Get 20M+ Full-Text Papers For Less Than $1.50/day. Subscribe now for You or Your Team.

Learn More →

Amyloid-β precursor protein promotes cell proliferation and motility of advanced breast cancer

Amyloid-β precursor protein promotes cell proliferation and motility of advanced breast cancer Background: Amyloid-β precursor protein (APP) is a highly conserved single transmembrane protein that has been linked to Alzheimer disease. Recently, the increased expression of APP in multiple types of cancers has been reported where it has significant correlation with the cancer cell proliferation. However, the function of APP in the pathogenesis of breast cancer has not previously been determined. In this study, we studied the pathological role of APP in breast cancer and revealed its potential mechanism. Methods: The expression level of APP in multiple breast cancer cell lines was measured by Western blot analysis and the breast cancer tissue microarray was utilized to analyze the expression pattern of APP in human patient specimens. To interrogate the functional role of APP in cell growth and apoptosis, the effect of APP knockdown in MDA-MB-231 cells were analyzed. Specifically, multiple signal transduction pathways and functional alterations linked to cell survival and motility were examined in in vivo animal modelaswellas in vitro cell culture with the manipulation of APP expression. Results: We found that the expression of APP is increased in mouse and human breast cancer cell lines, especially in the cell line possessing higher metastatic potential. Moreover, the analysis of human breast cancer tissues revealed a significant correlation between the level of APP and tumor development. Knockdown of APP (APP-kd) in breast cancer kip1 cells caused the retardation of cell growth in vitro and in vivo, with both the induction of p27 and caspase-3-mediated apoptosis. APP-kd cells also had higher sensitivity to treatment of chemotherapeutic agents, TRAIL and 5-FU. Such anti-tumorigenic effects shown in the APP-kd cells partially came from reduced pro-survival AKT activation in response to IGF-1, leading to activation of key signaling regulators for cell growth, survival, and pro-apoptotic events such as GSK3-β and FOXO1. Notably, knock-down of APP in metastatic breast cancer cells limited cell migration and invasion ability upon stimulation of IGF-1. Conclusion: The present data strongly suggest that the increase of APP expression is causally linked to tumorigenicity as well as invasion of aggressive breast cancer and, therefore, the targeting of APP may be an effective therapy for breast cancer. kip1 Keywords: AKT, Amyloid-β precursor protein, Apoptosis, Breast cancer, Invasion, p27 * Correspondence: sxl269@case.edu; hyoung-gon.lee@case.edu Department of Pediatrics, Case Comprehensive Cancer Center, Case Western Reserve University School of Medicine, 2103 Cornell Road, Cleveland, OH 44106, USA Department Pathology, Case Western Reserve University School of Medicine, 2103 Cornell Road, Cleveland, OH 44106, USA Full list of author information is available at the end of the article © 2014 Lim et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Lim et al. BMC Cancer 2014, 14:928 Page 2 of 12 http://www.biomedcentral.com/1471-2407/14/928 Background RPMI supplemented with 10% (vol/vol) FBS, penicillin Amyloid-β precursor protein (APP) is a highly conserved (100 units/ml), and streptomycin (100 μg/ml; Invitrogen, single transmembrane protein with a receptor-like struc- Rockville, MD). The four human breast cancer cell lines ture and has been linked with Alzheimer disease [1,2] MCF10A1 (M-I), MCF10AT1k.cl2 (M-II), MCF10CA1h while its normal physiological function is unclear. Several (M-III), and MCF10CA1a.cl1 (M-IV) were obtained from APP isoforms derived from alternative splicing processes Dr. Anita Roberts (NCI/NIH, Bethesda, MD). M-I, M-II, have been reported and diverse products including soluble M-III, and M-IV cells were grown in DMEM/F12 (Invitro- APP (sAPP) or abnormal amyloid-β peptide through α-, β-, gen, Carlsbad, CA) containing 5% horse serum (Invitrogen) or γ-secretase-mediated cleavage(s) are post-translationally at 37°C with 5% CO . M-I and M-II cells were supple- generated [3,4]. APP is ubiquitously expressed in a broad mented additionally with 10 μg/ml insulin (Sigma, St. spectrum of cell types including non-neuronal cells, while Louis, MO), 20 ng/ml epidermal growth factor (Sigma), 0.5 the nature of APP has been mainly studied in neuronal μg/ml hydrocortisone (Sigma), and 100 ng/ml cholera cells due to its pathological significance in Alzheimer dis- toxin (Sigma). Antibodies specific for APP (22C11) were ease. Several pathophysiological functions of APP have purchased from EMD Millipore; APP (4G8) from Covance. been proposed such as its potential role in cell growth and Specific antibodies for p27(C-19) and p21 (F-5) were from cell adherence [5-7]. It has been demonstrated that APP is Santacruz and anti-β-actin (AC-15) was from Sigma. Anti- engaged in neuronal growth cone adhesion and plays a role bodies purchased from Cell Signaling were AKT (#9772), as an independently operating cell adhesion molecule for pAKT Thr308 (#4056), pAKT Ser473 (#9271), pFOXO1 binding to extracellular matrices such as laminin [6]. Thr24 (#9464), pGSK3 Ser9 (#9336), pp65 Ser536 Specifically, it has been reported that APP is linked to pro- (#3033), pERK1/2 (#9101), β-Catenin (#9562), PARP liferation of thyroid epithelial cells and epidermal basal cell (#9542), and cleaved Caspase-3 (#9661). Anti-survivin proliferation [8-11] and, interestingly, the increased ex- antibody (AB8228) was purchased from Abcam. The anti- pression of APP in several types of cancers including pan- CD44 antibody (#15675-1-AP) was from Proteintech creatic, lung, colon and breast cancer has been reported group and anti-GSK3b (KAP-ST002E) antibody was from [10-15]. These studies suggested that APP has growth- Stressgen. promoting effect as an autocrine growth factor while the underlying mechanism in the regulation of cellular signal- Knockdown of human APP using lentiviral infection ing and gene expression has not been fully explored. The system potential role of APP in cancer cell motility is also Knockdown of human endogenous APP gene expression supported by studies which show APP plays a role in was carried out using the lentivirus shRNA expression migration of neuronal precursor cells and neurite out- system and experimental method as previously described growth [16,17]. [19]. The target sequence of human APP (shAPP-5: 5’- In this study, we explored the pathological role of APP CCCTGTTCATTGTAAGCACTT, shAPP-7: 5’-GCAG in malignancy of breast cancer and its potential molecular ACACAGACTATGCAGAT) or control luciferase was mechanism related with cell proliferation and metastasis. used. In order to produce viral particles, the shRNA Breast cancer is the most common cancer diagnosed constructs and virus packaging plasmids were trans- among women worldwide [18] and metastatic breast can- fected into fresh 293T cells and then harvested the viral cer is significantly correlated with poor prognosis and a supernatant and filtered through 0.45 μm syringe filter main cause of death while the underlying molecular prior to infection. Target cells were infected with virus pathogenic mechanism still remains to be delineated. We by spinning at 2000 rpm for 30 min. Semi-quantitative found that the expression level of APP is mechanistically RT-PCR and immunoblotting were carried out to meas- linked with tumorigenicity and malignancy of breast ure knock-down efficiency. cancer. APP knockdown (APP-kd) in breast cancer cells kip1 reduced cell growth via p27 induction, promoting Western blotting and RT-PCR apoptosis, increasing sensitivity to therapeutic treatments, The cells were harvested and lysed in RIPA buffer. Equal and delayed cell migration and invasion ability upon amounts of protein were loaded and separated in SDS- stimulation. These results suggest that targeting APP may PAGE gel and then transferred to PVDF membrane. The effectively suppress the growth and invasion of malignant blot was incubated in blocking solution (5% milk/TBST) breast cancer cells. and then incubated with primary antibody followed by incubation with secondary HRP conjugated antibody for 1 Methods or 2 hours. The blot was washed 3 times for 5 minutes with Cell culture and reagents TBST between the incubations. Eventually, the change of MDA-MB-231 cells were grown in DMEM, and 67NR, target protein expression was detected by conducting reac- 4T07, and 4T1 breast cancer cell lines were grown in tion with Chemiluminescent Substrate (Thermo Scientific), Lim et al. BMC Cancer 2014, 14:928 Page 3 of 12 http://www.biomedcentral.com/1471-2407/14/928 exposing, and developing the film. RT-PCR for measuring performed in compliance with guidelines established by the level of APP mRNA expression was performed with the Institutional Animal Care and Use Committee at Case the primers specific to human APP [20]. Western Reserve University. Detection of apoptotic cell population Immunohistochemistry MDA-MB-231 cells (5×10 ) freshly infected with shLuc, The breast cancer tissue array was purchased from US shAPP-5, or shAPP-7 lentiviral particles were immedi- Biomax (Cat# BRC961). For immunohistochemistry for ately seeded in 6-well plates. In order to detect early the APP detection, the tissue microarrays were hydrated apoptotic events, we employed Annexin V staining through two changes of xylene and descending ethanol method (eBioscience) which can detect phosphatidylser- solutions for 10 min each, followed by a 30 min submer- ineonthe outerplasmamembraneuponinitiation of sion in 3% H O and finally Tris-buffered saline (TBS). 2 2 apoptosis. Cell viability staining was carried out using The slides were incubated in 10% normal goat serum propidium iodide (PI) to identify early-stage apoptotic (NGS) in TBS for 30 min and the primary antibody was cells. The FACS analysis was immediately followed after applied overnight. A monoclonal antibody specific to staining the cells. APP, 22C11 (recognizing the N-terminal domain of full length amyloid-β precursor protein; EMD Millipore, Cell growth assay 1:250), was applied to the microarrays and then the The control and APP-kd of MDA-MB-231cells (2×10 ) peroxidase-anti-peroxidase technique was employed and were seeded in 6-well plate in triplicate and maintained developed with 3′-3’-diaminobenzidine (Dako). in normal growth medium. The sub-confluently growing cells were counted using coulter counter (Beckman) at Statistical analysis day 2 and 4. Data are presented as means ± standard deviation. Differences between the experimental groups were com- Wound-healing assay and cell invasion assay pared with Student’s paired two tailed t-test. A p-value less To compare the cell motility, the MDA-MB-231 control than 0.05 was considered statistically significant. (shluc) or APP knockdown (shAPP-7) MDA-MB-231 cells were examined in wound healing assay. The conflu- Results ently grown cells were wounded with 200 μl tips and The level of APP expression is linked to malignancy of followed by either no treatment or treated with IGF-1 breast cancer cells (25 ng/ml) for 18 hours in 0.1% serum containing In order to investigate the correlation between APP expres- medium. Subsequently, cells were fixed with 2% parafor- sion and malignancy of breast cancer, the expression level maldehyde and then stained with rapid 3 step staining of APP was examined in a series of human and mouse set (Richard-Allen Scientific) for clear visualization of breast cancers with increasing malignancy. The four human migrated cells. The initial wounded edges were marked breast cancer cell lines MCF10A1 (M-I), MCF10AT1k.cl2 with dotted lines. Representative results from at least (M-II), MCF10CA1h (M-III), and MCF10CA1a.cl1 (M-IV) three independent experiments are shown. Cell invasion were used in which M-I cells are spontaneously immor- assays were performed by seeding cells in Boyden chamber talized from normal breast epithelial cells whereas M-II, M- (BD Bioscience) coated with matrigel in serum-free III, and M-IV cells are derived from M-I cells transformed medium with or without IGF-1 (50 ng/ml) in the bottom with Ha-Ras oncogene [22,23]. M-III cells are a well- of each wells for 18 hours. The migrated cells were visual- differentiated tumor derived from M-II xenografts while ized by staining and photographing under the microscope. M-IV cells are a poorly differentiated metastatic tumor de- rived from xenografts of M-II cells. In our analysis, the total Xenograft mouse model APP expression of both mature (upper band) and imma- The breast cancer cells were seeded freshly prior to in- ture (lower band) forms was significantly elevated approxi- jection. The control and shAPP MDA-MB-231 (1×10 ) mately 2 to 7-fold in MCF10A (M-II, -III, and -IV) cells cells were prepared in the solution (1:1) of PBS and compared to M-I cells (Figure 1A). This positive correlation growth factor-reduced matrigel and followed by injection between APP expression and malignancy was further con- into athymic nude mice subcutaneously. Primary tumor firmed in mouse breast cancer cells; 67NR, 4T07, and 4T1 outgrowth was monitored every 4 days by taking measure- cells which are derived from the same primary tumor [24]. ments of the tumor length (L) and width (W). Tumor vol- 67NR cells, which can form primary tumors without meta- ume was calculated as πLW /6 [21]. The mice were static ability, showed negligible APP expression whereas maintained up to 6 weeks and sacrificed for tumor exci- highly tumorigenic 4T07 and metastatic 4T1 cells express sion. The tumor growth was compared to the counterpart APP up to 8-fold (Figure 1B). These results suggest that and imaged. All animal housing and procedures were APP is functionally linked to the aggressiveness in breast Lim et al. BMC Cancer 2014, 14:928 Page 4 of 12 http://www.biomedcentral.com/1471-2407/14/928 Figure 1 The elevated expression of APP engaged in breast cancer cell proliferation. (A) APP expression is detected by 22C11 mouse monoclonal anti-APP antibody in human breast cancer cell lines and correlates with increasing malignancy. (+); a positive control of APP protein overexpressed in neuronal cells. (B) The expression of APP is compared in mouse breast cancer cells with increasing metastatic potential. (C) APP protein expression was present at a similar level in both M-IV and MDA-MB-231. Knock down of APP expression was verified in RT-PCR following lentiviral infection encoding shAPP in MDA-MB-231. APP knockdown resulted in decreased expression of APP and soluble APP. The equal volume of conditioned media was condensed by using Centricon and analyzed in Western blot. For the loading control, β-actin was uesd. (D) Cells (2x10 ) were seeded in 6-well plate and cell numbers counted using coulter counter at day 2 and 4. (E) MDA-MB-231 cells were seeded at two different numbers and the cell growth was compared by MTT assay. (F) MDA-MB-231 cells fixed and stained with propidium iodide (PI) were subjected to cell cycle analysis by FACS. tumor cells and contribute to maintaining their malignancy The cell cycle analysis showed that APP-kd cells were such as tumorigenic and metastatic ability. arrested largely in G1 phase (45.2%) compared to control (31.4%), but low percentage of APP-kd cells (19.4%) was Reduction of the expression of APP prevents cell growth in S phase as compared to that of control cells (25.5%) in MDA-MB-231 cells (Figure 1F). Retarded cell growth and G1 arrest of APP-kd We investigated the pathophysiological function of APP cells suggest that APP is likely engaged in expression of kip1 by knocking it down using the shRNA targeting APP in cell cycle inhibitors working on G1 phase such as p27 cip1 MDA-MB-231 malignant human breast cancer cells (Fig- and p21 [27,28]. ure 1A). Both mRNA and protein expression of APP were kip1 markedly reduced in APP-kd cells compared to control APP enhances cell proliferation via regulation of p27 cells (Figure 1C). APP protein expression of MDA-MB- To address whether APP regulates G1 phase cell cycle 231 was comparable to that of M-IV cells while MDA- inhibitors, the control and APP-kd cells grown in normal kip1 MB-231, but not M-IV cells, showed fair amount of growth medium were examined to compare p27 and/ cip1 soluble APP secretion that is known to enhance cell or p21 expression of APP-kd cells to control. In our kip1 growth and survival [25,26]. Next, we examined cell prolif- analysis, the level of p27 was dramatically induced in eration in normal growth medium with 10% FBS in the APP-kd cells compared to control (Figure 2A and 2B). cip1 control (shluc) and APP-kd (shAPP) cells. Consistent with However, p21 expression was unchanged or slightly our hypothesis, reduction of APP expression significantly affected by APP knockdown in multiple cell lines (M-I, affected cell proliferation and viability (Figure 1D,E). To M-IV and MDA-MB-231) (Figure 2B and 2C) suggesting kip1 confirm the effect of APP on cell growth further, we that APP regulates cell cycle by modulating p27 performed FACS analysis to determine cell cycle phase. specifically. Lim et al. BMC Cancer 2014, 14:928 Page 5 of 12 http://www.biomedcentral.com/1471-2407/14/928 kip1 It has been established that p27 has dual function as APP knockdown. These data also suggest that APP plays a either a tumor suppressor or promoter because nuclear crucial role for cell proliferation of malignant breast can- Kip1 p27 works as an anti-proliferative protein, while cyto- cers by modulating the expression of cyclin-dependent kip1 kip1 plasmic p27 promotes cytoskeleton remodeling that is kinase inhibitor, p27 . important for tumor cell motility and dissemination. In Kip1 particular, subcellular location of p27 is significantly APP modulates breast cancer cell survival correlated with survival of breast cancer patients [29,30]. The reduction of breast tumor growth may result not kip1 In order to verify functional competency of p27 as a only from blocking cell cycle progression but also the in- cell cycle inhibitor, we analyzed cellular localization of duction of programmed cell death. Thus, we examined if kip1 p27 with immunocytochemistry. A substantial amount knockdown of APP expression induces cell death in kip1 of p27 is still located in nuclear compartment of APP- MCF10A and MDA-MB-231 cell lines. Knocking down kd cells even after one hour in serum-containing medium of APP in M-II cells significantly induced apoptotic kip1 (Figure 2D). Conversely, in control cells, p27 located in markers such as cleavage product of PARP and cleaved nuclei required much longer exposure time to be displayed caspase-3 in contrast to the normal immortalized M-I owing to the substantial decrease of total protein with 10% cells which did not sensitively induce such apoptotic serum stimulation, and potentially the redistribution of markers. Moreover, M-III and M-IV showed such apop- kip1 p27 to cytoplasmic compartment. These results indicate totic markers to a much greater extent (Figure 3A), kip1 that serum-sensitive signaling pathways regulating p27 suggesting that the cell survival of advanced breast cancer expression and cytoplasmic translocation were skewed by cells is more dependent on APP expression than non- kip1 Figure 2 APP involved in the induction of cell cycle inhibitor p27 in breast cancer cells. (A) Knock-down of APP in MDA-MB-231 cells using two different shRNA constructs of APP (shAPP-5 and shAPP-7) resulted in marked suppression of both cellular and soluble form of APP kip1 kip1 cip1 expression. The p27 expression was elevated in shAPP-5 and shAPP-7 cells. (B) The p27 and p21 expression was evaluated in M-I and M-IV after introduction of shluc, shAPP-5, or shAPP-7. (C) The control and shAPP-7 cells were incubated in serum deprived medium for 3 hours kip1 cip1 and then released with 10% serum for the indicated time points. The cells were harvested and subjected to assessment of p27 and p21 expression. (D) The cells incubated in serum-free medium for 18 hours were treated with 10% serum for 60 minutes and then the images were kip1 kip1 acquired to show subcellular localization of p27 . The nuclear localized p27 was confirmed by merging with DAPI images. The longer image kip1 kip1 acquisition was needed to detect p27 in the control (shluc) cells due to the low expression of p27 . Scale bar = 20 μm. Lim et al. BMC Cancer 2014, 14:928 Page 6 of 12 http://www.biomedcentral.com/1471-2407/14/928 malignant breast epithelial cells (M-I). Next, we assessed (Figure 3C and 3D). These results clearly indicate that the induction of apoptotic markers in MDA-MB-231 and APP expression on breast cancer cells is closely interelated the sensitivity to therapeutic agents such as recombinant with cell survival. tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL), or 5-Fluorouracil (5-FU). TRAIL has been APP affects cell growth in 3D culture and in xenografted tested as a potential therapeutic agent for various types of mouse model cancer in clinical trials [31], and 5-FU is a conventional In order to solidify the finding of APP functions on cell chemotherapeutic agent that is commonly used for cancer growth, we employed three-dimensional (3D) cultures of therapy [32]. The cleaved capase-3 and PARP were breast cancer cells in reconstituted basement membrane augmented in MDA-MB-231 APP-kd cells (shAPP-5 or (Matrigel, BD Bioscience). It is widely recognized that shAPP-7) (Figure 3B) which were consistent with the the 3D cultures offer many microenvironmental cues results from M-III and M-IV cells (Figure 3A). The induc- which reconstitute in vivo tumor cell behavior [33,34]. tion of apoptosis by knockdown of APP was also con- The APP-kd MDA-MB-231 cells and its counterpart firmed by FACS analysis with staining for Annexin V and were cultured in 3D Matrigel up to 7 days. The control propidium iodide (PI). The apoptotic cell populations with MDA-MB-231 cells showed higher tumor growth than Annexin V-high and PI-low were obviously increased in APP-kd cells. Interestingly, control MDA-MB-231 cells APP-kd cells showing about 25-fold (shAPP-5) and 14- showed stellate 3D phenotype whereas APP-kd cells dis- fold (shAPP-7) induction as compared to control played more round forms (Figure 4A and 4B). Since the Figure 3 Reduction of APP expression is associated with the apoptotic induction in breast cancer cells. (A) A series of MCF-10A cells were infected with lentivirus encoding control (shluc) or APP shRNA (shAPP-7) and then tested for APP expression by immunoblotting. Under this condition, alteration of apoptotic indicators such as cleaved PARP and cleaved Caspase-3 were compared. (B) MDA-MB-231 cells were infected with lentivirus encoding shluc, shAPP-5, or shAPP-7. Each cell line was treated with TRAIL (10 ng/ml) or 5-FU (200 μM) for 24 hours. (C, D) The on-going early apoptotic events were compared by staining for extracellular Annexin V and cell viability with propidium iodide (PI). The apoptotic cell populations with Annexin V high and PI low were indicated as percentage. Lim et al. BMC Cancer 2014, 14:928 Page 7 of 12 http://www.biomedcentral.com/1471-2407/14/928 characteristics of 3D morphology may represent func- APP is engaged in IGF1-induced AKT activation tional and genetic alteration of cancer cells as shown in To understand the underlying mechanism of the effect of altered E-cadherin expression [35,36], the 3D morpho- APP on breast cancer cells, we examined the signaling kip1 logical change of APP-kd cells would result in behavioral pathways potentially linked to p27 and apoptotic induc- and functional conversion. To confirm these in vitro tion in APP-kd cells. MDA-MB-231 cells are known to findings further, we examined the effect of APP in the possess both K-Ras and B-Raf oncogenic mutations [37] tumor xenograft mouse model. We injected the control which regulate ERK pathway. Thus, we examined the effect or APP-kd MDA-MB-231 cells (2x10 ) subcutaneously of APP-kd on ERK activation. After EGF treatment, APP to nude mice and maintained the mice for 6 weeks. Con- knockdown failed to reduce ERK activation at both basal sistent with the findings in cell culture models, APP-kd and EGF-stimulated conditions of MDA-MB-231 cells cells showed significantly reduced tumor forming ability (Figure 5A). In addition, NF-κB activation, which is im- in vivo compared to control (Figure 4C). As an independ- portant for cell survival, was unaffected by APP knock- ent experiment, we subcutaneously injected further re- down, as indicated by similar level of I-kB degradation and duced numbers (2.5×10 ) of MDA-MB-231 cells (groups p-p65 (Ser536) post LPS stimulation (Figure 5B), suggest- of control and APP-kd) and then measured tumor size ing both pathways are not likely responsible either for kip1 over time. As a result of measurement up to 28-days post p27 or apoptotic induction in APP-kd cells. Next, we injection, there was a significant difference in tumor vol- examined IGF-1/AKT signaling pathway in APP-kd cells ume between control and APP-kd groups (Figure 4D). since AKT/FOXO signaling axis have been identified as Tumor growth was negligible and difficult to measure in critical signaling intermediates for breast cancer survival, APP-kd group up to 22-days. These 3D culture and growth, and migration as well as therapeutic drug resist- in vivo xenograft studies strongly support the role of APP ance [38,39]. In the APP-kd cells, IGF-1-induced AKT in the promotion of breast cancer cell growth. phosphorylation at T308/S473 was evidently decreased A B P<0.027 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 Vector shAPP-7 C D shLuc shAPP-7 P<0.01 Day10 day14 day18 day22 day26 Days post injection Figure 4 APP modulates breast cancer cell growth in 3D culture and in xenografted model. MDA-MB-231 cells were subjected to 3D Matrigel on-top assay. The cells were seeded (2x10 /well) in 48-well plate coated with Matrigel in triplicate and then cultured for 7 days with medium change in every two days. The morphology of growing cells were obtained (A) and followed by MTT assay (B). (C) The control and shAPP-7 MDA-MB-231 (2x10 ) cells were injected into nude mice s.c. (n = 6) and allowed to grow for 6 weeks. The grown tumors were excised and the grown tumor size compared. (Scale bar = 1cm) (D) The independent xenograft study (2.5x10 cells s.c injected; n = 5, respectively) revealed that shAPP-7 MDA-MB-231 cell growth rate was largely decreased as compared to control group (p < 0.01). shAPP-7 shluc shAPP-7 Vector Tumor volume (mm ) MTT Assay (A570nm) Lim et al. BMC Cancer 2014, 14:928 Page 8 of 12 http://www.biomedcentral.com/1471-2407/14/928 over total Akt and, concurrently, AKT-mediated GSK3β elevated APP expression in breast cancer may promote cell phosphorylation at Ser 9 was reduced (Figure 5C). Knock growth and survival by the induction of AKT-FOXO and down of APP also significantly reduced the phosphoryl- AKT- GSK3β signaling cascades. ation of FOXO, a main substrate of AKT and a transcrip- tion factor that regulates cell cycle progression through APP reduction reduces cell motility in MDA-MB-231 cells cip1 induction of cell cycle inhibitors including p21 and Since APP expression has been linked to cell migration kip1 p27 . AKT is known to suppress FOXO family by indu- [6,16], we explored the role of APP in cell migration and cing phosphorylation, nuclear export, and degradation invasion of MDA-MB-231. The confluent control (shLuc) cip1 kip1 which lead to subsequent p21 and/or p27 reduction and APP-kd (shAPP-5 or shAPP-7) cell cultures were [40]. AKT can also directly phosphorylate and regulate wounded and allowed to migrate into the wounded area kip1 p27 cytoplasmic redistribution [41]. As demonstrated in in low serum containing medium with or without IGF-1. kip1 Figure 2, p27 remained in the nucleus for a longer time APP-kd cells showed very limited cell migration into in APP-kd cells after serum release. Thus, it is likely that the wounded space compared to the control cells in the mitigated AKT activation in APP-kd cells resulted in higher absence of any stimulation. Moreover, upon IGF-1 treat- kip1 p27 expression and prolonged retention in nucleus. ment, more substantial difference in cell migration was Next, we examined the change of GSK3β downstream tar- observed between control and APP-kd cells (Figure 6A). get proteins (Figure 5D). The expression of β-catenin and Next, we assessed the cell migration ability of APP-kd its downstream targets such as survivin and CD44, but not MDA-MB-231 cells in transwell chambers. As was ob- Cyclin D1 were affected by knockdown of APP likely served in the wound healing assay, APP-kd cells exhibited through AKT-GSK3β axis. These findings indicate that limited migration ability with about 50% reduction in Figure 5 APP significantly impacts IGF-1-mediated activation of AKT and its downstream effectors. Both MDA-MB-231 control (shluc) and APP-kd (shAPP) cells were treated with EGF (50 ng/ml), LPS (100 ng/ml), or IGF-1 (100 ng/ml) as indicated. (A) EGF-mediated Erk activation was assessed in the APP knock-down cells post stimulation with EGF. (B) LPS-mediated activation of pro-inflammatory response in the APP knockdown cells was tested by demonstrating the level of IκBα expression and NF-κB activation (phosphorylated p65 at S536). (C) IGF-1-stimulated Akt activation and phosphorylation of Akt target proteins such as GSK3β (S9) and FOXO1 (T24) were examined. (D) APP affects the expression of β-Catenin, a target of GSK3β, and its downstream targets such as Survivin and CD44, but not Cyclin D1. Lim et al. BMC Cancer 2014, 14:928 Page 9 of 12 http://www.biomedcentral.com/1471-2407/14/928 untreated cells and 75% reduction in IGF-1 treated cells containing various grades of breast cancer tissues and (Figure 6B and 6C). Notably, MDA-MB-231 control cells normal breast tissues was analyzed with an anti-APP treated with IGF-1 showed spindle-like mesenchymal cell antibody (22C11). In the normal breast tissues, there morphology whereas APP-kd cells did not, suggesting the was minimal to no staining of the breast epithelium. potential role of APP during cell invasion and metastasis However, the vast majority of the invasive breast carcin- through regulation of epithelial-mesenchymal transition omas showed some degree of APP expression. In total, (EMT). Taken together, our data indicate that APP is there were 40 invasive breast carcinomas that could be involved in the regulation of cell motility triggered by evaluated on the TMA sections stained with 22C11 anti- IGF-1 and APP might be an attractive therapeutic target body. No staining was observed in 3 (7.5%) of the cases. to prevent cell invasion and metastasis. Weak staining was observed in 10 (25%) of the cases, moderate staining in 18 (45%), and strong staining in 9 Increased expression of APP in human breast cancer tissues (22.5%). Though the number of cases in this series is In order to examine the clinical relevance of APP small, there was a trend seen where the higher grade expression in breast cancer, a tissue microarray (TMA) tumors showed more intense staining than the lower Figure 6 APP promotes cell migration of MDA-MB-231 and its expression is elevated in invasive breast cancer of human tissues. (A) The cell motility of APP knockdown (shAPP) MDA-MB-231 was examined in wound healing assay. Following the wounding, cells were untreated or treated with IGF-1 (25 ng/ml) for 18 hours in 0.1% serum containing medium. Cells were then fixed and stained for clear demonstration (scale bar = 200 μm). (B) The role of APP for cell migration was evaluated in Boyden chamber assay in serum-free medium with or without IGF-1 (50 ng/ml) for 18 hours. The rectangular area was further magnified for demonstration of different cell morphology. (C) The migrated cells in panel B were counted in three randomly selected areas. (D) No staining for APP (22C11) is present in this normal terminal duct lobular unit. (E) The well-differentiated grade 1 invasive ductal carcinoma shows weak staining for APP. (F) The poorly-differentiated grade 3 invasive ductal carcinoma shows strong staining for APP. Scale bar = 100 μm. Lim et al. BMC Cancer 2014, 14:928 Page 10 of 12 http://www.biomedcentral.com/1471-2407/14/928 grade tumors overall (Figure 6D-F). These results strongly other combinatorial genetic modifications. These results support our hypothesis that elevated APP expression has strongly suggest that the pathological role of APP in breast close correlation with tumor cell growth and progression. cancer pathogenesis works diversely upon the cellular context and this needs to be addressed in the future study. Discussion Our data also suggest that APP is involved in IGF-1/ Our data strongly indicate the pathological role of APP in AKT signaling pathways, which are key regulatory path- breast cancer. First, we demonstrated increased expression ways for cell growth and survival of breast cancer. APP-kd APP in breast cancer cells and its correlation with malig- cells displayed mitigated AKT activation which leads to nancy. Second, the inhibition of APP expression in breast decreased inhibitory phosphorylation of GSK3β (Ser9) and cancer cells effectively prevents cell growth and motility FOXO1 (T24). GSK3β is known to suppress β-catenin- in vitro and in vivo models. Third, we also demonstrated dependent oncogenic signaling pathway by phosphorylating that APP is mechanistically linked to the AKT/FOXO and β-Catenin [44,45]. Activation of β-catenin is reported in AKT/GSK3-β pathways which are known to modulate cell subgroup of triple negative breast cancers (i.e., aggressive growth, survival, and invasion of breast cancer cells breast cancers possessing lack of estrogen receptor, kip1 through the regulation of target genes including p27 progesterone receptor, and Her2 receptor expression) and and survivin. Importantly, knocking down of APP expres- is associated with poor clinical outcomes [44]. On the other sion resulted in retarded cell growth in vitro and in vivo hand, FOXO family including FOXO1 can induce cell kip1 cip1 xenografted mouse model. We found that the slower cell cycle inhibitors (e.g., p27 ,p21 ) and pro-apoptotic proliferation was, in part, caused by the upregulated cell molecules (e.g., BIM, BNIP3, FASL, TRAIL, and survivin) kip1 cycle inhibitor p27 expression in APP-kd cells. Thus, [46]. The anti-apoptotic protein, survivin, is a family increased APP expression is inversely correlated with member of inhibitors of apoptosis (IAP) which embodies kip1 p27 expression in malignant breast cancers. Since the diverse cellular function, encompassing mitosis, metabol- kip1 reduced p27 expression is correlated with tumor ism, and survival by promoting adaptation to stresses aggressiveness and poor patient survival [29], this finding [47]. As such, FOXO-survivin and β-catenin-survivin suggests that APP plays a significant role in regulation of regulatory pathways are considered to play an essential kip1 p27 in a malignant human breast cancer. In addition, role for the expression of survivin in breast cancer knockdown of APP in breast cancers augmented apoptotic [38,44]. Thus, our results strongly suggest that APP- markers and it is likely that advanced breast cancers mediated regulation of AKT/FOXO and AKT/GSK3β (M-II, M-III, and M-IV) with knockdown of APP are pathways are playing a significant role for breast cancer more prone to enter into apoptosis. Similarly, in addition development. Supporting this hypothesis, a previous to the result of MCF-10A cells, APP knockdown in MDA- study demonstrated that sAPPα stimulates AKT/GSK3β MB-231 promotes sensitivity to therapeutic treatments of pathway in neuronal cells and consequently resulted in TRAIL or 5-FU, implying that targeting APP in malig- its neuroprotective effect [48]. nant breast cancers may promote the sensitivity to Interestingly, APP is also known to promote cell migra- therapeutic drugs. Since homozygous APP-deficient tion in neuronal progenitor cells [16] and engage in neur- mice are viable and normal in development [42], it onal growth cone adhesion where it plays a role as an seemsthatnormalbreastepithelialcellgrowthisnot independently operating cell adhesion molecule for bind- affected by knockdown of APP expression. However, ing to extracellular matrices such as laminin [6]. Acquiring advanced breast cancers may struggle to survive in the cell motility is a key aspect enabling cancer cells to invade absence of APP, presumably because they have evolved to into adjacent tissue and disseminate into the secondary survive better, at least in part, in an APP-dependent organs. We therefore examined the cell motility and inva- manner. After the submission of this manuscript, sion ability of MDA-MB-231 after knocking down of APP Goodarzi et al. [43] published an article demonstrating expression. Upon stimulation with IGF-1 that promotes the biological effect of APP in the regulation of breast cell migration and cancer metastasis, APP-kd cells migrate cancer progression. Their results suggest that APP might slowly in response to IGF-1 partly due to limited activa- suppress aggressiveness of breast cancer cells. While those tion of AKT. It is well known that AKT plays an import- results are not overlapped with the phenotype of our APP ant role in the process of EMT via repression of E-cadhrin knockdown experiments, both reports strongly suggest the [49]. In addition, β-catenin is also closely engaged in EMT pathological role of APP in breast cancer pathogenesis. and cell migration [50,51]. Our findings that APP is func- The discrepancy between two studies might be explained tionally linked with AKT activation and GSK-3β/β-catenin by different cellular conditions used in the studies. While pathways warrant the future study that elevated APP in they examined the role of APP under the condition of malignant breast cancers is associated with dissemination TARBP2 knockdown, our study examined a direct function of breast cancer into other target organs by promoting of APP in the parental MDA-MB-231 cells without any EMT process. Lim et al. BMC Cancer 2014, 14:928 Page 11 of 12 http://www.biomedcentral.com/1471-2407/14/928 Conclusions adult hippocampal neural progenitor cells. Hippocampus 2012, 22(7):1517–1527. In summary, we found that the expression of APP is 8. Hoffmann J, Twiesselmann C, Kummer MP, Romagnoli P, Herzog V: Apossible increased both in mouse and human malignant breast role for the Alzheimer amyloid precursor protein in the regulation of cancer cell lines and similarly in human breast cancer epidermal basal cell proliferation. Eur J Cell Biol 2000, 79(12):905–914. 9. Pietrzik CU, Hoffmann J, Stober K, Chen CY, Bauer C, Otero DA, Roch JM, tissues. The APP expression is important to regulate cell Herzog V: From differentiation to proliferation: the secretory amyloid growth, apoptosis, and motility of breast cancer, possibly precursor protein as a local mediator of growth in thyroid epithelial through engagement of AKT-mediated signaling pathways. cells. Proc Natl Acad Sci U S A 1998, 95(4):1770–1775. 10. Meng JY, Kataoka H, Itoh H, Koono M: Amyloid beta protein precursor is Overall, our findings provide substantial groundwork for involved in the growth of human colon carcinoma cell in vitro and the pathophysiological function of APP and its underlying in vivo. Int J Cancer 2001, 92(1):31–39. mechanism that promotes breast cancer malignancy. 11. Hansel DE, Rahman A, Wehner S, Herzog V, Yeo CJ, Maitra A: Increased expression and processing of the Alzheimer amyloid precursor protein in pancreatic cancer may influence cellular proliferation. Cancer Res 2003, Abbreviations 63(21):7032–7037. APP: Amyloid-β precursor protein; TMA: Tissue microArray; IGF-1: Insulin-like 12. Krause K, Karger S, Sheu SY, Aigner T, Kursawe R, Gimm O, Schmid KW, growth factor-1; DAPI: Diamidino-2-phenylindole; TRAIL: Tumor necrosis Dralle H, Fuhrer D: Evidence for a role of the amyloid precursor protein factor (TNF)-related apoptosis-inducing ligand; 5-FU: 5-Fluorouracil. in thyroid carcinogenesis. J Endocrinol 2008, 198(2):291–299. 13. Takayama K, Tsutsumi S, Suzuki T, Horie-Inoue K, Ikeda K, Kaneshiro K, Competing interests Fujimura T, Kumagai J, Urano T, Sakaki Y, Shirahige K, Sasano H, Takahashi S, The authors declare that they have no competing interests. Kitamura T, Ouchi Y, Aburatani H, Inoue S: Amyloid precursor protein is a primary androgen target gene that promotes prostate cancer growth. Authors’ contributions Cancer Res 2009, 69(1):137–142. SL and HGL conceived and designed the study. SL, HK, HL, HGL, and YL 14. Venkataramani V, Rossner C, Iffland L, Schweyer S, Tamboli IY, Walter J, contributed for the generation of stable cell lines and analyzed cellular and Wirths O, Bayer TA: Histone deacetylase inhibitor valproic acid inhibits molecular effects of APP knockdown in cell growth, apoptosis, and invasion cancer cell proliferation via down-regulation of the alzheimer amyloid (cell proliferation assay, cell cycle analysis, RT-PCR, flow cytometry, Western precursor protein. JBiolChem 2010, 285(14):10678–10689. blots); HLG and HGL analyzed human breast cancer tissue array data. SL, SK, 15. Takagi K, Ito S, Miyazaki T, Miki Y, Shibahara Y, Ishida T, Watanabe M, Inoue JL, and HGL participated in the data analysis; BY and SL coordinated the S, Sasano H, Suzuki T: Amyloid precursor protein (APP) in human breast mouse xenograft study and SL and HGL wrote the manuscript. All authors cancer: an androgen-induced gene associated with cell proliferation. have read and approved the final manuscript. Cancer Sci 2013, 104(11):1532–1538. 16. Young-Pearse TL, Bai J, Chang R, Zheng JB, LoTurco JJ, Selkoe DJ: Acritical function for beta-amyloid precursor protein in neuronal migration revealed Acknowledgements by in utero RNA interference. JNeurosci 2007, 27(52):14459–14469. We thank Sandra Siedlak for the technical assistance. This study was 17. Young-Pearse TL, Chen AC, Chang R, Marquez C, Selkoe DJ: Secreted APP supported by the National Institutes of Health (AG028679) to HGL. regulates the function of full-length APP in neurite outgrowth through interaction with integrin beta1. Neural Dev 2008, 3:15. Author details Department of Pediatrics, Case Comprehensive Cancer Center, Case Western 18. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D: Global cancer Reserve University School of Medicine, 2103 Cornell Road, Cleveland, OH statistics. Cancer J Clin 2011, 61(2):69–90. 44106, USA. Department Pathology, Case Western Reserve University School 19. Hong S, Lim S, Li AG, Lee C, Lee YS, Lee EK, Park SH, Wang XJ, Kim SJ: of Medicine, 2103 Cornell Road, Cleveland, OH 44106, USA. Department Smad7 binds to the adaptors TAB2 and TAB3 to block recruitment of Pharmacology, Case Western Reserve University School of Medicine, the kinase TAK1 to the adaptor TRAF2. Nat Immunol 2007, 8(5):504–513. Cleveland, OH 44106, USA. Department of Human and Molecular Genetics, 20. Harris JA, Devidze N, Verret L, Ho K, Halabisky B, Thwin MT, Kim D, Hamto P, Virginia Commonwealth University School of Medicine, Richmond, VA, USA. Lo I, Yu GQ, Palop JJ, Masliah E, Mucke L: Transsynaptic progression of 5 6 CHA Cancer Institute, CHA University, Seoul 135-081, Korea. The Angie amyloid-beta-induced neuronal dysfunction within the entorhinal- Fowler Adolescent and Young Adult Cancer Institute, University Hospitals hippocampal network. Neuron 2010, 68(3):428–441. Rainbow Children's Hospital, Cleveland, OH 44106, USA. 21. Minn AJ, Gupta GP, Siegel PM, Bos PD, Shu W, Giri DD, Viale A, Olshen AB, Gerald WL, Massague J: Genes that mediate breast cancer metastasis to Received: 15 April 2014 Accepted: 5 December 2014 lung. Nature 2005, 436(7050):518–524. Published: 10 December 2014 22. Tang B, Vu M, Booker T, Santner SJ, Miller FR, Anver MR, Wakefield LM: TGF-beta switches from tumor suppressor to prometastatic factor in a model of breast cancer progression. J Clin Invest 2003, 112(7):1116–1124. References 23. Miller FR, Soule HD, Tait L, Pauley RJ, Wolman SR, Dawson PJ, Heppner GH: 1. O’Brien RJ, Wong PC: Amyloid precursor protein processing and Xenograft model of progressive human proliferative breast disease. Alzheimer’s disease. Annu Rev Neurosci 2011, 34:185–204. J Natl Cancer Inst 1993, 85(21):1725–1732. 2. Hardy JA, Higgins GA: Alzheimer’s disease: the amyloid cascade 24. Aslakson CJ, Miller FR: Selective events in the metastatic process defined hypothesis. Science 1992, 256(5054):184–185. by analysis of the sequential dissemination of subpopulations of a 3. De Strooper B, Annaert W: Proteolytic processing and cell biological mouse mammary tumor. Cancer Res 1992, 52(6):1399–1405. functions of the amyloid precursor protein. J Cell Sci 2000, 25. Mattson MP: Cellular actions of beta-amyloid precursor protein and its 113(Pt 11):1857–1870. soluble and fibrillogenic derivatives. Physiol Rev 1997, 77(4):1081–1132. 4. Jacobsen KT, Iverfeldt K: Amyloid precursor protein and its homologues: a 26. Kummer C, Wehner S, Quast T, Werner S, Herzog V: Expression and family of proteolysis-dependent receptors. Cell Mol Life Sci 2009, potential function of beta-amyloid precursor proteins during cutaneous 66(14):2299–2318. wound repair. Exp Cell Res 2002, 280(2):222–232. 5. Sheng B, Song B, Zheng Z, Zhou F, Lu G, Zhao N, Zhang X, Gong Y: 27. Sherr CJ, Roberts JM: CDK inhibitors: positive and negative regulators of Abnormal cleavage of APP impairs its functions in cell adhesion and G1-phase progression. Genes Dev 1999, 13(12):1501–1512. migration. Neurosci Lett 2009, 450(3):327–331. 28. Caldon CE, Daly RJ, Sutherland RL, Musgrove EA: Cell cycle control in 6. Sosa LJ, Bergman J, Estrada-Bernal A, Glorioso TJ, Kittelson JM, Pfenninger breast cancer cells. J Cell Biochem 2006, 97(2):261–274. KH: Amyloid precursor protein is an autonomous growth cone adhesion molecule engaged in contact guidance. PLoS One 2013, 8(5):e64521. 29. Chu IM, Hengst L, Slingerland JM: The Cdk inhibitor p27 in human cancer: 7. Baratchi S, Evans J, Tate WP, Abraham WC, Connor B: Secreted amyloid prognostic potential and relevance to anticancer therapy. Nat Rev 2008, precursor proteins promote proliferation and glial differentiation of 8(4):253–267. Lim et al. BMC Cancer 2014, 14:928 Page 12 of 12 http://www.biomedcentral.com/1471-2407/14/928 30. Wander SA, Zhao D, Slingerland JM: p27: a barometer of signaling deregulation and potential predictor of response to targeted therapies. Clin Cancer Res 2011, 17(1):12–18. 31. Mahalingam D, Szegezdi E, Keane M, de Jong S, Samali A: TRAIL receptor signalling and modulation: Are we on the right TRAIL? Cancer Treat Rev 2009, 35(3):280–288. 32. Joensuu H, Gligorov J: Adjuvant treatments for triple-negative breast cancers. Ann Oncol 2012, 23(Suppl 6):vi40–vi45. 33. Lee GY, Kenny PA, Lee EH, Bissell MJ: Three-dimensional culture models of normal and malignant breast epithelial cells. Nat Methods 2007, 4(4):359–365. 34. Schmeichel KL, Bissell MJ: Modeling tissue-specific signaling and organ function in three dimensions. J Cell Sci 2003, 116(Pt 12):2377–2388. 35. Weigelt B, Bissell MJ: Unraveling the microenvironmental influences on the normal mammary gland and breast cancer. Semin Cancer Biol 2008, 18(5):311–321. 36. Kenny PA, Lee GY, Myers CA, Neve RM, Semeiks JR, Spellman PT, Lorenz K, Lee EH, Barcellos-Hoff MH, Petersen OW, Gray JW, Bissell MJ: The morphologies of breast cancer cell lines in three-dimensional assays correlate with their profiles of gene expression. Mol Oncol 2007, 1(1):84–96. 37. Hollestelle A, Elstrodt F, Nagel JH, Kallemeijn WW, Schutte M: Phosphatidylinositol-3-OH kinase or RAS pathway mutations in human breast cancer cell lines. Mol Cancer Res 2007, 5(2):195–201. 38. Chakrabarty A, Bhola NE, Sutton C, Ghosh R, Kuba MG, Dave B, Chang JC, Arteaga CL: Trastuzumab-resistant cells rely on a HER2-PI3K-FoxO-survivin axis and are sensitive to PI3K inhibitors. Cancer Res 2013, 73(3):1190–1200. 39. Rexer BN, Arteaga CL: Optimal targeting of HER2-PI3K signaling in breast cancer: mechanistic insights and clinical implications. Cancer Res 2013, 73(13):3817–3820. 40. Tzivion G, Dobson M, Ramakrishnan G: FoxO transcription factors; Regulation by AKT and 14-3-3 proteins. Biochim Biophys Acta 2011, 1813(11):1938–1945. 41. Clarke RB: p27KIP1 phosphorylation by PKB/Akt leads to poor breast cancer prognosis. Breast Cancer Res 2003, 5(3):162–163. 42. Zheng H, Jiang M, Trumbauer ME, Hopkins R, Sirinathsinghji DJ, Stevens KA, Conner MW, Slunt HH, Sisodia SS, Chen HY, Van der Ploeg LH: Mice deficient for the amyloid precursor protein gene. Ann N Y Acad Sci 1996, 777:421–426. 43. Goodarzi H, Zhang S, Buss CG, Fish L, Tavazoie S, Tavazoie SF: Metastasis- suppressor transcript destabilization through TARBP2 binding of mRNA hairpins. Nature 2014, 513(7517):256–260. 44. King TD, Suto MJ, Li Y: The Wnt/beta-catenin signaling pathway: a potential therapeutic target in the treatment of triple negative breast cancer. J Cell Biochem 2012, 113(1):13–18. 45. Incassati A, Chandramouli A, Eelkema R, Cowin P: Key signaling nodes in mammary gland development and cancer: beta-catenin. Breast Cancer Res 2010, 12(6):213. 46. Yang JY, Hung MC: Deciphering the role of forkhead transcription factors in cancer therapy. Curr Drug Targets 2011, 12(9):1284–1290. 47. Srinivasula SM, Ashwell JD: IAPs: what’s in a name? Mol Cell 2008, 30(2):123–135. 48. Jimenez S, Torres M, Vizuete M, Sanchez-Varo R, Sanchez-Mejias E, Trujillo- Estrada L, Carmona-Cuenca I, Caballero C, Ruano D, Gutierrez A, Vitorica J: Age-dependent accumulation of soluble amyloid beta (Abeta) oligomers reverses the neuroprotective effect of soluble amyloid precursor protein- alpha (sAPP(alpha)) by modulating phosphatidylinositol 3-kinase (PI3K)/ Akt-GSK-3beta pathway in Alzheimer mouse model. J Biol Chem 2011, 286(21):18414–18425. 49. Larue L, Bellacosa A: Epithelial-mesenchymal transition in development and cancer: role of phosphatidylinositol 3′ kinase/AKT pathways. Submit your next manuscript to BioMed Central Oncogene 2005, 24(50):7443–7454. and take full advantage of: 50. Gilles C, Polette M, Mestdagt M, Nawrocki-Raby B, Ruggeri P, Birembaut P, Foidart JM: Transactivation of vimentin by beta-catenin in human breast cancer cells. Cancer Res 2003, 63(10):2658–2664. • Convenient online submission 51. Roxanis I: Occurrence and significance of epithelial-mesenchymal transition • Thorough peer review in breast cancer. J Clin Pathol 2013, 66(6):517–521. • No space constraints or color figure charges doi:10.1186/1471-2407-14-928 • Immediate publication on acceptance Cite this article as: Lim et al.: Amyloid-β precursor protein promotes cell • Inclusion in PubMed, CAS, Scopus and Google Scholar proliferation and motility of advanced breast cancer. BMC Cancer 2014 14:928. • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png BMC Cancer Springer Journals

Amyloid-β precursor protein promotes cell proliferation and motility of advanced breast cancer

Loading next page...
 
/lp/springer-journals/amyloid-precursor-protein-promotes-cell-proliferation-and-motility-of-Z7DA4k6243

References (51)

Publisher
Springer Journals
Copyright
Copyright © 2014 by Lim et al.; licensee BioMed Central Ltd.
Subject
Biomedicine; Cancer Research; Oncology; Surgical Oncology; Health Promotion and Disease Prevention; Biomedicine general; Medicine/Public Health, general
eISSN
1471-2407
DOI
10.1186/1471-2407-14-928
pmid
25491510
Publisher site
See Article on Publisher Site

Abstract

Background: Amyloid-β precursor protein (APP) is a highly conserved single transmembrane protein that has been linked to Alzheimer disease. Recently, the increased expression of APP in multiple types of cancers has been reported where it has significant correlation with the cancer cell proliferation. However, the function of APP in the pathogenesis of breast cancer has not previously been determined. In this study, we studied the pathological role of APP in breast cancer and revealed its potential mechanism. Methods: The expression level of APP in multiple breast cancer cell lines was measured by Western blot analysis and the breast cancer tissue microarray was utilized to analyze the expression pattern of APP in human patient specimens. To interrogate the functional role of APP in cell growth and apoptosis, the effect of APP knockdown in MDA-MB-231 cells were analyzed. Specifically, multiple signal transduction pathways and functional alterations linked to cell survival and motility were examined in in vivo animal modelaswellas in vitro cell culture with the manipulation of APP expression. Results: We found that the expression of APP is increased in mouse and human breast cancer cell lines, especially in the cell line possessing higher metastatic potential. Moreover, the analysis of human breast cancer tissues revealed a significant correlation between the level of APP and tumor development. Knockdown of APP (APP-kd) in breast cancer kip1 cells caused the retardation of cell growth in vitro and in vivo, with both the induction of p27 and caspase-3-mediated apoptosis. APP-kd cells also had higher sensitivity to treatment of chemotherapeutic agents, TRAIL and 5-FU. Such anti-tumorigenic effects shown in the APP-kd cells partially came from reduced pro-survival AKT activation in response to IGF-1, leading to activation of key signaling regulators for cell growth, survival, and pro-apoptotic events such as GSK3-β and FOXO1. Notably, knock-down of APP in metastatic breast cancer cells limited cell migration and invasion ability upon stimulation of IGF-1. Conclusion: The present data strongly suggest that the increase of APP expression is causally linked to tumorigenicity as well as invasion of aggressive breast cancer and, therefore, the targeting of APP may be an effective therapy for breast cancer. kip1 Keywords: AKT, Amyloid-β precursor protein, Apoptosis, Breast cancer, Invasion, p27 * Correspondence: sxl269@case.edu; hyoung-gon.lee@case.edu Department of Pediatrics, Case Comprehensive Cancer Center, Case Western Reserve University School of Medicine, 2103 Cornell Road, Cleveland, OH 44106, USA Department Pathology, Case Western Reserve University School of Medicine, 2103 Cornell Road, Cleveland, OH 44106, USA Full list of author information is available at the end of the article © 2014 Lim et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Lim et al. BMC Cancer 2014, 14:928 Page 2 of 12 http://www.biomedcentral.com/1471-2407/14/928 Background RPMI supplemented with 10% (vol/vol) FBS, penicillin Amyloid-β precursor protein (APP) is a highly conserved (100 units/ml), and streptomycin (100 μg/ml; Invitrogen, single transmembrane protein with a receptor-like struc- Rockville, MD). The four human breast cancer cell lines ture and has been linked with Alzheimer disease [1,2] MCF10A1 (M-I), MCF10AT1k.cl2 (M-II), MCF10CA1h while its normal physiological function is unclear. Several (M-III), and MCF10CA1a.cl1 (M-IV) were obtained from APP isoforms derived from alternative splicing processes Dr. Anita Roberts (NCI/NIH, Bethesda, MD). M-I, M-II, have been reported and diverse products including soluble M-III, and M-IV cells were grown in DMEM/F12 (Invitro- APP (sAPP) or abnormal amyloid-β peptide through α-, β-, gen, Carlsbad, CA) containing 5% horse serum (Invitrogen) or γ-secretase-mediated cleavage(s) are post-translationally at 37°C with 5% CO . M-I and M-II cells were supple- generated [3,4]. APP is ubiquitously expressed in a broad mented additionally with 10 μg/ml insulin (Sigma, St. spectrum of cell types including non-neuronal cells, while Louis, MO), 20 ng/ml epidermal growth factor (Sigma), 0.5 the nature of APP has been mainly studied in neuronal μg/ml hydrocortisone (Sigma), and 100 ng/ml cholera cells due to its pathological significance in Alzheimer dis- toxin (Sigma). Antibodies specific for APP (22C11) were ease. Several pathophysiological functions of APP have purchased from EMD Millipore; APP (4G8) from Covance. been proposed such as its potential role in cell growth and Specific antibodies for p27(C-19) and p21 (F-5) were from cell adherence [5-7]. It has been demonstrated that APP is Santacruz and anti-β-actin (AC-15) was from Sigma. Anti- engaged in neuronal growth cone adhesion and plays a role bodies purchased from Cell Signaling were AKT (#9772), as an independently operating cell adhesion molecule for pAKT Thr308 (#4056), pAKT Ser473 (#9271), pFOXO1 binding to extracellular matrices such as laminin [6]. Thr24 (#9464), pGSK3 Ser9 (#9336), pp65 Ser536 Specifically, it has been reported that APP is linked to pro- (#3033), pERK1/2 (#9101), β-Catenin (#9562), PARP liferation of thyroid epithelial cells and epidermal basal cell (#9542), and cleaved Caspase-3 (#9661). Anti-survivin proliferation [8-11] and, interestingly, the increased ex- antibody (AB8228) was purchased from Abcam. The anti- pression of APP in several types of cancers including pan- CD44 antibody (#15675-1-AP) was from Proteintech creatic, lung, colon and breast cancer has been reported group and anti-GSK3b (KAP-ST002E) antibody was from [10-15]. These studies suggested that APP has growth- Stressgen. promoting effect as an autocrine growth factor while the underlying mechanism in the regulation of cellular signal- Knockdown of human APP using lentiviral infection ing and gene expression has not been fully explored. The system potential role of APP in cancer cell motility is also Knockdown of human endogenous APP gene expression supported by studies which show APP plays a role in was carried out using the lentivirus shRNA expression migration of neuronal precursor cells and neurite out- system and experimental method as previously described growth [16,17]. [19]. The target sequence of human APP (shAPP-5: 5’- In this study, we explored the pathological role of APP CCCTGTTCATTGTAAGCACTT, shAPP-7: 5’-GCAG in malignancy of breast cancer and its potential molecular ACACAGACTATGCAGAT) or control luciferase was mechanism related with cell proliferation and metastasis. used. In order to produce viral particles, the shRNA Breast cancer is the most common cancer diagnosed constructs and virus packaging plasmids were trans- among women worldwide [18] and metastatic breast can- fected into fresh 293T cells and then harvested the viral cer is significantly correlated with poor prognosis and a supernatant and filtered through 0.45 μm syringe filter main cause of death while the underlying molecular prior to infection. Target cells were infected with virus pathogenic mechanism still remains to be delineated. We by spinning at 2000 rpm for 30 min. Semi-quantitative found that the expression level of APP is mechanistically RT-PCR and immunoblotting were carried out to meas- linked with tumorigenicity and malignancy of breast ure knock-down efficiency. cancer. APP knockdown (APP-kd) in breast cancer cells kip1 reduced cell growth via p27 induction, promoting Western blotting and RT-PCR apoptosis, increasing sensitivity to therapeutic treatments, The cells were harvested and lysed in RIPA buffer. Equal and delayed cell migration and invasion ability upon amounts of protein were loaded and separated in SDS- stimulation. These results suggest that targeting APP may PAGE gel and then transferred to PVDF membrane. The effectively suppress the growth and invasion of malignant blot was incubated in blocking solution (5% milk/TBST) breast cancer cells. and then incubated with primary antibody followed by incubation with secondary HRP conjugated antibody for 1 Methods or 2 hours. The blot was washed 3 times for 5 minutes with Cell culture and reagents TBST between the incubations. Eventually, the change of MDA-MB-231 cells were grown in DMEM, and 67NR, target protein expression was detected by conducting reac- 4T07, and 4T1 breast cancer cell lines were grown in tion with Chemiluminescent Substrate (Thermo Scientific), Lim et al. BMC Cancer 2014, 14:928 Page 3 of 12 http://www.biomedcentral.com/1471-2407/14/928 exposing, and developing the film. RT-PCR for measuring performed in compliance with guidelines established by the level of APP mRNA expression was performed with the Institutional Animal Care and Use Committee at Case the primers specific to human APP [20]. Western Reserve University. Detection of apoptotic cell population Immunohistochemistry MDA-MB-231 cells (5×10 ) freshly infected with shLuc, The breast cancer tissue array was purchased from US shAPP-5, or shAPP-7 lentiviral particles were immedi- Biomax (Cat# BRC961). For immunohistochemistry for ately seeded in 6-well plates. In order to detect early the APP detection, the tissue microarrays were hydrated apoptotic events, we employed Annexin V staining through two changes of xylene and descending ethanol method (eBioscience) which can detect phosphatidylser- solutions for 10 min each, followed by a 30 min submer- ineonthe outerplasmamembraneuponinitiation of sion in 3% H O and finally Tris-buffered saline (TBS). 2 2 apoptosis. Cell viability staining was carried out using The slides were incubated in 10% normal goat serum propidium iodide (PI) to identify early-stage apoptotic (NGS) in TBS for 30 min and the primary antibody was cells. The FACS analysis was immediately followed after applied overnight. A monoclonal antibody specific to staining the cells. APP, 22C11 (recognizing the N-terminal domain of full length amyloid-β precursor protein; EMD Millipore, Cell growth assay 1:250), was applied to the microarrays and then the The control and APP-kd of MDA-MB-231cells (2×10 ) peroxidase-anti-peroxidase technique was employed and were seeded in 6-well plate in triplicate and maintained developed with 3′-3’-diaminobenzidine (Dako). in normal growth medium. The sub-confluently growing cells were counted using coulter counter (Beckman) at Statistical analysis day 2 and 4. Data are presented as means ± standard deviation. Differences between the experimental groups were com- Wound-healing assay and cell invasion assay pared with Student’s paired two tailed t-test. A p-value less To compare the cell motility, the MDA-MB-231 control than 0.05 was considered statistically significant. (shluc) or APP knockdown (shAPP-7) MDA-MB-231 cells were examined in wound healing assay. The conflu- Results ently grown cells were wounded with 200 μl tips and The level of APP expression is linked to malignancy of followed by either no treatment or treated with IGF-1 breast cancer cells (25 ng/ml) for 18 hours in 0.1% serum containing In order to investigate the correlation between APP expres- medium. Subsequently, cells were fixed with 2% parafor- sion and malignancy of breast cancer, the expression level maldehyde and then stained with rapid 3 step staining of APP was examined in a series of human and mouse set (Richard-Allen Scientific) for clear visualization of breast cancers with increasing malignancy. The four human migrated cells. The initial wounded edges were marked breast cancer cell lines MCF10A1 (M-I), MCF10AT1k.cl2 with dotted lines. Representative results from at least (M-II), MCF10CA1h (M-III), and MCF10CA1a.cl1 (M-IV) three independent experiments are shown. Cell invasion were used in which M-I cells are spontaneously immor- assays were performed by seeding cells in Boyden chamber talized from normal breast epithelial cells whereas M-II, M- (BD Bioscience) coated with matrigel in serum-free III, and M-IV cells are derived from M-I cells transformed medium with or without IGF-1 (50 ng/ml) in the bottom with Ha-Ras oncogene [22,23]. M-III cells are a well- of each wells for 18 hours. The migrated cells were visual- differentiated tumor derived from M-II xenografts while ized by staining and photographing under the microscope. M-IV cells are a poorly differentiated metastatic tumor de- rived from xenografts of M-II cells. In our analysis, the total Xenograft mouse model APP expression of both mature (upper band) and imma- The breast cancer cells were seeded freshly prior to in- ture (lower band) forms was significantly elevated approxi- jection. The control and shAPP MDA-MB-231 (1×10 ) mately 2 to 7-fold in MCF10A (M-II, -III, and -IV) cells cells were prepared in the solution (1:1) of PBS and compared to M-I cells (Figure 1A). This positive correlation growth factor-reduced matrigel and followed by injection between APP expression and malignancy was further con- into athymic nude mice subcutaneously. Primary tumor firmed in mouse breast cancer cells; 67NR, 4T07, and 4T1 outgrowth was monitored every 4 days by taking measure- cells which are derived from the same primary tumor [24]. ments of the tumor length (L) and width (W). Tumor vol- 67NR cells, which can form primary tumors without meta- ume was calculated as πLW /6 [21]. The mice were static ability, showed negligible APP expression whereas maintained up to 6 weeks and sacrificed for tumor exci- highly tumorigenic 4T07 and metastatic 4T1 cells express sion. The tumor growth was compared to the counterpart APP up to 8-fold (Figure 1B). These results suggest that and imaged. All animal housing and procedures were APP is functionally linked to the aggressiveness in breast Lim et al. BMC Cancer 2014, 14:928 Page 4 of 12 http://www.biomedcentral.com/1471-2407/14/928 Figure 1 The elevated expression of APP engaged in breast cancer cell proliferation. (A) APP expression is detected by 22C11 mouse monoclonal anti-APP antibody in human breast cancer cell lines and correlates with increasing malignancy. (+); a positive control of APP protein overexpressed in neuronal cells. (B) The expression of APP is compared in mouse breast cancer cells with increasing metastatic potential. (C) APP protein expression was present at a similar level in both M-IV and MDA-MB-231. Knock down of APP expression was verified in RT-PCR following lentiviral infection encoding shAPP in MDA-MB-231. APP knockdown resulted in decreased expression of APP and soluble APP. The equal volume of conditioned media was condensed by using Centricon and analyzed in Western blot. For the loading control, β-actin was uesd. (D) Cells (2x10 ) were seeded in 6-well plate and cell numbers counted using coulter counter at day 2 and 4. (E) MDA-MB-231 cells were seeded at two different numbers and the cell growth was compared by MTT assay. (F) MDA-MB-231 cells fixed and stained with propidium iodide (PI) were subjected to cell cycle analysis by FACS. tumor cells and contribute to maintaining their malignancy The cell cycle analysis showed that APP-kd cells were such as tumorigenic and metastatic ability. arrested largely in G1 phase (45.2%) compared to control (31.4%), but low percentage of APP-kd cells (19.4%) was Reduction of the expression of APP prevents cell growth in S phase as compared to that of control cells (25.5%) in MDA-MB-231 cells (Figure 1F). Retarded cell growth and G1 arrest of APP-kd We investigated the pathophysiological function of APP cells suggest that APP is likely engaged in expression of kip1 by knocking it down using the shRNA targeting APP in cell cycle inhibitors working on G1 phase such as p27 cip1 MDA-MB-231 malignant human breast cancer cells (Fig- and p21 [27,28]. ure 1A). Both mRNA and protein expression of APP were kip1 markedly reduced in APP-kd cells compared to control APP enhances cell proliferation via regulation of p27 cells (Figure 1C). APP protein expression of MDA-MB- To address whether APP regulates G1 phase cell cycle 231 was comparable to that of M-IV cells while MDA- inhibitors, the control and APP-kd cells grown in normal kip1 MB-231, but not M-IV cells, showed fair amount of growth medium were examined to compare p27 and/ cip1 soluble APP secretion that is known to enhance cell or p21 expression of APP-kd cells to control. In our kip1 growth and survival [25,26]. Next, we examined cell prolif- analysis, the level of p27 was dramatically induced in eration in normal growth medium with 10% FBS in the APP-kd cells compared to control (Figure 2A and 2B). cip1 control (shluc) and APP-kd (shAPP) cells. Consistent with However, p21 expression was unchanged or slightly our hypothesis, reduction of APP expression significantly affected by APP knockdown in multiple cell lines (M-I, affected cell proliferation and viability (Figure 1D,E). To M-IV and MDA-MB-231) (Figure 2B and 2C) suggesting kip1 confirm the effect of APP on cell growth further, we that APP regulates cell cycle by modulating p27 performed FACS analysis to determine cell cycle phase. specifically. Lim et al. BMC Cancer 2014, 14:928 Page 5 of 12 http://www.biomedcentral.com/1471-2407/14/928 kip1 It has been established that p27 has dual function as APP knockdown. These data also suggest that APP plays a either a tumor suppressor or promoter because nuclear crucial role for cell proliferation of malignant breast can- Kip1 p27 works as an anti-proliferative protein, while cyto- cers by modulating the expression of cyclin-dependent kip1 kip1 plasmic p27 promotes cytoskeleton remodeling that is kinase inhibitor, p27 . important for tumor cell motility and dissemination. In Kip1 particular, subcellular location of p27 is significantly APP modulates breast cancer cell survival correlated with survival of breast cancer patients [29,30]. The reduction of breast tumor growth may result not kip1 In order to verify functional competency of p27 as a only from blocking cell cycle progression but also the in- cell cycle inhibitor, we analyzed cellular localization of duction of programmed cell death. Thus, we examined if kip1 p27 with immunocytochemistry. A substantial amount knockdown of APP expression induces cell death in kip1 of p27 is still located in nuclear compartment of APP- MCF10A and MDA-MB-231 cell lines. Knocking down kd cells even after one hour in serum-containing medium of APP in M-II cells significantly induced apoptotic kip1 (Figure 2D). Conversely, in control cells, p27 located in markers such as cleavage product of PARP and cleaved nuclei required much longer exposure time to be displayed caspase-3 in contrast to the normal immortalized M-I owing to the substantial decrease of total protein with 10% cells which did not sensitively induce such apoptotic serum stimulation, and potentially the redistribution of markers. Moreover, M-III and M-IV showed such apop- kip1 p27 to cytoplasmic compartment. These results indicate totic markers to a much greater extent (Figure 3A), kip1 that serum-sensitive signaling pathways regulating p27 suggesting that the cell survival of advanced breast cancer expression and cytoplasmic translocation were skewed by cells is more dependent on APP expression than non- kip1 Figure 2 APP involved in the induction of cell cycle inhibitor p27 in breast cancer cells. (A) Knock-down of APP in MDA-MB-231 cells using two different shRNA constructs of APP (shAPP-5 and shAPP-7) resulted in marked suppression of both cellular and soluble form of APP kip1 kip1 cip1 expression. The p27 expression was elevated in shAPP-5 and shAPP-7 cells. (B) The p27 and p21 expression was evaluated in M-I and M-IV after introduction of shluc, shAPP-5, or shAPP-7. (C) The control and shAPP-7 cells were incubated in serum deprived medium for 3 hours kip1 cip1 and then released with 10% serum for the indicated time points. The cells were harvested and subjected to assessment of p27 and p21 expression. (D) The cells incubated in serum-free medium for 18 hours were treated with 10% serum for 60 minutes and then the images were kip1 kip1 acquired to show subcellular localization of p27 . The nuclear localized p27 was confirmed by merging with DAPI images. The longer image kip1 kip1 acquisition was needed to detect p27 in the control (shluc) cells due to the low expression of p27 . Scale bar = 20 μm. Lim et al. BMC Cancer 2014, 14:928 Page 6 of 12 http://www.biomedcentral.com/1471-2407/14/928 malignant breast epithelial cells (M-I). Next, we assessed (Figure 3C and 3D). These results clearly indicate that the induction of apoptotic markers in MDA-MB-231 and APP expression on breast cancer cells is closely interelated the sensitivity to therapeutic agents such as recombinant with cell survival. tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL), or 5-Fluorouracil (5-FU). TRAIL has been APP affects cell growth in 3D culture and in xenografted tested as a potential therapeutic agent for various types of mouse model cancer in clinical trials [31], and 5-FU is a conventional In order to solidify the finding of APP functions on cell chemotherapeutic agent that is commonly used for cancer growth, we employed three-dimensional (3D) cultures of therapy [32]. The cleaved capase-3 and PARP were breast cancer cells in reconstituted basement membrane augmented in MDA-MB-231 APP-kd cells (shAPP-5 or (Matrigel, BD Bioscience). It is widely recognized that shAPP-7) (Figure 3B) which were consistent with the the 3D cultures offer many microenvironmental cues results from M-III and M-IV cells (Figure 3A). The induc- which reconstitute in vivo tumor cell behavior [33,34]. tion of apoptosis by knockdown of APP was also con- The APP-kd MDA-MB-231 cells and its counterpart firmed by FACS analysis with staining for Annexin V and were cultured in 3D Matrigel up to 7 days. The control propidium iodide (PI). The apoptotic cell populations with MDA-MB-231 cells showed higher tumor growth than Annexin V-high and PI-low were obviously increased in APP-kd cells. Interestingly, control MDA-MB-231 cells APP-kd cells showing about 25-fold (shAPP-5) and 14- showed stellate 3D phenotype whereas APP-kd cells dis- fold (shAPP-7) induction as compared to control played more round forms (Figure 4A and 4B). Since the Figure 3 Reduction of APP expression is associated with the apoptotic induction in breast cancer cells. (A) A series of MCF-10A cells were infected with lentivirus encoding control (shluc) or APP shRNA (shAPP-7) and then tested for APP expression by immunoblotting. Under this condition, alteration of apoptotic indicators such as cleaved PARP and cleaved Caspase-3 were compared. (B) MDA-MB-231 cells were infected with lentivirus encoding shluc, shAPP-5, or shAPP-7. Each cell line was treated with TRAIL (10 ng/ml) or 5-FU (200 μM) for 24 hours. (C, D) The on-going early apoptotic events were compared by staining for extracellular Annexin V and cell viability with propidium iodide (PI). The apoptotic cell populations with Annexin V high and PI low were indicated as percentage. Lim et al. BMC Cancer 2014, 14:928 Page 7 of 12 http://www.biomedcentral.com/1471-2407/14/928 characteristics of 3D morphology may represent func- APP is engaged in IGF1-induced AKT activation tional and genetic alteration of cancer cells as shown in To understand the underlying mechanism of the effect of altered E-cadherin expression [35,36], the 3D morpho- APP on breast cancer cells, we examined the signaling kip1 logical change of APP-kd cells would result in behavioral pathways potentially linked to p27 and apoptotic induc- and functional conversion. To confirm these in vitro tion in APP-kd cells. MDA-MB-231 cells are known to findings further, we examined the effect of APP in the possess both K-Ras and B-Raf oncogenic mutations [37] tumor xenograft mouse model. We injected the control which regulate ERK pathway. Thus, we examined the effect or APP-kd MDA-MB-231 cells (2x10 ) subcutaneously of APP-kd on ERK activation. After EGF treatment, APP to nude mice and maintained the mice for 6 weeks. Con- knockdown failed to reduce ERK activation at both basal sistent with the findings in cell culture models, APP-kd and EGF-stimulated conditions of MDA-MB-231 cells cells showed significantly reduced tumor forming ability (Figure 5A). In addition, NF-κB activation, which is im- in vivo compared to control (Figure 4C). As an independ- portant for cell survival, was unaffected by APP knock- ent experiment, we subcutaneously injected further re- down, as indicated by similar level of I-kB degradation and duced numbers (2.5×10 ) of MDA-MB-231 cells (groups p-p65 (Ser536) post LPS stimulation (Figure 5B), suggest- of control and APP-kd) and then measured tumor size ing both pathways are not likely responsible either for kip1 over time. As a result of measurement up to 28-days post p27 or apoptotic induction in APP-kd cells. Next, we injection, there was a significant difference in tumor vol- examined IGF-1/AKT signaling pathway in APP-kd cells ume between control and APP-kd groups (Figure 4D). since AKT/FOXO signaling axis have been identified as Tumor growth was negligible and difficult to measure in critical signaling intermediates for breast cancer survival, APP-kd group up to 22-days. These 3D culture and growth, and migration as well as therapeutic drug resist- in vivo xenograft studies strongly support the role of APP ance [38,39]. In the APP-kd cells, IGF-1-induced AKT in the promotion of breast cancer cell growth. phosphorylation at T308/S473 was evidently decreased A B P<0.027 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 Vector shAPP-7 C D shLuc shAPP-7 P<0.01 Day10 day14 day18 day22 day26 Days post injection Figure 4 APP modulates breast cancer cell growth in 3D culture and in xenografted model. MDA-MB-231 cells were subjected to 3D Matrigel on-top assay. The cells were seeded (2x10 /well) in 48-well plate coated with Matrigel in triplicate and then cultured for 7 days with medium change in every two days. The morphology of growing cells were obtained (A) and followed by MTT assay (B). (C) The control and shAPP-7 MDA-MB-231 (2x10 ) cells were injected into nude mice s.c. (n = 6) and allowed to grow for 6 weeks. The grown tumors were excised and the grown tumor size compared. (Scale bar = 1cm) (D) The independent xenograft study (2.5x10 cells s.c injected; n = 5, respectively) revealed that shAPP-7 MDA-MB-231 cell growth rate was largely decreased as compared to control group (p < 0.01). shAPP-7 shluc shAPP-7 Vector Tumor volume (mm ) MTT Assay (A570nm) Lim et al. BMC Cancer 2014, 14:928 Page 8 of 12 http://www.biomedcentral.com/1471-2407/14/928 over total Akt and, concurrently, AKT-mediated GSK3β elevated APP expression in breast cancer may promote cell phosphorylation at Ser 9 was reduced (Figure 5C). Knock growth and survival by the induction of AKT-FOXO and down of APP also significantly reduced the phosphoryl- AKT- GSK3β signaling cascades. ation of FOXO, a main substrate of AKT and a transcrip- tion factor that regulates cell cycle progression through APP reduction reduces cell motility in MDA-MB-231 cells cip1 induction of cell cycle inhibitors including p21 and Since APP expression has been linked to cell migration kip1 p27 . AKT is known to suppress FOXO family by indu- [6,16], we explored the role of APP in cell migration and cing phosphorylation, nuclear export, and degradation invasion of MDA-MB-231. The confluent control (shLuc) cip1 kip1 which lead to subsequent p21 and/or p27 reduction and APP-kd (shAPP-5 or shAPP-7) cell cultures were [40]. AKT can also directly phosphorylate and regulate wounded and allowed to migrate into the wounded area kip1 p27 cytoplasmic redistribution [41]. As demonstrated in in low serum containing medium with or without IGF-1. kip1 Figure 2, p27 remained in the nucleus for a longer time APP-kd cells showed very limited cell migration into in APP-kd cells after serum release. Thus, it is likely that the wounded space compared to the control cells in the mitigated AKT activation in APP-kd cells resulted in higher absence of any stimulation. Moreover, upon IGF-1 treat- kip1 p27 expression and prolonged retention in nucleus. ment, more substantial difference in cell migration was Next, we examined the change of GSK3β downstream tar- observed between control and APP-kd cells (Figure 6A). get proteins (Figure 5D). The expression of β-catenin and Next, we assessed the cell migration ability of APP-kd its downstream targets such as survivin and CD44, but not MDA-MB-231 cells in transwell chambers. As was ob- Cyclin D1 were affected by knockdown of APP likely served in the wound healing assay, APP-kd cells exhibited through AKT-GSK3β axis. These findings indicate that limited migration ability with about 50% reduction in Figure 5 APP significantly impacts IGF-1-mediated activation of AKT and its downstream effectors. Both MDA-MB-231 control (shluc) and APP-kd (shAPP) cells were treated with EGF (50 ng/ml), LPS (100 ng/ml), or IGF-1 (100 ng/ml) as indicated. (A) EGF-mediated Erk activation was assessed in the APP knock-down cells post stimulation with EGF. (B) LPS-mediated activation of pro-inflammatory response in the APP knockdown cells was tested by demonstrating the level of IκBα expression and NF-κB activation (phosphorylated p65 at S536). (C) IGF-1-stimulated Akt activation and phosphorylation of Akt target proteins such as GSK3β (S9) and FOXO1 (T24) were examined. (D) APP affects the expression of β-Catenin, a target of GSK3β, and its downstream targets such as Survivin and CD44, but not Cyclin D1. Lim et al. BMC Cancer 2014, 14:928 Page 9 of 12 http://www.biomedcentral.com/1471-2407/14/928 untreated cells and 75% reduction in IGF-1 treated cells containing various grades of breast cancer tissues and (Figure 6B and 6C). Notably, MDA-MB-231 control cells normal breast tissues was analyzed with an anti-APP treated with IGF-1 showed spindle-like mesenchymal cell antibody (22C11). In the normal breast tissues, there morphology whereas APP-kd cells did not, suggesting the was minimal to no staining of the breast epithelium. potential role of APP during cell invasion and metastasis However, the vast majority of the invasive breast carcin- through regulation of epithelial-mesenchymal transition omas showed some degree of APP expression. In total, (EMT). Taken together, our data indicate that APP is there were 40 invasive breast carcinomas that could be involved in the regulation of cell motility triggered by evaluated on the TMA sections stained with 22C11 anti- IGF-1 and APP might be an attractive therapeutic target body. No staining was observed in 3 (7.5%) of the cases. to prevent cell invasion and metastasis. Weak staining was observed in 10 (25%) of the cases, moderate staining in 18 (45%), and strong staining in 9 Increased expression of APP in human breast cancer tissues (22.5%). Though the number of cases in this series is In order to examine the clinical relevance of APP small, there was a trend seen where the higher grade expression in breast cancer, a tissue microarray (TMA) tumors showed more intense staining than the lower Figure 6 APP promotes cell migration of MDA-MB-231 and its expression is elevated in invasive breast cancer of human tissues. (A) The cell motility of APP knockdown (shAPP) MDA-MB-231 was examined in wound healing assay. Following the wounding, cells were untreated or treated with IGF-1 (25 ng/ml) for 18 hours in 0.1% serum containing medium. Cells were then fixed and stained for clear demonstration (scale bar = 200 μm). (B) The role of APP for cell migration was evaluated in Boyden chamber assay in serum-free medium with or without IGF-1 (50 ng/ml) for 18 hours. The rectangular area was further magnified for demonstration of different cell morphology. (C) The migrated cells in panel B were counted in three randomly selected areas. (D) No staining for APP (22C11) is present in this normal terminal duct lobular unit. (E) The well-differentiated grade 1 invasive ductal carcinoma shows weak staining for APP. (F) The poorly-differentiated grade 3 invasive ductal carcinoma shows strong staining for APP. Scale bar = 100 μm. Lim et al. BMC Cancer 2014, 14:928 Page 10 of 12 http://www.biomedcentral.com/1471-2407/14/928 grade tumors overall (Figure 6D-F). These results strongly other combinatorial genetic modifications. These results support our hypothesis that elevated APP expression has strongly suggest that the pathological role of APP in breast close correlation with tumor cell growth and progression. cancer pathogenesis works diversely upon the cellular context and this needs to be addressed in the future study. Discussion Our data also suggest that APP is involved in IGF-1/ Our data strongly indicate the pathological role of APP in AKT signaling pathways, which are key regulatory path- breast cancer. First, we demonstrated increased expression ways for cell growth and survival of breast cancer. APP-kd APP in breast cancer cells and its correlation with malig- cells displayed mitigated AKT activation which leads to nancy. Second, the inhibition of APP expression in breast decreased inhibitory phosphorylation of GSK3β (Ser9) and cancer cells effectively prevents cell growth and motility FOXO1 (T24). GSK3β is known to suppress β-catenin- in vitro and in vivo models. Third, we also demonstrated dependent oncogenic signaling pathway by phosphorylating that APP is mechanistically linked to the AKT/FOXO and β-Catenin [44,45]. Activation of β-catenin is reported in AKT/GSK3-β pathways which are known to modulate cell subgroup of triple negative breast cancers (i.e., aggressive growth, survival, and invasion of breast cancer cells breast cancers possessing lack of estrogen receptor, kip1 through the regulation of target genes including p27 progesterone receptor, and Her2 receptor expression) and and survivin. Importantly, knocking down of APP expres- is associated with poor clinical outcomes [44]. On the other sion resulted in retarded cell growth in vitro and in vivo hand, FOXO family including FOXO1 can induce cell kip1 cip1 xenografted mouse model. We found that the slower cell cycle inhibitors (e.g., p27 ,p21 ) and pro-apoptotic proliferation was, in part, caused by the upregulated cell molecules (e.g., BIM, BNIP3, FASL, TRAIL, and survivin) kip1 cycle inhibitor p27 expression in APP-kd cells. Thus, [46]. The anti-apoptotic protein, survivin, is a family increased APP expression is inversely correlated with member of inhibitors of apoptosis (IAP) which embodies kip1 p27 expression in malignant breast cancers. Since the diverse cellular function, encompassing mitosis, metabol- kip1 reduced p27 expression is correlated with tumor ism, and survival by promoting adaptation to stresses aggressiveness and poor patient survival [29], this finding [47]. As such, FOXO-survivin and β-catenin-survivin suggests that APP plays a significant role in regulation of regulatory pathways are considered to play an essential kip1 p27 in a malignant human breast cancer. In addition, role for the expression of survivin in breast cancer knockdown of APP in breast cancers augmented apoptotic [38,44]. Thus, our results strongly suggest that APP- markers and it is likely that advanced breast cancers mediated regulation of AKT/FOXO and AKT/GSK3β (M-II, M-III, and M-IV) with knockdown of APP are pathways are playing a significant role for breast cancer more prone to enter into apoptosis. Similarly, in addition development. Supporting this hypothesis, a previous to the result of MCF-10A cells, APP knockdown in MDA- study demonstrated that sAPPα stimulates AKT/GSK3β MB-231 promotes sensitivity to therapeutic treatments of pathway in neuronal cells and consequently resulted in TRAIL or 5-FU, implying that targeting APP in malig- its neuroprotective effect [48]. nant breast cancers may promote the sensitivity to Interestingly, APP is also known to promote cell migra- therapeutic drugs. Since homozygous APP-deficient tion in neuronal progenitor cells [16] and engage in neur- mice are viable and normal in development [42], it onal growth cone adhesion where it plays a role as an seemsthatnormalbreastepithelialcellgrowthisnot independently operating cell adhesion molecule for bind- affected by knockdown of APP expression. However, ing to extracellular matrices such as laminin [6]. Acquiring advanced breast cancers may struggle to survive in the cell motility is a key aspect enabling cancer cells to invade absence of APP, presumably because they have evolved to into adjacent tissue and disseminate into the secondary survive better, at least in part, in an APP-dependent organs. We therefore examined the cell motility and inva- manner. After the submission of this manuscript, sion ability of MDA-MB-231 after knocking down of APP Goodarzi et al. [43] published an article demonstrating expression. Upon stimulation with IGF-1 that promotes the biological effect of APP in the regulation of breast cell migration and cancer metastasis, APP-kd cells migrate cancer progression. Their results suggest that APP might slowly in response to IGF-1 partly due to limited activa- suppress aggressiveness of breast cancer cells. While those tion of AKT. It is well known that AKT plays an import- results are not overlapped with the phenotype of our APP ant role in the process of EMT via repression of E-cadhrin knockdown experiments, both reports strongly suggest the [49]. In addition, β-catenin is also closely engaged in EMT pathological role of APP in breast cancer pathogenesis. and cell migration [50,51]. Our findings that APP is func- The discrepancy between two studies might be explained tionally linked with AKT activation and GSK-3β/β-catenin by different cellular conditions used in the studies. While pathways warrant the future study that elevated APP in they examined the role of APP under the condition of malignant breast cancers is associated with dissemination TARBP2 knockdown, our study examined a direct function of breast cancer into other target organs by promoting of APP in the parental MDA-MB-231 cells without any EMT process. Lim et al. BMC Cancer 2014, 14:928 Page 11 of 12 http://www.biomedcentral.com/1471-2407/14/928 Conclusions adult hippocampal neural progenitor cells. Hippocampus 2012, 22(7):1517–1527. In summary, we found that the expression of APP is 8. Hoffmann J, Twiesselmann C, Kummer MP, Romagnoli P, Herzog V: Apossible increased both in mouse and human malignant breast role for the Alzheimer amyloid precursor protein in the regulation of cancer cell lines and similarly in human breast cancer epidermal basal cell proliferation. Eur J Cell Biol 2000, 79(12):905–914. 9. Pietrzik CU, Hoffmann J, Stober K, Chen CY, Bauer C, Otero DA, Roch JM, tissues. The APP expression is important to regulate cell Herzog V: From differentiation to proliferation: the secretory amyloid growth, apoptosis, and motility of breast cancer, possibly precursor protein as a local mediator of growth in thyroid epithelial through engagement of AKT-mediated signaling pathways. cells. Proc Natl Acad Sci U S A 1998, 95(4):1770–1775. 10. Meng JY, Kataoka H, Itoh H, Koono M: Amyloid beta protein precursor is Overall, our findings provide substantial groundwork for involved in the growth of human colon carcinoma cell in vitro and the pathophysiological function of APP and its underlying in vivo. Int J Cancer 2001, 92(1):31–39. mechanism that promotes breast cancer malignancy. 11. Hansel DE, Rahman A, Wehner S, Herzog V, Yeo CJ, Maitra A: Increased expression and processing of the Alzheimer amyloid precursor protein in pancreatic cancer may influence cellular proliferation. Cancer Res 2003, Abbreviations 63(21):7032–7037. APP: Amyloid-β precursor protein; TMA: Tissue microArray; IGF-1: Insulin-like 12. Krause K, Karger S, Sheu SY, Aigner T, Kursawe R, Gimm O, Schmid KW, growth factor-1; DAPI: Diamidino-2-phenylindole; TRAIL: Tumor necrosis Dralle H, Fuhrer D: Evidence for a role of the amyloid precursor protein factor (TNF)-related apoptosis-inducing ligand; 5-FU: 5-Fluorouracil. in thyroid carcinogenesis. J Endocrinol 2008, 198(2):291–299. 13. Takayama K, Tsutsumi S, Suzuki T, Horie-Inoue K, Ikeda K, Kaneshiro K, Competing interests Fujimura T, Kumagai J, Urano T, Sakaki Y, Shirahige K, Sasano H, Takahashi S, The authors declare that they have no competing interests. Kitamura T, Ouchi Y, Aburatani H, Inoue S: Amyloid precursor protein is a primary androgen target gene that promotes prostate cancer growth. Authors’ contributions Cancer Res 2009, 69(1):137–142. SL and HGL conceived and designed the study. SL, HK, HL, HGL, and YL 14. Venkataramani V, Rossner C, Iffland L, Schweyer S, Tamboli IY, Walter J, contributed for the generation of stable cell lines and analyzed cellular and Wirths O, Bayer TA: Histone deacetylase inhibitor valproic acid inhibits molecular effects of APP knockdown in cell growth, apoptosis, and invasion cancer cell proliferation via down-regulation of the alzheimer amyloid (cell proliferation assay, cell cycle analysis, RT-PCR, flow cytometry, Western precursor protein. JBiolChem 2010, 285(14):10678–10689. blots); HLG and HGL analyzed human breast cancer tissue array data. SL, SK, 15. Takagi K, Ito S, Miyazaki T, Miki Y, Shibahara Y, Ishida T, Watanabe M, Inoue JL, and HGL participated in the data analysis; BY and SL coordinated the S, Sasano H, Suzuki T: Amyloid precursor protein (APP) in human breast mouse xenograft study and SL and HGL wrote the manuscript. All authors cancer: an androgen-induced gene associated with cell proliferation. have read and approved the final manuscript. Cancer Sci 2013, 104(11):1532–1538. 16. Young-Pearse TL, Bai J, Chang R, Zheng JB, LoTurco JJ, Selkoe DJ: Acritical function for beta-amyloid precursor protein in neuronal migration revealed Acknowledgements by in utero RNA interference. JNeurosci 2007, 27(52):14459–14469. We thank Sandra Siedlak for the technical assistance. This study was 17. Young-Pearse TL, Chen AC, Chang R, Marquez C, Selkoe DJ: Secreted APP supported by the National Institutes of Health (AG028679) to HGL. regulates the function of full-length APP in neurite outgrowth through interaction with integrin beta1. Neural Dev 2008, 3:15. Author details Department of Pediatrics, Case Comprehensive Cancer Center, Case Western 18. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D: Global cancer Reserve University School of Medicine, 2103 Cornell Road, Cleveland, OH statistics. Cancer J Clin 2011, 61(2):69–90. 44106, USA. Department Pathology, Case Western Reserve University School 19. Hong S, Lim S, Li AG, Lee C, Lee YS, Lee EK, Park SH, Wang XJ, Kim SJ: of Medicine, 2103 Cornell Road, Cleveland, OH 44106, USA. Department Smad7 binds to the adaptors TAB2 and TAB3 to block recruitment of Pharmacology, Case Western Reserve University School of Medicine, the kinase TAK1 to the adaptor TRAF2. Nat Immunol 2007, 8(5):504–513. Cleveland, OH 44106, USA. Department of Human and Molecular Genetics, 20. Harris JA, Devidze N, Verret L, Ho K, Halabisky B, Thwin MT, Kim D, Hamto P, Virginia Commonwealth University School of Medicine, Richmond, VA, USA. Lo I, Yu GQ, Palop JJ, Masliah E, Mucke L: Transsynaptic progression of 5 6 CHA Cancer Institute, CHA University, Seoul 135-081, Korea. The Angie amyloid-beta-induced neuronal dysfunction within the entorhinal- Fowler Adolescent and Young Adult Cancer Institute, University Hospitals hippocampal network. Neuron 2010, 68(3):428–441. Rainbow Children's Hospital, Cleveland, OH 44106, USA. 21. Minn AJ, Gupta GP, Siegel PM, Bos PD, Shu W, Giri DD, Viale A, Olshen AB, Gerald WL, Massague J: Genes that mediate breast cancer metastasis to Received: 15 April 2014 Accepted: 5 December 2014 lung. Nature 2005, 436(7050):518–524. Published: 10 December 2014 22. Tang B, Vu M, Booker T, Santner SJ, Miller FR, Anver MR, Wakefield LM: TGF-beta switches from tumor suppressor to prometastatic factor in a model of breast cancer progression. J Clin Invest 2003, 112(7):1116–1124. References 23. Miller FR, Soule HD, Tait L, Pauley RJ, Wolman SR, Dawson PJ, Heppner GH: 1. O’Brien RJ, Wong PC: Amyloid precursor protein processing and Xenograft model of progressive human proliferative breast disease. Alzheimer’s disease. Annu Rev Neurosci 2011, 34:185–204. J Natl Cancer Inst 1993, 85(21):1725–1732. 2. Hardy JA, Higgins GA: Alzheimer’s disease: the amyloid cascade 24. Aslakson CJ, Miller FR: Selective events in the metastatic process defined hypothesis. Science 1992, 256(5054):184–185. by analysis of the sequential dissemination of subpopulations of a 3. De Strooper B, Annaert W: Proteolytic processing and cell biological mouse mammary tumor. Cancer Res 1992, 52(6):1399–1405. functions of the amyloid precursor protein. J Cell Sci 2000, 25. Mattson MP: Cellular actions of beta-amyloid precursor protein and its 113(Pt 11):1857–1870. soluble and fibrillogenic derivatives. Physiol Rev 1997, 77(4):1081–1132. 4. Jacobsen KT, Iverfeldt K: Amyloid precursor protein and its homologues: a 26. Kummer C, Wehner S, Quast T, Werner S, Herzog V: Expression and family of proteolysis-dependent receptors. Cell Mol Life Sci 2009, potential function of beta-amyloid precursor proteins during cutaneous 66(14):2299–2318. wound repair. Exp Cell Res 2002, 280(2):222–232. 5. Sheng B, Song B, Zheng Z, Zhou F, Lu G, Zhao N, Zhang X, Gong Y: 27. Sherr CJ, Roberts JM: CDK inhibitors: positive and negative regulators of Abnormal cleavage of APP impairs its functions in cell adhesion and G1-phase progression. Genes Dev 1999, 13(12):1501–1512. migration. Neurosci Lett 2009, 450(3):327–331. 28. Caldon CE, Daly RJ, Sutherland RL, Musgrove EA: Cell cycle control in 6. Sosa LJ, Bergman J, Estrada-Bernal A, Glorioso TJ, Kittelson JM, Pfenninger breast cancer cells. J Cell Biochem 2006, 97(2):261–274. KH: Amyloid precursor protein is an autonomous growth cone adhesion molecule engaged in contact guidance. PLoS One 2013, 8(5):e64521. 29. Chu IM, Hengst L, Slingerland JM: The Cdk inhibitor p27 in human cancer: 7. Baratchi S, Evans J, Tate WP, Abraham WC, Connor B: Secreted amyloid prognostic potential and relevance to anticancer therapy. Nat Rev 2008, precursor proteins promote proliferation and glial differentiation of 8(4):253–267. Lim et al. BMC Cancer 2014, 14:928 Page 12 of 12 http://www.biomedcentral.com/1471-2407/14/928 30. Wander SA, Zhao D, Slingerland JM: p27: a barometer of signaling deregulation and potential predictor of response to targeted therapies. Clin Cancer Res 2011, 17(1):12–18. 31. Mahalingam D, Szegezdi E, Keane M, de Jong S, Samali A: TRAIL receptor signalling and modulation: Are we on the right TRAIL? Cancer Treat Rev 2009, 35(3):280–288. 32. Joensuu H, Gligorov J: Adjuvant treatments for triple-negative breast cancers. Ann Oncol 2012, 23(Suppl 6):vi40–vi45. 33. Lee GY, Kenny PA, Lee EH, Bissell MJ: Three-dimensional culture models of normal and malignant breast epithelial cells. Nat Methods 2007, 4(4):359–365. 34. Schmeichel KL, Bissell MJ: Modeling tissue-specific signaling and organ function in three dimensions. J Cell Sci 2003, 116(Pt 12):2377–2388. 35. Weigelt B, Bissell MJ: Unraveling the microenvironmental influences on the normal mammary gland and breast cancer. Semin Cancer Biol 2008, 18(5):311–321. 36. Kenny PA, Lee GY, Myers CA, Neve RM, Semeiks JR, Spellman PT, Lorenz K, Lee EH, Barcellos-Hoff MH, Petersen OW, Gray JW, Bissell MJ: The morphologies of breast cancer cell lines in three-dimensional assays correlate with their profiles of gene expression. Mol Oncol 2007, 1(1):84–96. 37. Hollestelle A, Elstrodt F, Nagel JH, Kallemeijn WW, Schutte M: Phosphatidylinositol-3-OH kinase or RAS pathway mutations in human breast cancer cell lines. Mol Cancer Res 2007, 5(2):195–201. 38. Chakrabarty A, Bhola NE, Sutton C, Ghosh R, Kuba MG, Dave B, Chang JC, Arteaga CL: Trastuzumab-resistant cells rely on a HER2-PI3K-FoxO-survivin axis and are sensitive to PI3K inhibitors. Cancer Res 2013, 73(3):1190–1200. 39. Rexer BN, Arteaga CL: Optimal targeting of HER2-PI3K signaling in breast cancer: mechanistic insights and clinical implications. Cancer Res 2013, 73(13):3817–3820. 40. Tzivion G, Dobson M, Ramakrishnan G: FoxO transcription factors; Regulation by AKT and 14-3-3 proteins. Biochim Biophys Acta 2011, 1813(11):1938–1945. 41. Clarke RB: p27KIP1 phosphorylation by PKB/Akt leads to poor breast cancer prognosis. Breast Cancer Res 2003, 5(3):162–163. 42. Zheng H, Jiang M, Trumbauer ME, Hopkins R, Sirinathsinghji DJ, Stevens KA, Conner MW, Slunt HH, Sisodia SS, Chen HY, Van der Ploeg LH: Mice deficient for the amyloid precursor protein gene. Ann N Y Acad Sci 1996, 777:421–426. 43. Goodarzi H, Zhang S, Buss CG, Fish L, Tavazoie S, Tavazoie SF: Metastasis- suppressor transcript destabilization through TARBP2 binding of mRNA hairpins. Nature 2014, 513(7517):256–260. 44. King TD, Suto MJ, Li Y: The Wnt/beta-catenin signaling pathway: a potential therapeutic target in the treatment of triple negative breast cancer. J Cell Biochem 2012, 113(1):13–18. 45. Incassati A, Chandramouli A, Eelkema R, Cowin P: Key signaling nodes in mammary gland development and cancer: beta-catenin. Breast Cancer Res 2010, 12(6):213. 46. Yang JY, Hung MC: Deciphering the role of forkhead transcription factors in cancer therapy. Curr Drug Targets 2011, 12(9):1284–1290. 47. Srinivasula SM, Ashwell JD: IAPs: what’s in a name? Mol Cell 2008, 30(2):123–135. 48. Jimenez S, Torres M, Vizuete M, Sanchez-Varo R, Sanchez-Mejias E, Trujillo- Estrada L, Carmona-Cuenca I, Caballero C, Ruano D, Gutierrez A, Vitorica J: Age-dependent accumulation of soluble amyloid beta (Abeta) oligomers reverses the neuroprotective effect of soluble amyloid precursor protein- alpha (sAPP(alpha)) by modulating phosphatidylinositol 3-kinase (PI3K)/ Akt-GSK-3beta pathway in Alzheimer mouse model. J Biol Chem 2011, 286(21):18414–18425. 49. Larue L, Bellacosa A: Epithelial-mesenchymal transition in development and cancer: role of phosphatidylinositol 3′ kinase/AKT pathways. Submit your next manuscript to BioMed Central Oncogene 2005, 24(50):7443–7454. and take full advantage of: 50. Gilles C, Polette M, Mestdagt M, Nawrocki-Raby B, Ruggeri P, Birembaut P, Foidart JM: Transactivation of vimentin by beta-catenin in human breast cancer cells. Cancer Res 2003, 63(10):2658–2664. • Convenient online submission 51. Roxanis I: Occurrence and significance of epithelial-mesenchymal transition • Thorough peer review in breast cancer. J Clin Pathol 2013, 66(6):517–521. • No space constraints or color figure charges doi:10.1186/1471-2407-14-928 • Immediate publication on acceptance Cite this article as: Lim et al.: Amyloid-β precursor protein promotes cell • Inclusion in PubMed, CAS, Scopus and Google Scholar proliferation and motility of advanced breast cancer. BMC Cancer 2014 14:928. • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit

Journal

BMC CancerSpringer Journals

Published: Dec 10, 2014

There are no references for this article.