Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

A necdin/MAGE-like gene in the chromosome 15 autism susceptibility region: expression, imprinting, and mapping of the human and mouse orthologues

A necdin/MAGE-like gene in the chromosome 15 autism susceptibility region: expression,... Background: Proximal chromosome 15q is implicated in neurodevelopmental disorders including Prader-Willi and Angelman syndromes, autistic disorder and developmental abnormalities resulting from chromosomal deletions or duplications. A subset of genes in this region are subject to genomic imprinting, the expression of the gene from only one parental allele. Results: We have now identified the NDNL2 (also known as MAGE-G) gene within the 15q autistic disorder susceptibility region and have mapped its murine homolog to the region of conserved synteny near necdin (Ndn) on mouse Chr 7. NDNL2/MAGE-G is a member of a large gene family that includes the X-linked MAGE cluster, MAGED1 (NRAGE), MAGEL2 and NDN, where the latter two genes are implicated in Prader-Willi syndrome. We have now determined that NDNL2/Ndnl2 is widely expressed in mouse and human fetal and adult tissues, and that it is apparently not subject to genomic imprinting by the PWS/AS Imprinting Center. Conclusion: Although NDNL2/MAGE-G in the broadly defined chromosome 15 autistic disorder susceptibility region, it is not likely to be pathogenic based on its wide expression pattern and lack of imprinted expression. Background with UBE3A mutations [6,7]. Strong candidates for PWS Human chromosome 15q is prone to cytogenetic rear- have recently emerged and are likely to have an additive rangements, in part due to repetitive elements located effect in causing this disorder [8–12]. In particular, two therein [1,2]. Prader-Willi syndrome (PWS) and Angel- members of the NDN/MAGE gene family, NDN and man syndrome (AS) are two neurodevelopmental disor- MAGEL2, are located in the PWS deletion region and are ders caused by deletions of 15q11-q13, and inactivated in individuals with PWS [8,11–14]. Respira- neurodevelopmental abnormalities are associated with tory and behavioral abnormalities in a mouse deleted for supernumerary chromosomes derived from inverted du- Ndn, the murine orthologue of NDN, may suggest that plications of 15q [3]. In addition, an autistic disorder sus- NDN is implicated in the PWS phenotype [15,16]. We ceptibility locus has been localized to proximal 15q by have therefore investigated the possibility that other linkage and association studies [4,5]. AS is associated NDN/MAGE genes may also be present on proximal 15q Page 1 of 7 (page number not for citation purposes) BMC Genetics 2001, 2:22 http://www.biomedcentral.com/1471-2156/2/22 region for a 15q autistic disorder susceptibility locus, and outside the PWS/AS deletion region [4,5] (Fig. 1). An open reading frame of 472 amino acids was predicted from the genomic sequence of NDNL2 and is located within a single exon of the predicted gene. A series of ex- pressed sequence tags (ESTs) were identified through a BLAST search of the EST database and were found to be part of the Unigene cluster Hs.94011. Assembly of the ESTs into a consensus sequence was performed and this sequence was compared to our sequence of IMAGE clones representing NDNL2 to arrive at a final sequence for the predicted protein (Fig. 2) (also see partial se- quence in GenBank AF320911, MAGE-G). The sequence for murine Ndnl2 was identified using se- quence data obtained from homology searches of mouse ESTs (UniGene cluster Mm.19944). Comparison of the sequence from multiple cDNAs revealed that the predict- ed mouse protein has 279 amino acids and has 83% se- quence identity with the human protein (Fig. 2). As with other NDN/MAGE family members, the maximum se- quence conservation is in the C-terminus of the protein, Figure 1 suggesting a common function for this domain among Map of the human 15q11-q14 region. Location of family members. The murine protein is truncated at the NDNL2 was derived from the Ensembl Human Genome server [http://www.ensembl.org/] and the physical location N terminus compared to the human protein at the posi- of APBA2, which is located on the same genomic clone as tion equivalent to the methionine at position 168 in the NDNL2. The large double-headed arrow indicates the com- human predicted protein, predicted based on the pres- mon PWS/AS deletion, and BP2 and BP3 indicate the most ence of a strong Kozak consensus surrounding the common proximal and distal breakpoint regions. The break- murine AUG, including a G at the minus three position. point region for the largest inv dup (15) chromosome [27] In at least two EST clones, including RIKEN clone and the autistic disorder susceptibility region [5] are also AK010294 from a library enriched for full-length cDNAs, indicated. The physical distance between BP3 and APBA2/ the predicted amino acids upstream of the putative NDNL2 is as yet unknown due to the presence of repetitive murine start methionine are not conserved with the hu- elements in the intervening region. man sequence, in sharp contrast with those C-terminal to this methionine (Fig. 2). In addition, the lack of con- and may be involved in neurodevelopmental disorders. servation does not appear to be due to the presence of an Indeed, we identified a novel necdin-related gene, intron or a sequencing error. Closer inspection of the se- NDNL2, on proximal 15q within the critical region for quence revealed that NDNL2 contains only partial simi- autistic disorder susceptibility. We have examined the larity to the antigenic nonapeptide characteristic of other expression of NDNL2 and its murine orthologue, and MAGE family proteins (Fig. 2). Ndnl2 is identical in se- placed the murine gene on Chr. 7. The proximal region of quence to a predicted protein named "mage-g1" (Gen- chromosome 15 is subject to genomic imprinting, the ex- Bank accession AF319979). pression of a gene from only one allele depending on par- ent-of-origin. Furthermore, the maternal derivation of We identified a DNA polymorphism within Ndnl2 by di- chromosome 15 abnormalities seen in individuals with rect sequencing of a 469 bp PCR product amplified from autistic disorder suggests a parent-of origin effect [4,5]. M. musculus strain C57BL/6JEi and M. spretus SPRET/ We have therefore analyzed the imprinting of human Ei DNA. The presence of a T to C transition at position 42 and mouse NDNL2/Ndnl2. of AV005659 abolishes an Msp I site in C57BL/6JEi that is present in SPRET/Ei. By genotyping the Jackson labo- Results and discussion ratory BSS backcross derived from the cross (C57BL/ Using a BLAST search for genes with sequence similarity 6JEi × SPRET/Ei)F1 × SPRET/Ei), we demonstrated to NDN, NDNL2 was identified as a MAGE-like protein linkage of Ndnl2 to chromosome 7, at a position geneti- on the BAC clone RP11-18H24 (GenBank accession cally inseparable from that of Ndn (see Mouse Genome AC016484). This clone also contains the APBA2 gene Informatics, [http://www.informatics.jax.org/] for de- which has been physically mapped to within the critical tails). As predicted from the location of human APBA2 Page 2 of 7 (page number not for citation purposes) BMC Genetics 2001, 2:22 http://www.biomedcentral.com/1471-2156/2/22 Figure 2 Sequence comparison of human NDNL2 and mouse Ndnl2 sequence. The human and mouse predicted amino acid sequences are aligned with conserved amino acids shaded. Partial sequence of two cDNA clones has been included for com- parison of the predicted translation with the longer human open reading frame. The predicted position of a MAGE-like non- apeptide present in other MAGE proteins is underlined. near NDNL2, the murine Apba2 gene is also located in mosomal disorders of chromosome 15 [4], we performed the central region of Chr 7, but the use of different map- experiments to analyze the imprinting of NDNL2 and ping panels for the two genes does not permit their rela- Ndnl2. To test imprinting of Ndnl2, we examined new- tive order to be established [17]. Based on the high born brain, liver and lung, and embryonic day 12.5 whole sequence similarity between human and mouse sequenc- embryo RNA samples from the offspring of an interspe- es and on the location in a region of conserved synteny cific mouse cross for allelic expression using the same we conclude that the NDNL2 andNdnl2 genes are orthol- murine MspI polymorphism as used for genetic map- ogous in these two species. ping. Both parental alleles were detected equally, indi- cating that expression of Ndnl2 is not imprinted (Fig. The expression of NDNL2 and Ndnl2 was analyzed by 4A). We were unable to identify an intragenic polymor- northern blot studies (Fig. 3). The observed 1.9 kb RNA phism in NDNL2 that would allow direct evaluation of transcript roughly corresponds in size to the 1.5 kb cDNA the levels of expression of each allele. Instead, we evalu- present in IMAGE clone 1134795, which likely contains ated the effect of deletion of the chromosome 15q11-q13 most of the transcript. The transcript was observed in all imprinting center (IC) on the expression of NDNL2. Spo- human tissues tested, and appeared to be most abundant radic PWS and AS patients with de novo deletions not in testis after adjustments were made for RNA loading. only have a loss of the genes located inside the deletion Expression in mouse is also widespread, with a moder- interval, they also have a loss of the imprinting control ately abundant 1.7 kb transcript observed in all tissues element located therein. In a previous study, a somatic, tested consistent with the 1.5 kb insert size for cDNA de novo deletion of the IC impaired imprinting of target clone RIKEN ID 1010001J10. The origin of the smaller genes [22]. These target genes are not necessarily limited transcript in mouse testis is unknown but may represent to the region typically deleted in PWS and AS, which is an alternative polyadenylation site or alternative tran- defined by unstable genomic elements located at the de- scriptional start site. It is notable that expression of letion boundaries [1], but could include other genes with- NDNL2/Ndnl2 is widespread although for other family in the range of the imprinting center. However, our members, including Ndn, Magel2 and Dlxin, the murine previous study had predicted that it is unlikely that the homologue of MAGED1, expression is more spatially and range of the IC extended beyond the deletion itself [20]. temporally limited [12,18,19]. To test this hypothesis and to examine the possibility that NDNL2 is acted on by the IC, we tested the effect of Previous studies have suggested that the imprinted do- the loss of the IC in sporadic PWS and AS patients on the main on chromosome 15q is limited to a region of about expression of NDNL2. Using a previously defined assay 1.5 Mb surrounding the imprinting center [20,21]. How- [20], RNA from lymphoblast and fibroblast cell lines that ever, given the observed parent-of-origin effects in chro- carry either a paternal 15q11-q13 deletion (PWS) or the Page 3 of 7 (page number not for citation purposes) BMC Genetics 2001, 2:22 http://www.biomedcentral.com/1471-2156/2/22 Figure 3 Expression analysis necdin-like 2 in embryonic and adult human and mouse tissues. (A) Northern blots of adult (left and center) and fetal (right) human tissues. The 1.9 kb NDNL2 transcript is indicated by the arrow. Size markers are as indicated. (B) Northern blot of adult (left) and embryonic (right) mouse tissues shows expression of a 1.7 kb transcript (arrow). equivalent maternal deletion (AS) were tested by RT- that the human and mouse nomenclature committees PCR for expression of NDNL2. On repeated trials, both evaluate the arguments for the names of genes in this cell lines expressed NDNL2, indicating that NDNL2 is gene family to establish a unified nomenclature that clar- not imprinted by the imprinting center located in the de- ifies the relationships among the family members. letion region (Fig. 4B). Necdin was originally identified as a gene induced on The names NDNL2/Ndnl2 have been approved by the neuronal differentiation of embryonic carcinoma cells, human and mouse nomenclature committees, based on but has more recently been implicated in PWS. Members sequence similarity to NDN and chromosomal localiza- of the MAGE gene family are recognized for their expres- tion. In a recent review of the NDN/MAGE gene family, sion in tumor cells, and a new family member MAGED1 a multiple sequence alignment clustered the chromo- (NRAGE/dlxin) is postulated to have roles in chondro- some 15 family members (NDN, MAGEL2/NDNL1, and genesis, neurotrophin signaling and apoptosis NDNL2/MAGE-G) together with the X-linked MAGE-D, [19,24,25]. Although the widespread expression of MAGE-E and chromosome 3-linked MAGE-F genes NDNL2 does not immediately suggest a role in the neu- [23]. MAGE-D, known more commonly as NRAGE (hu- rodevelopmental disorders associated with abnormali- man) or dlxin (mouse) may be ancestral to other mem- ties of chromosome 15, NDNL2 is located within the bers of the NDN/MAGE gene family. We recommend broad region associated with developmental disorders. Page 4 of 7 (page number not for citation purposes) BMC Genetics 2001, 2:22 http://www.biomedcentral.com/1471-2156/2/22 Figure 4 Imprinting analysis of NDNL2/Ndnl2. (A) Restriction digestion of PCR of genomic DNA from C57BL/6, SPRET and an F1 offspring demonstrating the interspecific polymorphism, RT-PCR of tissues (nb = newborn) from the F1 offspring. Note that both alleles are active. (B) RT-PCR of fibroblast (FB) and lymphoblast (LCL) RNA from PWS, AS and control samples. NDNL2 is expressed in all cell lines whereas SNRPN is not expressed in PWS cell lines (i.e. is imprinted). In particular, the location of NDNL2 near D15S1019, (Amersham-Phamacia Biotech, Buckinghamshire, Eng- proximal to D15S165 implies that copies of NDNL2 are land) and LiCor technology (LiCor 4200 Automatic Se- present on most phenotypically relevant inv dup(15) quencer, Lincoln, Nebraska). The human cDNA was chromosomes [26,27] and may contribute to the findings represented by IMAGE clone 1147395; mouse cDNAs in patients carrying these supernumerary chromosomes were IMAGE clones 483464, 2101532 and RIKEN through a doubling of NDNL2 expression levels. Howev- #1010001J10. er, NDNL2 is outside the more narrowed interstitial du- plication interval associated with some autistic Northern blot expression studies phenotypes [28], although long range effects on NDNL2 A PCR product derived from the 3' end of human NDNL2 expression may still occur. was generated with oligonucleotide primers NDNL2-3F (5'-GTCTACCCCACCAAGAAGCA) and NDNL2-4R (5'- CCTTCCCCCAATCCTCTAAA), in a 20 µl PCR reaction Conclusions Given the wide range of processes that members of this containing 20 pmol of each oligonucleotide. The PCR intriguing gene family participate in and the possibility was performed as follows: 94°C for 5 min. followed by 30 of redundant function within the gene family, we suggest cycles of 94°C for 30 s, 52°C for 30 s, 72°C for 30 s, and that the 15q NDN/MAGE family members be considered final extension at 72°C for 10 min., The PCR product was as candidates for involvement in the neurodevelopmen- random prime P-dCTP labeled with the Random Prim- tal disorders associated with chromosome 15q. ers DNA Labeling System (Life Technologies, Rockville, MD). The labeled probe was hybridized to human adult Materials and methods and fetal Multiple Tissue Northern (MTN) Blots (Clon- cDNA clones tech Laboratories, Palo Alto, CA., Cat. #7760–1, 7759–1 Human and mouse cDNAs were obtained from Research and 7756–1) in ExpressHyb solution according to manu- Genetics or the MRC Genome Resource Facility and were facturer's directions. The final wash was at 50°C in sequenced using the Thermo Sequenase fluorescent la- 0.1XSSC, 0.1%SDS twice for 20 min each time. Exposure beled primer cycle sequencing kit with 7-deaza dGTP to Hyperfilm (Amersham-Pharmacia Biotech) was for Page 5 of 7 (page number not for citation purposes) BMC Genetics 2001, 2:22 http://www.biomedcentral.com/1471-2156/2/22 2. Christian SL, Fantes JA, Mewborn SK, Huang B, Ledbetter DH: Large four days at -80°C. Oligonucleotide primers Ndnl2-1F genomic duplicons map to sites of instability in the Prader- (5'-CTTGGAGTACCGGAGGATACC) and Ndnl2-2R (5'- Willi/Angelman syndrome chromosome region (15q11-q13). CAACACATCCTAACGCTCCA) were used for mouse Hum. Mol. Genet 1999, 8:1025-1037 3. Nicholls RD: The impact of genomic imprinting for neurobe- northern blots. These primers amplified a 343 bp DNA havioral and developmental disorders. J. Clin. Invest 2000, fragment corresponding to the 3' end of the Ndnl2 gene. 105:413-418 4. Maddox LO, Menold MM, Bass MP, Rogala AR, Pericak-Vance MA, The PCR was performed as above but with an annealing Vance JM, Gilbert JR: Autistic disorder and chromosome temperature of 58°C. Mouse adult and embryo MTN 15q11-q13: construction and analysis of a BAC/PAC contig. blots (Cat. #7762–1 and 7763–1, Clontech Laboratories) Genomics 1999, 62:325-331 5. Bass MP, Menold MM, Wolpert CM, Donnelly SL, Ravan SA, Hauser were similarly hybridized with the radioactively labeled ER, Maddox LO, Vance JM, Abramson RK, Wright HH, Gilbert JR, Ndnl21F/2R PCR product. To control for the amount of Cuccaro ML, DeLong GR, Pericak-Vance MA: Genetic studies in loaded RNA the same blot was subsequently hybridized autistic disorder and chromosome 15. Neurogenetics 2000, 2:219-226 with a β-actin or ubiquitin probe demonstrating approx- 6. Matsuura T, Sutcliffe JS, Fang P, Galjaard R-J, Jiang Y-h, Benton CS, imately equal loading in all lanes. Rommens JM, Beaudet AL: De novo truncation mutations in E6- AP ubiquitin-protein ligase gene (UBE3A) in Angelman syn- drome. Nature Genet 1997, 15:74-77 Genetic mapping and imprinting studies 7. Kishino T, Lalande M, Wagstaff J: UBE3A/E6-AP mutations cause A 469 bp product corresponding to the 3' end of Ndnl2 Angelman syndrome. Nature Genet 1997, 15:70-73 8. MacDonald HR, Wevrick R: The necdin gene is deleted in Prad- was generated from mouse genomic DNA (C57BL/J or er-Willi syndrome and is imprinted in human and mouse. SPRET/Ei) using oligonucleotide primers Ndnl2-7F (5'- Hum. Mol. Genet 1997, 6:1873-1878 9. Cavaille J, Buiting K, Kiefmann M, Lalande M, Brannan CI, Horsthemke TGGAAACCAGCAAGATGAAA) and Ndnl2-8R (5'- B, Bachellerie JP, Brosius J, Huttenhofer A: From the cover: iden- AGCTACCCTGTTTCTTTATCGTC). DNA samples were tification of brain-specific and imprinted small nucleolar sequenced on both strands using the LiCor automated RNA genes exhibiting an unusual genomic organization. Proc. Natl. Acad. Sci. U S A 2000, 97:14311-14316 sequencer. DNA amplification products were digested 10. de los Santos T, Schweizer J, Rees CA, Francke U: Small evolution- with MspI to produce a 469 bp undigested product in arily conserved RNA, resembling C/D box small nucleolar C57BL/6J and 180 bp and 289 bp digested products in RNA, is transcribed from PWCR1, a novel imprinted gene in the Prader-Willi deletion region, which Is highly expressed in DNA from M. spretus. Genetic mapping was performed brain. Am. J. Hum. Genet 2000, 67:1067-1082 on the Jackson Laboratories BSS backcross. Cell lines 11. Boccaccio I, Glatt-Deeley H, Watrin F, Roeckel N, Lalande M, Musc- atelli F: The human MAGEL2 gene and its mouse homologue used for human imprinting analysis were PWS lymphob- are paternally expressed and mapped to the Prader-Willi re- last GM09024B and AS lymphoblast GM11515 (both gion. Hum. Mol. Genet 1999, 8:2497-2505 from the NIGMS Human Genetic Mutant Cell Reposi- 12. Lee S, Kozlov S, Hernandez L, Chamberlain SJ, Brannan CI, Stewart CL, Wevrick R: Expression and imprinting of MAGEL2 suggest tory), PWS fibroblast 1889 from the University of Miami a role in Prader-Willi syndrome and the homologous murine Brain and Tissue Bank for Developmental Disorders and imprinting phenotype. Hum. Mol. Genet 2000, 9:1813-1819 AS fibroblast KAT graciously provided by Dr. A. Beaudet 13. Jay P, Rougeulle C, Massacrier A, Moncla A, Mattei MG, Malzac P, Roeckel N, Taviaux S, Lefranc JL, Cau P, Berta P, Lalande M, Muscatelli (Baylor College of Medicine). F: The human necdin gene, NDN, is maternally imprinted and located in the Prader-Willi syndrome chromosomal re- gion. Nature Genet 1997, 17:357-361 List of abbreviations 14. Sutcliffe JS, Han M, Christian SL, Ledbetter DH: Neuronally-ex- AS (Angelman syndrome), ESTs, (expressed sequence pressed necdin gene: an imprinted candidate gene in Prader- tags), IC (imprinting center), PWS (Prader-Willi syn- Willi syndrome. Lancet 1997, 350:1520-1521 15. Gerard M, Hernandez L, Wevrick R, Stewart C: Disruption of the drome). mouse necdin gene results in early postnatal lethality: a model for neonatal distress in Prader-Willi syndrome. Nature Genet 1999, 23:199-202 Acknowledgements 16. Muscatelli F, Abrous DN, Massacrier A, Boccaccio I, Moal ML, Cau P, We thank Mary Barter from the Jackson Laboratories for the murine hap- Cremer H: Disruption of the mouse necdin gene results in hy- lotype analysis, the MRC Genome Resource Facility and the RIKEN Ge- pothalamic and behavioral alterations reminiscent of the hu- nome Science Center for DNA clones, and Dr. A. Beaudet for the AS man Prader-Willi syndrome. Hum. Mol. Genet 2000, 9:3101-3110 fibroblast cell line. Samples used in this study were provided by the Univer- 17. Blanco G, Irving NG, Brown SD, Miller CC, McLoughlin DM: Map- sity of Miami Brain and Tissue Bank for Developmental Disorders through ping of the human and murine X11-like genes (APBA2 and NICHD contract # NO1-HD-8-3284. This work was supported in part by apba2), the murine Fe65 gene (Apbb1), and the human a Research Grant No. 6-FY00-196 from the March of Dimes Birth Defects Fe65-like gene (APBB2): genes encoding phosphotyrosine- Foundation, Summer Studentships to T.K.C. from the Alberta Heritage binding domain proteins that interact with the Alzheimer's Foundation for Medical Research (AHFMR) and the Canadian Genetic Dis- disease amyloid precursor protein. Mamm. Genome 1998, 9:473- ease Network. R.W. is a Scholar of the AHFMR and the Canadian Institutes of Health Research. Research involving human subjects and animals has 18. Yoshikawa K: Cell cycle regulators in neural stem cells and been performed in accordance with the Institutional policies of the Univer- postmitotic neurons. Neurosci. Res 2000, 37:1-14 sity of Alberta. 19. Masuda Y, Sasaki A, Shibuya H, Ueno N, Ikeda K, Watanabe K: Dlxin- 1, a novel protein that binds Dlx5 and regulates its transcrip- References tional function. J. Biol. Chem 2000, 17:5331-5338 1. Amos-Landgraf JM, Ji Y, Gottlieb W, Depinet T, Wandstrat AE, Cas- 20. Lee S, Wevrick R: Identification of novel imprinted transcripts sidy SB, Driscoll DJ, Rogan PK, Schwartz S, Nicholls RD: Chromo- in the Prader-Willi/Angelman syndrome deletion region: some breakage in the Prader-Willi and Angelman further evidence for regional imprinting control. Am. J. Hum. syndromes involves recombination between large, tran- Genet 2000, 66:848-858 scribed repeats at proximal and distal breakpoints. Am. J. Hum. Genet 1999, 65:370-386 Page 6 of 7 (page number not for citation purposes) BMC Genetics 2001, 2:22 http://www.biomedcentral.com/1471-2156/2/22 21. Meguro M, Mitsuya K, Nomura N, Kohda M, Kashiwagi A, Nishigaki R, Yoshioka H, Nakao M, Oishi M, Oshimura M: Large-scale eval- uation of imprinting status in the Prader-Willi syndrome re- gion: an imprinted direct repeat cluster resembling small nucleolar RNA genes. Hum. Mol. Genet 2001, 10:383-394 22. Bielinska B, Blaydes SM, Buiting K, Yang T, Krajewska-Walasek M, Horsthemke B, Brannan CI: De novo deletions of SNRPN exon 1 in early human and mouse embryos result in a paternal to maternal imprint switch. Nat Genet 2000, 25:74-78 23. Chomez P, De Backer O, Bertrand M, De Plaen E, Boon T, Lucas S: An overview of the MAGE gene family with the identification of all human members of the family. Cancer Res 2001, 61:5544- 24. Jordan BW, Dinev D, LeMellay V, Troppmair J, Gotz R, Wixler L, Sendtner M, Ludwig S, Rapp UR: NRAGE is an inducible IAP-in- teracting protein that augments cell death. J. Biol. Chem 2001, 6:1-6 25. Salehi AH, Roux PP, Kubu CJ, Zeindler C, Bhakar A, Tannis LL, Verdi JM, Barker PA: NRAGE, a novel MAGE protein, interacts with the p75 neurotrophin receptor and facilitates nerve growth factor-dependent apoptosis. Neuron 2000, 27:279-288 26. Wandstrat AE, Leana-Cox J, Jenkins L, Schwartz S: Molecular cy- togenetic evidence for a common breakpoint in the largest inverted duplications of chromosome 15. Am J Hum Genet 1998, 62:925-936 27. Wandstrat AE, Schwartz S: Isolation and molecular analysis of inv dup(15) and construction of a physical map of a common breakpoint in order to elucidate their mechanism of forma- tion. Chromosoma 2000, 109:498-505 28. Repetto GM, White LM, Bader PJ, Johnson D, Knoll JH: Interstitial duplications of chromosome region 15q11q13: clinical and molecular characterization. Am. J. Med. Genet 1998, 79:82-89 Publish with BioMed Central and every scientist can read your work free of charge "BioMedcentral will be the most significant development for disseminating the results of biomedical research in our lifetime." Paul Nurse, Director-General, Imperial Cancer Research Fund Publish with BMC and your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours - you keep the copyright BioMedcentral.com Submit your manuscript here: http://www.biomedcentral.com/manuscript/ editorial@biomedcentral.com Page 7 of 7 (page number not for citation purposes) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png BMC Genetics Springer Journals

A necdin/MAGE-like gene in the chromosome 15 autism susceptibility region: expression, imprinting, and mapping of the human and mouse orthologues

BMC Genetics , Volume 2 (1) – Dec 20, 2001

Loading next page...
 
/lp/springer-journals/a-necdin-mage-like-gene-in-the-chromosome-15-autism-susceptibility-TrPeiROrhT

References (31)

Publisher
Springer Journals
Copyright
Copyright © 2001 by Chibuk et al; licensee BioMed Central Ltd.
Subject
Life Sciences; Life Sciences, general; Animal Genetics and Genomics; Microbial Genetics and Genomics; Plant Genetics & Genomics; Genetics and Population Dynamics
eISSN
1471-2156
DOI
10.1186/1471-2156-2-22
Publisher site
See Article on Publisher Site

Abstract

Background: Proximal chromosome 15q is implicated in neurodevelopmental disorders including Prader-Willi and Angelman syndromes, autistic disorder and developmental abnormalities resulting from chromosomal deletions or duplications. A subset of genes in this region are subject to genomic imprinting, the expression of the gene from only one parental allele. Results: We have now identified the NDNL2 (also known as MAGE-G) gene within the 15q autistic disorder susceptibility region and have mapped its murine homolog to the region of conserved synteny near necdin (Ndn) on mouse Chr 7. NDNL2/MAGE-G is a member of a large gene family that includes the X-linked MAGE cluster, MAGED1 (NRAGE), MAGEL2 and NDN, where the latter two genes are implicated in Prader-Willi syndrome. We have now determined that NDNL2/Ndnl2 is widely expressed in mouse and human fetal and adult tissues, and that it is apparently not subject to genomic imprinting by the PWS/AS Imprinting Center. Conclusion: Although NDNL2/MAGE-G in the broadly defined chromosome 15 autistic disorder susceptibility region, it is not likely to be pathogenic based on its wide expression pattern and lack of imprinted expression. Background with UBE3A mutations [6,7]. Strong candidates for PWS Human chromosome 15q is prone to cytogenetic rear- have recently emerged and are likely to have an additive rangements, in part due to repetitive elements located effect in causing this disorder [8–12]. In particular, two therein [1,2]. Prader-Willi syndrome (PWS) and Angel- members of the NDN/MAGE gene family, NDN and man syndrome (AS) are two neurodevelopmental disor- MAGEL2, are located in the PWS deletion region and are ders caused by deletions of 15q11-q13, and inactivated in individuals with PWS [8,11–14]. Respira- neurodevelopmental abnormalities are associated with tory and behavioral abnormalities in a mouse deleted for supernumerary chromosomes derived from inverted du- Ndn, the murine orthologue of NDN, may suggest that plications of 15q [3]. In addition, an autistic disorder sus- NDN is implicated in the PWS phenotype [15,16]. We ceptibility locus has been localized to proximal 15q by have therefore investigated the possibility that other linkage and association studies [4,5]. AS is associated NDN/MAGE genes may also be present on proximal 15q Page 1 of 7 (page number not for citation purposes) BMC Genetics 2001, 2:22 http://www.biomedcentral.com/1471-2156/2/22 region for a 15q autistic disorder susceptibility locus, and outside the PWS/AS deletion region [4,5] (Fig. 1). An open reading frame of 472 amino acids was predicted from the genomic sequence of NDNL2 and is located within a single exon of the predicted gene. A series of ex- pressed sequence tags (ESTs) were identified through a BLAST search of the EST database and were found to be part of the Unigene cluster Hs.94011. Assembly of the ESTs into a consensus sequence was performed and this sequence was compared to our sequence of IMAGE clones representing NDNL2 to arrive at a final sequence for the predicted protein (Fig. 2) (also see partial se- quence in GenBank AF320911, MAGE-G). The sequence for murine Ndnl2 was identified using se- quence data obtained from homology searches of mouse ESTs (UniGene cluster Mm.19944). Comparison of the sequence from multiple cDNAs revealed that the predict- ed mouse protein has 279 amino acids and has 83% se- quence identity with the human protein (Fig. 2). As with other NDN/MAGE family members, the maximum se- quence conservation is in the C-terminus of the protein, Figure 1 suggesting a common function for this domain among Map of the human 15q11-q14 region. Location of family members. The murine protein is truncated at the NDNL2 was derived from the Ensembl Human Genome server [http://www.ensembl.org/] and the physical location N terminus compared to the human protein at the posi- of APBA2, which is located on the same genomic clone as tion equivalent to the methionine at position 168 in the NDNL2. The large double-headed arrow indicates the com- human predicted protein, predicted based on the pres- mon PWS/AS deletion, and BP2 and BP3 indicate the most ence of a strong Kozak consensus surrounding the common proximal and distal breakpoint regions. The break- murine AUG, including a G at the minus three position. point region for the largest inv dup (15) chromosome [27] In at least two EST clones, including RIKEN clone and the autistic disorder susceptibility region [5] are also AK010294 from a library enriched for full-length cDNAs, indicated. The physical distance between BP3 and APBA2/ the predicted amino acids upstream of the putative NDNL2 is as yet unknown due to the presence of repetitive murine start methionine are not conserved with the hu- elements in the intervening region. man sequence, in sharp contrast with those C-terminal to this methionine (Fig. 2). In addition, the lack of con- and may be involved in neurodevelopmental disorders. servation does not appear to be due to the presence of an Indeed, we identified a novel necdin-related gene, intron or a sequencing error. Closer inspection of the se- NDNL2, on proximal 15q within the critical region for quence revealed that NDNL2 contains only partial simi- autistic disorder susceptibility. We have examined the larity to the antigenic nonapeptide characteristic of other expression of NDNL2 and its murine orthologue, and MAGE family proteins (Fig. 2). Ndnl2 is identical in se- placed the murine gene on Chr. 7. The proximal region of quence to a predicted protein named "mage-g1" (Gen- chromosome 15 is subject to genomic imprinting, the ex- Bank accession AF319979). pression of a gene from only one allele depending on par- ent-of-origin. Furthermore, the maternal derivation of We identified a DNA polymorphism within Ndnl2 by di- chromosome 15 abnormalities seen in individuals with rect sequencing of a 469 bp PCR product amplified from autistic disorder suggests a parent-of origin effect [4,5]. M. musculus strain C57BL/6JEi and M. spretus SPRET/ We have therefore analyzed the imprinting of human Ei DNA. The presence of a T to C transition at position 42 and mouse NDNL2/Ndnl2. of AV005659 abolishes an Msp I site in C57BL/6JEi that is present in SPRET/Ei. By genotyping the Jackson labo- Results and discussion ratory BSS backcross derived from the cross (C57BL/ Using a BLAST search for genes with sequence similarity 6JEi × SPRET/Ei)F1 × SPRET/Ei), we demonstrated to NDN, NDNL2 was identified as a MAGE-like protein linkage of Ndnl2 to chromosome 7, at a position geneti- on the BAC clone RP11-18H24 (GenBank accession cally inseparable from that of Ndn (see Mouse Genome AC016484). This clone also contains the APBA2 gene Informatics, [http://www.informatics.jax.org/] for de- which has been physically mapped to within the critical tails). As predicted from the location of human APBA2 Page 2 of 7 (page number not for citation purposes) BMC Genetics 2001, 2:22 http://www.biomedcentral.com/1471-2156/2/22 Figure 2 Sequence comparison of human NDNL2 and mouse Ndnl2 sequence. The human and mouse predicted amino acid sequences are aligned with conserved amino acids shaded. Partial sequence of two cDNA clones has been included for com- parison of the predicted translation with the longer human open reading frame. The predicted position of a MAGE-like non- apeptide present in other MAGE proteins is underlined. near NDNL2, the murine Apba2 gene is also located in mosomal disorders of chromosome 15 [4], we performed the central region of Chr 7, but the use of different map- experiments to analyze the imprinting of NDNL2 and ping panels for the two genes does not permit their rela- Ndnl2. To test imprinting of Ndnl2, we examined new- tive order to be established [17]. Based on the high born brain, liver and lung, and embryonic day 12.5 whole sequence similarity between human and mouse sequenc- embryo RNA samples from the offspring of an interspe- es and on the location in a region of conserved synteny cific mouse cross for allelic expression using the same we conclude that the NDNL2 andNdnl2 genes are orthol- murine MspI polymorphism as used for genetic map- ogous in these two species. ping. Both parental alleles were detected equally, indi- cating that expression of Ndnl2 is not imprinted (Fig. The expression of NDNL2 and Ndnl2 was analyzed by 4A). We were unable to identify an intragenic polymor- northern blot studies (Fig. 3). The observed 1.9 kb RNA phism in NDNL2 that would allow direct evaluation of transcript roughly corresponds in size to the 1.5 kb cDNA the levels of expression of each allele. Instead, we evalu- present in IMAGE clone 1134795, which likely contains ated the effect of deletion of the chromosome 15q11-q13 most of the transcript. The transcript was observed in all imprinting center (IC) on the expression of NDNL2. Spo- human tissues tested, and appeared to be most abundant radic PWS and AS patients with de novo deletions not in testis after adjustments were made for RNA loading. only have a loss of the genes located inside the deletion Expression in mouse is also widespread, with a moder- interval, they also have a loss of the imprinting control ately abundant 1.7 kb transcript observed in all tissues element located therein. In a previous study, a somatic, tested consistent with the 1.5 kb insert size for cDNA de novo deletion of the IC impaired imprinting of target clone RIKEN ID 1010001J10. The origin of the smaller genes [22]. These target genes are not necessarily limited transcript in mouse testis is unknown but may represent to the region typically deleted in PWS and AS, which is an alternative polyadenylation site or alternative tran- defined by unstable genomic elements located at the de- scriptional start site. It is notable that expression of letion boundaries [1], but could include other genes with- NDNL2/Ndnl2 is widespread although for other family in the range of the imprinting center. However, our members, including Ndn, Magel2 and Dlxin, the murine previous study had predicted that it is unlikely that the homologue of MAGED1, expression is more spatially and range of the IC extended beyond the deletion itself [20]. temporally limited [12,18,19]. To test this hypothesis and to examine the possibility that NDNL2 is acted on by the IC, we tested the effect of Previous studies have suggested that the imprinted do- the loss of the IC in sporadic PWS and AS patients on the main on chromosome 15q is limited to a region of about expression of NDNL2. Using a previously defined assay 1.5 Mb surrounding the imprinting center [20,21]. How- [20], RNA from lymphoblast and fibroblast cell lines that ever, given the observed parent-of-origin effects in chro- carry either a paternal 15q11-q13 deletion (PWS) or the Page 3 of 7 (page number not for citation purposes) BMC Genetics 2001, 2:22 http://www.biomedcentral.com/1471-2156/2/22 Figure 3 Expression analysis necdin-like 2 in embryonic and adult human and mouse tissues. (A) Northern blots of adult (left and center) and fetal (right) human tissues. The 1.9 kb NDNL2 transcript is indicated by the arrow. Size markers are as indicated. (B) Northern blot of adult (left) and embryonic (right) mouse tissues shows expression of a 1.7 kb transcript (arrow). equivalent maternal deletion (AS) were tested by RT- that the human and mouse nomenclature committees PCR for expression of NDNL2. On repeated trials, both evaluate the arguments for the names of genes in this cell lines expressed NDNL2, indicating that NDNL2 is gene family to establish a unified nomenclature that clar- not imprinted by the imprinting center located in the de- ifies the relationships among the family members. letion region (Fig. 4B). Necdin was originally identified as a gene induced on The names NDNL2/Ndnl2 have been approved by the neuronal differentiation of embryonic carcinoma cells, human and mouse nomenclature committees, based on but has more recently been implicated in PWS. Members sequence similarity to NDN and chromosomal localiza- of the MAGE gene family are recognized for their expres- tion. In a recent review of the NDN/MAGE gene family, sion in tumor cells, and a new family member MAGED1 a multiple sequence alignment clustered the chromo- (NRAGE/dlxin) is postulated to have roles in chondro- some 15 family members (NDN, MAGEL2/NDNL1, and genesis, neurotrophin signaling and apoptosis NDNL2/MAGE-G) together with the X-linked MAGE-D, [19,24,25]. Although the widespread expression of MAGE-E and chromosome 3-linked MAGE-F genes NDNL2 does not immediately suggest a role in the neu- [23]. MAGE-D, known more commonly as NRAGE (hu- rodevelopmental disorders associated with abnormali- man) or dlxin (mouse) may be ancestral to other mem- ties of chromosome 15, NDNL2 is located within the bers of the NDN/MAGE gene family. We recommend broad region associated with developmental disorders. Page 4 of 7 (page number not for citation purposes) BMC Genetics 2001, 2:22 http://www.biomedcentral.com/1471-2156/2/22 Figure 4 Imprinting analysis of NDNL2/Ndnl2. (A) Restriction digestion of PCR of genomic DNA from C57BL/6, SPRET and an F1 offspring demonstrating the interspecific polymorphism, RT-PCR of tissues (nb = newborn) from the F1 offspring. Note that both alleles are active. (B) RT-PCR of fibroblast (FB) and lymphoblast (LCL) RNA from PWS, AS and control samples. NDNL2 is expressed in all cell lines whereas SNRPN is not expressed in PWS cell lines (i.e. is imprinted). In particular, the location of NDNL2 near D15S1019, (Amersham-Phamacia Biotech, Buckinghamshire, Eng- proximal to D15S165 implies that copies of NDNL2 are land) and LiCor technology (LiCor 4200 Automatic Se- present on most phenotypically relevant inv dup(15) quencer, Lincoln, Nebraska). The human cDNA was chromosomes [26,27] and may contribute to the findings represented by IMAGE clone 1147395; mouse cDNAs in patients carrying these supernumerary chromosomes were IMAGE clones 483464, 2101532 and RIKEN through a doubling of NDNL2 expression levels. Howev- #1010001J10. er, NDNL2 is outside the more narrowed interstitial du- plication interval associated with some autistic Northern blot expression studies phenotypes [28], although long range effects on NDNL2 A PCR product derived from the 3' end of human NDNL2 expression may still occur. was generated with oligonucleotide primers NDNL2-3F (5'-GTCTACCCCACCAAGAAGCA) and NDNL2-4R (5'- CCTTCCCCCAATCCTCTAAA), in a 20 µl PCR reaction Conclusions Given the wide range of processes that members of this containing 20 pmol of each oligonucleotide. The PCR intriguing gene family participate in and the possibility was performed as follows: 94°C for 5 min. followed by 30 of redundant function within the gene family, we suggest cycles of 94°C for 30 s, 52°C for 30 s, 72°C for 30 s, and that the 15q NDN/MAGE family members be considered final extension at 72°C for 10 min., The PCR product was as candidates for involvement in the neurodevelopmen- random prime P-dCTP labeled with the Random Prim- tal disorders associated with chromosome 15q. ers DNA Labeling System (Life Technologies, Rockville, MD). The labeled probe was hybridized to human adult Materials and methods and fetal Multiple Tissue Northern (MTN) Blots (Clon- cDNA clones tech Laboratories, Palo Alto, CA., Cat. #7760–1, 7759–1 Human and mouse cDNAs were obtained from Research and 7756–1) in ExpressHyb solution according to manu- Genetics or the MRC Genome Resource Facility and were facturer's directions. The final wash was at 50°C in sequenced using the Thermo Sequenase fluorescent la- 0.1XSSC, 0.1%SDS twice for 20 min each time. Exposure beled primer cycle sequencing kit with 7-deaza dGTP to Hyperfilm (Amersham-Pharmacia Biotech) was for Page 5 of 7 (page number not for citation purposes) BMC Genetics 2001, 2:22 http://www.biomedcentral.com/1471-2156/2/22 2. Christian SL, Fantes JA, Mewborn SK, Huang B, Ledbetter DH: Large four days at -80°C. Oligonucleotide primers Ndnl2-1F genomic duplicons map to sites of instability in the Prader- (5'-CTTGGAGTACCGGAGGATACC) and Ndnl2-2R (5'- Willi/Angelman syndrome chromosome region (15q11-q13). CAACACATCCTAACGCTCCA) were used for mouse Hum. Mol. Genet 1999, 8:1025-1037 3. Nicholls RD: The impact of genomic imprinting for neurobe- northern blots. These primers amplified a 343 bp DNA havioral and developmental disorders. J. Clin. Invest 2000, fragment corresponding to the 3' end of the Ndnl2 gene. 105:413-418 4. Maddox LO, Menold MM, Bass MP, Rogala AR, Pericak-Vance MA, The PCR was performed as above but with an annealing Vance JM, Gilbert JR: Autistic disorder and chromosome temperature of 58°C. Mouse adult and embryo MTN 15q11-q13: construction and analysis of a BAC/PAC contig. blots (Cat. #7762–1 and 7763–1, Clontech Laboratories) Genomics 1999, 62:325-331 5. Bass MP, Menold MM, Wolpert CM, Donnelly SL, Ravan SA, Hauser were similarly hybridized with the radioactively labeled ER, Maddox LO, Vance JM, Abramson RK, Wright HH, Gilbert JR, Ndnl21F/2R PCR product. To control for the amount of Cuccaro ML, DeLong GR, Pericak-Vance MA: Genetic studies in loaded RNA the same blot was subsequently hybridized autistic disorder and chromosome 15. Neurogenetics 2000, 2:219-226 with a β-actin or ubiquitin probe demonstrating approx- 6. Matsuura T, Sutcliffe JS, Fang P, Galjaard R-J, Jiang Y-h, Benton CS, imately equal loading in all lanes. Rommens JM, Beaudet AL: De novo truncation mutations in E6- AP ubiquitin-protein ligase gene (UBE3A) in Angelman syn- drome. Nature Genet 1997, 15:74-77 Genetic mapping and imprinting studies 7. Kishino T, Lalande M, Wagstaff J: UBE3A/E6-AP mutations cause A 469 bp product corresponding to the 3' end of Ndnl2 Angelman syndrome. Nature Genet 1997, 15:70-73 8. MacDonald HR, Wevrick R: The necdin gene is deleted in Prad- was generated from mouse genomic DNA (C57BL/J or er-Willi syndrome and is imprinted in human and mouse. SPRET/Ei) using oligonucleotide primers Ndnl2-7F (5'- Hum. Mol. Genet 1997, 6:1873-1878 9. Cavaille J, Buiting K, Kiefmann M, Lalande M, Brannan CI, Horsthemke TGGAAACCAGCAAGATGAAA) and Ndnl2-8R (5'- B, Bachellerie JP, Brosius J, Huttenhofer A: From the cover: iden- AGCTACCCTGTTTCTTTATCGTC). DNA samples were tification of brain-specific and imprinted small nucleolar sequenced on both strands using the LiCor automated RNA genes exhibiting an unusual genomic organization. Proc. Natl. Acad. Sci. U S A 2000, 97:14311-14316 sequencer. DNA amplification products were digested 10. de los Santos T, Schweizer J, Rees CA, Francke U: Small evolution- with MspI to produce a 469 bp undigested product in arily conserved RNA, resembling C/D box small nucleolar C57BL/6J and 180 bp and 289 bp digested products in RNA, is transcribed from PWCR1, a novel imprinted gene in the Prader-Willi deletion region, which Is highly expressed in DNA from M. spretus. Genetic mapping was performed brain. Am. J. Hum. Genet 2000, 67:1067-1082 on the Jackson Laboratories BSS backcross. Cell lines 11. Boccaccio I, Glatt-Deeley H, Watrin F, Roeckel N, Lalande M, Musc- atelli F: The human MAGEL2 gene and its mouse homologue used for human imprinting analysis were PWS lymphob- are paternally expressed and mapped to the Prader-Willi re- last GM09024B and AS lymphoblast GM11515 (both gion. Hum. Mol. Genet 1999, 8:2497-2505 from the NIGMS Human Genetic Mutant Cell Reposi- 12. Lee S, Kozlov S, Hernandez L, Chamberlain SJ, Brannan CI, Stewart CL, Wevrick R: Expression and imprinting of MAGEL2 suggest tory), PWS fibroblast 1889 from the University of Miami a role in Prader-Willi syndrome and the homologous murine Brain and Tissue Bank for Developmental Disorders and imprinting phenotype. Hum. Mol. Genet 2000, 9:1813-1819 AS fibroblast KAT graciously provided by Dr. A. Beaudet 13. Jay P, Rougeulle C, Massacrier A, Moncla A, Mattei MG, Malzac P, Roeckel N, Taviaux S, Lefranc JL, Cau P, Berta P, Lalande M, Muscatelli (Baylor College of Medicine). F: The human necdin gene, NDN, is maternally imprinted and located in the Prader-Willi syndrome chromosomal re- gion. Nature Genet 1997, 17:357-361 List of abbreviations 14. Sutcliffe JS, Han M, Christian SL, Ledbetter DH: Neuronally-ex- AS (Angelman syndrome), ESTs, (expressed sequence pressed necdin gene: an imprinted candidate gene in Prader- tags), IC (imprinting center), PWS (Prader-Willi syn- Willi syndrome. Lancet 1997, 350:1520-1521 15. Gerard M, Hernandez L, Wevrick R, Stewart C: Disruption of the drome). mouse necdin gene results in early postnatal lethality: a model for neonatal distress in Prader-Willi syndrome. Nature Genet 1999, 23:199-202 Acknowledgements 16. Muscatelli F, Abrous DN, Massacrier A, Boccaccio I, Moal ML, Cau P, We thank Mary Barter from the Jackson Laboratories for the murine hap- Cremer H: Disruption of the mouse necdin gene results in hy- lotype analysis, the MRC Genome Resource Facility and the RIKEN Ge- pothalamic and behavioral alterations reminiscent of the hu- nome Science Center for DNA clones, and Dr. A. Beaudet for the AS man Prader-Willi syndrome. Hum. Mol. Genet 2000, 9:3101-3110 fibroblast cell line. Samples used in this study were provided by the Univer- 17. Blanco G, Irving NG, Brown SD, Miller CC, McLoughlin DM: Map- sity of Miami Brain and Tissue Bank for Developmental Disorders through ping of the human and murine X11-like genes (APBA2 and NICHD contract # NO1-HD-8-3284. This work was supported in part by apba2), the murine Fe65 gene (Apbb1), and the human a Research Grant No. 6-FY00-196 from the March of Dimes Birth Defects Fe65-like gene (APBB2): genes encoding phosphotyrosine- Foundation, Summer Studentships to T.K.C. from the Alberta Heritage binding domain proteins that interact with the Alzheimer's Foundation for Medical Research (AHFMR) and the Canadian Genetic Dis- disease amyloid precursor protein. Mamm. Genome 1998, 9:473- ease Network. R.W. is a Scholar of the AHFMR and the Canadian Institutes of Health Research. Research involving human subjects and animals has 18. Yoshikawa K: Cell cycle regulators in neural stem cells and been performed in accordance with the Institutional policies of the Univer- postmitotic neurons. Neurosci. Res 2000, 37:1-14 sity of Alberta. 19. Masuda Y, Sasaki A, Shibuya H, Ueno N, Ikeda K, Watanabe K: Dlxin- 1, a novel protein that binds Dlx5 and regulates its transcrip- References tional function. J. Biol. Chem 2000, 17:5331-5338 1. Amos-Landgraf JM, Ji Y, Gottlieb W, Depinet T, Wandstrat AE, Cas- 20. Lee S, Wevrick R: Identification of novel imprinted transcripts sidy SB, Driscoll DJ, Rogan PK, Schwartz S, Nicholls RD: Chromo- in the Prader-Willi/Angelman syndrome deletion region: some breakage in the Prader-Willi and Angelman further evidence for regional imprinting control. Am. J. Hum. syndromes involves recombination between large, tran- Genet 2000, 66:848-858 scribed repeats at proximal and distal breakpoints. Am. J. Hum. Genet 1999, 65:370-386 Page 6 of 7 (page number not for citation purposes) BMC Genetics 2001, 2:22 http://www.biomedcentral.com/1471-2156/2/22 21. Meguro M, Mitsuya K, Nomura N, Kohda M, Kashiwagi A, Nishigaki R, Yoshioka H, Nakao M, Oishi M, Oshimura M: Large-scale eval- uation of imprinting status in the Prader-Willi syndrome re- gion: an imprinted direct repeat cluster resembling small nucleolar RNA genes. Hum. Mol. Genet 2001, 10:383-394 22. Bielinska B, Blaydes SM, Buiting K, Yang T, Krajewska-Walasek M, Horsthemke B, Brannan CI: De novo deletions of SNRPN exon 1 in early human and mouse embryos result in a paternal to maternal imprint switch. Nat Genet 2000, 25:74-78 23. Chomez P, De Backer O, Bertrand M, De Plaen E, Boon T, Lucas S: An overview of the MAGE gene family with the identification of all human members of the family. Cancer Res 2001, 61:5544- 24. Jordan BW, Dinev D, LeMellay V, Troppmair J, Gotz R, Wixler L, Sendtner M, Ludwig S, Rapp UR: NRAGE is an inducible IAP-in- teracting protein that augments cell death. J. Biol. Chem 2001, 6:1-6 25. Salehi AH, Roux PP, Kubu CJ, Zeindler C, Bhakar A, Tannis LL, Verdi JM, Barker PA: NRAGE, a novel MAGE protein, interacts with the p75 neurotrophin receptor and facilitates nerve growth factor-dependent apoptosis. Neuron 2000, 27:279-288 26. Wandstrat AE, Leana-Cox J, Jenkins L, Schwartz S: Molecular cy- togenetic evidence for a common breakpoint in the largest inverted duplications of chromosome 15. Am J Hum Genet 1998, 62:925-936 27. Wandstrat AE, Schwartz S: Isolation and molecular analysis of inv dup(15) and construction of a physical map of a common breakpoint in order to elucidate their mechanism of forma- tion. Chromosoma 2000, 109:498-505 28. Repetto GM, White LM, Bader PJ, Johnson D, Knoll JH: Interstitial duplications of chromosome region 15q11q13: clinical and molecular characterization. Am. J. Med. Genet 1998, 79:82-89 Publish with BioMed Central and every scientist can read your work free of charge "BioMedcentral will be the most significant development for disseminating the results of biomedical research in our lifetime." Paul Nurse, Director-General, Imperial Cancer Research Fund Publish with BMC and your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours - you keep the copyright BioMedcentral.com Submit your manuscript here: http://www.biomedcentral.com/manuscript/ editorial@biomedcentral.com Page 7 of 7 (page number not for citation purposes)

Journal

BMC GeneticsSpringer Journals

Published: Dec 20, 2001

There are no references for this article.