moreover, Pathogenic and opportunistic free living according to previous researches it has been amoebae: Acanthamoeba spp, Balamuthia found that Hartmannella isolated from keratitis mandrillaris, Naegleria fowleri, and Sappinia patient could lead to cytotoxicity on epithelial diploidea. FEMS Immunol Med Microbiol. corneal cells (10). To this end, presence of 2007; 50(1):1-26. Hartmannella in hot springs should be consid- 2. Khan NA. Acanthamoeba: biology and in- ered as health hazard. creasing importance in human health. FEMS Microbiol Rev. 2006; 30(4): 564– The present study also reports the occurrence of Naegleria sp. based on molecular approaches. 3. Rezaeian M, Niyyati M. Pathogenic Free This is the first report of N. carteri in Iran. It is st Living Amebas In Human. 1 ed. Tehran: important to note that although the identified TUMS Publication; 2010. Naegleria are non-pathogenic and they have 4. Niyyati M, Lorenzo-Morales J, Rezaie S, not isolated from clinical cases yet, but they Rahimi F, Martín-Navarro CM, Mohebali could be a suitable host for pathogenic M, Maghsood AH, Farnia S, Valladares B, microorganisms (17). A previous research re- Rezaeian M. First report of a mixed ported that N. pagei could coexict with patho- infection due to Acanthamoeba genotype T3 genic L. pneumophila (17). Indeed, non-patho- and Vahlkampfia in a cosmetic soft contact 51 Solgi et al.: Occurrence of Thermotolerant Hartmannella vermiformis … lens wearer in Iran. Exp Parasitol. 2010; Genotyping of Acanthamoeba isolates from 126(1): 89-90. clinical and environmental specimens in 5. Visvesvara GS, Sriram R, Qvarnstorm Y, Iran. Exp Parasitol. 2009; 121(3): 242-245. Bandyopadhyay K, Silva A, Pina NJ, Ca- 13. Pelandakis M, Pernin P. Use of multiplex bral GA. Paravahlkampfia francinae n. sp. PCR and PCR restriction enzyme analysis Masquerading as an agent of primary for detection and exploration of the amoebic meningoencephalitis. J Eukaryot variability in the free-living amoeba Naegle- Microbiol. 2009; 56: 357–366. ria in the environment. Appl Environ 6. Marciano-Cabral F, Jamerson M, Kanes- Microbiol. 2002 ;68: 2061–2065. hiro ES. Free-living amoebae, Legionella and 14. Lasjerdi Z, Niyyati M, Haghighi A, Shahabi Mycobacterium in tap water supplied by a S, Biderouni FT, Taghipour N, Eftekhar M, municipal drinking water utility in the USA. Nazemalhosseini Mojarad E. Potentially J Water Health. 2010; 8(1): 71-82. pathogenic free-living amoebae isolated 7. Jamerson, M., Remmers, K., Cabral, G. & from hospital wards with immunodeficient Marciano-Cabral, F. Survey for the pres- patients in Tehran, Iran. Parasitol Res. ence of Naegleria fowleri amebae in lake wa- 2011;109(3):575-80. ter used to cool reactors at a nuclear power 15. Kennedy SM, Devine P, Hurley C, Ooi generating plant. Parasitol Res. 2009 ; 104: YS, Collum LMT. Corneal infection with 969–978. Hartmannella vermiformis in contact-lens 8. De Jonckheere JF. Molecular definition wearer. Lancet. 1995; 346: 637–638. and the ubiquity of species in the genus 16. Centeno M, Rivera F, Cerva L, Tsutsumi Naegleria. Protist. 2004; 155: 89–103. V, Gallegos E, Calderon A, Ortiz R, 9. Badirzadeh A, Niyyati M, Babaei Z, Amini Bonilla P, Ramirez E, Suarez G. Hartman- H, Badirzadeh H, Rezaeian M. Isolation of nella vermiformis isolated from the Free-Living Amoebae from Sarein Hot cerebrospinal fluid of a young male patient Springs in Ardebil Province, Iran. Iranian J with meningoencephalitis and Parasitol. 2011; 6 (2):1-8. bronchopneumonia. Arch Med Res. 1996; 10. Lorenzo-Morales J, Martínez-Carretero E, 27:579–586. Batista N, Alvarez-Marín J, Bahaya Y, Wa- 17. Huang SW, Hsu BM. Survey of Naegleria lochnik J, Valladares B. Early diagnosis of and its resisting bacteria-Legionella in hot amoebic keratitis due to a mixed infection spring water of Taiwan using molecular with Acanthamoeba and Hartmannella. Parasi- method. Parasitol Res. 2010; 106: 1395- tol Res. 2007 ;102(1):167-9. 1402. 11. Page FC (1988). A New Key to Freshwater 18. Huang SW, Hsu BM, Chen NH, Huang and Soil Gymnamoebae. Freshwater CC, Huang KH, Chen JS, Kao PM. Isola- Biological Association, Ambleside, UK. tion and identification of Legionella and 12. Niyyati M, Lorenzo-Morales J, Rezaie S, their host amoebae from weak alkaline car- Rahimi F, Mohebali M, Maghsood AH, bonate spring water using a culture method Motevalli-haghi A, Martín-Navarro CM, combined with PCR. Parasitol Res. 2011; Farnia Sh, Valladares B, Rezaeian M. DOI: 10.1007/s00436-011-2366-8. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Iranian Journal of Parasitology Pubmed Central

Occurrence of Thermotolerant Hartmannella vermiformis and Naegleria Spp. in Hot Springs of Ardebil Province, Northwest Iran

Iranian Journal of Parasitology , Volume 7 (2) – Aug 1, 168

Loading next page...
 
/lp/pubmed-central/occurrence-of-thermotolerant-hartmannella-vermiformis-and-naegleria-gqMyZoBZpb

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Pubmed Central
Copyright
© 2012 Iranian Society of Parasitology & Tehran University of Medical Sciences
ISSN
1735-7020
eISSN
2008-238X
Publisher site
See Article on Publisher Site

Abstract

Iranian J Parasitol: Vol. 7, No.2, 2012, pp.47-52 Iranian J Parasitol Tehran University of Medical Open access Journal at Sciences Publication http:// ijpa.tums.ac.ir Iranian Society of Parasitology http:// tums.ac.ir http:// isp.tums.ac.ir Original Article Occurrence of Thermotolerant Hartmannella vermiformis and Naegleria Spp. in Hot Springs of Ardebil Province, Northwest Iran 1 1 1 2 R Solgi , *M Niyyati , A Haghighi , E Nazemalhosseini Mojarad 1. Department of Medical Parasitology and Mycology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran 2. Research Center for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran (Received 17 Dec 2011; accepted 11 May 2012) ABSTRACT Background: Geothermal waters could be suitable niches for thermophilic free living amoebae including Naegleria and Hartmannella. Ardebil Province, northwest Iran is popular for having many hot springs for recreational and health purposes activity. The present research is the first molecular based investigation regarding the presence of Naegleria and Hartmannella in the hot springs of Ardebil Province in Iran. Methods: Overall, 30 water samples were taken from waters of thermal hot springs in Ardebil Prov- ince, Iran during 2010-2011. All collected samples were transferred to Dept. of Parasitology and Mycology, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Cultivation of concentrated water samples was performed using culture-enrichment method. Cloning of the target amoebae was obtained and morphological and molecular analysis was done using page key combined with two sets of primers, respectively. Sequence analysis and homology search was used for strains identification. Results: Of 30 water samples, 8 (26.7%) were positive for thermotolerant Vahlkampfiids and Hartmannella based on morphological characteristics of vegetative form and double walled cysts. Cloning of the target amoebae were done successfully. Sequencing of the positive isolates revealed that the strains belonged to Naegleria (N. carteri and N. spp) and H. vermiformis. Conclusion: The result highlights a need for improved filtration and disinfection and periodic monitoring of recreational thermal waters in order to prevent disease related to free- living amoebae. This is the first comprehensive molecular study of thermophilic Naegleria and Hartmannella in hot springs of Iran. Keywords: Hot springs, Hartmannella, Naegleria, Iran Corresponding author: Tel: +989122407432 E-mail: maryamniyati@yahoo.com. 47 Solgi et al.: Occurrence of Thermotolerant Hartmannella vermiformis … Introduction ree-living amoebae (FLA) including waters have been used for recreational and various families which some of them health purpose. High temperature of thermal are classified as potentially pathogenic springs is suitable factor for growth of organisms for human and animals (1, 2). The thermotolerant amoebae such as Naegleria and family Vahlkampfiidae has been found in Hartmannella (1). Indeed, the ability of these environmental sources such as fresh water, ubiquitous organisms to tolerate high soil, dust and clays (3). To date, the genera of temperatures made thermal waters favorable Naegleria, Vahlkampfia and Paravahlkampfia niches. introduced as potentially pathogenic amoebae The present research is the first molecular for human (4-6). Indeed, recent report regard- based investigation regarding the presence of ing pathogenic potential of Vahlkampfia in Iran Naegleria and Hartmannella in hotsprings of leads to more attention regarding this free-liv- Ardebil Province in Iran. The occurrence of ing organism (4). The genus Naegleria spp. these amoebae highlights the need of more consists of 30 different species, two of which monitoring of such waters and reflects peri- (N. fowleri and N. australiensis) have been de- odic surveillance of recreational hot springs in scribed as potential pathogenic organisms and Iran. they are the causative agents of fulminant meningoencephalitis (1). These amoebae are Material and Methods able to tolerate extremes of temperature and thus thermal waters could be an ideal environ- Sampling ment for Naegleria growth and survival (1, 3). Overall, 30 water samples were taken from It should be mentioned that nonpathogenic thermal hot springs in Ardebil Province, Iran Naegleria could also be an important threat for during 2010-2011. All of the cities which con- human, since these avirulent amoebae could tained recreational hot springs have included harbor pathogenic microbes and could act as in the present study such as Sarein, Meshkin Trojan horse (7). A previous research in Iran shahr, Nir, Ardebil and Givi. Briefly, 500 ml revealed the presence of vahlkampfiids in of surface water were collected from hot thermal waters of Sarein City (8), however this springs and transferred to the Department of reported study were based on only Parasitology and Mycology, School of Medi- morphological criteria. It is important to men- cine, Shahid Beheshti University of Medical tion that morphological criteria can reveal the Sciences, Iran. All hot springs included were presence of vahlkampfiids, however, molecu- used for both recreation and for health pur- lar analysis is necessary for genera identifica- poses. tion of Vahlkampfidae family (9). The family Hartmannellidae also includes Filtration, cultivation and cloning thermotolerant amoebae such as Hartmannella Samples were filtered through cellulose nitrate vermiformis. There are recent reports regarding membranes with a pore size of 1.2 µm. The the pathogenic potential of this free living or- filters were then inverted and transferred onto ganism (10). A case of mixed keratitis infec- 1% non-nutrient agar plates covered with a tion has been reported due to Acanthamoeba thin layer of autoclaved Escherichia coli. Positive and H. vermiformis (10). plates were screened for vahlkampfiids and Ardebil Province in the northwest of Iran is a Hartmannella spp. using both optical and in- famous place for having many hot springs, hot verted microscopes based on pages key (11). tubs, spas, and mineral waters. These thermal Cloning of the candidate amoebae were per- 48 Iranian J Parasitol: Vol. 7, No.2, 2012, pp.47-52 formed using culture replicates according to our previous study (12). Sequencing of the PCR products PCR amplification and gel electrophoresis PCR-products were submitted to sequencing Amoebae were harvested from plates and using an ABI 3130X automatic sequencer at washed using phosphate-buffered saline (PBS the Research Center for Gastroenterology and pH 7). DNA Extraction was performed using Liver Diseases, Shahid Beheshti University of the Instagene matrix (Chelex; Biorad). Briefly, Medical Sciences, Tehran. Homolgy analysis approximately 1000 cells were incubated with of the obtained sequences with genes in the 50 µl Chelex. Incubation was done at 56 C gene data bank was done using BLAST soft- for 20 min. Additional incubation were per- ware from the National Center for formed for 10 min using boiling water. DNA Biotechnology Information (NCBI) site. The pellet was obtained by centrifuging the sam- highest homology and query overage was the ples at 10 000 g for 5 min and the supernatant base of strains identification. was used as the DNA template for PCR reac- tion. Modified phenol-chloroform methods Results were performed for DNA extraction of cysts Overall, out of 30 water samples, 8 (26.7 %) according to our previous study (12). were positive for vahlkampfiids and The PCR reaction was performed in 30 µl Hartmannellidae family based on morphology Ampliqone (Taq DNA Polymerase Master characteristics. Temperatures and pH of ther- Mix Red, Denmark) as a readymade mixture. mal springs were ranged from 41-53 C and Briefly, 25 µl of master mix with 5 ng DNA 4.90-7, respectively (Table 1). Vahlkmapfiids templates and 20 pmol primers were com- identification was based on spherical double bined to achieve a volume of 30 µl. Two sets wall cysts and temporarily branched tropho- of primers were used for identification of zoites (Fig. 1). Hartmannella were also characte- vahlkampfiids and Hartmannella spp. The first rized using morphological criteria including set was ITS primers which were able to detect small spherical or ovoid cyst shape and outer Naegleria spp. and they are designed to obtain wall of some were separated (Fig. 1). The tro- a 400-430 bp PCR product (13). The se- phozoite form was limax containing one small quences of ITS primers were: forward nucleolus. Cloning of the candidate amoebae 5’GAACCTGCGTAGGGATCATTT 3’ and were done successfully after 2 months. reverse primer ITS2 5’ A 400 bp and 800 bp PCR products were ob- TTTCTTTTCCTCCCCTTATTA 3’. The sec- tained for vahlkampfiids and Hartmannella, re- ond set was a primers which could amplify a spectively (Fig. 2). Sequence analysis of the fragment of 18s rRNA gene of Hartmannella PCR products revealed that the three (12, 14). The sequences were: forward 5’GCT vahlkampfiid amoebae belonged to the Naegle- CCA ATA GCG TAT ATT AA 3’ and revers ria genera (Isolates: HSS1, HSN1, HSM1). Ba- 5’ AGA AAG AGC TAT CAA TCT GT 3’. sic local alignment search tool (BLAST) Each PCR cycling condition included 35 cy- showed that one of strains had a high homol- cles of denaturation at 94 C for 1 min, fol- ogy to N. carteri (Accession number: lowed by 35 repetition cycles at 94 C for 35 s, AM167887.1). Moreover, all of the Hartman- annealing at 56 C for 45 s, and extension at nella isolates detected in the present study were 72 C for 1 min. identified as H. vermiformis. Gel electrophoresis were performed to detect Nucleotide sequence accession numbers were PCR products using 1.5% agarose gel stained deposited in the GenBank database (accession with a solution of ethidium bromide (25 mg number: JQ023590-JQ023597). ml-1) and examined under UV illumination. 49 Solgi et al.: Occurrence of Thermotolerant Hartmannella vermiformis … Fig. 1: (A) Light micrograph of Naegleria cysts in non-nutrient agar x400 (B) Light micrograph of Hartmannella vermiformis cysts in non-nutrient agar x400 Table 1: Location and distribution of Free- living Naegleria and Hartmannella in hot springs of Ardebil province, Iran Code Locality Water type pH Tem Genus Accession (°C) number HSS1 Sarein bicarbonate 6.15 46 Naegleria JQ023595 spring (N. carteri) HSS5 Sarein bicarbonate 6.28 41 Hartmannella JQ023592 spring vermiformis HSS9 Sarein bicarbonate 7.00 42.0 Hartmannella JQ023591 spring vermiformis HSS3 Sarein bicarbonate 6.07 43.50 Hartmannella JQ023590 spring vermiformis HSM1 Meshkin Sulfur spring 4.90 45.1 Hartmannella JQ023593 shahr vermiformis HSM1 Meshkin Sulfur spring 4.90 45.1 Naegleria spp. JQ023596 shahr HSM2 Meshkin bicarbonate 6.39 48.2 Hartmannella JQ023594 shahr spring vermiformis HSN1 Nir Sodium 6.18 53 Naegleria spp. JQ023597 chloride *HSS: Hot springs Sarein/HSM: Hot spring Meshkin shahr/HSN: Hot spring Nir 800 bp Fig. 2: PCR products of the isolated strains (Hartmannella spp. and Naegleria spp.) from hot springs of Ardebil province, Iran 50 Iranian J Parasitol: Vol. 7, No.2, 2012, pp.47-52 Discussion The present study is the first molecular genic free living amoebae must consider as a identification of FLA belonging to the Naegle- carrier of pathogenic microbes (18). It should ria spp. and H. vermiformis in hot springs of be noted that in one springs we have identi- Iran. Presence of potentially pathogenic FLA fied mixed (isolates: HSM1) amoebae belong- could be a serious hazard for people using ing to Hartmannella and Naegleria. Filtration of such waters. It is important to mention that this contaminated spring was not adequate for some of thermal waters in this region are used decontamination of water. for recovery of eye trauma. Therefore, the In conclusion, the result of the present study occurrence of H. vermiformis in thermal waters highlights an urgent need for improved filtra- could lead to the exposure of high risk people tion and disinfection and periodic monitoring to thermotolerant amoebae. Recent reports of thermal waters in order to prevent disease reflect the pathogenic potential of H. vermi- related to thermotolerant free living amoebae. formis for human cornea (10, 15). This is in agreement with Lorenzo et al. (2007) study Acknowledgments who revealed the presence of mixed keratitis infection due to Acanthamoeba and Hartmannella The corresponding author was supported by a (10). Hartmannella amoebae are also considered Research Grant from the National Elites as suitable hosts for pathogenic microorgan- Foundation for distinguished Young Assistant isms including Legionella pneumophila and Professors. The present research was funded Pseudomonas (16). Previous researches stated by the project # 89-01-91-7574 from the Sha- that Hartmannellid amoebae are an important hid Beheshti University of Medical Sciences, growth factor for L. pneumophila (16). Indeed, Tehran. The authors declare that they have no various factors including the ability of conflicts of interest. Hartmannella to grow at temperatures above 40 C and the isolation of this thermotolerant References amoebae from amoebic keratitis patients emphasize that Hartmannella could be a poten- 1. Visvesvara GS, Moura H, Schuster FL. tial pathogen for human (10). Moreover, Pathogenic and opportunistic free living according to previous researches it has been amoebae: Acanthamoeba spp, Balamuthia found that Hartmannella isolated from keratitis mandrillaris, Naegleria fowleri, and Sappinia patient could lead to cytotoxicity on epithelial diploidea. FEMS Immunol Med Microbiol. corneal cells (10). To this end, presence of 2007; 50(1):1-26. Hartmannella in hot springs should be consid- 2. Khan NA. Acanthamoeba: biology and in- ered as health hazard. creasing importance in human health. FEMS Microbiol Rev. 2006; 30(4): 564– The present study also reports the occurrence of Naegleria sp. based on molecular approaches. 3. Rezaeian M, Niyyati M. Pathogenic Free This is the first report of N. carteri in Iran. It is st Living Amebas In Human. 1 ed. Tehran: important to note that although the identified TUMS Publication; 2010. Naegleria are non-pathogenic and they have 4. Niyyati M, Lorenzo-Morales J, Rezaie S, not isolated from clinical cases yet, but they Rahimi F, Martín-Navarro CM, Mohebali could be a suitable host for pathogenic M, Maghsood AH, Farnia S, Valladares B, microorganisms (17). A previous research re- Rezaeian M. First report of a mixed ported that N. pagei could coexict with patho- infection due to Acanthamoeba genotype T3 genic L. pneumophila (17). Indeed, non-patho- and Vahlkampfia in a cosmetic soft contact 51 Solgi et al.: Occurrence of Thermotolerant Hartmannella vermiformis … lens wearer in Iran. Exp Parasitol. 2010; Genotyping of Acanthamoeba isolates from 126(1): 89-90. clinical and environmental specimens in 5. Visvesvara GS, Sriram R, Qvarnstorm Y, Iran. Exp Parasitol. 2009; 121(3): 242-245. Bandyopadhyay K, Silva A, Pina NJ, Ca- 13. Pelandakis M, Pernin P. Use of multiplex bral GA. Paravahlkampfia francinae n. sp. PCR and PCR restriction enzyme analysis Masquerading as an agent of primary for detection and exploration of the amoebic meningoencephalitis. J Eukaryot variability in the free-living amoeba Naegle- Microbiol. 2009; 56: 357–366. ria in the environment. Appl Environ 6. Marciano-Cabral F, Jamerson M, Kanes- Microbiol. 2002 ;68: 2061–2065. hiro ES. Free-living amoebae, Legionella and 14. Lasjerdi Z, Niyyati M, Haghighi A, Shahabi Mycobacterium in tap water supplied by a S, Biderouni FT, Taghipour N, Eftekhar M, municipal drinking water utility in the USA. Nazemalhosseini Mojarad E. Potentially J Water Health. 2010; 8(1): 71-82. pathogenic free-living amoebae isolated 7. Jamerson, M., Remmers, K., Cabral, G. & from hospital wards with immunodeficient Marciano-Cabral, F. Survey for the pres- patients in Tehran, Iran. Parasitol Res. ence of Naegleria fowleri amebae in lake wa- 2011;109(3):575-80. ter used to cool reactors at a nuclear power 15. Kennedy SM, Devine P, Hurley C, Ooi generating plant. Parasitol Res. 2009 ; 104: YS, Collum LMT. Corneal infection with 969–978. Hartmannella vermiformis in contact-lens 8. De Jonckheere JF. Molecular definition wearer. Lancet. 1995; 346: 637–638. and the ubiquity of species in the genus 16. Centeno M, Rivera F, Cerva L, Tsutsumi Naegleria. Protist. 2004; 155: 89–103. V, Gallegos E, Calderon A, Ortiz R, 9. Badirzadeh A, Niyyati M, Babaei Z, Amini Bonilla P, Ramirez E, Suarez G. Hartman- H, Badirzadeh H, Rezaeian M. Isolation of nella vermiformis isolated from the Free-Living Amoebae from Sarein Hot cerebrospinal fluid of a young male patient Springs in Ardebil Province, Iran. Iranian J with meningoencephalitis and Parasitol. 2011; 6 (2):1-8. bronchopneumonia. Arch Med Res. 1996; 10. Lorenzo-Morales J, Martínez-Carretero E, 27:579–586. Batista N, Alvarez-Marín J, Bahaya Y, Wa- 17. Huang SW, Hsu BM. Survey of Naegleria lochnik J, Valladares B. Early diagnosis of and its resisting bacteria-Legionella in hot amoebic keratitis due to a mixed infection spring water of Taiwan using molecular with Acanthamoeba and Hartmannella. Parasi- method. Parasitol Res. 2010; 106: 1395- tol Res. 2007 ;102(1):167-9. 1402. 11. Page FC (1988). A New Key to Freshwater 18. Huang SW, Hsu BM, Chen NH, Huang and Soil Gymnamoebae. Freshwater CC, Huang KH, Chen JS, Kao PM. Isola- Biological Association, Ambleside, UK. tion and identification of Legionella and 12. Niyyati M, Lorenzo-Morales J, Rezaie S, their host amoebae from weak alkaline car- Rahimi F, Mohebali M, Maghsood AH, bonate spring water using a culture method Motevalli-haghi A, Martín-Navarro CM, combined with PCR. Parasitol Res. 2011; Farnia Sh, Valladares B, Rezaeian M. DOI: 10.1007/s00436-011-2366-8.

Journal

Iranian Journal of ParasitologyPubmed Central

Published: Aug 1, 168

References