Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Alginate oligosaccharide-induced intestinal morphology, barrier function and epithelium apoptosis modifications have beneficial effects on the growth performance of weaned pigs

Alginate oligosaccharide-induced intestinal morphology, barrier function and epithelium apoptosis... Background: Alginate oligosaccharide (AOS), produced from alginate by alginate lyase-mediated depolymerisation, is a potential substitute for antibiotics and possesses growth-enhancing effects. Nevertheless, the mechanisms by which AOS regulates porcine growth remain to be elucidated. Therefore, we investigated the AOS-mediated changes in the growth performance of weaned pigs by determining the intestinal morphology, barrier function, as well as epithelium apoptosis. Methods: Twenty-four weaned pigs were distributed into two groups (n = 12) and received either a basal diet (control group) or the same diet supplemented with 100 mg/kg AOS. On d 15, D-xylose (0.1 g/kg body weight) was orally administrated to eight randomly selected pigs per treatment, and their serum and intestinal mucosa samples were collected 1 h later. Results: Our results showed that inclusion of AOS in the diet for 2 wk increased (P < 0.05) the average daily body weight gain in weaned pigs. Notably, AOS supplementation ameliorated the intestinal morphology and barrier function, as suggested by the enhanced (P < 0.05) intestinal villus height, secretory immunoglobulin A content and goblet cell counts. Compared to the control group, AOS ingestion both decreased (P < 0.05) the total apoptotic percentage and increased (P < 0.05) the proportion of S phase in the intestinal epithelial cells. Furthermore, AOS not only up-regulated (P < 0.05) the B-cell lymphoma-2 (BCL2) transcriptional level but also down-regulated (P <0.05) the B-cell lymphoma-2-associated X protein (BAX), cysteinyl aspartate-specific proteinase-3 (caspase-3)and caspase-9 transcriptional levels in the small intestine. Conclusions: In summary, this study provides evidence that supplemental AOS beneficially affects the growth performance of weaned pigs, which may result from the improved intestinal morphology and barrier function, as well as the inhibited enterocyte death, through reducing apoptosis via mitochondria-dependent apoptosis. Keywords: Alginate oligosaccharide, Barrier function, Cell apoptosis, Intestinal morphology, Weaned pigs * Correspondence: hejun8067@163.com Jin Wan and Jiao Zhang contributed equally to this work. Institute of Animal Nutrition, Sichuan Agricultural University, Chengdu 611130, Sichuan, People’s Republic of China © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 2 of 12 Background (6.21 ± 0.0 9) kg, were assigned to two treatments with Weaning is one of the most significant events in the life 12 replicates per treatment. The treatment groups in- of pigs as they are abruptly forced to adapt to nutri- cluding a control group (CON), in which pigs were fed a tional, immunological and psychological disruptions [1]. basal diet, and an AOS group, in which pigs were fed a The weaning transition of piglets is commonly accom- basal diet supplemented with 100 mg/kg AOS (provided panied by growth retardation and impaired intestinal by the Dalian Institute of Chemical Physics, Chinese barrier [2–4]. Studies have also indicated that weaning Academy of Sciences, Dalian, China). The basal diet was can disrupt the physiological oxidant and antioxidant formulated to meet or exceed the nutrient requirements equilibrium and lead to oxidative stress [5, 6], eventually recommended by the National Research Council inducing epithelium apoptosis and cell cycle arrest in (Table 1)[21]. During the 14-day experimental period, the small intestine of post-weaning piglets [7]. Over the all pigs were individually housed in metabolism cages past decades, antibiotic medication has proven an effect- (0.7 m × 1.5 m) in a temperature- (24−26 °C), humidity- ive preventative and treatment method, used worldwide (65% ± 5%) and light-controlled room and were given ad to treat these issues. However, the widespread use of an- libitum access to feed and water. tibiotics has led, at least in part, to bacterial resistance, resulting in the delayed administration of effective ther- apy, as well as morbidity and mortality in both humans and animals [8–10]. Hence, numerous antibiotic alterna- Table 1 Ingredients and nutrient composition of the basal diet tives have been investigated, among which oligosaccha- Ingredient Content, % Nutrient Content, % rides have attracted considerable research interest, due composition to their health benefits in weaned pigs [11, 12]. Corn (7.8% crude protein) 28.80 Digestible energy, 14.85 Alginate, a naturally occurring anionic polysaccharide MJ/kg that is extracted from marine brown algae, is composed Extruded corn (7.8% crude 26.00 Crude protein 19.35 protein) of two types of uronic acid monomers, distributed as blocks of 1,4-linked β-D-mannuronic acid (M) or Soybean meal (44.2% 11.00 Calcium 0.83 crude protein) α-L-guluronic acid (G), as well as heteropolymeric mixed sequences (M–G, usually alternating) [13, 14]. Alginate Extruded soybean 10.00 Total phosphorus 0.60 oligosaccharide (AOS), prepared by depolymerising al- Whey powder (low 7.00 Available 0.43 protein) phosphorus ginate, is a non-immunogenic, non-toxic, biodegradable polymer with reported multifarious biological properties Soybean protein 5.00 Lysine 1.37 concentrate [15], including anti-oxidation [16], anti-apoptotic [17], anti-inflammatory [18] and anti-tumour effects [19]. Fish meal (62.5% crude 4.00 Methionine 0.49 protein) These beneficial properties of AOS suggest it may be an Sucrose 4.00 Methionine + 0.76 effective dietary ingredient, yet the use of AOS as a food Cysteine supplement for humans or animals is contemporarily Soybean oil 1.50 Threonine 0.81 still in its infancy. Although emerging evidence identi- fied that AOS supplements favourably enhanced the Limestone 0.75 Tryptophan 0.22 growth performance in piglets after weaning [20], the Dicalcium phosphate 0.60 AOS mechanisms responsible for this benefit are poorly L-Lysine-HCl (78%) 0.40 understood. As such, further elucidation is meaningful NaCl 0.30 and essential. DL-Methionine 0.18 Accordingly, the present study was performed to ex- L-Threonine (98.5%) 0.10 plore the effects of AOS supplementation on the intestinal architecture, barrier function and epithelium apoptosis in Chloride choline 0.10 weaned pigs, aiming to provide partial theoretical evidence Tryptophan (98%) 0.02 for the mechanisms by which AOS enhances growth per- a Vitamin premix 0.05 formance of weaned pigs. It is anticipated that our find- Mineral premix 0.20 ings will pave the way for developing AOS as a functional Total 100 food for both humans and animals in the near future. The vitamin premix provided the following per kg of diets: 6,000 IU vitamin (V) A, 3,000 IU VD , 24 mg VE, 3 mg VK , 1.5 mg VB , 6 mg VB , 3 mg VB , 3 3 1 2 6 Methods 0.02 mg VB , 14 mg niacin, 15 mg pantothenic acid, 1.2 mg folic acid and 0.15 mg biotin Animal care and experimental design The mineral premix provided the following per kg of diets: 100 mg Fe, 6 mg Initially, 24 pigs (Duroc × Landrace × Yorkshire), Cu, 100 mg Zn, 4 mg Mn, 0.30 mg I and 0.35 mg Se weaned at 21 d and with an average body weight (BW) of Values are calculated composition Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 3 of 12 Growth performance assessment Afterwards, the goblet cell and columnar cell counts per At the start and end of the experiment, the pigs were in- villus were also assessed. Villus height was recorded as dividually weighed before feeding, and daily feed con- the distance from the tip of the villi to the villus-crypt sumption per pig was measured throughout the study. junction, and width was measured at half of the villus Growth performance indices, including average daily height [25]. Crypt depth was expressed as the invagi- body weight gain (ADG), average daily feed intake nated depth between adjacent villi. A total of 10 intact, (ADFI) and the gain-to-feed ratio (G:F), were well-oriented, crypt-villus units were analysed in tripli- subsequently determined for each group from the data cate per intestinal segment. The values obtained from 10 obtained. villi, in triplicate by each intestinal segment, were aver- aged. The villus height-to-crypt depth ratio was com- Sample collection puted from the measurements obtained above, and the On the morning of d 15, after overnight starvation, eight villus surface area (mm ) was calculated by multiplying pigs from each treatment were randomly selected and 2π(villus width/2) by the villus height [26]. orally infused with D-xylose at the dose of 0.1 g/kg BW [22, 23]. After infusion of D-xylose (1 h), blood samples Immunohistochemistry were collected by jugular vein puncture and placed in For immunohistochemistry, the paraformaldehyde-fixed 10-mL vacuum tubes (non-anticoagulant). The samples duodenal, jejunal and ileal samples were embedded in were centrifuged at 3,500×g, 4 °C for 15 min, to acquire paraffin and sectioned into 2 μm thickness, then col- serum, and stored at −20 °C, until measurement of lected on glass slides. After deparaffinisation and hydra- D-xylose concentration. tion, the sections were pre-treated with 3% H O in 2 2 After blood sampling, the same pigs were anaesthe- methanol at room temperature for 10 min, to quench tised with an intravenous injection of sodium pentobar- endogenous peroxidase activity and, then, heated in bital (200 mg/kg BW), and the tissues of the duodenum, 10 mmol/L citrate buffer (pH 6.0) to retrieve the anti- jejunum and ileum were immediately isolated [24]. Ap- gen. After several rinses in PBS, the sections were proximately 5-cm duodenal, jejunal and ileal middle seg- blocked with 10% goat serum at room temperature for ments were gently flushed with ice-cold phosphate 20 min, to eliminate non-specific antibody binding and buffered saline (PBS), followed by fixation in PBS for then incubated overnight at 4 °C with 1:200 dilution of flow cytometry or in 4% paraformaldehyde solution for rabbit anti-secretory immunoglobulin A (sIgA) antibody morphological and immunohistochemical analyses. Fi- (Beijing Biosynthesis Biotechnology Co., Ltd., Beijing, nally, the residual duodenal, jejunal and ileal segments China). After rinsing with PBS several times, the sections were scraped with a scalpel blade, and the collected mu- were incubated with biotinylated goat anti-rabbit IgG cosa stored at −80 °C for quantitative real-time polymer- secondary antibody (Beijing Zhongshan Golden Bridge ase chain reaction (qPCR) analysis. Biotechnology Co., Ltd., Beijing, China) at 37 °C for 30 min. After rinsing several times in PBS, immunode- Serum D-xylose determination tection was conducted, using 3,3′-diaminobenzidine Serum D-xylose was quantitated using a D-xylose assay (DAB) as the chromogen. The sections were counter- kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, stained with haematoxylin and mounted in neutral resin. China), by following the manufacturer’s protocols. The For each section in the Motic BA210 digital microscope absorbance of the reaction mixture was acquired spec- (Motic China Group Co., Ltd., Xiamen, China), five trophotometrically at 554 nm, using a multi-mode mi- fields of vision were randomly selected, with a fixed win- croplate reader (SpectraMax M2, Molecular Devices, dow area. The integrated optical density of sIgA in the Sunnyvale, CA, USA). D-Xylose concentration was pre- duodenal, jejunal and ileal mucosa was detected by using sented as milligrams per litre of serum (mg/L). Image-Pro Plus 6.0 image analysis system (Media Cyber- netics, Inc), and the sIgA protein expression was Histomorphological analysis and cell counting reflected by the mean value of the integrated optical One-cm long duodenal, jejunal and ileal samples were density. dehydrated through a graded series of ethanol and em- bedded in paraffin. Cross-sections of each sample were Enterocyte apoptosis detection prepared, stained with haematoxylin and eosin (H&E), Duodenal, jejunal and ileal epithelial cells were isolated, and then sealed with neutral resin. Ultrathin sections of to measure the proportion of apoptotic cells by flow cy- the duodenal, jejunal and ileal samples were examined tometry with a PE Annexin V Apoptosis Detection Kit I for villus height, villus width and crypt depth, using an (Becton, Dickinson and Company, BD Biosciences, San image processing and analysis system (Image-Pro Plus Jose, CA, USA) [27]. Briefly, the excised mucosal layer of 6.0, Media Cybernetics, Inc., Bethesda, MD, USA). the duodenum, jejunum and ileum were isolated, and Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 4 of 12 Table 2 Primer sequences for quantitative real-time polymerase chain reaction Gene Primer sequence (5′→3′) Size, bp Accession No. MUC1 Forward: GTGCCGCTGCCCACAACCTG 141 XM_001926883.4 Reverse: AGCCGGGTACCCCAGACCCA MUC2 Forward: GGTCATGCTGGAGCTGGACAGT 181 XM_013989745.1 Reverse: TGCCTCCTCGGGGTCGTCAC MUC4 Forward: GATGCCCTGGCCACAGAA 89 XM_001926442.1 Reverse: TGATTCAAGGTAGCATTCATTTGC BAX Forward: CTGACGGCAACTTCAACTGG 200 XM_003127290.4 Reverse: CGTCCCAAAGTAGGAGAGGA BCL2 Forward: AGCATGCGGCCTCTATTTGA 120 XM_003121700.2 Reverse: GGCCCGTGGACTTCACTTAT FAS Forward: TGATGCCCAAGTGACTGACC 103 NM_213839.1 Reverse: GCAGAATTGACCCTCACGAT caspase-3 Forward: GTGGGACTGAAGATGACA 190 NM_214131.1 Reverse: ACCCGAGTAAGAATGTG caspase-8 Forward: AGACAAGGGCATCATCATCGG 102 NM_001031779.2 Reverse: GGTTTACCAAGAAGGGAACGG caspase-9 Forward: AATGCCGATTTGGCTTACGT 195 XM_003127618.4 Reverse: CATTTGCTTGGCAGTCAGGTT GAPDH Forward: ATGGTGAAGGTCGGAGTGAAC 235 NM_001206359.1 Reverse: CTCGCTCCTGGAAGATGGT MUC1, mucin 1; MUC2, mucin 2; MUC4, mucin 4; BAX, B-cell lymphoma-2-associated X protein; BCL2, B-cell lymphoma-2; caspase-3, cysteinyl aspartate-specific proteinase-3; caspase-8, cysteinyl aspartate-specific proteinase-8; caspase-9, cysteinyl aspartate-specific proteinase-9; GAPDH, glyceraldehyde-3-phosphate dehydrogenase then, ground and filtered to form a cell suspension. The Enterocyte cell cycle analysis cells were carefully washed twice with ice-cold PBS and For enterocyte cell cycle analysis, duodenal, jejunal and suspended in the PBS at 1 × 10 cells/mL. After adding ileal epithelial cell suspensions were prepared, as de- 5 μL of PE Annexin V and 5 μL of 7-aminoactinomycin scribed above for apoptosis detection. A total 1 mL of D (7-AAD) to a 100-μL aliquot of the cell suspension, cell suspension was transferred to a 5-mL culture tube. the mixture was incubated at room temperature for After adding 1 mL of 0.25% Triton X-100, the mixture 15 min in a dark room. Afterwards, 400 μL of Annexin was incubated at 4 °C for 10 min, and the cells washed V Binding Buffer (1×) was added, and the apoptotic cells with PBS. Next, 5 μL of 7-AAD was added to 100 μLof were examined by flow cytometry (CytoFlex, Beckman Coulter, Inc., Brea, CA, USA) within 1 h. Table 3 Effects of alginate oligosaccharide on the growth performance of weaned pigs throughout the entire experimental period c b Item Treatment P- value CON AOS Initial BW, kg 6.20 ± 0.09 6.21 ± 0.08 0.973 ** Final BW, kg 8.73 ± 0.16 9.46 ± 0.20 0.009 D1−14 ** ADG, g/d 180.36 ± 9.70 232.44 ± 13.51 0.005 ADFI, g/d 253.12 ± 11.75 311.61 ± 19.64 0.018 Fig. 1 Effects of alginate oligosaccharide on the serum D-xylose concentration of weaned pigs. Values are means (8 pigs/treatment), G:F 0.72 ± 0.02 0.75 ± 0.02 0.213 with standard errors represented by vertical bars. P < 0.05 (indicates * ** P < 0.05 versus the CON group. P < 0.01 versus the CON group that the serum D-xylose concentration is significantly higher in the Values are the means of 12 replicates per treatment AOS group than CON group). CON, control (a corn-soybean basal CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the diet); AOS, alginate oligosaccharide (the basal diet supplemented basal diet supplemented with 100 mg/kg alginate oligosaccharide) BW, body weight; ADG, average daily body weight gain; ADFI, average daily with 100 mg/kg alginate oligosaccharide) feed intake; G:F, the gain-to-feed ratio Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 5 of 12 Fig. 2 Histological evaluation of the small intestinal tissues after exposure to alginate oligosaccharide (H&E; × 100). CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the basal diet supplemented with 100 mg/kg alginate oligosaccharide). Scale bar is 100 μm cell suspension and incubated at 4 °C for 30 min in the and purchased from Sangon Biotech Co., Ltd. (Shanghai, dark. Finally, 400 μL of PBS was added. The cell cycle China), as depicted in Table 2. All qPCR reactions were distribution was assayed using a CytoFlex flow cytometer performed in triplicate on a QuanStudio™ 6 Flex (Beckman Coulter, Inc) within 45 min and analysed by Real-Time PCR System (Applied Biosystems), using ModFit LT 5.0 (Verity Software House, Topsham, ME, SYBR® Premix Ex Taq™ II (Tli RNaseH Plus) (Takara Bio- USA) [28]. The proliferating index (%) was calculated by technology Co., Ltd). Amplification was performed in a SþðG þMÞ final volume of 10 μL, which consisted of 5 μL of SYBR the formula × 100. ðG =G ÞþSþðG þMÞ 0 1 2 Premix Ex Taq II (Tli RNaseH Plus, 2×), 0.2 μL ROX Total RNA isolation and reverse transcription Table 4 Effects of alginate oligosaccharide on the intestinal mucosal morphology of weaned pigs Frozen duodenal, jejunal and ileal samples (about 0.1 g), respectively, were pulverised in liquid nitrogen and sub- Item Treatment P-value sequently homogenised in 1 mL of RNAiso Plus (Takara CON AOS Biotechnology Co., Ltd., Dalian, China) to extract total Duodenum RNA, according to the manufacturer’s instructions. The Villus height, μm 407.63 ± 11.36 457.88 ± 17.07 0.028 concentration and quality of total RNA were assessed Villus width, μm 132.26 ± 5.62 136.98 ± 7.61 0.626 using a spectrophotometer (NanoDrop 2000, Thermo Crypt depth, μm 224.74 ± 4.17 226.91 ± 8.58 0.823 Fisher Scientific, Inc., Waltham, MA, USA), considering Villus surface area, mm 0.17 ± 0.01 0.20 ± 0.01 0.054 the high-quality absorbance ratio (260/280 nm) being within 1.8 and 2.0, and the integrity of total RNA was Villus height:Crypt depth 1.81 ± 0.03 2.03 ± 0.08 0.030 checked by electrophoresis on a 1% agarose gel. Next, a Jejunum volume equivalent to 1 μg total RNA of each duodenal, ** Villus height, μm 408.75 ± 10.49 456.94 ± 12.07 0.009 jejunal and ileal sample, respectively, was used to synthe- Villus width, μm 109.22 ± 3.61 114.36 ± 5.18 0.429 sise cDNA, based on the protocol of PrimeScript™ RT Crypt depth, μm 194.80 ± 1.95 189.25 ± 2.43 0.096 reagent kit with gDNA Eraser (Takara Biotechnology 2 * Villus surface area, mm 0.14 ± 0.01 0.16 ± 0.01 0.031 Co., Ltd). The synthesis was achieved in two steps: 37 °C ** for 15 min, followed by 85 °C for 5 s. Villus height:Crypt depth 2.10 ± 0.06 2.41 ± 0.04 < 0.001 Ileum qPCR Villus height, μm 334.83 ± 2.86 351.34 ± 7.73 0.077 Mucin 1 (MUC1), MUC2, MUC4, B-cell Villus width, μm 113.17 ± 5.19 123.39 ± 5.07 0.180 lymphoma-2-associated X protein (BAX), B-cell Crypt depth, μm 169.61 ± 5.19 174.41 ± 6.70 0.580 lymphoma-2 (BCL2), FAS, cysteinyl aspartate-specific Villus surface area, mm 0.12 ± 0.01 0.14 ± 0.01 0.120 proteinase-3 (caspase-3), caspase-8 and caspase-9 Villus height:Crypt depth 2.01 ± 0.05 2.04 ± 0.09 0.793 mRNA levels in intestinal mucosa were quantified using * ** P < 0.05 versus the CON group. P < 0.01 versus the CON group qPCR, as described by Wan et al. [29]. In brief, the spe- Values are the means of 8 replicates per treatment cific primers were designed using Primer Express 3.0 b CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the software (Applied Biosystems, Foster City, CA, USA) basal diet supplemented with 100 mg/kg alginate oligosaccharide) Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 6 of 12 Table 5 Effects of alginate oligosaccharide on the intestinal the primers amplified with an efficiency of approxi- goblet and columnar cell counts of weaned pigs mately 100%, the relative gene expressions between b -ΔΔCt Item Treatment P-value the two groups were calculated, based on the 2 method [30]. CON AOS Duodenum (number/villus) Statistical analysis Goblet cells 8.69 ± 0.26 10.03 ± 0.43 0.018 All data were analysed by a Student’s t-test using SAS Columnar cells 71.94 ± 3.10 75.09 ± 3.53 0.514 9.0 (SAS Inst., Inc., Cary, NC, USA). Each pig served as Jejunum (number/villus) a statistical unit. Data are shown as the mean ± standard ** Goblet cells 7.31 ± 0.34 9.79 ± 0.23 < 0.001 error. P < 0.05 was considered significant when used to Columnar cells 70.25 ± 1.57 73.55 ± 1.51 0.153 compare the differences between the CON group and the AOS group. Ileum (number/villus) Goblet cells 11.33 ± 0.79 11.60 ± 0.37 0.758 Results Columnar cells 78.20 ± 1.77 81.91 ± 2.40 0.233 Growth performance * ** P < 0.05 versus the CON group. P < 0.01 versus the CON group Although AOS addition did not have a significant effect Values are the means of 8 replicates per treatment CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the (P > 0.05) on G:F, the ADG and ADFI were elevated (P < basal diet supplemented with 100 mg/kg alginate oligosaccharide) 0.05) by supplemental AOS throughout the entire ex- perimental period (Table 3). Reference Dye II (50×), 0.4 μL forward primer (10 μmol/ L), 0.4 μL reverse primer (10 μmol/L), 1 μL cDNA and Serum D-xylose concentration 3 μL diethylpyrocarbonate-treated water, under the Fig. 1 reveals the effects of AOS supplementation on the following cycling conditions: 95 °C for 30 s, followed serum D-xylose level in weaned pigs. The data showed that by 40 cycles: at 95 °C for 5 s and 60 °C for 34 s. the pigs in the AOS group had a higher (P < 0.05) serum After the amplification phase, a melt curve analysis D-xylose concentration compared to the CON group. was performed at 95 °C for 15 s, 60 °C for 1 min and 95 °C for 15 s, to confirm the specificity of the amp- Intestinal architecture lification reaction. Porcine glyceraldehyde-3-phosphate H&E staining of the small intestine tissues after expos- dehydrogenase (GAPDH) gene was chosen as the ure to AOS indicated that AOS supplementation caused housekeeping gene, to normalise the expression levels duodenal and jejunal architecture alternations but failed of the target genes. Amplification efficiencies were to change the ileal structure (Fig. 2). calculated from the specific gene standard curves that Next, the specific duodenal, jejunal and ileal morpho- were generated from 10-fold serial dilutions, logical parameters for the two groups were calculated quantifying six concentrations. After verification that (Table 4). Dietary AOS inclusion resulted in a significant Fig. 3 Effects of alginate oligosaccharide on the sIgA content in the duodenum (a), jejunum (b) and ileum (c) of weaned pigs (immunohistochemistry; × 400). Values are means (8 pigs/treatment), with standard errors represented by vertical bars. P < 0.05 (indicates that the sIgA content is significantly higher in the AOS group than CON group). CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the basal diet supplemented with 100 mg/kg alginate oligosaccharide). sIgA, secretory immunoglobulin A. Scale bar is 40 μm Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 7 of 12 Fig. 4 Percentage of apoptotic cells in the small intestine of weaned pigs fed diets containing or lacking alginate oligosaccharide. Frames were divided into four quadrants: Q2–1 represents necrotic cells; Q2–2 represents late-stage apoptotic cells; Q2–3 represents normal cells; Q2–4 represents early-stage apoptotic cells. CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the basal diet supplemented with 100 mg/kg alginate oligosaccharide). 7-AAD, 7-aminoactinomycin D increase (P < 0.05) in the villus height and the villus percentage, in the jejunal epithelium. Furthermore, there height-to-crypt depth ratio in both, the duodenum and je- were no marked differences (P> 0.05) in the duodenal junum, as well as the jejunal villus surface area. Moreover, and ileal epithelial cell apoptotic percentages between there were no significant differences (P > 0.05) in the ileal the AOS and CON groups. morphological parameters between the two treatments. Cell cycle distribution Goblet and columnar cell counts Fig. 5 and Table 7 demonstrate that AOS supplementa- A summary of the goblet and columnar cell counts after tion decreased (P < 0.05) the proportion of G /G phase 0 1 AOS supplementation is provided in Table 5. AOS sup- plementation did not affect (P > 0.05) the columnar cell Table 6 Effects of alginate oligosaccharide on the enterocyte counts but increased (P < 0.05) the goblet cell counts in apoptosis of weaned pigs the duodenum and jejunum. There was no impact (P > Item Treatment P-value 0.05) on the ileal goblet and columnar cell counts by CON AOS AOS ingestion. Duodenum, % Early-stage apoptotic cells 2.94 ± 0.31 2.98 ± 0.22 0.909 sIgA content Late-stage apoptotic cells 9.31 ± 1.18 5.92 ± 0.46 0.055 Fig. 3 presents the mean optical density of intestinal Total apoptotic cells 12.25 ± 1.32 8.90 ± 0.61 0.083 sIgA in the CON and AOS groups. Interestingly, the je- Jejunum, % junal mean optical density of sIgA was higher (P < 0.05) Early-stage apoptotic cells 10.98 ± 0.99 6.31 ± 0.68 0.018 in the AOS group than CON group, whereas the duo- Late-stage apoptotic cells 15.70 ± 0.85 10.86 ± 1.02 0.022 denal and ileal mean optical densities of sIgA were not ** Total apoptotic cells 26.68 ± 0.61 17.17 ± 0.35 < 0.001 affected (P > 0.05) by AOS supplementation. Ileum, % Early-stage apoptotic cells 3.83 ± 0.46 2.93 ± 0.34 0.149 Apoptotic percentage Late-stage apoptotic cells 1.14 ± 0.18 1.03 ± 0.11 0.618 The impacts of AOS on the intestinal epithelial cell apoptosis are demonstrated in Fig. 4 and Table 6. Com- Total apoptotic cells 4.97 ± 0.42 3.96 ± 0.32 0.093 * ** pared to the control group, AOS supplementation de- P < 0.05 versus the CON group. P < 0.01 versus the CON group Values are the means of 8 replicates per treatment creased (P < 0.05) the early- and late-stage apoptotic cell CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the percentages, as well as the total apoptotic cells basal diet supplemented with 100 mg/kg alginate oligosaccharide) Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 8 of 12 cells but increased (P < 0.05) the ratio of S phase cells, as Discussion well as the proliferating index, in the jejunal epithelium. Compromising alterations in intestinal architecture, such Furthermore, the duodenal and ileal cell cycle distribu- as villus atrophy and crypt hyperplasia, are commonly tions did not markedly change (P> 0.05) after AOS encountered in post-weaning piglets [31, 32]. However, a supplementation. decrease in the villus height-to-crypt depth ratio or a re- duced villus surface area is considered deleterious for di- gestion and absorption and could lead to retarded Mucins gene expressions growth in post-weaning piglets [33, 34]. Consequently, According to Fig. 6, pigs supplemented with AOS had maintaining the normal intestinal architecture and func- an increase (P < 0.05) in mucin 2 (MUC2) transcrip- tion is essential for growth and development in piglets tion in the duodenal and ileal mucosae, but not after weaning [35]. It is therefore noteworthy that an in- (P> 0.05) in the ileal mucosa. Besides, no effects creased villus height-to-crypt depth ratio in the duode- (P> 0.05) were detected on the MUC1 and MUC4 num and jejunum, as well as an increased villus surface transcriptions in all of the three intestinal mucosae area in the jejunum, was seen in AOS-supplemented after AOS ingestion. pigs. These observations support the notion that AOS inclusion in the diet can change the intestinal morpho- Apoptosis-related genes expression logical structure, and thereby promote the intestinal The transcriptional levels of apoptosis-related genes in digestion-absorption function in piglets after weaning the small intestine are illustrated in Fig. 7. Compared to [36]. Meanwhile, the increased entry of orally admi- the CON group, AOS ingestion decreased (P < 0.05) the nistered D-xylose into the blood after AOS ingestion pro-apoptotic factor BAX, caspase-3 and caspase-9 further corroborates the aforementioned view [37]. mRNA abundances and increased (P < 0.05) the These findings are sufficient to suggest that the anti-apoptotic factor BCL2 mRNA abundance in the je- growth-promoting effects of AOS on weaned pigs can junal mucosa, but not (P> 0.05) in the duodenal and be partially attributable to the improved intestinal ileal mucosa. However, no difference (P> 0.05) was ob- morphology and function. served in the FAS and caspase-8 mRNA abundances There is plentiful of evidence that the early weaning among the three intestinal mucosae, after AOS process is correlated with impaired intestinal barrier supplementation. function in piglets [38, 39]. Interestingly, dietary Fig. 5 DNA histogram of the cell cycle in the small intestinal epithelium of weaned pigs fed diets containing or lacking alginate oligosaccharide. The first peak in the DNA histogram of the small intestinal epithelium cell cycle is in G /G phase, the second peak is in G + M phase, and S 0 1 2 phase lies between these two peaks. CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the basal diet supplemented with 100 mg/kg alginate oligosaccharide). 7-AAD, 7-aminoactinomycin D Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 9 of 12 Table 7 Effects of alginate oligosaccharide on the enterocyte the mucus layer in the intestine, providing an intestinal proliferation of weaned pigs chemical barrier function [44–46]. In the current study, Item Treatment P-value more goblet cells in the duodenum and jejunum were noticed after AOS addition, accompanied by an CON AOS up-regulated MUC2 transcriptional level in the duode- Duodenum, % num and jejunum, indicating that AOS supplementation G /G phase cells 75.15 ± 1.41 70.65 ± 1.37 0.051 0 1 also improved the intestinal chemical barrier function in S phase cells 18.71 ± 1.25 22.05 ± 0.78 0.053 weaned pigs. Together, these results revealed that AOS G + M phase cells 6.02 ± 1.05 6.54 ± 0.72 0.698 is conducive for repairing weaning-associated intestinal Proliferating index 24.77 ± 1.39 28.81 ± 1.28 0.064 barrier dysfunction in piglets and then possibly im- Jejunum, % proved growth performance. Apoptosis is a form of physiological cell death, import- G /G phase cells 75.93 ± 1.81 70.42 ± 0.78 0.023 0 1 ant in controlling the epithelial turnover in the intestinal S phase cells 16.66 ± 1.37 21.88 ± 0.87 0.012 mucosa. However, dysregulated or excessive apoptosis G + M phase cells 5.98 ± 0.74 7.62 ± 0.55 0.112 results in severe intestinal pathology [47]. A recent re- ** Proliferating index 22.99 ± 1.51 29.53 ± 0.79 0.005 search certified that weaning could increase enterocyte Ileum, % apoptosis in piglets [48]. Here, we noted that apoptosis G /G phase cells 73.57 ± 2.04 68.74 ± 1.98 0.128 was less prevalent in the jejunal epithelial cells in the 0 1 AOS group than control group, suggesting that AOS S phase cells 17.78 ± 0.90 21.64 ± 1.43 0.052 may have a protective influence against enterocyte apop- G + M phase cells 8.10 ± 1.05 9.13 ± 1.11 0.521 tosis promoted by weaning of piglets. In addition to in- Proliferating index 26.04 ± 1.90 30.89 ± 2.27 0.140 ducing enterocyte apoptosis, weaning also inhibits * ** P < 0.05 versus the CON group. P < 0.01 versus the CON group intestinal epithelial cell proliferation in piglets [49]. Values are the means of 8 replicates per treatment CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the Here, we identified that AOS supplementation increased basal diet supplemented with 100 mg/kg alginate oligosaccharide) jejunal epithelial cell proliferation, through promoting the transition from G /G to S phase of the cell cycle. 0 1 supplementation with some oligosaccharides provides a As such, it was confirmed that AOS could alleviate the promising approach to improve the intestinal barrier elevated apoptosis and depressed proliferation of intes- function in weaned pigs [40, 41]. Therefore, we expected tinal epithelial cells in piglets caused by weaning and that AOS would have benefits on intestinal barrier func- consequently mitigate weaning-induced intestinal struc- tion when administered to weaned pigs. In the present tural injury. So far, the molecular mechanisms by which study, AOS supplementation increased the jejunal muco- AOS inhibits enterocyte apoptosis in weaned pigs re- sal sIgA content, suggesting that dietary inclusion of main unclear. Therefore, we studied the effects of AOS AOS could enhance the intestinal immune barrier func- addition in the diet, on signalling molecules involved in tion in weaned pigs [42, 43]. Goblet cells are specialised enterocyte apoptosis in weaned pigs. cells found along the crypt–villus axis of the small intes- It is well-known that the intrinsic (mitochondrial path- tine that biosynthesis, assemble and secrete mucins (in- way) and extrinsic (cytoplasmic pathway) pathways are cluding MUC1, MUC2 and MUC4), which contribute to two major apoptotic routes [50]. The intrinsic pathway Fig. 6 Relative mRNA abundances of MUC1 (a), MUC2 (b) and MUC4 (c) in the small intestine of weaned pigs fed diets containing or lacking * ** alginate oligosaccharide. Values are means (8 pigs/treatment), with standard errors represented by vertical bars. P < 0.05 or P < 0.01 (indicates that the gene mRNA levels between the AOS and CON groups differ significantly). CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the basal diet supplemented with 100 mg/kg alginate oligosaccharide). MUC1, mucin 1; MUC2, mucin 2; MUC4, mucin 4 Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 10 of 12 Fig. 7 Relative mRNA abundances of BAX (a), BCL2 (b), FAS (c), caspase-3 (d), caspase-8 (e) and caspase-9 (f) in the small intestine of weaned pigs fed diets containing or lacking alginate oligosaccharide. Values are means (8 pigs/treatment), with standard errors represented by vertical bars. P ** <0.05 or P < 0.01 (indicates that the gene mRNA levels between the AOS and CON groups differ significantly). CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the basal diet supplemented with 100 mg/kg alginate oligosaccharide). BAX, B-cell lymphoma-2-associated X protein; BCL2, B-cell lymphoma-2; caspase-3, cysteinyl aspartate-specific proteinase-3; caspase-8, cysteinyl aspartate-specific proteinase-8; caspase-9, cysteinyl aspartate-specific proteinase-9 is mitochondria-mediated and mainly regulated by the apoptosis in weaned pigs. Furthermore, these changes BCL2 family [51, 52], whereas the extrinsic pathway is were accompanied by an enhanced growth performance triggered through the Fas death receptor, a member of in weaned pigs. Our observations provide a strong scien- the tumour necrosis factor receptor superfamily [53]. tific basis for AOS as an alternative to the use of anti- Both pathways converge to a final common path involv- biotic growth promoters in swine production and also ing the activation of a cascade of proteases called cas- imply AOS has potential application in clinical nutrition pases that cleave regulatory and structural molecules, to prevent intestinal disruptions. culminating in the death of the cell [54, 55]. To illustrate Abbreviations the mechanisms underlying the suppression effects of 7-AAD: 7-aminoactinomycin D; ADFI: Average daily feed intake; AOS on weaning-induced intestinal epithelial cell apop- ADG: Average daily body weight gain; AOS: Alginate oligosaccharide (the basal diet supplemented with 100 mg/kg alginate oligosaccharide); BAX: B- tosis in piglets, the apoptosis-related gene transcriptional cell lymphoma-2-associated X protein; BCL2: B-cell lymphoma-2; BW: Body levels, including BAX, BCL2, FAS, caspase-3, caspase-8 weight; CON: Control (a corn-soybean basal diet); caspase-3: Cysteinyl and caspase-9, were determined. The present study evi- aspartate-specific proteinase-3; caspase-8: Cysteinyl aspartate-specific proteinase-8; caspase-9: Cysteinyl aspartate-specific proteinase-9; DAB: 3,3′- denced that AOS ingestion decreased the pro-apoptotic diaminobenzidine; G: α-L-guluronic acid; GAPDH: glyceraldehyde-3- factor BAX, caspase-3 and caspase-9 mRNA abundances phosphate dehydrogenase; G:F: The gain-to-feed ratio; M: β-D-mannuronic and increased the anti-apoptotic factor BCL2 mRNA acid; MUC1: Mucin 1; MUC2: Mucin 2; MUC4: Mucin 4; PBS: phosphate buffered saline; qPCR: quantitative real-time polymerase chain reaction; abundance in the jejunum. Thus, AOS inhibition of intes- sIgA: Secretory immunoglobulin A tinal epithelial cell death in weaned pigs might be inclined to decrease mitochondria-dependent apoptosis. Our find- Acknowledgements We thank Anran Jiao, Fei Jiang and Huifen Wang for their diligent ings explained the positive role of AOS in rendering the contribution to the animal experiments. We also express our gratitude to intestinal epithelial cells resistant to weaning-induced Zhengqiang Yu for his excellent technical assistance in enterocyte apoptosis apoptosis in piglets. and cell cycle detection by flow cytometry. Funding Conclusions This work was supported by the Special Fund for Agro-scientific Research in To summarise, we indicated that supplementing the diet the Public Interest (201403047). with 100 mg/kg AOS improved both the intestinal Availability of data and materials morphology and barrier function and inhibited the en- All data generated or analysed during this study are available from the terocyte death by reducing mitochondria-dependent corresponding author on reasonable request. Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 11 of 12 Authors’ contributions alginate in lipopolysaccharide-activated murine macrophage RAW 264.7 Jun He designed and supervised the experiments. Jin Wan and Jiao Zhang cells. J Agric Food Chem. 2015;63:160–8. carried out the experiments and performed statistical data analysis. Daiwen 19. Yang Y, Ma ZH, Yang GK, Wan J, Li GJ, Du LJ, et al. Alginate oligosaccharide Chen, Bing Yu, Xiangbing Mao, Ping Zheng, Jie Yu and Junqiu Luo gave indirectly affects toll-like receptor signaling via the inhibition of microrna- tremendous help in conducting experiments. Jin Wan was also in charge of 29b in aneurysm patients after endovascular aortic repair. Drug Des Devel preparing the manuscript. All authors have read and approved the final Ther. 2017;11:2565–79. manuscript. 20. Wan J, Zhang J, Chen DW, Yu B, He J. Effects of alginate oligosaccharide on the growth performance, antioxidant capacity and intestinal digestion-absorption function in weaned pigs. Anim Feed Sci Technol. 2017;234:118–27. Ethics approval 21. National Research Council. Nutrient requirements of swine. 11th ed. All procedures in the present study involving animals were approved by the Washington, DC: National Academics Press; 2012. Animal Care and Use Committee of Sichuan Agricultural University 22. Hou YQ, Wang L, Zhang W, Yang ZG, Ding BY, Zhu HL, et al. Protective (Chengdu, China). effects of N-acetylcysteine on intestinal functions of piglets challenged with lipopolysaccharide. Amino Acids. 2012;43:1233–42. Competing interests 23. Wan J, Li Y, Chen DW, Yu B, Chen G, Zheng P, et al. Recombinant plectasin The authors declare that they have no competing interests. elicits similar improvements in the performance and intestinal mucosa growth and activity in weaned pigs as an antibiotic. Anim Feed Sci Technol. Received: 21 January 2018 Accepted: 6 June 2018 2016;211:216–26. 24. Chen H, Mao XB, He J, Yu B, Huang ZQ, Yu J, et al. Dietary fibre affects intestinal mucosal barrier function and regulates intestinal bacteria in weaning piglets. Br J Nutr. 2013;110:1837–48. References 25. Fang TT, Liu GM, Cao W, Wu XJ, Jia G, Zhao H, et al. Spermine: new insights 1. Kim JC, Hansen CF, Mullan BP, Pluske JR. Nutrition and pathology of weaner into the intestinal development and serum antioxidant status of suckling pigs: nutritional strategies to support barrier function in the gastrointestinal piglets. RSC Adv. 2016;6:31323–35. tract. Anim Feed Sci Technol. 2012;173:3–16. 26. Cao W, Liu GM, Fang TT, Wu XJ, Jia G, Zhao H, et al. Effects of spermine on 2. Smith F, Clark JE, Overman BL, Tozel CC, Huang JH, Rivier JE, et al. Early the morphology, digestive enzyme activities, and antioxidant status of weaning stress impairs development of mucosal barrier function in the jejunum in suckling rats. RSC Adv. 2015;5:76607–14. porcine intestine. Am J Physiol Gastrointest Liver Physiol. 2010;298:G352–G63. 27. Yu ZQ, Wang FY, Liang N, Wang CH, Peng X, Fang J, et al. Effect of 3. Boudry G, Péron V, Le Huërou-Luron I, Lallès JP, Sève B. Weaning induces selenium supplementation on apoptosis and cell cycle blockage of renal both transient and long-lasting modifications of absorptive, secretory, and cells in broilers fed a diet containing aflatoxin B1. Biol Trace Elem Res. 2015; barrier properties of piglet intestine. J Nutr. 2004;134:2256–62. 168:242–51. 4. Hu CH, Song ZH, Xiao K, Song J, Jiao LF, Ke YL. Zinc oxide influences 28. Haag D, Goerttler K, Tschahargane C. The proliferative index (PI) of human intestinal integrity, the expressions of genes associated with inflammation breast cancer as obtained by flow cytometry. Pathology-Research and and TLR4-myeloid differentiation factor 88 signaling pathways in weanling Practice. 1984;178:315–22. pigs. Innate Immun. 2014;20:478–86. 29. Wan J, Jiang F, Zhang J, Xu QS, Chen DW, Yu B, et al. Amniotic fluid 5. Yin J, Wu MM, Xiao H, Ren WK, Duan JL, Yang G, et al. Development of an metabolomics and biochemistry analysis provides novel insights into the antioxidant system after early weaning in piglets. J Anim Sci. 2014;92:612–9. diet-regulated foetal growth in a pig model. Sci Rep. 2017;7:44782. 6. Zhu LH, Zhao KL, Chen XL, Xu JX. Impact of weaning and an antioxidant 30. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using blend on intestinal barrier function and antioxidant status in pigs. J Anim -ΔΔCt real-time quantitative PCR and the 2 method. Methods. 2001;25: Sci. 2012;90:2581–9. 402–8. 7. Yang HS, Xiong X, Wang XC, Li TJ, Yin YL. Effects of weaning on intestinal 31. Montagne L, Boudry G, Favier C, Le Huërou-Luron I, Lallès JP, Sève B. Main crypt epithelial cells in piglets. Sci Rep. 2016;6:36939. intestinal markers associated with the changes in gut architecture and 8. Wan J, Li Y, Chen DW, Yu B, Zheng P, Mao XB, et al. Expression of a function in piglets after weaning. Br J Nutr. 2007;97:45–57. tandemly arrayed plectasin gene from Pseudoplectania nigrella in Pichia 32. Hu CH, Xiao K, Luan ZS, Song J. Early weaning increases intestinal pastoris and its antimicrobial activity. J Microbiol Biotechnol. 2016;26:461–8. permeability, alters expression of cytokine and tight junction proteins, and 9. Yin XX, Song FJ, Gong YH, Tu XC, Wang YX, Cao SY, et al. A systematic review activates mitogen-activated protein kinases in pigs. J Anim Sci. 2013;91: of antibiotic utilization in China. J Antimicrob Chemother. 2013;68:2445–52. 1094–101. 10. Gill EE, Franco OL, Hancock REW. Antibiotic adjuvants: diverse strategies for 33. Montagne L, Pluske JR, Hampson DJ. A review of interactions between controlling drug-resistant pathogens. Chem Biol Drug Des. 2015;85:56–78. dietary fibre and the intestinal mucosa, and their consequences on 11. Liu P, Piao XS, Kim SW, Wang L, Shen YB, Lee HS, et al. Effects of chito- digestive health in young non-ruminant animals. Anim Feed Sci Technol. oligosaccharide supplementation on the growth performance, nutrient 2003;108:95–117. digestibility, intestinal morphology, and fecal shedding of and in weaning 34. Wijtten PJ, van der Meulen J, Verstegen MW. Intestinal barrier function and pigs. J Anim Sci. 2008;86:2609–18. absorption in pigs after weaning: a review. Br J Nutr. 2011;105:967–81. 12. Wu Y, Pan L, Shang QH, Ma XK, Long SF, Xu YT, et al. Effects of isomalto- 35. Pluske JR, Hampson DJ, Williams IH. Factors influencing the structure and oligosaccharides as potential prebiotics on performance, immune function and function of the small intestine in the weaned pig: a review. Livest Prod Sci. gut microbiota in weaned pigs. Anim Feed Sci Technol. 2017;230:126–35. 1997;51:215–36. 13. Ruvinov E, Cohen S. Alginate biomaterial for the treatment of myocardial 36. Wan J, Jiang F, Xu QS, Chen DW, He J. Alginic acid oligosaccharide infarction: progress, translational strategies, and clinical outlook: from ocean accelerates weaned pig growth through regulating antioxidant capacity, algae to patient bedside. Adv Drug Deliver Rev. 2016;96:54–76. immunity and intestinal development. RSC Adv. 2016;6:87026–35. 14. Lu JJ, Yang H, Hao J, Wu CL, Liu L, Xu NY, et al. Impact of hydrolysis 37. Hou YQ, Wang L, Ding BY, Liu YL, Zhu HL, Liu J, et al. Dietary α- conditions on the detection of mannuronic to guluronic acid ratio in ketoglutarate supplementation ameliorates intestinal injury in alginate and its derivatives. Carbohydr Polym. 2015;122:180–8. lipopolysaccharide-challenged piglets. Amino Acids. 2010;39:555–64. 15. Guo JJ, Ma LL, Shi HT, Zhu JB, Wu J, Ding ZW, et al. Alginate oligosaccharide 38. Moeser AJ, Ryan KA, Nighot PK, Blikslager AT. Gastrointestinal dysfunction prevents acute doxorubicin cardiotoxicity by suppressing oxidative stress and induced by early weaning is attenuated by delayed weaning and mast cell endoplasmic reticulum-mediated apoptosis. Mar Drugs. 2016;14:231. blockade in pigs. Am J Physiol Gastrointest Liver Physiol. 2007;293:G413–G1. 16. Wang P, Jiang XL, Jiang YH, Hu XK, Mou HJ, Li M, et al. In vitro antioxidative activities of three marine oligosaccharides. Nat Prod Res. 2007;21:646–54. 39. McLamb BL, Gibson AJ, Overman EL, Stahl C, Moeser AJ. Early weaning 17. Tusi SK, Khalaj L, Ashabi G, Kiaei M, Khodagholi F. Alginate oligosaccharide stress in pigs impairs innate mucosal immune responses to enterotoxigenic protects against endoplasmic reticulum- and mitochondrial-mediated E coli challenge and exacerbates intestinal injury and clinical disease. PLoS apoptotic cell death and oxidative stress. Biomaterials. 2011;32:5438–58. One. 2013;8:e59838. 18. Zhou R, Shi XY, Gao Y, Cai N, Jiang ZD, Xu X. Anti-inflammatory activity of 40. Wan J, Jiang F, Xu QS, Chen DW, Yu B, Huang ZQ, et al. New insights into guluronate oligosaccharides obtained by oxidative degradation from the role of chitosan oligosaccharide in enhancing growth performance, Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 12 of 12 antioxidant capacity, immunity and intestinal development of weaned pigs. RSC Adv. 2017;7:9669–79. 41. Yang CM, Ferket PR, Hong QH, Zhou J, Cao GT, Zhou L, et al. Effect of chito- oligosaccharide on growth performance, intestinal barrier function, intestinal morphology and cecal microflora in weaned pigs. J Anim Sci. 2012;90:2671–6. 42. Corthésy B. Role of secretory immunoglobulin a and secretory component in the protection of mucosal surfaces. Future Microbiol. 2010;5:817–29. 43. Keren DF. Intestinal mucosal immune defense mechanisms. Am J Surg Pathol. 1988;12:100–5. 44. Lamont JT. Mucus: the front line of intestinal mucosal defense. Ann N Y Acad Sci. 1992;664:190–201. 45. McCauley HA, Guasch G. Three cheers for the goblet cell: maintaining homeostasis in mucosal epithelia. Trends Mol Med. 2015;21:492–503. 46. Linden SK, Sutton P, Karlsson NG, Korolik V, McGuckin MA. Mucins in the mucosal barrier to infection. Mucosal Immunol. 2008;1:183–97. 47. Günther C, Neumann H, Neurath MF, Becker C. Apoptosis, necrosis and necroptosis: cell death regulation in the intestinal epithelium. Gut. 2013;62:1062–71. 48. Zhu LH, Cai X, Guo Q, Chen XL, Zhu SW, Xu JX. Effect of N-acetyl cysteine on enterocyte apoptosis and intracellular signalling pathways' response to oxidative stress in weaned piglets. Br J Nutr. 2013;110:1938–47. 49. Zhu LH, Xu JX, Zhu SW, Cai X, Yang SF, Chen XL, et al. Gene expression profiling analysis reveals weaning-induced cell cycle arrest and apoptosis in the small intestine of pigs. J Anim Sci. 2014;92:996–1006. 50. Ghobrial IM, Witzig TE, Adjei AA. Targeting apoptosis pathways in cancer therapy. CA Cancer J Clin. 2005;55:178–94. 51. Hockenbery D, Nuñez G, Milliman C, Schreiber RD, Korsmeyer SJ. Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature. 1990;348:334–6. 52. Reed JC, Miyashita T, Takayama S, Wang HG, Sato T, Krajewski S, et al. BCL-2 family proteins: regulators of cell death involved in the pathogenesis of cancer and resistance to therapy. J Cell Biochem. 1996;60:23–32. 53. Zapata JM, Pawlowski K, Haas E, Ware CF, Godzik A, Reed JC. A diverse family of proteins containing tumor necrosis factor receptor-associated factor domains. J Biol Chem. 2001;276:24242–52. 54. Elmore S. Apoptosis: a review of programmed cell death. Toxicol Pathol. 2007;35:495–516. 55. Riedl SJ, Shi Y. Molecular mechanisms of caspase regulation during apoptosis. Nat Rev Mol Cell Biol. 2004;5:897–907. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Animal Science and Biotechnology Springer Journals

Alginate oligosaccharide-induced intestinal morphology, barrier function and epithelium apoptosis modifications have beneficial effects on the growth performance of weaned pigs

Loading next page...
 
/lp/springer-journals/alginate-oligosaccharide-induced-intestinal-morphology-barrier-j5Unh1UQS4

References (57)

Publisher
Springer Journals
Copyright
Copyright © 2018 by The Author(s).
Subject
Life Sciences; Agriculture; Biotechnology; Food Science; Animal Genetics and Genomics; Animal Physiology
eISSN
2049-1891
DOI
10.1186/s40104-018-0273-x
Publisher site
See Article on Publisher Site

Abstract

Background: Alginate oligosaccharide (AOS), produced from alginate by alginate lyase-mediated depolymerisation, is a potential substitute for antibiotics and possesses growth-enhancing effects. Nevertheless, the mechanisms by which AOS regulates porcine growth remain to be elucidated. Therefore, we investigated the AOS-mediated changes in the growth performance of weaned pigs by determining the intestinal morphology, barrier function, as well as epithelium apoptosis. Methods: Twenty-four weaned pigs were distributed into two groups (n = 12) and received either a basal diet (control group) or the same diet supplemented with 100 mg/kg AOS. On d 15, D-xylose (0.1 g/kg body weight) was orally administrated to eight randomly selected pigs per treatment, and their serum and intestinal mucosa samples were collected 1 h later. Results: Our results showed that inclusion of AOS in the diet for 2 wk increased (P < 0.05) the average daily body weight gain in weaned pigs. Notably, AOS supplementation ameliorated the intestinal morphology and barrier function, as suggested by the enhanced (P < 0.05) intestinal villus height, secretory immunoglobulin A content and goblet cell counts. Compared to the control group, AOS ingestion both decreased (P < 0.05) the total apoptotic percentage and increased (P < 0.05) the proportion of S phase in the intestinal epithelial cells. Furthermore, AOS not only up-regulated (P < 0.05) the B-cell lymphoma-2 (BCL2) transcriptional level but also down-regulated (P <0.05) the B-cell lymphoma-2-associated X protein (BAX), cysteinyl aspartate-specific proteinase-3 (caspase-3)and caspase-9 transcriptional levels in the small intestine. Conclusions: In summary, this study provides evidence that supplemental AOS beneficially affects the growth performance of weaned pigs, which may result from the improved intestinal morphology and barrier function, as well as the inhibited enterocyte death, through reducing apoptosis via mitochondria-dependent apoptosis. Keywords: Alginate oligosaccharide, Barrier function, Cell apoptosis, Intestinal morphology, Weaned pigs * Correspondence: hejun8067@163.com Jin Wan and Jiao Zhang contributed equally to this work. Institute of Animal Nutrition, Sichuan Agricultural University, Chengdu 611130, Sichuan, People’s Republic of China © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 2 of 12 Background (6.21 ± 0.0 9) kg, were assigned to two treatments with Weaning is one of the most significant events in the life 12 replicates per treatment. The treatment groups in- of pigs as they are abruptly forced to adapt to nutri- cluding a control group (CON), in which pigs were fed a tional, immunological and psychological disruptions [1]. basal diet, and an AOS group, in which pigs were fed a The weaning transition of piglets is commonly accom- basal diet supplemented with 100 mg/kg AOS (provided panied by growth retardation and impaired intestinal by the Dalian Institute of Chemical Physics, Chinese barrier [2–4]. Studies have also indicated that weaning Academy of Sciences, Dalian, China). The basal diet was can disrupt the physiological oxidant and antioxidant formulated to meet or exceed the nutrient requirements equilibrium and lead to oxidative stress [5, 6], eventually recommended by the National Research Council inducing epithelium apoptosis and cell cycle arrest in (Table 1)[21]. During the 14-day experimental period, the small intestine of post-weaning piglets [7]. Over the all pigs were individually housed in metabolism cages past decades, antibiotic medication has proven an effect- (0.7 m × 1.5 m) in a temperature- (24−26 °C), humidity- ive preventative and treatment method, used worldwide (65% ± 5%) and light-controlled room and were given ad to treat these issues. However, the widespread use of an- libitum access to feed and water. tibiotics has led, at least in part, to bacterial resistance, resulting in the delayed administration of effective ther- apy, as well as morbidity and mortality in both humans and animals [8–10]. Hence, numerous antibiotic alterna- Table 1 Ingredients and nutrient composition of the basal diet tives have been investigated, among which oligosaccha- Ingredient Content, % Nutrient Content, % rides have attracted considerable research interest, due composition to their health benefits in weaned pigs [11, 12]. Corn (7.8% crude protein) 28.80 Digestible energy, 14.85 Alginate, a naturally occurring anionic polysaccharide MJ/kg that is extracted from marine brown algae, is composed Extruded corn (7.8% crude 26.00 Crude protein 19.35 protein) of two types of uronic acid monomers, distributed as blocks of 1,4-linked β-D-mannuronic acid (M) or Soybean meal (44.2% 11.00 Calcium 0.83 crude protein) α-L-guluronic acid (G), as well as heteropolymeric mixed sequences (M–G, usually alternating) [13, 14]. Alginate Extruded soybean 10.00 Total phosphorus 0.60 oligosaccharide (AOS), prepared by depolymerising al- Whey powder (low 7.00 Available 0.43 protein) phosphorus ginate, is a non-immunogenic, non-toxic, biodegradable polymer with reported multifarious biological properties Soybean protein 5.00 Lysine 1.37 concentrate [15], including anti-oxidation [16], anti-apoptotic [17], anti-inflammatory [18] and anti-tumour effects [19]. Fish meal (62.5% crude 4.00 Methionine 0.49 protein) These beneficial properties of AOS suggest it may be an Sucrose 4.00 Methionine + 0.76 effective dietary ingredient, yet the use of AOS as a food Cysteine supplement for humans or animals is contemporarily Soybean oil 1.50 Threonine 0.81 still in its infancy. Although emerging evidence identi- fied that AOS supplements favourably enhanced the Limestone 0.75 Tryptophan 0.22 growth performance in piglets after weaning [20], the Dicalcium phosphate 0.60 AOS mechanisms responsible for this benefit are poorly L-Lysine-HCl (78%) 0.40 understood. As such, further elucidation is meaningful NaCl 0.30 and essential. DL-Methionine 0.18 Accordingly, the present study was performed to ex- L-Threonine (98.5%) 0.10 plore the effects of AOS supplementation on the intestinal architecture, barrier function and epithelium apoptosis in Chloride choline 0.10 weaned pigs, aiming to provide partial theoretical evidence Tryptophan (98%) 0.02 for the mechanisms by which AOS enhances growth per- a Vitamin premix 0.05 formance of weaned pigs. It is anticipated that our find- Mineral premix 0.20 ings will pave the way for developing AOS as a functional Total 100 food for both humans and animals in the near future. The vitamin premix provided the following per kg of diets: 6,000 IU vitamin (V) A, 3,000 IU VD , 24 mg VE, 3 mg VK , 1.5 mg VB , 6 mg VB , 3 mg VB , 3 3 1 2 6 Methods 0.02 mg VB , 14 mg niacin, 15 mg pantothenic acid, 1.2 mg folic acid and 0.15 mg biotin Animal care and experimental design The mineral premix provided the following per kg of diets: 100 mg Fe, 6 mg Initially, 24 pigs (Duroc × Landrace × Yorkshire), Cu, 100 mg Zn, 4 mg Mn, 0.30 mg I and 0.35 mg Se weaned at 21 d and with an average body weight (BW) of Values are calculated composition Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 3 of 12 Growth performance assessment Afterwards, the goblet cell and columnar cell counts per At the start and end of the experiment, the pigs were in- villus were also assessed. Villus height was recorded as dividually weighed before feeding, and daily feed con- the distance from the tip of the villi to the villus-crypt sumption per pig was measured throughout the study. junction, and width was measured at half of the villus Growth performance indices, including average daily height [25]. Crypt depth was expressed as the invagi- body weight gain (ADG), average daily feed intake nated depth between adjacent villi. A total of 10 intact, (ADFI) and the gain-to-feed ratio (G:F), were well-oriented, crypt-villus units were analysed in tripli- subsequently determined for each group from the data cate per intestinal segment. The values obtained from 10 obtained. villi, in triplicate by each intestinal segment, were aver- aged. The villus height-to-crypt depth ratio was com- Sample collection puted from the measurements obtained above, and the On the morning of d 15, after overnight starvation, eight villus surface area (mm ) was calculated by multiplying pigs from each treatment were randomly selected and 2π(villus width/2) by the villus height [26]. orally infused with D-xylose at the dose of 0.1 g/kg BW [22, 23]. After infusion of D-xylose (1 h), blood samples Immunohistochemistry were collected by jugular vein puncture and placed in For immunohistochemistry, the paraformaldehyde-fixed 10-mL vacuum tubes (non-anticoagulant). The samples duodenal, jejunal and ileal samples were embedded in were centrifuged at 3,500×g, 4 °C for 15 min, to acquire paraffin and sectioned into 2 μm thickness, then col- serum, and stored at −20 °C, until measurement of lected on glass slides. After deparaffinisation and hydra- D-xylose concentration. tion, the sections were pre-treated with 3% H O in 2 2 After blood sampling, the same pigs were anaesthe- methanol at room temperature for 10 min, to quench tised with an intravenous injection of sodium pentobar- endogenous peroxidase activity and, then, heated in bital (200 mg/kg BW), and the tissues of the duodenum, 10 mmol/L citrate buffer (pH 6.0) to retrieve the anti- jejunum and ileum were immediately isolated [24]. Ap- gen. After several rinses in PBS, the sections were proximately 5-cm duodenal, jejunal and ileal middle seg- blocked with 10% goat serum at room temperature for ments were gently flushed with ice-cold phosphate 20 min, to eliminate non-specific antibody binding and buffered saline (PBS), followed by fixation in PBS for then incubated overnight at 4 °C with 1:200 dilution of flow cytometry or in 4% paraformaldehyde solution for rabbit anti-secretory immunoglobulin A (sIgA) antibody morphological and immunohistochemical analyses. Fi- (Beijing Biosynthesis Biotechnology Co., Ltd., Beijing, nally, the residual duodenal, jejunal and ileal segments China). After rinsing with PBS several times, the sections were scraped with a scalpel blade, and the collected mu- were incubated with biotinylated goat anti-rabbit IgG cosa stored at −80 °C for quantitative real-time polymer- secondary antibody (Beijing Zhongshan Golden Bridge ase chain reaction (qPCR) analysis. Biotechnology Co., Ltd., Beijing, China) at 37 °C for 30 min. After rinsing several times in PBS, immunode- Serum D-xylose determination tection was conducted, using 3,3′-diaminobenzidine Serum D-xylose was quantitated using a D-xylose assay (DAB) as the chromogen. The sections were counter- kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, stained with haematoxylin and mounted in neutral resin. China), by following the manufacturer’s protocols. The For each section in the Motic BA210 digital microscope absorbance of the reaction mixture was acquired spec- (Motic China Group Co., Ltd., Xiamen, China), five trophotometrically at 554 nm, using a multi-mode mi- fields of vision were randomly selected, with a fixed win- croplate reader (SpectraMax M2, Molecular Devices, dow area. The integrated optical density of sIgA in the Sunnyvale, CA, USA). D-Xylose concentration was pre- duodenal, jejunal and ileal mucosa was detected by using sented as milligrams per litre of serum (mg/L). Image-Pro Plus 6.0 image analysis system (Media Cyber- netics, Inc), and the sIgA protein expression was Histomorphological analysis and cell counting reflected by the mean value of the integrated optical One-cm long duodenal, jejunal and ileal samples were density. dehydrated through a graded series of ethanol and em- bedded in paraffin. Cross-sections of each sample were Enterocyte apoptosis detection prepared, stained with haematoxylin and eosin (H&E), Duodenal, jejunal and ileal epithelial cells were isolated, and then sealed with neutral resin. Ultrathin sections of to measure the proportion of apoptotic cells by flow cy- the duodenal, jejunal and ileal samples were examined tometry with a PE Annexin V Apoptosis Detection Kit I for villus height, villus width and crypt depth, using an (Becton, Dickinson and Company, BD Biosciences, San image processing and analysis system (Image-Pro Plus Jose, CA, USA) [27]. Briefly, the excised mucosal layer of 6.0, Media Cybernetics, Inc., Bethesda, MD, USA). the duodenum, jejunum and ileum were isolated, and Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 4 of 12 Table 2 Primer sequences for quantitative real-time polymerase chain reaction Gene Primer sequence (5′→3′) Size, bp Accession No. MUC1 Forward: GTGCCGCTGCCCACAACCTG 141 XM_001926883.4 Reverse: AGCCGGGTACCCCAGACCCA MUC2 Forward: GGTCATGCTGGAGCTGGACAGT 181 XM_013989745.1 Reverse: TGCCTCCTCGGGGTCGTCAC MUC4 Forward: GATGCCCTGGCCACAGAA 89 XM_001926442.1 Reverse: TGATTCAAGGTAGCATTCATTTGC BAX Forward: CTGACGGCAACTTCAACTGG 200 XM_003127290.4 Reverse: CGTCCCAAAGTAGGAGAGGA BCL2 Forward: AGCATGCGGCCTCTATTTGA 120 XM_003121700.2 Reverse: GGCCCGTGGACTTCACTTAT FAS Forward: TGATGCCCAAGTGACTGACC 103 NM_213839.1 Reverse: GCAGAATTGACCCTCACGAT caspase-3 Forward: GTGGGACTGAAGATGACA 190 NM_214131.1 Reverse: ACCCGAGTAAGAATGTG caspase-8 Forward: AGACAAGGGCATCATCATCGG 102 NM_001031779.2 Reverse: GGTTTACCAAGAAGGGAACGG caspase-9 Forward: AATGCCGATTTGGCTTACGT 195 XM_003127618.4 Reverse: CATTTGCTTGGCAGTCAGGTT GAPDH Forward: ATGGTGAAGGTCGGAGTGAAC 235 NM_001206359.1 Reverse: CTCGCTCCTGGAAGATGGT MUC1, mucin 1; MUC2, mucin 2; MUC4, mucin 4; BAX, B-cell lymphoma-2-associated X protein; BCL2, B-cell lymphoma-2; caspase-3, cysteinyl aspartate-specific proteinase-3; caspase-8, cysteinyl aspartate-specific proteinase-8; caspase-9, cysteinyl aspartate-specific proteinase-9; GAPDH, glyceraldehyde-3-phosphate dehydrogenase then, ground and filtered to form a cell suspension. The Enterocyte cell cycle analysis cells were carefully washed twice with ice-cold PBS and For enterocyte cell cycle analysis, duodenal, jejunal and suspended in the PBS at 1 × 10 cells/mL. After adding ileal epithelial cell suspensions were prepared, as de- 5 μL of PE Annexin V and 5 μL of 7-aminoactinomycin scribed above for apoptosis detection. A total 1 mL of D (7-AAD) to a 100-μL aliquot of the cell suspension, cell suspension was transferred to a 5-mL culture tube. the mixture was incubated at room temperature for After adding 1 mL of 0.25% Triton X-100, the mixture 15 min in a dark room. Afterwards, 400 μL of Annexin was incubated at 4 °C for 10 min, and the cells washed V Binding Buffer (1×) was added, and the apoptotic cells with PBS. Next, 5 μL of 7-AAD was added to 100 μLof were examined by flow cytometry (CytoFlex, Beckman Coulter, Inc., Brea, CA, USA) within 1 h. Table 3 Effects of alginate oligosaccharide on the growth performance of weaned pigs throughout the entire experimental period c b Item Treatment P- value CON AOS Initial BW, kg 6.20 ± 0.09 6.21 ± 0.08 0.973 ** Final BW, kg 8.73 ± 0.16 9.46 ± 0.20 0.009 D1−14 ** ADG, g/d 180.36 ± 9.70 232.44 ± 13.51 0.005 ADFI, g/d 253.12 ± 11.75 311.61 ± 19.64 0.018 Fig. 1 Effects of alginate oligosaccharide on the serum D-xylose concentration of weaned pigs. Values are means (8 pigs/treatment), G:F 0.72 ± 0.02 0.75 ± 0.02 0.213 with standard errors represented by vertical bars. P < 0.05 (indicates * ** P < 0.05 versus the CON group. P < 0.01 versus the CON group that the serum D-xylose concentration is significantly higher in the Values are the means of 12 replicates per treatment AOS group than CON group). CON, control (a corn-soybean basal CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the diet); AOS, alginate oligosaccharide (the basal diet supplemented basal diet supplemented with 100 mg/kg alginate oligosaccharide) BW, body weight; ADG, average daily body weight gain; ADFI, average daily with 100 mg/kg alginate oligosaccharide) feed intake; G:F, the gain-to-feed ratio Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 5 of 12 Fig. 2 Histological evaluation of the small intestinal tissues after exposure to alginate oligosaccharide (H&E; × 100). CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the basal diet supplemented with 100 mg/kg alginate oligosaccharide). Scale bar is 100 μm cell suspension and incubated at 4 °C for 30 min in the and purchased from Sangon Biotech Co., Ltd. (Shanghai, dark. Finally, 400 μL of PBS was added. The cell cycle China), as depicted in Table 2. All qPCR reactions were distribution was assayed using a CytoFlex flow cytometer performed in triplicate on a QuanStudio™ 6 Flex (Beckman Coulter, Inc) within 45 min and analysed by Real-Time PCR System (Applied Biosystems), using ModFit LT 5.0 (Verity Software House, Topsham, ME, SYBR® Premix Ex Taq™ II (Tli RNaseH Plus) (Takara Bio- USA) [28]. The proliferating index (%) was calculated by technology Co., Ltd). Amplification was performed in a SþðG þMÞ final volume of 10 μL, which consisted of 5 μL of SYBR the formula × 100. ðG =G ÞþSþðG þMÞ 0 1 2 Premix Ex Taq II (Tli RNaseH Plus, 2×), 0.2 μL ROX Total RNA isolation and reverse transcription Table 4 Effects of alginate oligosaccharide on the intestinal mucosal morphology of weaned pigs Frozen duodenal, jejunal and ileal samples (about 0.1 g), respectively, were pulverised in liquid nitrogen and sub- Item Treatment P-value sequently homogenised in 1 mL of RNAiso Plus (Takara CON AOS Biotechnology Co., Ltd., Dalian, China) to extract total Duodenum RNA, according to the manufacturer’s instructions. The Villus height, μm 407.63 ± 11.36 457.88 ± 17.07 0.028 concentration and quality of total RNA were assessed Villus width, μm 132.26 ± 5.62 136.98 ± 7.61 0.626 using a spectrophotometer (NanoDrop 2000, Thermo Crypt depth, μm 224.74 ± 4.17 226.91 ± 8.58 0.823 Fisher Scientific, Inc., Waltham, MA, USA), considering Villus surface area, mm 0.17 ± 0.01 0.20 ± 0.01 0.054 the high-quality absorbance ratio (260/280 nm) being within 1.8 and 2.0, and the integrity of total RNA was Villus height:Crypt depth 1.81 ± 0.03 2.03 ± 0.08 0.030 checked by electrophoresis on a 1% agarose gel. Next, a Jejunum volume equivalent to 1 μg total RNA of each duodenal, ** Villus height, μm 408.75 ± 10.49 456.94 ± 12.07 0.009 jejunal and ileal sample, respectively, was used to synthe- Villus width, μm 109.22 ± 3.61 114.36 ± 5.18 0.429 sise cDNA, based on the protocol of PrimeScript™ RT Crypt depth, μm 194.80 ± 1.95 189.25 ± 2.43 0.096 reagent kit with gDNA Eraser (Takara Biotechnology 2 * Villus surface area, mm 0.14 ± 0.01 0.16 ± 0.01 0.031 Co., Ltd). The synthesis was achieved in two steps: 37 °C ** for 15 min, followed by 85 °C for 5 s. Villus height:Crypt depth 2.10 ± 0.06 2.41 ± 0.04 < 0.001 Ileum qPCR Villus height, μm 334.83 ± 2.86 351.34 ± 7.73 0.077 Mucin 1 (MUC1), MUC2, MUC4, B-cell Villus width, μm 113.17 ± 5.19 123.39 ± 5.07 0.180 lymphoma-2-associated X protein (BAX), B-cell Crypt depth, μm 169.61 ± 5.19 174.41 ± 6.70 0.580 lymphoma-2 (BCL2), FAS, cysteinyl aspartate-specific Villus surface area, mm 0.12 ± 0.01 0.14 ± 0.01 0.120 proteinase-3 (caspase-3), caspase-8 and caspase-9 Villus height:Crypt depth 2.01 ± 0.05 2.04 ± 0.09 0.793 mRNA levels in intestinal mucosa were quantified using * ** P < 0.05 versus the CON group. P < 0.01 versus the CON group qPCR, as described by Wan et al. [29]. In brief, the spe- Values are the means of 8 replicates per treatment cific primers were designed using Primer Express 3.0 b CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the software (Applied Biosystems, Foster City, CA, USA) basal diet supplemented with 100 mg/kg alginate oligosaccharide) Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 6 of 12 Table 5 Effects of alginate oligosaccharide on the intestinal the primers amplified with an efficiency of approxi- goblet and columnar cell counts of weaned pigs mately 100%, the relative gene expressions between b -ΔΔCt Item Treatment P-value the two groups were calculated, based on the 2 method [30]. CON AOS Duodenum (number/villus) Statistical analysis Goblet cells 8.69 ± 0.26 10.03 ± 0.43 0.018 All data were analysed by a Student’s t-test using SAS Columnar cells 71.94 ± 3.10 75.09 ± 3.53 0.514 9.0 (SAS Inst., Inc., Cary, NC, USA). Each pig served as Jejunum (number/villus) a statistical unit. Data are shown as the mean ± standard ** Goblet cells 7.31 ± 0.34 9.79 ± 0.23 < 0.001 error. P < 0.05 was considered significant when used to Columnar cells 70.25 ± 1.57 73.55 ± 1.51 0.153 compare the differences between the CON group and the AOS group. Ileum (number/villus) Goblet cells 11.33 ± 0.79 11.60 ± 0.37 0.758 Results Columnar cells 78.20 ± 1.77 81.91 ± 2.40 0.233 Growth performance * ** P < 0.05 versus the CON group. P < 0.01 versus the CON group Although AOS addition did not have a significant effect Values are the means of 8 replicates per treatment CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the (P > 0.05) on G:F, the ADG and ADFI were elevated (P < basal diet supplemented with 100 mg/kg alginate oligosaccharide) 0.05) by supplemental AOS throughout the entire ex- perimental period (Table 3). Reference Dye II (50×), 0.4 μL forward primer (10 μmol/ L), 0.4 μL reverse primer (10 μmol/L), 1 μL cDNA and Serum D-xylose concentration 3 μL diethylpyrocarbonate-treated water, under the Fig. 1 reveals the effects of AOS supplementation on the following cycling conditions: 95 °C for 30 s, followed serum D-xylose level in weaned pigs. The data showed that by 40 cycles: at 95 °C for 5 s and 60 °C for 34 s. the pigs in the AOS group had a higher (P < 0.05) serum After the amplification phase, a melt curve analysis D-xylose concentration compared to the CON group. was performed at 95 °C for 15 s, 60 °C for 1 min and 95 °C for 15 s, to confirm the specificity of the amp- Intestinal architecture lification reaction. Porcine glyceraldehyde-3-phosphate H&E staining of the small intestine tissues after expos- dehydrogenase (GAPDH) gene was chosen as the ure to AOS indicated that AOS supplementation caused housekeeping gene, to normalise the expression levels duodenal and jejunal architecture alternations but failed of the target genes. Amplification efficiencies were to change the ileal structure (Fig. 2). calculated from the specific gene standard curves that Next, the specific duodenal, jejunal and ileal morpho- were generated from 10-fold serial dilutions, logical parameters for the two groups were calculated quantifying six concentrations. After verification that (Table 4). Dietary AOS inclusion resulted in a significant Fig. 3 Effects of alginate oligosaccharide on the sIgA content in the duodenum (a), jejunum (b) and ileum (c) of weaned pigs (immunohistochemistry; × 400). Values are means (8 pigs/treatment), with standard errors represented by vertical bars. P < 0.05 (indicates that the sIgA content is significantly higher in the AOS group than CON group). CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the basal diet supplemented with 100 mg/kg alginate oligosaccharide). sIgA, secretory immunoglobulin A. Scale bar is 40 μm Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 7 of 12 Fig. 4 Percentage of apoptotic cells in the small intestine of weaned pigs fed diets containing or lacking alginate oligosaccharide. Frames were divided into four quadrants: Q2–1 represents necrotic cells; Q2–2 represents late-stage apoptotic cells; Q2–3 represents normal cells; Q2–4 represents early-stage apoptotic cells. CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the basal diet supplemented with 100 mg/kg alginate oligosaccharide). 7-AAD, 7-aminoactinomycin D increase (P < 0.05) in the villus height and the villus percentage, in the jejunal epithelium. Furthermore, there height-to-crypt depth ratio in both, the duodenum and je- were no marked differences (P> 0.05) in the duodenal junum, as well as the jejunal villus surface area. Moreover, and ileal epithelial cell apoptotic percentages between there were no significant differences (P > 0.05) in the ileal the AOS and CON groups. morphological parameters between the two treatments. Cell cycle distribution Goblet and columnar cell counts Fig. 5 and Table 7 demonstrate that AOS supplementa- A summary of the goblet and columnar cell counts after tion decreased (P < 0.05) the proportion of G /G phase 0 1 AOS supplementation is provided in Table 5. AOS sup- plementation did not affect (P > 0.05) the columnar cell Table 6 Effects of alginate oligosaccharide on the enterocyte counts but increased (P < 0.05) the goblet cell counts in apoptosis of weaned pigs the duodenum and jejunum. There was no impact (P > Item Treatment P-value 0.05) on the ileal goblet and columnar cell counts by CON AOS AOS ingestion. Duodenum, % Early-stage apoptotic cells 2.94 ± 0.31 2.98 ± 0.22 0.909 sIgA content Late-stage apoptotic cells 9.31 ± 1.18 5.92 ± 0.46 0.055 Fig. 3 presents the mean optical density of intestinal Total apoptotic cells 12.25 ± 1.32 8.90 ± 0.61 0.083 sIgA in the CON and AOS groups. Interestingly, the je- Jejunum, % junal mean optical density of sIgA was higher (P < 0.05) Early-stage apoptotic cells 10.98 ± 0.99 6.31 ± 0.68 0.018 in the AOS group than CON group, whereas the duo- Late-stage apoptotic cells 15.70 ± 0.85 10.86 ± 1.02 0.022 denal and ileal mean optical densities of sIgA were not ** Total apoptotic cells 26.68 ± 0.61 17.17 ± 0.35 < 0.001 affected (P > 0.05) by AOS supplementation. Ileum, % Early-stage apoptotic cells 3.83 ± 0.46 2.93 ± 0.34 0.149 Apoptotic percentage Late-stage apoptotic cells 1.14 ± 0.18 1.03 ± 0.11 0.618 The impacts of AOS on the intestinal epithelial cell apoptosis are demonstrated in Fig. 4 and Table 6. Com- Total apoptotic cells 4.97 ± 0.42 3.96 ± 0.32 0.093 * ** pared to the control group, AOS supplementation de- P < 0.05 versus the CON group. P < 0.01 versus the CON group Values are the means of 8 replicates per treatment creased (P < 0.05) the early- and late-stage apoptotic cell CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the percentages, as well as the total apoptotic cells basal diet supplemented with 100 mg/kg alginate oligosaccharide) Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 8 of 12 cells but increased (P < 0.05) the ratio of S phase cells, as Discussion well as the proliferating index, in the jejunal epithelium. Compromising alterations in intestinal architecture, such Furthermore, the duodenal and ileal cell cycle distribu- as villus atrophy and crypt hyperplasia, are commonly tions did not markedly change (P> 0.05) after AOS encountered in post-weaning piglets [31, 32]. However, a supplementation. decrease in the villus height-to-crypt depth ratio or a re- duced villus surface area is considered deleterious for di- gestion and absorption and could lead to retarded Mucins gene expressions growth in post-weaning piglets [33, 34]. Consequently, According to Fig. 6, pigs supplemented with AOS had maintaining the normal intestinal architecture and func- an increase (P < 0.05) in mucin 2 (MUC2) transcrip- tion is essential for growth and development in piglets tion in the duodenal and ileal mucosae, but not after weaning [35]. It is therefore noteworthy that an in- (P> 0.05) in the ileal mucosa. Besides, no effects creased villus height-to-crypt depth ratio in the duode- (P> 0.05) were detected on the MUC1 and MUC4 num and jejunum, as well as an increased villus surface transcriptions in all of the three intestinal mucosae area in the jejunum, was seen in AOS-supplemented after AOS ingestion. pigs. These observations support the notion that AOS inclusion in the diet can change the intestinal morpho- Apoptosis-related genes expression logical structure, and thereby promote the intestinal The transcriptional levels of apoptosis-related genes in digestion-absorption function in piglets after weaning the small intestine are illustrated in Fig. 7. Compared to [36]. Meanwhile, the increased entry of orally admi- the CON group, AOS ingestion decreased (P < 0.05) the nistered D-xylose into the blood after AOS ingestion pro-apoptotic factor BAX, caspase-3 and caspase-9 further corroborates the aforementioned view [37]. mRNA abundances and increased (P < 0.05) the These findings are sufficient to suggest that the anti-apoptotic factor BCL2 mRNA abundance in the je- growth-promoting effects of AOS on weaned pigs can junal mucosa, but not (P> 0.05) in the duodenal and be partially attributable to the improved intestinal ileal mucosa. However, no difference (P> 0.05) was ob- morphology and function. served in the FAS and caspase-8 mRNA abundances There is plentiful of evidence that the early weaning among the three intestinal mucosae, after AOS process is correlated with impaired intestinal barrier supplementation. function in piglets [38, 39]. Interestingly, dietary Fig. 5 DNA histogram of the cell cycle in the small intestinal epithelium of weaned pigs fed diets containing or lacking alginate oligosaccharide. The first peak in the DNA histogram of the small intestinal epithelium cell cycle is in G /G phase, the second peak is in G + M phase, and S 0 1 2 phase lies between these two peaks. CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the basal diet supplemented with 100 mg/kg alginate oligosaccharide). 7-AAD, 7-aminoactinomycin D Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 9 of 12 Table 7 Effects of alginate oligosaccharide on the enterocyte the mucus layer in the intestine, providing an intestinal proliferation of weaned pigs chemical barrier function [44–46]. In the current study, Item Treatment P-value more goblet cells in the duodenum and jejunum were noticed after AOS addition, accompanied by an CON AOS up-regulated MUC2 transcriptional level in the duode- Duodenum, % num and jejunum, indicating that AOS supplementation G /G phase cells 75.15 ± 1.41 70.65 ± 1.37 0.051 0 1 also improved the intestinal chemical barrier function in S phase cells 18.71 ± 1.25 22.05 ± 0.78 0.053 weaned pigs. Together, these results revealed that AOS G + M phase cells 6.02 ± 1.05 6.54 ± 0.72 0.698 is conducive for repairing weaning-associated intestinal Proliferating index 24.77 ± 1.39 28.81 ± 1.28 0.064 barrier dysfunction in piglets and then possibly im- Jejunum, % proved growth performance. Apoptosis is a form of physiological cell death, import- G /G phase cells 75.93 ± 1.81 70.42 ± 0.78 0.023 0 1 ant in controlling the epithelial turnover in the intestinal S phase cells 16.66 ± 1.37 21.88 ± 0.87 0.012 mucosa. However, dysregulated or excessive apoptosis G + M phase cells 5.98 ± 0.74 7.62 ± 0.55 0.112 results in severe intestinal pathology [47]. A recent re- ** Proliferating index 22.99 ± 1.51 29.53 ± 0.79 0.005 search certified that weaning could increase enterocyte Ileum, % apoptosis in piglets [48]. Here, we noted that apoptosis G /G phase cells 73.57 ± 2.04 68.74 ± 1.98 0.128 was less prevalent in the jejunal epithelial cells in the 0 1 AOS group than control group, suggesting that AOS S phase cells 17.78 ± 0.90 21.64 ± 1.43 0.052 may have a protective influence against enterocyte apop- G + M phase cells 8.10 ± 1.05 9.13 ± 1.11 0.521 tosis promoted by weaning of piglets. In addition to in- Proliferating index 26.04 ± 1.90 30.89 ± 2.27 0.140 ducing enterocyte apoptosis, weaning also inhibits * ** P < 0.05 versus the CON group. P < 0.01 versus the CON group intestinal epithelial cell proliferation in piglets [49]. Values are the means of 8 replicates per treatment CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the Here, we identified that AOS supplementation increased basal diet supplemented with 100 mg/kg alginate oligosaccharide) jejunal epithelial cell proliferation, through promoting the transition from G /G to S phase of the cell cycle. 0 1 supplementation with some oligosaccharides provides a As such, it was confirmed that AOS could alleviate the promising approach to improve the intestinal barrier elevated apoptosis and depressed proliferation of intes- function in weaned pigs [40, 41]. Therefore, we expected tinal epithelial cells in piglets caused by weaning and that AOS would have benefits on intestinal barrier func- consequently mitigate weaning-induced intestinal struc- tion when administered to weaned pigs. In the present tural injury. So far, the molecular mechanisms by which study, AOS supplementation increased the jejunal muco- AOS inhibits enterocyte apoptosis in weaned pigs re- sal sIgA content, suggesting that dietary inclusion of main unclear. Therefore, we studied the effects of AOS AOS could enhance the intestinal immune barrier func- addition in the diet, on signalling molecules involved in tion in weaned pigs [42, 43]. Goblet cells are specialised enterocyte apoptosis in weaned pigs. cells found along the crypt–villus axis of the small intes- It is well-known that the intrinsic (mitochondrial path- tine that biosynthesis, assemble and secrete mucins (in- way) and extrinsic (cytoplasmic pathway) pathways are cluding MUC1, MUC2 and MUC4), which contribute to two major apoptotic routes [50]. The intrinsic pathway Fig. 6 Relative mRNA abundances of MUC1 (a), MUC2 (b) and MUC4 (c) in the small intestine of weaned pigs fed diets containing or lacking * ** alginate oligosaccharide. Values are means (8 pigs/treatment), with standard errors represented by vertical bars. P < 0.05 or P < 0.01 (indicates that the gene mRNA levels between the AOS and CON groups differ significantly). CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the basal diet supplemented with 100 mg/kg alginate oligosaccharide). MUC1, mucin 1; MUC2, mucin 2; MUC4, mucin 4 Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 10 of 12 Fig. 7 Relative mRNA abundances of BAX (a), BCL2 (b), FAS (c), caspase-3 (d), caspase-8 (e) and caspase-9 (f) in the small intestine of weaned pigs fed diets containing or lacking alginate oligosaccharide. Values are means (8 pigs/treatment), with standard errors represented by vertical bars. P ** <0.05 or P < 0.01 (indicates that the gene mRNA levels between the AOS and CON groups differ significantly). CON, control (a corn-soybean basal diet); AOS, alginate oligosaccharide (the basal diet supplemented with 100 mg/kg alginate oligosaccharide). BAX, B-cell lymphoma-2-associated X protein; BCL2, B-cell lymphoma-2; caspase-3, cysteinyl aspartate-specific proteinase-3; caspase-8, cysteinyl aspartate-specific proteinase-8; caspase-9, cysteinyl aspartate-specific proteinase-9 is mitochondria-mediated and mainly regulated by the apoptosis in weaned pigs. Furthermore, these changes BCL2 family [51, 52], whereas the extrinsic pathway is were accompanied by an enhanced growth performance triggered through the Fas death receptor, a member of in weaned pigs. Our observations provide a strong scien- the tumour necrosis factor receptor superfamily [53]. tific basis for AOS as an alternative to the use of anti- Both pathways converge to a final common path involv- biotic growth promoters in swine production and also ing the activation of a cascade of proteases called cas- imply AOS has potential application in clinical nutrition pases that cleave regulatory and structural molecules, to prevent intestinal disruptions. culminating in the death of the cell [54, 55]. To illustrate Abbreviations the mechanisms underlying the suppression effects of 7-AAD: 7-aminoactinomycin D; ADFI: Average daily feed intake; AOS on weaning-induced intestinal epithelial cell apop- ADG: Average daily body weight gain; AOS: Alginate oligosaccharide (the basal diet supplemented with 100 mg/kg alginate oligosaccharide); BAX: B- tosis in piglets, the apoptosis-related gene transcriptional cell lymphoma-2-associated X protein; BCL2: B-cell lymphoma-2; BW: Body levels, including BAX, BCL2, FAS, caspase-3, caspase-8 weight; CON: Control (a corn-soybean basal diet); caspase-3: Cysteinyl and caspase-9, were determined. The present study evi- aspartate-specific proteinase-3; caspase-8: Cysteinyl aspartate-specific proteinase-8; caspase-9: Cysteinyl aspartate-specific proteinase-9; DAB: 3,3′- denced that AOS ingestion decreased the pro-apoptotic diaminobenzidine; G: α-L-guluronic acid; GAPDH: glyceraldehyde-3- factor BAX, caspase-3 and caspase-9 mRNA abundances phosphate dehydrogenase; G:F: The gain-to-feed ratio; M: β-D-mannuronic and increased the anti-apoptotic factor BCL2 mRNA acid; MUC1: Mucin 1; MUC2: Mucin 2; MUC4: Mucin 4; PBS: phosphate buffered saline; qPCR: quantitative real-time polymerase chain reaction; abundance in the jejunum. Thus, AOS inhibition of intes- sIgA: Secretory immunoglobulin A tinal epithelial cell death in weaned pigs might be inclined to decrease mitochondria-dependent apoptosis. Our find- Acknowledgements We thank Anran Jiao, Fei Jiang and Huifen Wang for their diligent ings explained the positive role of AOS in rendering the contribution to the animal experiments. We also express our gratitude to intestinal epithelial cells resistant to weaning-induced Zhengqiang Yu for his excellent technical assistance in enterocyte apoptosis apoptosis in piglets. and cell cycle detection by flow cytometry. Funding Conclusions This work was supported by the Special Fund for Agro-scientific Research in To summarise, we indicated that supplementing the diet the Public Interest (201403047). with 100 mg/kg AOS improved both the intestinal Availability of data and materials morphology and barrier function and inhibited the en- All data generated or analysed during this study are available from the terocyte death by reducing mitochondria-dependent corresponding author on reasonable request. Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 11 of 12 Authors’ contributions alginate in lipopolysaccharide-activated murine macrophage RAW 264.7 Jun He designed and supervised the experiments. Jin Wan and Jiao Zhang cells. J Agric Food Chem. 2015;63:160–8. carried out the experiments and performed statistical data analysis. Daiwen 19. Yang Y, Ma ZH, Yang GK, Wan J, Li GJ, Du LJ, et al. Alginate oligosaccharide Chen, Bing Yu, Xiangbing Mao, Ping Zheng, Jie Yu and Junqiu Luo gave indirectly affects toll-like receptor signaling via the inhibition of microrna- tremendous help in conducting experiments. Jin Wan was also in charge of 29b in aneurysm patients after endovascular aortic repair. Drug Des Devel preparing the manuscript. All authors have read and approved the final Ther. 2017;11:2565–79. manuscript. 20. Wan J, Zhang J, Chen DW, Yu B, He J. Effects of alginate oligosaccharide on the growth performance, antioxidant capacity and intestinal digestion-absorption function in weaned pigs. Anim Feed Sci Technol. 2017;234:118–27. Ethics approval 21. National Research Council. Nutrient requirements of swine. 11th ed. All procedures in the present study involving animals were approved by the Washington, DC: National Academics Press; 2012. Animal Care and Use Committee of Sichuan Agricultural University 22. Hou YQ, Wang L, Zhang W, Yang ZG, Ding BY, Zhu HL, et al. Protective (Chengdu, China). effects of N-acetylcysteine on intestinal functions of piglets challenged with lipopolysaccharide. Amino Acids. 2012;43:1233–42. Competing interests 23. Wan J, Li Y, Chen DW, Yu B, Chen G, Zheng P, et al. Recombinant plectasin The authors declare that they have no competing interests. elicits similar improvements in the performance and intestinal mucosa growth and activity in weaned pigs as an antibiotic. Anim Feed Sci Technol. Received: 21 January 2018 Accepted: 6 June 2018 2016;211:216–26. 24. Chen H, Mao XB, He J, Yu B, Huang ZQ, Yu J, et al. Dietary fibre affects intestinal mucosal barrier function and regulates intestinal bacteria in weaning piglets. Br J Nutr. 2013;110:1837–48. References 25. Fang TT, Liu GM, Cao W, Wu XJ, Jia G, Zhao H, et al. Spermine: new insights 1. Kim JC, Hansen CF, Mullan BP, Pluske JR. Nutrition and pathology of weaner into the intestinal development and serum antioxidant status of suckling pigs: nutritional strategies to support barrier function in the gastrointestinal piglets. RSC Adv. 2016;6:31323–35. tract. Anim Feed Sci Technol. 2012;173:3–16. 26. Cao W, Liu GM, Fang TT, Wu XJ, Jia G, Zhao H, et al. Effects of spermine on 2. Smith F, Clark JE, Overman BL, Tozel CC, Huang JH, Rivier JE, et al. Early the morphology, digestive enzyme activities, and antioxidant status of weaning stress impairs development of mucosal barrier function in the jejunum in suckling rats. RSC Adv. 2015;5:76607–14. porcine intestine. Am J Physiol Gastrointest Liver Physiol. 2010;298:G352–G63. 27. Yu ZQ, Wang FY, Liang N, Wang CH, Peng X, Fang J, et al. Effect of 3. Boudry G, Péron V, Le Huërou-Luron I, Lallès JP, Sève B. Weaning induces selenium supplementation on apoptosis and cell cycle blockage of renal both transient and long-lasting modifications of absorptive, secretory, and cells in broilers fed a diet containing aflatoxin B1. Biol Trace Elem Res. 2015; barrier properties of piglet intestine. J Nutr. 2004;134:2256–62. 168:242–51. 4. Hu CH, Song ZH, Xiao K, Song J, Jiao LF, Ke YL. Zinc oxide influences 28. Haag D, Goerttler K, Tschahargane C. The proliferative index (PI) of human intestinal integrity, the expressions of genes associated with inflammation breast cancer as obtained by flow cytometry. Pathology-Research and and TLR4-myeloid differentiation factor 88 signaling pathways in weanling Practice. 1984;178:315–22. pigs. Innate Immun. 2014;20:478–86. 29. Wan J, Jiang F, Zhang J, Xu QS, Chen DW, Yu B, et al. Amniotic fluid 5. Yin J, Wu MM, Xiao H, Ren WK, Duan JL, Yang G, et al. Development of an metabolomics and biochemistry analysis provides novel insights into the antioxidant system after early weaning in piglets. J Anim Sci. 2014;92:612–9. diet-regulated foetal growth in a pig model. Sci Rep. 2017;7:44782. 6. Zhu LH, Zhao KL, Chen XL, Xu JX. Impact of weaning and an antioxidant 30. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using blend on intestinal barrier function and antioxidant status in pigs. J Anim -ΔΔCt real-time quantitative PCR and the 2 method. Methods. 2001;25: Sci. 2012;90:2581–9. 402–8. 7. Yang HS, Xiong X, Wang XC, Li TJ, Yin YL. Effects of weaning on intestinal 31. Montagne L, Boudry G, Favier C, Le Huërou-Luron I, Lallès JP, Sève B. Main crypt epithelial cells in piglets. Sci Rep. 2016;6:36939. intestinal markers associated with the changes in gut architecture and 8. Wan J, Li Y, Chen DW, Yu B, Zheng P, Mao XB, et al. Expression of a function in piglets after weaning. Br J Nutr. 2007;97:45–57. tandemly arrayed plectasin gene from Pseudoplectania nigrella in Pichia 32. Hu CH, Xiao K, Luan ZS, Song J. Early weaning increases intestinal pastoris and its antimicrobial activity. J Microbiol Biotechnol. 2016;26:461–8. permeability, alters expression of cytokine and tight junction proteins, and 9. Yin XX, Song FJ, Gong YH, Tu XC, Wang YX, Cao SY, et al. A systematic review activates mitogen-activated protein kinases in pigs. J Anim Sci. 2013;91: of antibiotic utilization in China. J Antimicrob Chemother. 2013;68:2445–52. 1094–101. 10. Gill EE, Franco OL, Hancock REW. Antibiotic adjuvants: diverse strategies for 33. Montagne L, Pluske JR, Hampson DJ. A review of interactions between controlling drug-resistant pathogens. Chem Biol Drug Des. 2015;85:56–78. dietary fibre and the intestinal mucosa, and their consequences on 11. Liu P, Piao XS, Kim SW, Wang L, Shen YB, Lee HS, et al. Effects of chito- digestive health in young non-ruminant animals. Anim Feed Sci Technol. oligosaccharide supplementation on the growth performance, nutrient 2003;108:95–117. digestibility, intestinal morphology, and fecal shedding of and in weaning 34. Wijtten PJ, van der Meulen J, Verstegen MW. Intestinal barrier function and pigs. J Anim Sci. 2008;86:2609–18. absorption in pigs after weaning: a review. Br J Nutr. 2011;105:967–81. 12. Wu Y, Pan L, Shang QH, Ma XK, Long SF, Xu YT, et al. Effects of isomalto- 35. Pluske JR, Hampson DJ, Williams IH. Factors influencing the structure and oligosaccharides as potential prebiotics on performance, immune function and function of the small intestine in the weaned pig: a review. Livest Prod Sci. gut microbiota in weaned pigs. Anim Feed Sci Technol. 2017;230:126–35. 1997;51:215–36. 13. Ruvinov E, Cohen S. Alginate biomaterial for the treatment of myocardial 36. Wan J, Jiang F, Xu QS, Chen DW, He J. Alginic acid oligosaccharide infarction: progress, translational strategies, and clinical outlook: from ocean accelerates weaned pig growth through regulating antioxidant capacity, algae to patient bedside. Adv Drug Deliver Rev. 2016;96:54–76. immunity and intestinal development. RSC Adv. 2016;6:87026–35. 14. Lu JJ, Yang H, Hao J, Wu CL, Liu L, Xu NY, et al. Impact of hydrolysis 37. Hou YQ, Wang L, Ding BY, Liu YL, Zhu HL, Liu J, et al. Dietary α- conditions on the detection of mannuronic to guluronic acid ratio in ketoglutarate supplementation ameliorates intestinal injury in alginate and its derivatives. Carbohydr Polym. 2015;122:180–8. lipopolysaccharide-challenged piglets. Amino Acids. 2010;39:555–64. 15. Guo JJ, Ma LL, Shi HT, Zhu JB, Wu J, Ding ZW, et al. Alginate oligosaccharide 38. Moeser AJ, Ryan KA, Nighot PK, Blikslager AT. Gastrointestinal dysfunction prevents acute doxorubicin cardiotoxicity by suppressing oxidative stress and induced by early weaning is attenuated by delayed weaning and mast cell endoplasmic reticulum-mediated apoptosis. Mar Drugs. 2016;14:231. blockade in pigs. Am J Physiol Gastrointest Liver Physiol. 2007;293:G413–G1. 16. Wang P, Jiang XL, Jiang YH, Hu XK, Mou HJ, Li M, et al. In vitro antioxidative activities of three marine oligosaccharides. Nat Prod Res. 2007;21:646–54. 39. McLamb BL, Gibson AJ, Overman EL, Stahl C, Moeser AJ. Early weaning 17. Tusi SK, Khalaj L, Ashabi G, Kiaei M, Khodagholi F. Alginate oligosaccharide stress in pigs impairs innate mucosal immune responses to enterotoxigenic protects against endoplasmic reticulum- and mitochondrial-mediated E coli challenge and exacerbates intestinal injury and clinical disease. PLoS apoptotic cell death and oxidative stress. Biomaterials. 2011;32:5438–58. One. 2013;8:e59838. 18. Zhou R, Shi XY, Gao Y, Cai N, Jiang ZD, Xu X. Anti-inflammatory activity of 40. Wan J, Jiang F, Xu QS, Chen DW, Yu B, Huang ZQ, et al. New insights into guluronate oligosaccharides obtained by oxidative degradation from the role of chitosan oligosaccharide in enhancing growth performance, Wan et al. Journal of Animal Science and Biotechnology (2018) 9:58 Page 12 of 12 antioxidant capacity, immunity and intestinal development of weaned pigs. RSC Adv. 2017;7:9669–79. 41. Yang CM, Ferket PR, Hong QH, Zhou J, Cao GT, Zhou L, et al. Effect of chito- oligosaccharide on growth performance, intestinal barrier function, intestinal morphology and cecal microflora in weaned pigs. J Anim Sci. 2012;90:2671–6. 42. Corthésy B. Role of secretory immunoglobulin a and secretory component in the protection of mucosal surfaces. Future Microbiol. 2010;5:817–29. 43. Keren DF. Intestinal mucosal immune defense mechanisms. Am J Surg Pathol. 1988;12:100–5. 44. Lamont JT. Mucus: the front line of intestinal mucosal defense. Ann N Y Acad Sci. 1992;664:190–201. 45. McCauley HA, Guasch G. Three cheers for the goblet cell: maintaining homeostasis in mucosal epithelia. Trends Mol Med. 2015;21:492–503. 46. Linden SK, Sutton P, Karlsson NG, Korolik V, McGuckin MA. Mucins in the mucosal barrier to infection. Mucosal Immunol. 2008;1:183–97. 47. Günther C, Neumann H, Neurath MF, Becker C. Apoptosis, necrosis and necroptosis: cell death regulation in the intestinal epithelium. Gut. 2013;62:1062–71. 48. Zhu LH, Cai X, Guo Q, Chen XL, Zhu SW, Xu JX. Effect of N-acetyl cysteine on enterocyte apoptosis and intracellular signalling pathways' response to oxidative stress in weaned piglets. Br J Nutr. 2013;110:1938–47. 49. Zhu LH, Xu JX, Zhu SW, Cai X, Yang SF, Chen XL, et al. Gene expression profiling analysis reveals weaning-induced cell cycle arrest and apoptosis in the small intestine of pigs. J Anim Sci. 2014;92:996–1006. 50. Ghobrial IM, Witzig TE, Adjei AA. Targeting apoptosis pathways in cancer therapy. CA Cancer J Clin. 2005;55:178–94. 51. Hockenbery D, Nuñez G, Milliman C, Schreiber RD, Korsmeyer SJ. Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature. 1990;348:334–6. 52. Reed JC, Miyashita T, Takayama S, Wang HG, Sato T, Krajewski S, et al. BCL-2 family proteins: regulators of cell death involved in the pathogenesis of cancer and resistance to therapy. J Cell Biochem. 1996;60:23–32. 53. Zapata JM, Pawlowski K, Haas E, Ware CF, Godzik A, Reed JC. A diverse family of proteins containing tumor necrosis factor receptor-associated factor domains. J Biol Chem. 2001;276:24242–52. 54. Elmore S. Apoptosis: a review of programmed cell death. Toxicol Pathol. 2007;35:495–516. 55. Riedl SJ, Shi Y. Molecular mechanisms of caspase regulation during apoptosis. Nat Rev Mol Cell Biol. 2004;5:897–907.

Journal

Journal of Animal Science and BiotechnologySpringer Journals

Published: Aug 16, 2018

There are no references for this article.