Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

A novel SNP in COMT is associated with alcohol dependence but not opiate or nicotine dependence: a case control study

A novel SNP in COMT is associated with alcohol dependence but not opiate or nicotine dependence:... Background: It is well established that COMT is a strong candidate gene for substance use disorder and schizophrenia. Recently we identified two SNPs in COMT (rs4680 and rs165774) that are associated with schizophrenia in an Australian cohort. Individuals with schizophrenia were more than twice as likely to carry the GG genotype compared to the AA genotype for both the rs165774 and rs4680 SNPs. Association of both rs4680 and rs165774 with substance dependence, a common comorbidity of schizophrenia has not been investigated. Methods: To determine whether COMT is important in substance dependence, rs165774 and rs4680 were genotyped and haplotyped in patients with nicotine, alcohol and opiate dependence. Results: The rs165774 SNP was associated with alcohol dependence. However, it was not associated with nicotine or opiate dependence. Individuals with alcohol dependence were more than twice as likely to carry the GG or AG genotypes compared to the AA genotype, indicating a dominant mode of inheritance. The rs4680 SNP showed a weak association with alcohol dependence at the allele level that did not reach significance at the genotype level but it was not associated with nicotine or opiate dependence. Analysis of rs165774/rs4680 haplotypes also revealed association with alcohol dependence with the G/G haplotype being almost 1.5 times more common in alcohol- dependent cases. Conclusions: Our study provides further support for the importance of the COMT in alcohol dependence in addition to schizophrenia. It is possible that the rs165774 SNP, in combination with rs4680, results in a common molecular variant of COMT that contributes to schizophrenia and alcohol dependence susceptibility. This is potentially important for future studies of comorbidity. As our participant numbers are limited our observations should be viewed with caution until they are independently replicated. Background encodes either valine or methionine at amino acid posi- Catechol-O-methyl transferase (COMT) is an enzyme tion 158, with the substitution shown to alter COMT involved in the degradation of dopamine [1] and is enzyme activity [12]. The only other non-synonymous encoded by the COMT gene.Thisliesinaregion that polymorphism in COMT that has been found to be has been strongly implicated in schizophrenia [2-4]. The associated with schizophrenia is rs6267. This alanine/ serine substitution also alters COMT enzyme activity COMT gene is located on chromosome 22q11 and asso- ciation studies have identified a number of polymorph- but has only been identified in Asian populations isms that are associated with schizophrenia [5-11]. One [13,14]. of the more interesting polymorphisms is rs4680 that Along with schizophrenia, studies have also identified COMT associations with a range of psychiatric condi- tions. A haplotype including the rs4680 polymorphism * Correspondence: p.morris@qut.edu.au is associated with risk for several anxiety disorders and Institute of Health and Biomedical Innovation, Queensland University of major depression [15] and the rs4680 polymorphism has Technology, Brisbane, Queensland, Australia Full list of author information is available at the end of the article © 2011 Voisey et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Voisey et al. Behavioral and Brain Functions 2011, 7:51 Page 2 of 6 http://www.behavioralandbrainfunctions.com/content/7/1/51 been associated with panic disorder [16] and early onset psychiatrist or physician experienced in drug and alco- major depression in a large European study [17]. hol dependence and met DSM-IV criteria for opiate Another European study found that COMT variation dependence. All were being assessed for naltrexone could predict onset of depressive episodes following treatment as outpatients in a large public hospital detox- exposure to stressful life events [18]. The rs4680 poly- ification unit in Brisbane, Australia. Participants had a morphism has been studied in addictive behaviours and mean age of 30.0 years of age (s.d. ± 7.9 years). Approxi- found to contribute significantly to the development of mately half of the participants were being managed on late-onset alcohol dependence [19]. A Finnish study of methadone prior to detoxification (47.2%) while the 896 males found rs4680 to not only contribute signifi- other half were on heroin (52.8%). Those on methadone cantly to alcohol intake in alcoholics but also in the had a mean dose of 48.1 milligrams (s.d. 30.5), with a general male population [20]. Smoking cessation and range between 10-165 milligrams. The mean age of association with the rs4680 polymorphism was found in onset of heroin use was 22.4 years of age (s.d. 5.14), a large study from the Netherlands [21]. As well as nico- with a range between 15-43 years. Mean number of par- tine and alcohol dependence, opiate dependence has ticipant-reported detoxifications prior to this occasion also been studied for the rs4680 polymorphism. An was 3.5 (s.d. 3.3), with a range between 0-16 detoxifica- association with opiate dependence and rs4680 was tions. Cannabis was the most common concurrently observed in Hispanic women but did not hold up after used illicit substance reported by participants prior to correction for multiple testing [22]. However there have treatment (52.5% reported use), followed by ampheta- been conflicting studies for COMT including a study mines (14.9% reported use). Opiate-dependent subjects that did not observe association with alcohol depen- were excluded from the study if they had an organic dence or nicotine dependence [23]. Genome-wide asso- brain syndrome, psychosis or any other condition that ciation studies of nicotine and alcohol dependence have would affect their ability to provide informed consent. not found association with COMT to date [24-27]. Alcohol Dependence Previously we confirmed that rs4680 is associated with A total of 231 unrelated Caucasian (74 female and 157 schizophreniainanAustralian population but we have male) alcohol-dependent subjects were recruited from identified stronger association with schizophrenia with a large public hospitals in Brisbane, Australia. All subjects novel COMT SNP, rs165774 [28]. Since psychotic disor- were assessed using a checklist of specific criteria by a ders are often comorbid with alcohol and other sub- clinical psychologist experienced in drug and alcohol stance dependence [29,30], we genotyped the two dependence and met DSM-IV criteria of alcohol depen- COMT polymorphisms in alcohol, nicotine and opiate dence. Participants had a mean age of 40.74 years (s.d. ± dependence. 10.3 years). All were inpatients and represented a spec- trum of severity with a significant proportion (n =65) Methods of these patients being diagnosed with two or more Participants alcohol related medical conditions such as pancreatitis, Controls cirrhosis, hepatitis or peripheral neuropathy. Alcohol- The control group consisted of 250 unrelated Cauca- dependent patients were excluded from the study if they sians (102 female and 148 male) with a mean age of had an organic brain syndrome, psychosis, or any other 36.8 years (s.d. ± 12.8 years). The control group con- condition that would affect their ability to provide sisted of volunteers from the general public, hospital informed consent. nursing and medical staff, and university staff and stu- Nicotine Dependence dents. Formal screening for psychological disorders was A total of 147 (68 male, 79 female) unrelated Caucasians not undertaken in the control population. As such the with a mean age of 43.3 (s.d. ± 11.1 years) were controls represent an unselected control group and may recruited for smoking reduction with a view to eventual include individuals with substance dependence. To cessation through hospital and media advertisements. minimise population stratification bias, both control and All subjects were assessed using a checklist of specific clinical subjects were recruited in the Brisbane region (a criteria by a consultant psychiatrist or physician experi- city of approximately 2 million inhabitants on the East enced in drug and alcohol dependence and met DSM- Coast of Australia) and all were of British or European IV criteria of nicotine dependence. All subjects were descent (ascertained by subject self-reporting). outpatients. Participant inclusion criteria included 18 Opiate Dependence years of age or older and smoking for at least three A total of 120 unrelated Caucasian participants (50 years and being generally healthy despite currently female and 70 male) diagnosed as opiate-dependent smoking 15 cigarettes or more per day. All were moti- were recruited for this study. All subjects were assessed vated to reduce smoking and had the goal of eventual using a checklist of specific criteria by a consultant cessation. However, all participants had at least one Voisey et al. Behavioral and Brain Functions 2011, 7:51 Page 3 of 6 http://www.behavioralandbrainfunctions.com/content/7/1/51 serious but unsuccessful attempt at quitting in the pre- involved pooling the low-risk homozygotes and the het- vious 24 months. One hundred and thirty nine of the erozygotes and comparing frequencies with the high-risk participants were administered the Fagerstrom test for homozygotes, i.e. OR > 1. Correction for multiple test- Nicotine Dependence [31]. ing was conducted using the Benjamini-Hochberg Ethics approval was obtained from all institutions method [35]. Linkage disequilibrium and haplotype esti- involved and each participant from the control, opiate mations were calculated using JLIN version 1.6.0 [36]. dependence, alcohol dependence and nicotine depen- dence groups gave written informed consent. Results Two COMT SNPs (rs165774 and rs4680) which we had Genotyping previously found to be associated with schizophrenia Oragene kits were used to extract DNA from saliva were genotyped in 250 controls, 147 nicotine-dependent samples. Samples were genotyped using a homogeneous subjects, 120 opiate-dependent subjects and 231 alco- MassEXTEND (hME) Sequenom assay [32] performed hol-dependent subjects to investigate their association by the Australian Genome Research Facility. The hME with substance dependence. In addition to our pre- assay is based on the annealing of an oligonucleotide viously reported association with schizophrenia, primer (hME primer) adjacent to the SNP of interest. rs165774 was found to be associated with alcohol The addition of a DNA polymerase along with a mixture dependence at the allele level after correction for multi- of terminator nucleotides allows extension of the hME pletesting.There wasnoassociation with opiate or primer through the polymorphic site and generates nicotine dependence (Table 1). For the two groups allele-specific extension products, each having a unique (nicotine and opiate dependence) that did not show molecular mass. The resultant masses of the extension association with rs165774, we did not have sufficient products are then analysed by matrix-assisted laser des- power (< 0.80) to detect association with our sample orption/ionization time-of-flight mass spectrometry size using retrospective power calculations for a case- (MALDI-TOF MS) and a genotype is assigned in real control study in syntax SPSS version 18 because the time. The hME assay was performed in multiplex with odds ratios were so low (nicotine OR = 1.24 and opiate up to 36 reactions in a single well. OR = 1.28). In fact a sample size ranging from 2000- Primers sequences for rs165774 are as follows: PCR 3000 cases and controls would be required to show any Primer 1: ACGTTGGATGGCCCTACCTAGCCAGG- significance for rs165774 with opiate or nicotine depen- CAT; PCR Primer 2: ACGTTGGATGTCCCA- dence with odds ratios of this size. GAAACTGGACACTGC; Extension Primer: cgct At the genotype level, rs165774 was still associated CCTCGTGCTCCTAGTC. Primers sequences for rs4680 with alcohol dependence (Table 2). Individuals with are as follows: PCR Primer 1: ACGTTGGATGTTTTC- alcohol dependence were more than twice as likely to CAGGTCTGACAACGG; PCR Primer 2: ACGTTG- carry the GG or AG genotype compared to the AA gen- GATGACCCAGCGGATGGTGGATTT; Extension otype. The rs165774 SNP was found to follow a domi- Primer: tcacGCACACCTTGTCCTTCA. nant mode of inheritance for alcohol dependence when The genotyping fail rate was 3.75% for rs165774 and genotypes were pooled (p = 0.006, OR 2.24, 95% CI 1.2 6.92% for rs4680 for all included patients. The genotyp- to 4.3). ing of several other SNPs were independently verified by In addition to our previously reported association with other methods such as real-time PCR with a concor- schizophrenia, rs4680 was only marginally associated dancerateof96.6%(the COMT SNPs were not inde- with alcohol dependence at the allele level (Table 3) but pendently verified). Genotypes were determined by was not significant with opiate or nicotine dependence. investigators blinded for clinical diagnoses. Table 1 Allele Association of COMT SNP rs165774 Statistical Analysis Sample Allele c p- Odds 95% CI APearson’s chi-squared test was performed to identify frequency value* Ratio statistical associations between alleles and genotype and GA substance dependence status. Odds ratios (OR) were Controls 304 176 also calculated. Tests were performed on both genotype Nicotine 199 93 1.856 0.173 1.24 0.91- and allele data. Statistical tests were performed using dependence 1.69 the COMPARE2 program from the WinPepi suite of Opiate dependence 161 73 2.072 0.150 1.28 0.91- epidemiology programs [33] and SPSS version 18. 1.78 Hardy-Weinberg equilibrium (HWE) was computed Alcohol 319 133 5.509 0.019 1.39 1.05- dependence 1.83 using Utility Programs for Analysis of Genetic Linkage [34]. The analysis of genotypes under a recessive model * p-value determined by Pearson’s chi-squared test (DF = 1) Voisey et al. Behavioral and Brain Functions 2011, 7:51 Page 4 of 6 http://www.behavioralandbrainfunctions.com/content/7/1/51 Table 2 Genotype Association of COMT SNP rs165774 Table 4 Haplotype analysis of COMT rs4680 and rs165774 polymorphisms in patients with alcohol Sample Genotype Counts p-value* dependence AA (%) AG (%) GG (%) c c a 2b Haplotype Controls Alcohol Odds Ratio c P control 39 (16.25) 98 (40.83) 103 (42.92) rs4680/ (%) (%) (P) Nicotine dependence 21 (14.38) 51 (34.93) 74 (50.69) 0.330 rs165774 Odds ratio 1 0.966 1.334 0.205 A/A 147 (34.5) 126 1 3.794 0.051 p-value 1.000 0.700 (28.4) A/G 93 (21.8) 89 (20.0) 1.116 (1.000) 0.419 0.517 Opiate dependence 13 (11.11) 47 (40.17) 57 (48.72) 0.363 G/A 5 (1.2) 1 (0.2) 0.233 (0.392) 3099 0.078 Odds ratio 1 1.439 1.660 0.172 G/G 181 (42.5) 228 1.470 (0.042) 6.866 0.009 p-value 0.626 0.300 (51.4) Alcohol dependence 18 (7.96) 97 (42.92) 111(49.12) 0.022 † TOTAL 426 444 9.656 0.022 Odds ratio 1 2.146 2.336 0.023 Odds ratio with respect to rs4680 A/rs165774 A haplotype which is more p-value 0.029 0.012 commonly associated with a normal phenotype * p-value determined by Pearson’s c test (DF = 2) b 2 Likelihood ratio c test comparing haplotype frequency between groups p-value determined using the extended Mantel-Haenszel test for trend (DF = when all other haplotypes were pooled (DF = 1, and DF = 3 for total c ) 1) c Haplotypes frequencies were estimated using JLIN version 1.6.0 However the association with rs4680 and alcohol depen- 2 2 Opiate: D’ =0.90, r =0.35. Alcohol: D’ = 0.98, r = dence did not hold up at the genotype level (p = 0.135) 0.41. Haplotype analysis of rs165774 and rs4680 was and it did not survive correction for multiple testing. performed in all groups and only reached statistical sig- For the two groups (nicotine and opiate dependence) nificance in the alcohol-dependent group (Table 4). that did not show association with rs4680, the odds When all substance dependence groups were analysed ratios were even lower (nicotine OR = 1.03 and opiate together as a single phenotype, the haplotypes did not OR = 1.24) requiring a sample size ranging from 2000- show association. 200000 cases and controls. Respective genotype frequencies indicated that both Analysis of combined addictive disorders (alcohol, polymorphisms were in HWE in both case and control nicotine and opiate dependence) revealed no association samples, with the exception of rs165774 in the nicotine at the genotype level (p = 0.18) or allele level for rs4680 group (c =5.6, p= 0.02), although this SNP did not (p = 0.114). Combined addictive disorders were asso- show association with the nicotine dependence group. ciated with rs165774 at the allele level (p =0.020)but not at the genotype level (p = 0.062). Discussion In addition, the nicotine-dependent group genotype Two SNPs in COMT previously identified as being asso- was tested for an association with the Fagerstrom Nico- ciated with schizophrenia [28] were examined for their tine Dependence Test (FNDT). Analysis of variance association with alcohol, nicotine and opiate depen- revealed no significant associations between FNDT and dence. Evidence suggests that a common molecular axis genotype (rs165774: p= 0.135, F= 2.032; rs4680: p = involving the dopamine pathway exists for multiple psy- 0.520, F = 0.656). chiatric disorders. One SNP in COMT rs4680 (Val 158 Linkage disequilibrium (LD) analysis was performed Met) has received considerable scientific attention as it on all groups for the rs4680 and rs165774 SNPs. Strong influences the availability of COMT and subsequently LD was found between the two SNPs in all groups. Con- 2 2 the efficiency of extracellular dopamine degradation. trols: D’ =0.93, r =0.37.Nicotine:D’ =1.0,r =0.37. Homozygosity for 158 Met leads to a 3-4 fold reduction in enzymatic activity compared with homozygosity for Table 3 Allele Association of COMT SNP rs4680 158 Val [37,38]. Since COMT plays a crucial role in the Sample Allele c p- Odds 95% CI metabolism of dopamine it is likely that it contributes to frequency value* Ratio the etiology of alcohol dependence. Alcohol-induced GA euphoria is associated with rapid release of dopamine in Controls 194 244 limbic areas and a study has shown that subjects with Nicotine 126 154 0.035 0.852 1.03 0.76- the 158 Met polymorphism have low dopamine inactiva- dependence 1.39 tion and are more vulnerable to alcohol dependence Opiate dependence 110 112 1.639 0.200 1.24 0.89- [19]. It is well known that psychotic disorders are fre- 1.71 quently comorbid with alcohol and other substance Alcohol 231 223 3.880 0.049 1.30 1.00- dependence 1.69 dependence [29,30] but it is not possible to tell whether * p-value determined by Pearson’s chi-squared test (DF = 1) this is because these disorders have a common Voisey et al. Behavioral and Brain Functions 2011, 7:51 Page 5 of 6 http://www.behavioralandbrainfunctions.com/content/7/1/51 Acknowledgements molecular metabolic aetiology or whether psychosis This work was financially supported by the Queensland State Government, leads to substance abuse via an as yet unidentified the Nicol Foundation and the Institute of Health and Biomedical Innovation, mechanism. QUT. JV is a Queensland Smart State Fellow. The authors would also like to thank Jason Connor for the collection of alcohol-dependent samples. Association studies of rs4680 have produced varied results and it may play a role in susceptibility to a range Author details of psychiatric conditions. Another possible candidate Institute of Health and Biomedical Innovation, Queensland University of Technology, Brisbane, Queensland, Australia. Division of Mental Health, regarding risk is rs165774 that we have previously Royal Brisbane and Women’s Hospital, Brisbane, Queensland, Australia. shown to be associated with schizophrenia and is in strong linkage disequilibrium with rs4680 [28]. Most Authors’ contributions JV: Involved in conception and design, acquisition of data, analysed and studies of COMT have focused on rs4680 and a stronger interpreted data, drafted the article and approved final version. CS: Involved candidate polymorphism is yet to be identified. Analysis in conception and design, acquisition of data, critically revised article and of rs165774 revealed associations with alcohol depen- approved final version. IH: Involved in conception and design, acquisition of data, analysed and interpreted data, critically revised article and approved dence at both the allele and genotype levels. Although final version. BL: Involved in conception and design, acquisition of data, rs4680 was associated with alcohol dependence at the critically revised article and approved final version. RY: Involved in allele level, the association was not convincing and did conception and design, acquisition of data, critically revised article and approved final version. CM: Involved in conception and design, acquisition notholdupat the genotype level. Nicotine andopiate of data, critically revised article and approved final version. dependence were not associated with rs4680 or rs165774 in our study but association cannot be ruled Competing interests All authors declare that they have no conflicts of interest, including no out as we only analysed a limited number of cases financial, personal or other relationships with other people or organisations. (Tables 1 and 3). Theonlyother studybesides our schizophrenia study Received: 4 May 2011 Accepted: 31 December 2011 Published: 31 December 2011 [28] that has found association with a neurological/psy- chiatric condition and rs165774 is a Chinese study References examining mental retardation in a Chinese Han popula- 1. Axelrod J, Tomchick R: Enzymatic O-methylation of epinephrine and tion [39]. The rs165774 SNP has not been studied in other catechols. J Biol Chem 1958, 233:702-705. 2. Bassett AS, Chow EW: 22q11 deletion syndrome: a genetic subtype of genome-wide association studies. schizophrenia. Biol Psychiatry 1999, 46:882-891. 3. Bassett AS, Hodgkinson K, Chow EW, Correia S, Scutt LE, Weksberg R: 22q11 Conclusions deletion syndrome in adults with schizophrenia. Am J Med Genet 1998, 81:328-337. This study identified a polymorphism in COMT that 4. Gothelf D, Frisch A, Munitz H, Rockah R, Aviram A, Mozes T, Birger M, possibly plays a role in psychiatric liability for schizo- Weizman A, Frydman M: Velocardiofacial manifestations and phrenia and alcohol dependence. The rs165774 poly- microdeletions in schizophrenic inpatients. Am J Med Genet 1997, 72:455-461. morphism may affect COMT enzyme activity and 5. Abdolmaleky HM, Cheng KH, Faraone SV, Wilcox M, Glatt SJ, Gao F, therefore dopamine inactivation resulting in vulnerabil- Smith CL, Shafa R, Aeali B, Carnevale J, Pan H, Papageorgis P, Ponte JF, ity to substance dependence. The rs165774 SNP dis- Sivaraman V, Tsuang MT, Thiagalingam S: Hypomethylation of MB-COMT promoter is a major risk factor for schizophrenia and bipolar disorder. played stronger association with alcohol dependence Hum Mol Genet 2006, 15:3132-3145. than rs4680 but it is in tight LD with the non-synon- 6. de Chaldee M, Laurent C, Thibaut F, Martinez M, Samolyk D, Petit M, ymous SNP rs4680. A limitation of our study is that Campion D, Mallet J: Linkage disequilibrium on the COMT gene in French schizophrenics and controls. Am J Med Genet 1999, 88:452-457. controls were not screened for psychiatric conditions 7. Egan MF, Straub RE, Goldberg TE, Yakub I, Callicott JH, Hariri AR, Mattay VS, including substance dependence. However not screening Bertolino A, Hyde TM, Shannon-Weickert C, Akil M, Crook J, Vakkalanka RK, controls is unlikely to bias results as screening would be Balkissoon R, Gibbs RA, Kleinman JE, Weinberger DR: Variation in GRM3 affects cognition, prefrontal glutamate, and risk for schizophrenia. Proc likely to strengthen the associations observed between Natl Acad Sci USA 2004, 101:12604-12609. cases and controls. Another limitation was that no SCID 8. Goghari VM, Sponheim SR: Differential association of the COMT (Structured Clinical Interview for DSM Disorders) was Val158Met polymorphism with clinical phenotypes in schizophrenia and bipolar disorder. Schizophr Res 2008, 103:186-191. performed on patients. However, all participants met 9. Kremer I, Pinto M, Murad I, Muhaheed M, Bannoura I, Muller DJ, Schulze TG, DSM-IV criteria. We did not adjust our P-values for Reshef A, Blanaru M, Gathas S, Goichman R, Rietschel M, Dobrusin M, multiple testing as the validity of this technique is con- Bachner-Melman R, Nemanov L, Belmaker RH, Maier W, Ebstein RP: Family- based and case-control study of catechol-O-methyltransferase in troversial and has been shown to increase type II errors, schizophrenia among Palestinian Arabs. Am J Med Genet Part B 2003, making important differences non-significant [40]. 119B:35-39. Therefore, our significant association must be seen as 10. Li T, Sham PC, Vallada H, Xie T, Tang X, Murray RM, Liu X, Collier DA: Preferential transmission of the high activity allele of COMT in exploratory and further replication is required. For the schizophrenia. Psychiatr Genet 1996, 6:131-133. opiate and nicotine-dependent groups that did not show 11. Wonodi I, Stine OC, Mitchell BD, Buchanan RW, Thaker GK: Association significance with rs165774 or rs4680, replication in an between Val108/158 Met polymorphism of the COMT gene and schizophrenia. Am J Med Genet Part B 2003, 120B:47-50. independent study is required with a larger sample size. Voisey et al. Behavioral and Brain Functions 2011, 7:51 Page 6 of 6 http://www.behavioralandbrainfunctions.com/content/7/1/51 12. Chen J, Lipska BK, Halim N, Ma QD, Matsumoto M, Melhem S, Kolachana BS, 27. Treutlein J, Cichon S, Ridinger M, Wodarz N, Soyka M, Zill P, Maier W, Hyde TM, Herman MM, Apud J, Egan MF, Kleinman JE, Weinberger DR: Moessner R, Gaebel W, Dahmen N, Fehr C, Scherbaum N, Steffens M, Functional analysis of genetic variation in catechol-O-methyltransferase Ludwig KU, Frank J, Wichmann HE, Schreiber S, Dragano N, Sommer WH, (COMT): effects on mRNA, protein, and enzyme activity in postmortem Leonardi-Essmann F, Lourdusamy A, Gebicke-Haerter P, Wienker TF, human brain. Am J Hum Genet 2004, 75:807-821. Sullivan PF, Nothen MM, Kiefer F, Spanagel R, Mann K, Rietschel M: 13. Hong JP, Lee JS, Chung S, Jung J, Yoo HK, Chang SM, Kim CY: New Genome-wide association study of alcohol dependence. Arch Gen functional single nucleotide polymorphism (Ala72Ser) in the COMT gene Psychiatry 2009, 66:773-784. is associated with aggressive behavior in male schizophrenia. Am J Med 28. Voisey J, Swagell CD, Hughes IP, Lawford BR, Young RM, Morris CP: Genet Part B 2008, 147B:658-660. HapMap tag-SNP analysis confirms a role for COMT in schizophrenia risk 14. Lee SG, Joo Y, Kim B, Chung S, Kim HL, Lee I, Choi B, Kim C, Song K: and reveals a novel association. Eur Psychiatry 2010, doi:10.1016/j. Association of Ala72Ser polymorphism with COMT enzyme activity and eurpsy.2010.1008.004. the risk of schizophrenia in Koreans. Hum Genet 2005, 116:319-328. 29. Buckley PF: Substance abuse in schizophrenia: a review. J Clin Psychiatry 15. Hettema JM, An SS, Bukszar J, van den Oord EJ, Neale MC, Kendler KS, 1998, 59(Suppl 3):26-30. Chen X: Catechol-O-methyltransferase contributes to genetic 30. Dixon L: Dual diagnosis of substance abuse in schizophrenia: prevalence susceptibility shared among anxiety spectrum phenotypes. Biol Psychiatry and impact on outcomes. Schizophr Res 1999, 35 Suppl:S93-100. 2008, 64:302-310. 31. Heatherton TF, Kozlowski LT, Frecker RC, Fagerstrom KO: The Fagerstrom 16. Hamilton SP, Slager SL, Heiman GA, Deng Z, Haghighi F, Klein DF, Test for Nicotine Dependence: a revision of the Fagerstrom Tolerance Hodge SE, Weissman MM, Fyer AJ, Knowles JA: Evidence for a Questionnaire. Br J Addict 1991, 86:1119-1127. susceptibility locus for panic disorder near the catechol-O- 32. Oeth P, del Mistro G, Marnellos G, Shi T, van den Boom D: Qualitative and methyltransferase gene on chromosome 22. Biol Psychiatry 2002, quantitative genotyping using single base primer extension coupled 51:591-601. with matrix-assisted laser desorption/ionization time-of-flight mass 17. Massat I, Souery D, Del-Favero J, Nothen M, Blackwood D, Muir W, spectrometry (MassARRAY). Methods Mol Biol 2009, 578:307-343. Kaneva R, Serretti A, Lorenzi C, Rietschel M, Milanova V, Papadimitriou GN, 33. Abramson JH: WINPEPI (PEPI-for-Windows): computer programs for Dikeos D, Van Broekhoven C, Mendlewicz J: Association between COMT epidemiologists. Epidemiol Perspect Innov 2004, 1:6. (Val158Met) functional polymorphism and early onset in patients with 34. Ott J: Utility programs for analysis of genetic linkage, Program, HWE major depressive disorder in a European multicenter genetic association version 1.10. New York: Columbia University; 1988. study. Mol Psychiatry 2005, 10:598-605. 35. Benjamini YHY: Controlling the false discovery rate: a practical and 18. Mandelli L, Serretti A, Marino E, Pirovano A, Calati R, Colombo C: powerful approach to multiple testing. Journal of the Royal Statistical Interaction between serotonin transporter gene, catechol-O- Society, Series B 1995, 57:289-300. methyltransferase gene and stressful life events in mood disorders. Int J 36. Carter KW, McCaskie PA, Palmer LJ: JLIN: A Java based Linkage Neuropsychopharmacol 2007, 10:437-447. Disequilibrium plotter. BMC Bioinformatics 2006, 7:60. 19. Tiihonen J, Hallikainen T, Lachman H, Saito T, Volavka J, Kauhanen J, 37. Lachman HM, Papolos DF, Saito T, Yu YM, Szumlanski CL, Salonen JT, Ryynanen OP, Koulu M, Karvonen MK, Pohjalainen T, Syvalahti E, Weinshilboum RM: Human catechol-O-methyltransferase Hietala J: Association between the functional variant of the catechol-O- pharmacogenetics: description of a functional polymorphism and its methyltransferase (COMT) gene and type 1 alcoholism. Mol Psychiatry potential application to neuropsychiatric disorders. Pharmacogenetics 1999, 4:286-289. 1996, 6:243-250. 20. Kauhanen J, Hallikainen T, Tuomainen TP, Koulu M, Karvonen MK, 38. Syvanen AC, Tilgmann C, Rinne J, Ulmanen I: Genetic polymorphism of Salonen JT, Tiihonen J: Association between the functional polymorphism catechol-O-methyltransferase (COMT): correlation of genotype with of catechol-O-methyltransferase gene and alcohol consumption among individual variation of S-COMT activity and comparison of the allele social drinkers. Alcohol Clin Exp Res 2000, 24:135-139. frequencies in the normal population and parkinsonian patients in 21. Omidvar M, Stolk L, Uitterlinden AG, Hofman A, Van Duijn CM, Tiemeier H: Finland. Pharmacogenetics 1997, 7:65-71. The effect of catechol-O-methyltransferase Met/Val functional 39. Zhang K, Gao J, An C, Gao X, Zheng Z, Li R, Huang S, Zhang F: An polymorphism on smoking cessation: retrospective and prospective association study between cathechol-O-methyltransferase gene and analyses in a cohort study. Pharmacogenet Genomics 2009, 19:45-51. mental retardation in the Chinese Han population. Neurosci Lett 2007, 22. Oosterhuis BE, LaForge KS, Proudnikov D, Ho A, Nielsen DA, Gianotti R, 419:83-87. Barral S, Gordon D, Leal SM, Ott J, Kreek MJ: Catechol-O-methyltransferase 40. Perneger TV: What’s wrong with Bonferroni adjustments. BMJ 1998, (COMT) gene variants: possible association of the Val158Met variant 316:1236-1238. with opiate addiction in Hispanic women. Am J Med Genet B doi:10.1186/1744-9081-7-51 Neuropsychiatr Genet 2008, 147B:793-798. Cite this article as: Voisey et al.: A novel SNP in COMT is associated with 23. Foroud T, Wetherill LF, Dick DM, Hesselbrock V, Nurnberger JI, Kramer J, alcohol dependence but not opiate or nicotine dependence: a case Tischfield J, Schuckit M, Bierut LJ, Xuei X, Edenberg HJ: Lack of association control study. Behavioral and Brain Functions 2011 7:51. of alcohol dependence and habitual smoking with catechol-O- methyltransferase. Alcohol Clin Exp Res 2007, 31:1773-1779. 24. Caporaso N, Gu F, Chatterjee N, Sheng-Chih J, Yu K, Yeager M, Chen C, Jacobs K, Wheeler W, Landi MT, Ziegler RG, Hunter DJ, Chanock S, Hankinson S, Kraft P, Bergen AW: Genome-wide and candidate gene association study of cigarette smoking behaviors. PLoS One 2009, 4: e4653. 25. Edenberg HJ, Koller DL, Xuei X, Wetherill L, McClintick JN, Almasy L, Submit your next manuscript to BioMed Central Bierut LJ, Bucholz KK, Goate A, Aliev F, Dick D, Hesselbrock V, Hinrichs A, and take full advantage of: Kramer J, Kuperman S, Nurnberger JI, Rice JP, Schuckit MA, Taylor R, Todd Webb B, Tischfield JA, Porjesz B, Foroud T: Genome-wide association study • Convenient online submission of alcohol dependence implicates a region on chromosome 11. Alcohol Clin Exp Res 2010, 34:840-852. • Thorough peer review 26. Lind PA, Macgregor S, Vink JM, Pergadia ML, Hansell NK, de Moor MH, • No space constraints or color figure charges Smit AB, Hottenga JJ, Richter MM, Heath AC, Martin NG, Willemsen G, de • Immediate publication on acceptance Geus EJ, Vogelzangs N, Penninx BW, Whitfield JB, Montgomery GW, Boomsma DI, Madden PA: A genomewide association study of nicotine • Inclusion in PubMed, CAS, Scopus and Google Scholar and alcohol dependence in Australian and Dutch populations. Twin Res • Research which is freely available for redistribution Hum Genet 2010, 13:10-29. Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Behavioral and Brain Functions Springer Journals

A novel SNP in COMT is associated with alcohol dependence but not opiate or nicotine dependence: a case control study

Download PDF
6 pages

Loading next page...
 
/lp/springer-journals/a-novel-snp-in-comt-is-associated-with-alcohol-dependence-but-not-HeSnjFIOOv

References (83)

Publisher
Springer Journals
Copyright
Copyright © 2011 by Voisey et al; licensee BioMed Central Ltd.
Subject
Biomedicine; Neurosciences; Neurology; Behavioral Therapy; Psychiatry
eISSN
1744-9081
DOI
10.1186/1744-9081-7-51
pmid
22208661
Publisher site
See Article on Publisher Site

Abstract

Background: It is well established that COMT is a strong candidate gene for substance use disorder and schizophrenia. Recently we identified two SNPs in COMT (rs4680 and rs165774) that are associated with schizophrenia in an Australian cohort. Individuals with schizophrenia were more than twice as likely to carry the GG genotype compared to the AA genotype for both the rs165774 and rs4680 SNPs. Association of both rs4680 and rs165774 with substance dependence, a common comorbidity of schizophrenia has not been investigated. Methods: To determine whether COMT is important in substance dependence, rs165774 and rs4680 were genotyped and haplotyped in patients with nicotine, alcohol and opiate dependence. Results: The rs165774 SNP was associated with alcohol dependence. However, it was not associated with nicotine or opiate dependence. Individuals with alcohol dependence were more than twice as likely to carry the GG or AG genotypes compared to the AA genotype, indicating a dominant mode of inheritance. The rs4680 SNP showed a weak association with alcohol dependence at the allele level that did not reach significance at the genotype level but it was not associated with nicotine or opiate dependence. Analysis of rs165774/rs4680 haplotypes also revealed association with alcohol dependence with the G/G haplotype being almost 1.5 times more common in alcohol- dependent cases. Conclusions: Our study provides further support for the importance of the COMT in alcohol dependence in addition to schizophrenia. It is possible that the rs165774 SNP, in combination with rs4680, results in a common molecular variant of COMT that contributes to schizophrenia and alcohol dependence susceptibility. This is potentially important for future studies of comorbidity. As our participant numbers are limited our observations should be viewed with caution until they are independently replicated. Background encodes either valine or methionine at amino acid posi- Catechol-O-methyl transferase (COMT) is an enzyme tion 158, with the substitution shown to alter COMT involved in the degradation of dopamine [1] and is enzyme activity [12]. The only other non-synonymous encoded by the COMT gene.Thisliesinaregion that polymorphism in COMT that has been found to be has been strongly implicated in schizophrenia [2-4]. The associated with schizophrenia is rs6267. This alanine/ serine substitution also alters COMT enzyme activity COMT gene is located on chromosome 22q11 and asso- ciation studies have identified a number of polymorph- but has only been identified in Asian populations isms that are associated with schizophrenia [5-11]. One [13,14]. of the more interesting polymorphisms is rs4680 that Along with schizophrenia, studies have also identified COMT associations with a range of psychiatric condi- tions. A haplotype including the rs4680 polymorphism * Correspondence: p.morris@qut.edu.au is associated with risk for several anxiety disorders and Institute of Health and Biomedical Innovation, Queensland University of major depression [15] and the rs4680 polymorphism has Technology, Brisbane, Queensland, Australia Full list of author information is available at the end of the article © 2011 Voisey et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Voisey et al. Behavioral and Brain Functions 2011, 7:51 Page 2 of 6 http://www.behavioralandbrainfunctions.com/content/7/1/51 been associated with panic disorder [16] and early onset psychiatrist or physician experienced in drug and alco- major depression in a large European study [17]. hol dependence and met DSM-IV criteria for opiate Another European study found that COMT variation dependence. All were being assessed for naltrexone could predict onset of depressive episodes following treatment as outpatients in a large public hospital detox- exposure to stressful life events [18]. The rs4680 poly- ification unit in Brisbane, Australia. Participants had a morphism has been studied in addictive behaviours and mean age of 30.0 years of age (s.d. ± 7.9 years). Approxi- found to contribute significantly to the development of mately half of the participants were being managed on late-onset alcohol dependence [19]. A Finnish study of methadone prior to detoxification (47.2%) while the 896 males found rs4680 to not only contribute signifi- other half were on heroin (52.8%). Those on methadone cantly to alcohol intake in alcoholics but also in the had a mean dose of 48.1 milligrams (s.d. 30.5), with a general male population [20]. Smoking cessation and range between 10-165 milligrams. The mean age of association with the rs4680 polymorphism was found in onset of heroin use was 22.4 years of age (s.d. 5.14), a large study from the Netherlands [21]. As well as nico- with a range between 15-43 years. Mean number of par- tine and alcohol dependence, opiate dependence has ticipant-reported detoxifications prior to this occasion also been studied for the rs4680 polymorphism. An was 3.5 (s.d. 3.3), with a range between 0-16 detoxifica- association with opiate dependence and rs4680 was tions. Cannabis was the most common concurrently observed in Hispanic women but did not hold up after used illicit substance reported by participants prior to correction for multiple testing [22]. However there have treatment (52.5% reported use), followed by ampheta- been conflicting studies for COMT including a study mines (14.9% reported use). Opiate-dependent subjects that did not observe association with alcohol depen- were excluded from the study if they had an organic dence or nicotine dependence [23]. Genome-wide asso- brain syndrome, psychosis or any other condition that ciation studies of nicotine and alcohol dependence have would affect their ability to provide informed consent. not found association with COMT to date [24-27]. Alcohol Dependence Previously we confirmed that rs4680 is associated with A total of 231 unrelated Caucasian (74 female and 157 schizophreniainanAustralian population but we have male) alcohol-dependent subjects were recruited from identified stronger association with schizophrenia with a large public hospitals in Brisbane, Australia. All subjects novel COMT SNP, rs165774 [28]. Since psychotic disor- were assessed using a checklist of specific criteria by a ders are often comorbid with alcohol and other sub- clinical psychologist experienced in drug and alcohol stance dependence [29,30], we genotyped the two dependence and met DSM-IV criteria of alcohol depen- COMT polymorphisms in alcohol, nicotine and opiate dence. Participants had a mean age of 40.74 years (s.d. ± dependence. 10.3 years). All were inpatients and represented a spec- trum of severity with a significant proportion (n =65) Methods of these patients being diagnosed with two or more Participants alcohol related medical conditions such as pancreatitis, Controls cirrhosis, hepatitis or peripheral neuropathy. Alcohol- The control group consisted of 250 unrelated Cauca- dependent patients were excluded from the study if they sians (102 female and 148 male) with a mean age of had an organic brain syndrome, psychosis, or any other 36.8 years (s.d. ± 12.8 years). The control group con- condition that would affect their ability to provide sisted of volunteers from the general public, hospital informed consent. nursing and medical staff, and university staff and stu- Nicotine Dependence dents. Formal screening for psychological disorders was A total of 147 (68 male, 79 female) unrelated Caucasians not undertaken in the control population. As such the with a mean age of 43.3 (s.d. ± 11.1 years) were controls represent an unselected control group and may recruited for smoking reduction with a view to eventual include individuals with substance dependence. To cessation through hospital and media advertisements. minimise population stratification bias, both control and All subjects were assessed using a checklist of specific clinical subjects were recruited in the Brisbane region (a criteria by a consultant psychiatrist or physician experi- city of approximately 2 million inhabitants on the East enced in drug and alcohol dependence and met DSM- Coast of Australia) and all were of British or European IV criteria of nicotine dependence. All subjects were descent (ascertained by subject self-reporting). outpatients. Participant inclusion criteria included 18 Opiate Dependence years of age or older and smoking for at least three A total of 120 unrelated Caucasian participants (50 years and being generally healthy despite currently female and 70 male) diagnosed as opiate-dependent smoking 15 cigarettes or more per day. All were moti- were recruited for this study. All subjects were assessed vated to reduce smoking and had the goal of eventual using a checklist of specific criteria by a consultant cessation. However, all participants had at least one Voisey et al. Behavioral and Brain Functions 2011, 7:51 Page 3 of 6 http://www.behavioralandbrainfunctions.com/content/7/1/51 serious but unsuccessful attempt at quitting in the pre- involved pooling the low-risk homozygotes and the het- vious 24 months. One hundred and thirty nine of the erozygotes and comparing frequencies with the high-risk participants were administered the Fagerstrom test for homozygotes, i.e. OR > 1. Correction for multiple test- Nicotine Dependence [31]. ing was conducted using the Benjamini-Hochberg Ethics approval was obtained from all institutions method [35]. Linkage disequilibrium and haplotype esti- involved and each participant from the control, opiate mations were calculated using JLIN version 1.6.0 [36]. dependence, alcohol dependence and nicotine depen- dence groups gave written informed consent. Results Two COMT SNPs (rs165774 and rs4680) which we had Genotyping previously found to be associated with schizophrenia Oragene kits were used to extract DNA from saliva were genotyped in 250 controls, 147 nicotine-dependent samples. Samples were genotyped using a homogeneous subjects, 120 opiate-dependent subjects and 231 alco- MassEXTEND (hME) Sequenom assay [32] performed hol-dependent subjects to investigate their association by the Australian Genome Research Facility. The hME with substance dependence. In addition to our pre- assay is based on the annealing of an oligonucleotide viously reported association with schizophrenia, primer (hME primer) adjacent to the SNP of interest. rs165774 was found to be associated with alcohol The addition of a DNA polymerase along with a mixture dependence at the allele level after correction for multi- of terminator nucleotides allows extension of the hME pletesting.There wasnoassociation with opiate or primer through the polymorphic site and generates nicotine dependence (Table 1). For the two groups allele-specific extension products, each having a unique (nicotine and opiate dependence) that did not show molecular mass. The resultant masses of the extension association with rs165774, we did not have sufficient products are then analysed by matrix-assisted laser des- power (< 0.80) to detect association with our sample orption/ionization time-of-flight mass spectrometry size using retrospective power calculations for a case- (MALDI-TOF MS) and a genotype is assigned in real control study in syntax SPSS version 18 because the time. The hME assay was performed in multiplex with odds ratios were so low (nicotine OR = 1.24 and opiate up to 36 reactions in a single well. OR = 1.28). In fact a sample size ranging from 2000- Primers sequences for rs165774 are as follows: PCR 3000 cases and controls would be required to show any Primer 1: ACGTTGGATGGCCCTACCTAGCCAGG- significance for rs165774 with opiate or nicotine depen- CAT; PCR Primer 2: ACGTTGGATGTCCCA- dence with odds ratios of this size. GAAACTGGACACTGC; Extension Primer: cgct At the genotype level, rs165774 was still associated CCTCGTGCTCCTAGTC. Primers sequences for rs4680 with alcohol dependence (Table 2). Individuals with are as follows: PCR Primer 1: ACGTTGGATGTTTTC- alcohol dependence were more than twice as likely to CAGGTCTGACAACGG; PCR Primer 2: ACGTTG- carry the GG or AG genotype compared to the AA gen- GATGACCCAGCGGATGGTGGATTT; Extension otype. The rs165774 SNP was found to follow a domi- Primer: tcacGCACACCTTGTCCTTCA. nant mode of inheritance for alcohol dependence when The genotyping fail rate was 3.75% for rs165774 and genotypes were pooled (p = 0.006, OR 2.24, 95% CI 1.2 6.92% for rs4680 for all included patients. The genotyp- to 4.3). ing of several other SNPs were independently verified by In addition to our previously reported association with other methods such as real-time PCR with a concor- schizophrenia, rs4680 was only marginally associated dancerateof96.6%(the COMT SNPs were not inde- with alcohol dependence at the allele level (Table 3) but pendently verified). Genotypes were determined by was not significant with opiate or nicotine dependence. investigators blinded for clinical diagnoses. Table 1 Allele Association of COMT SNP rs165774 Statistical Analysis Sample Allele c p- Odds 95% CI APearson’s chi-squared test was performed to identify frequency value* Ratio statistical associations between alleles and genotype and GA substance dependence status. Odds ratios (OR) were Controls 304 176 also calculated. Tests were performed on both genotype Nicotine 199 93 1.856 0.173 1.24 0.91- and allele data. Statistical tests were performed using dependence 1.69 the COMPARE2 program from the WinPepi suite of Opiate dependence 161 73 2.072 0.150 1.28 0.91- epidemiology programs [33] and SPSS version 18. 1.78 Hardy-Weinberg equilibrium (HWE) was computed Alcohol 319 133 5.509 0.019 1.39 1.05- dependence 1.83 using Utility Programs for Analysis of Genetic Linkage [34]. The analysis of genotypes under a recessive model * p-value determined by Pearson’s chi-squared test (DF = 1) Voisey et al. Behavioral and Brain Functions 2011, 7:51 Page 4 of 6 http://www.behavioralandbrainfunctions.com/content/7/1/51 Table 2 Genotype Association of COMT SNP rs165774 Table 4 Haplotype analysis of COMT rs4680 and rs165774 polymorphisms in patients with alcohol Sample Genotype Counts p-value* dependence AA (%) AG (%) GG (%) c c a 2b Haplotype Controls Alcohol Odds Ratio c P control 39 (16.25) 98 (40.83) 103 (42.92) rs4680/ (%) (%) (P) Nicotine dependence 21 (14.38) 51 (34.93) 74 (50.69) 0.330 rs165774 Odds ratio 1 0.966 1.334 0.205 A/A 147 (34.5) 126 1 3.794 0.051 p-value 1.000 0.700 (28.4) A/G 93 (21.8) 89 (20.0) 1.116 (1.000) 0.419 0.517 Opiate dependence 13 (11.11) 47 (40.17) 57 (48.72) 0.363 G/A 5 (1.2) 1 (0.2) 0.233 (0.392) 3099 0.078 Odds ratio 1 1.439 1.660 0.172 G/G 181 (42.5) 228 1.470 (0.042) 6.866 0.009 p-value 0.626 0.300 (51.4) Alcohol dependence 18 (7.96) 97 (42.92) 111(49.12) 0.022 † TOTAL 426 444 9.656 0.022 Odds ratio 1 2.146 2.336 0.023 Odds ratio with respect to rs4680 A/rs165774 A haplotype which is more p-value 0.029 0.012 commonly associated with a normal phenotype * p-value determined by Pearson’s c test (DF = 2) b 2 Likelihood ratio c test comparing haplotype frequency between groups p-value determined using the extended Mantel-Haenszel test for trend (DF = when all other haplotypes were pooled (DF = 1, and DF = 3 for total c ) 1) c Haplotypes frequencies were estimated using JLIN version 1.6.0 However the association with rs4680 and alcohol depen- 2 2 Opiate: D’ =0.90, r =0.35. Alcohol: D’ = 0.98, r = dence did not hold up at the genotype level (p = 0.135) 0.41. Haplotype analysis of rs165774 and rs4680 was and it did not survive correction for multiple testing. performed in all groups and only reached statistical sig- For the two groups (nicotine and opiate dependence) nificance in the alcohol-dependent group (Table 4). that did not show association with rs4680, the odds When all substance dependence groups were analysed ratios were even lower (nicotine OR = 1.03 and opiate together as a single phenotype, the haplotypes did not OR = 1.24) requiring a sample size ranging from 2000- show association. 200000 cases and controls. Respective genotype frequencies indicated that both Analysis of combined addictive disorders (alcohol, polymorphisms were in HWE in both case and control nicotine and opiate dependence) revealed no association samples, with the exception of rs165774 in the nicotine at the genotype level (p = 0.18) or allele level for rs4680 group (c =5.6, p= 0.02), although this SNP did not (p = 0.114). Combined addictive disorders were asso- show association with the nicotine dependence group. ciated with rs165774 at the allele level (p =0.020)but not at the genotype level (p = 0.062). Discussion In addition, the nicotine-dependent group genotype Two SNPs in COMT previously identified as being asso- was tested for an association with the Fagerstrom Nico- ciated with schizophrenia [28] were examined for their tine Dependence Test (FNDT). Analysis of variance association with alcohol, nicotine and opiate depen- revealed no significant associations between FNDT and dence. Evidence suggests that a common molecular axis genotype (rs165774: p= 0.135, F= 2.032; rs4680: p = involving the dopamine pathway exists for multiple psy- 0.520, F = 0.656). chiatric disorders. One SNP in COMT rs4680 (Val 158 Linkage disequilibrium (LD) analysis was performed Met) has received considerable scientific attention as it on all groups for the rs4680 and rs165774 SNPs. Strong influences the availability of COMT and subsequently LD was found between the two SNPs in all groups. Con- 2 2 the efficiency of extracellular dopamine degradation. trols: D’ =0.93, r =0.37.Nicotine:D’ =1.0,r =0.37. Homozygosity for 158 Met leads to a 3-4 fold reduction in enzymatic activity compared with homozygosity for Table 3 Allele Association of COMT SNP rs4680 158 Val [37,38]. Since COMT plays a crucial role in the Sample Allele c p- Odds 95% CI metabolism of dopamine it is likely that it contributes to frequency value* Ratio the etiology of alcohol dependence. Alcohol-induced GA euphoria is associated with rapid release of dopamine in Controls 194 244 limbic areas and a study has shown that subjects with Nicotine 126 154 0.035 0.852 1.03 0.76- the 158 Met polymorphism have low dopamine inactiva- dependence 1.39 tion and are more vulnerable to alcohol dependence Opiate dependence 110 112 1.639 0.200 1.24 0.89- [19]. It is well known that psychotic disorders are fre- 1.71 quently comorbid with alcohol and other substance Alcohol 231 223 3.880 0.049 1.30 1.00- dependence 1.69 dependence [29,30] but it is not possible to tell whether * p-value determined by Pearson’s chi-squared test (DF = 1) this is because these disorders have a common Voisey et al. Behavioral and Brain Functions 2011, 7:51 Page 5 of 6 http://www.behavioralandbrainfunctions.com/content/7/1/51 Acknowledgements molecular metabolic aetiology or whether psychosis This work was financially supported by the Queensland State Government, leads to substance abuse via an as yet unidentified the Nicol Foundation and the Institute of Health and Biomedical Innovation, mechanism. QUT. JV is a Queensland Smart State Fellow. The authors would also like to thank Jason Connor for the collection of alcohol-dependent samples. Association studies of rs4680 have produced varied results and it may play a role in susceptibility to a range Author details of psychiatric conditions. Another possible candidate Institute of Health and Biomedical Innovation, Queensland University of Technology, Brisbane, Queensland, Australia. Division of Mental Health, regarding risk is rs165774 that we have previously Royal Brisbane and Women’s Hospital, Brisbane, Queensland, Australia. shown to be associated with schizophrenia and is in strong linkage disequilibrium with rs4680 [28]. Most Authors’ contributions JV: Involved in conception and design, acquisition of data, analysed and studies of COMT have focused on rs4680 and a stronger interpreted data, drafted the article and approved final version. CS: Involved candidate polymorphism is yet to be identified. Analysis in conception and design, acquisition of data, critically revised article and of rs165774 revealed associations with alcohol depen- approved final version. IH: Involved in conception and design, acquisition of data, analysed and interpreted data, critically revised article and approved dence at both the allele and genotype levels. Although final version. BL: Involved in conception and design, acquisition of data, rs4680 was associated with alcohol dependence at the critically revised article and approved final version. RY: Involved in allele level, the association was not convincing and did conception and design, acquisition of data, critically revised article and approved final version. CM: Involved in conception and design, acquisition notholdupat the genotype level. Nicotine andopiate of data, critically revised article and approved final version. dependence were not associated with rs4680 or rs165774 in our study but association cannot be ruled Competing interests All authors declare that they have no conflicts of interest, including no out as we only analysed a limited number of cases financial, personal or other relationships with other people or organisations. (Tables 1 and 3). Theonlyother studybesides our schizophrenia study Received: 4 May 2011 Accepted: 31 December 2011 Published: 31 December 2011 [28] that has found association with a neurological/psy- chiatric condition and rs165774 is a Chinese study References examining mental retardation in a Chinese Han popula- 1. Axelrod J, Tomchick R: Enzymatic O-methylation of epinephrine and tion [39]. The rs165774 SNP has not been studied in other catechols. J Biol Chem 1958, 233:702-705. 2. Bassett AS, Chow EW: 22q11 deletion syndrome: a genetic subtype of genome-wide association studies. schizophrenia. Biol Psychiatry 1999, 46:882-891. 3. Bassett AS, Hodgkinson K, Chow EW, Correia S, Scutt LE, Weksberg R: 22q11 Conclusions deletion syndrome in adults with schizophrenia. Am J Med Genet 1998, 81:328-337. This study identified a polymorphism in COMT that 4. Gothelf D, Frisch A, Munitz H, Rockah R, Aviram A, Mozes T, Birger M, possibly plays a role in psychiatric liability for schizo- Weizman A, Frydman M: Velocardiofacial manifestations and phrenia and alcohol dependence. The rs165774 poly- microdeletions in schizophrenic inpatients. Am J Med Genet 1997, 72:455-461. morphism may affect COMT enzyme activity and 5. Abdolmaleky HM, Cheng KH, Faraone SV, Wilcox M, Glatt SJ, Gao F, therefore dopamine inactivation resulting in vulnerabil- Smith CL, Shafa R, Aeali B, Carnevale J, Pan H, Papageorgis P, Ponte JF, ity to substance dependence. The rs165774 SNP dis- Sivaraman V, Tsuang MT, Thiagalingam S: Hypomethylation of MB-COMT promoter is a major risk factor for schizophrenia and bipolar disorder. played stronger association with alcohol dependence Hum Mol Genet 2006, 15:3132-3145. than rs4680 but it is in tight LD with the non-synon- 6. de Chaldee M, Laurent C, Thibaut F, Martinez M, Samolyk D, Petit M, ymous SNP rs4680. A limitation of our study is that Campion D, Mallet J: Linkage disequilibrium on the COMT gene in French schizophrenics and controls. Am J Med Genet 1999, 88:452-457. controls were not screened for psychiatric conditions 7. Egan MF, Straub RE, Goldberg TE, Yakub I, Callicott JH, Hariri AR, Mattay VS, including substance dependence. However not screening Bertolino A, Hyde TM, Shannon-Weickert C, Akil M, Crook J, Vakkalanka RK, controls is unlikely to bias results as screening would be Balkissoon R, Gibbs RA, Kleinman JE, Weinberger DR: Variation in GRM3 affects cognition, prefrontal glutamate, and risk for schizophrenia. Proc likely to strengthen the associations observed between Natl Acad Sci USA 2004, 101:12604-12609. cases and controls. Another limitation was that no SCID 8. Goghari VM, Sponheim SR: Differential association of the COMT (Structured Clinical Interview for DSM Disorders) was Val158Met polymorphism with clinical phenotypes in schizophrenia and bipolar disorder. Schizophr Res 2008, 103:186-191. performed on patients. However, all participants met 9. Kremer I, Pinto M, Murad I, Muhaheed M, Bannoura I, Muller DJ, Schulze TG, DSM-IV criteria. We did not adjust our P-values for Reshef A, Blanaru M, Gathas S, Goichman R, Rietschel M, Dobrusin M, multiple testing as the validity of this technique is con- Bachner-Melman R, Nemanov L, Belmaker RH, Maier W, Ebstein RP: Family- based and case-control study of catechol-O-methyltransferase in troversial and has been shown to increase type II errors, schizophrenia among Palestinian Arabs. Am J Med Genet Part B 2003, making important differences non-significant [40]. 119B:35-39. Therefore, our significant association must be seen as 10. Li T, Sham PC, Vallada H, Xie T, Tang X, Murray RM, Liu X, Collier DA: Preferential transmission of the high activity allele of COMT in exploratory and further replication is required. For the schizophrenia. Psychiatr Genet 1996, 6:131-133. opiate and nicotine-dependent groups that did not show 11. Wonodi I, Stine OC, Mitchell BD, Buchanan RW, Thaker GK: Association significance with rs165774 or rs4680, replication in an between Val108/158 Met polymorphism of the COMT gene and schizophrenia. Am J Med Genet Part B 2003, 120B:47-50. independent study is required with a larger sample size. Voisey et al. Behavioral and Brain Functions 2011, 7:51 Page 6 of 6 http://www.behavioralandbrainfunctions.com/content/7/1/51 12. Chen J, Lipska BK, Halim N, Ma QD, Matsumoto M, Melhem S, Kolachana BS, 27. Treutlein J, Cichon S, Ridinger M, Wodarz N, Soyka M, Zill P, Maier W, Hyde TM, Herman MM, Apud J, Egan MF, Kleinman JE, Weinberger DR: Moessner R, Gaebel W, Dahmen N, Fehr C, Scherbaum N, Steffens M, Functional analysis of genetic variation in catechol-O-methyltransferase Ludwig KU, Frank J, Wichmann HE, Schreiber S, Dragano N, Sommer WH, (COMT): effects on mRNA, protein, and enzyme activity in postmortem Leonardi-Essmann F, Lourdusamy A, Gebicke-Haerter P, Wienker TF, human brain. Am J Hum Genet 2004, 75:807-821. Sullivan PF, Nothen MM, Kiefer F, Spanagel R, Mann K, Rietschel M: 13. Hong JP, Lee JS, Chung S, Jung J, Yoo HK, Chang SM, Kim CY: New Genome-wide association study of alcohol dependence. Arch Gen functional single nucleotide polymorphism (Ala72Ser) in the COMT gene Psychiatry 2009, 66:773-784. is associated with aggressive behavior in male schizophrenia. Am J Med 28. Voisey J, Swagell CD, Hughes IP, Lawford BR, Young RM, Morris CP: Genet Part B 2008, 147B:658-660. HapMap tag-SNP analysis confirms a role for COMT in schizophrenia risk 14. Lee SG, Joo Y, Kim B, Chung S, Kim HL, Lee I, Choi B, Kim C, Song K: and reveals a novel association. Eur Psychiatry 2010, doi:10.1016/j. Association of Ala72Ser polymorphism with COMT enzyme activity and eurpsy.2010.1008.004. the risk of schizophrenia in Koreans. Hum Genet 2005, 116:319-328. 29. Buckley PF: Substance abuse in schizophrenia: a review. J Clin Psychiatry 15. Hettema JM, An SS, Bukszar J, van den Oord EJ, Neale MC, Kendler KS, 1998, 59(Suppl 3):26-30. Chen X: Catechol-O-methyltransferase contributes to genetic 30. Dixon L: Dual diagnosis of substance abuse in schizophrenia: prevalence susceptibility shared among anxiety spectrum phenotypes. Biol Psychiatry and impact on outcomes. Schizophr Res 1999, 35 Suppl:S93-100. 2008, 64:302-310. 31. Heatherton TF, Kozlowski LT, Frecker RC, Fagerstrom KO: The Fagerstrom 16. Hamilton SP, Slager SL, Heiman GA, Deng Z, Haghighi F, Klein DF, Test for Nicotine Dependence: a revision of the Fagerstrom Tolerance Hodge SE, Weissman MM, Fyer AJ, Knowles JA: Evidence for a Questionnaire. Br J Addict 1991, 86:1119-1127. susceptibility locus for panic disorder near the catechol-O- 32. Oeth P, del Mistro G, Marnellos G, Shi T, van den Boom D: Qualitative and methyltransferase gene on chromosome 22. Biol Psychiatry 2002, quantitative genotyping using single base primer extension coupled 51:591-601. with matrix-assisted laser desorption/ionization time-of-flight mass 17. Massat I, Souery D, Del-Favero J, Nothen M, Blackwood D, Muir W, spectrometry (MassARRAY). Methods Mol Biol 2009, 578:307-343. Kaneva R, Serretti A, Lorenzi C, Rietschel M, Milanova V, Papadimitriou GN, 33. Abramson JH: WINPEPI (PEPI-for-Windows): computer programs for Dikeos D, Van Broekhoven C, Mendlewicz J: Association between COMT epidemiologists. Epidemiol Perspect Innov 2004, 1:6. (Val158Met) functional polymorphism and early onset in patients with 34. Ott J: Utility programs for analysis of genetic linkage, Program, HWE major depressive disorder in a European multicenter genetic association version 1.10. New York: Columbia University; 1988. study. Mol Psychiatry 2005, 10:598-605. 35. Benjamini YHY: Controlling the false discovery rate: a practical and 18. Mandelli L, Serretti A, Marino E, Pirovano A, Calati R, Colombo C: powerful approach to multiple testing. Journal of the Royal Statistical Interaction between serotonin transporter gene, catechol-O- Society, Series B 1995, 57:289-300. methyltransferase gene and stressful life events in mood disorders. Int J 36. Carter KW, McCaskie PA, Palmer LJ: JLIN: A Java based Linkage Neuropsychopharmacol 2007, 10:437-447. Disequilibrium plotter. BMC Bioinformatics 2006, 7:60. 19. Tiihonen J, Hallikainen T, Lachman H, Saito T, Volavka J, Kauhanen J, 37. Lachman HM, Papolos DF, Saito T, Yu YM, Szumlanski CL, Salonen JT, Ryynanen OP, Koulu M, Karvonen MK, Pohjalainen T, Syvalahti E, Weinshilboum RM: Human catechol-O-methyltransferase Hietala J: Association between the functional variant of the catechol-O- pharmacogenetics: description of a functional polymorphism and its methyltransferase (COMT) gene and type 1 alcoholism. Mol Psychiatry potential application to neuropsychiatric disorders. Pharmacogenetics 1999, 4:286-289. 1996, 6:243-250. 20. Kauhanen J, Hallikainen T, Tuomainen TP, Koulu M, Karvonen MK, 38. Syvanen AC, Tilgmann C, Rinne J, Ulmanen I: Genetic polymorphism of Salonen JT, Tiihonen J: Association between the functional polymorphism catechol-O-methyltransferase (COMT): correlation of genotype with of catechol-O-methyltransferase gene and alcohol consumption among individual variation of S-COMT activity and comparison of the allele social drinkers. Alcohol Clin Exp Res 2000, 24:135-139. frequencies in the normal population and parkinsonian patients in 21. Omidvar M, Stolk L, Uitterlinden AG, Hofman A, Van Duijn CM, Tiemeier H: Finland. Pharmacogenetics 1997, 7:65-71. The effect of catechol-O-methyltransferase Met/Val functional 39. Zhang K, Gao J, An C, Gao X, Zheng Z, Li R, Huang S, Zhang F: An polymorphism on smoking cessation: retrospective and prospective association study between cathechol-O-methyltransferase gene and analyses in a cohort study. Pharmacogenet Genomics 2009, 19:45-51. mental retardation in the Chinese Han population. Neurosci Lett 2007, 22. Oosterhuis BE, LaForge KS, Proudnikov D, Ho A, Nielsen DA, Gianotti R, 419:83-87. Barral S, Gordon D, Leal SM, Ott J, Kreek MJ: Catechol-O-methyltransferase 40. Perneger TV: What’s wrong with Bonferroni adjustments. BMJ 1998, (COMT) gene variants: possible association of the Val158Met variant 316:1236-1238. with opiate addiction in Hispanic women. Am J Med Genet B doi:10.1186/1744-9081-7-51 Neuropsychiatr Genet 2008, 147B:793-798. Cite this article as: Voisey et al.: A novel SNP in COMT is associated with 23. Foroud T, Wetherill LF, Dick DM, Hesselbrock V, Nurnberger JI, Kramer J, alcohol dependence but not opiate or nicotine dependence: a case Tischfield J, Schuckit M, Bierut LJ, Xuei X, Edenberg HJ: Lack of association control study. Behavioral and Brain Functions 2011 7:51. of alcohol dependence and habitual smoking with catechol-O- methyltransferase. Alcohol Clin Exp Res 2007, 31:1773-1779. 24. Caporaso N, Gu F, Chatterjee N, Sheng-Chih J, Yu K, Yeager M, Chen C, Jacobs K, Wheeler W, Landi MT, Ziegler RG, Hunter DJ, Chanock S, Hankinson S, Kraft P, Bergen AW: Genome-wide and candidate gene association study of cigarette smoking behaviors. PLoS One 2009, 4: e4653. 25. Edenberg HJ, Koller DL, Xuei X, Wetherill L, McClintick JN, Almasy L, Submit your next manuscript to BioMed Central Bierut LJ, Bucholz KK, Goate A, Aliev F, Dick D, Hesselbrock V, Hinrichs A, and take full advantage of: Kramer J, Kuperman S, Nurnberger JI, Rice JP, Schuckit MA, Taylor R, Todd Webb B, Tischfield JA, Porjesz B, Foroud T: Genome-wide association study • Convenient online submission of alcohol dependence implicates a region on chromosome 11. Alcohol Clin Exp Res 2010, 34:840-852. • Thorough peer review 26. Lind PA, Macgregor S, Vink JM, Pergadia ML, Hansell NK, de Moor MH, • No space constraints or color figure charges Smit AB, Hottenga JJ, Richter MM, Heath AC, Martin NG, Willemsen G, de • Immediate publication on acceptance Geus EJ, Vogelzangs N, Penninx BW, Whitfield JB, Montgomery GW, Boomsma DI, Madden PA: A genomewide association study of nicotine • Inclusion in PubMed, CAS, Scopus and Google Scholar and alcohol dependence in Australian and Dutch populations. Twin Res • Research which is freely available for redistribution Hum Genet 2010, 13:10-29. Submit your manuscript at www.biomedcentral.com/submit

Journal

Behavioral and Brain Functions – Springer Journals

Published: Dec 31, 2011

There are no references for this article.