Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Analysis of colorectal cancers for human cytomegalovirus presence

Analysis of colorectal cancers for human cytomegalovirus presence Background: A possible association between human cytomegalovirus (HCMV) infection and colorectal cancer progression has been inferred by the identification in tumour tissues of HCMV antigens and specific viral DNA or RNA sequences. To further investigate the relationship between HCMV and colorectal cancers we developed qualitative and quantitative PCR assay to detect HCMV DNA in 56 formalin-fixed paraffin-embedded (FFPE) tissue samples from patients belonging to 4 different histological phenotypes: adenoma; poorly, moderately and well differentiated adenocarcinomas. Results: Of the 56 FFPE tested tissue samples, 6 (11%) were positive for HCMV nested PCR amplification, and more precisely 1 (5%) of 20 cases of adenoma and 5 (21%) of 24 cases of moderately differentiated adenocarcinoma. No PCR positivity was obtained in samples from well and poorly differentiated adenocarcinomas. Conclusion: Our observations suggest that there is no evidence of a direct association between HCMV and colorectal cancer. Moreover, the results obtained are not supportive of a causal role of HCMV in the processes of carcinogenesis and/or progression of colorectal cancer. However, the fact that the virus may present a "hit and run" like-mechanism and HCMV can thus only be detectable at a particular stage of a processing adenocarcinoma, suggests that a significant number of colorectal cancers might have been the subject of HCMV infection that could contribute to trigger the oncogenic differentiation. Our analysis does not exclude the possibility of HCMV infection subsequent viral clearance. often asymptomatic but the latent virus can reactivate to Background HCMV is a member of the herpesvirus family and consti- cause severe diseases in immunocompromised individu- tutes a major public health problem. HCMV infection is als [1]. lifelong, and it manifests differently depending on the patient's underlying condition and immunological status. Evidence has already been obtained that HCMV gene Healthy young people with primary HCMV infection are products are capable of transforming cells in vitro and of Page 1 of 6 (page number not for citation purposes) Infectious Agents and Cancer 2009, 4:6 http://www.infectagentscancer.com/content/4/1/6 regulating the expression of important host genes, thus of albumin DNA was visualized as a band of 120 bp inducing a deregulation of cellular pathways relevant to obtained by using primers specific for albumin gene (see colon adenocarcinoma pathogenesis [1-6]. Methods). These data indicate that in all examined sam- ples a suitable amplification of albumin gene was Furthermore, the identification of HCMV nucleic acids obtained. and antigens in tumour tissues, combined with serologi- Nested PCR analysis of HCMV in adenomas and cal evidence, has led to a suggestion of a possible associa- tion between HCMV infection and the progression of adenocarcinomas certain malignancies. Indeed, HCMV infection has been The nested PCR reaction that amplifies a fragment of 180 associated with colon adenocarcinoma by several authors bp of the HCMV UL55 gene (see Methods) was carried out [7-11]. However, other studies have found no evidence of on 56 human DNA samples extracted from adenomas and a direct association between HCMV infection and adeno- adenocarcinomas. The results obtained by nested PCR carcinoma malignancy [12-17]. with primers I-1/I-2 are presented in Table 1. The UL55 gene was amplified in 1 (5%) of the 20 DNA samples The possible contribution of HCMV in the development from patients with adenoma, and in 5 (20.8%) of the 24 and progression of colorectal cancer is thus still controver- samples from patients with moderately differentiated ade- sial. To further investigate whether HCMV infection could nocarcinoma. No amplification was obtained in any of be responsible for the induction of colorectal cancers and the 5 cases of well-differentiated adenocarcinoma nor in to obtain a precise assessment of the presence of viral the 7 cases of poorly differentiated adenocarcinoma. DNA in tissue samples, we have performed qualitative and quantitative PCR analyses for HCMV. We have ana- Since the presence of HCMV DNA was found only in a lysed samples obtained from 58 different patients, includ- reduced subset of colorectal cancers, these results suggest ing 20 adenomas and 38 adenocarcinomas. In order to that there is no evidence of a direct causal association study the possible relationship between HCMV infection between HCMV infection and induction of poorly or well- and cancer differentiation we have compared adenomas differentiated adenocarcinomas. However, viral DNA was with adenocarcinomas belonging to 3 different histologi- found in approximately 21% of moderately differentiated cal phenotypes (poorly, moderately and well differenti- adenocarcinomas, suggesting that the virus, although not ated). essential to progression towards the transforming pheno- type, could conceivably have a role in the initiation of the Results tumorigenic event. Genomic DNA quality control DNA was purified from the histological tissues, and its In Figure 2 the results obtained for 5 of the 56 clinical quality was tested using PCR primers targeting for the samples tested in the second round of PCR are reported; human albumin gene. Fifty six DNA samples (96.5%) of samples 4 and 5 were considered positive since a 182 bp the 58 extracted with xylol/ethanol were positive by albu- band corresponding to the expected size of viral amplicon min PCR, and were thus considered suitable for subse- was found. quent analysis for the presence of HCMV DNA. A representative PCR analysis of albumin gene amplification in FFPE tissue samples is shown in Figure 1. The presence M 1 2 3 4 6 5 7 8 9 10  N 200 bp 120 bp 100 bp PCR an Figure 1 alysis of albumin gene PCR analysis of albumin gene. DNA extracted from FFPE samples was amplified for albumin gene using primers described in Methods. Amplification yielded a band of 120 bp. As positive control (+), human DNA from non-FFPE tissue was used; as neg- ative control (N), PCR master mix without DNA was used. Clinical samples, lanes 1–10. DNA molecular weight marker, M. Page 2 of 6 (page number not for citation purposes) Infectious Agents and Cancer 2009, 4:6 http://www.infectagentscancer.com/content/4/1/6 Table 1: Phenotype and PCR results for FFPE samples of colorectal cancer clinic phenotype number of samples HCMV PCR positive samples poorly differentiated adenocarcinomas 70 moderately differentiated adenocarcinomas 24 5 well differentiated adenocarcinomas 50 adenomas 20 1 total 56 6 Quantitative PCR analysis [18,19] which interfere with the PCR reaction and reduce We developed a real-time PCR quantitative analysis using PCR efficiency [20]. SYBR Green I to quantify the viral load in the nested PCR- HCMV positive samples. A standard curve was generated Although this method did not allow quantitation in by 10 fold serial dilutions (8 × 10 – 8 copies) of a plasmid deparaffinised samples, the real time PCR assay con- containing a single copy of HCMV US28 gene. The regres- firmed the qualitative positivity obtained by nested PCR sion curve analysis consisting of 5 points tested in tripli- in 2 tested samples (data not shown). cate gave a reaction with an efficiency of 100% and a Spearmann's correlation coefficient (R ) of 0.99. Quanti- Discussion tative PCR analysis of DNA extracts from FFPE tissues did The role of HCMV in the development and progression of not allow to obtain reproducible data since the efficiency colorectal cancers has not yet been clarified. The presence of PCR was lower (60%, R = 0.82) than the 100% stand- of HCMV antigens and nucleic acids in colorectal cancers ard required. Also the replicate values, from a paraffin- has been obtained by means of molecular and virologic embedded tissue, were discordant (C standard deviation studies and a direct relationship between the virus and ≥ 1) and the dissociation curve highlighted the presence of cancer was suggested [7-11]. However, in other studies, no non specific amplified products in target samples. evidence of a direct association between colorectal cancer and HCMV infection was found [12-17]. The difficulty in obtaining reliable data from clinical sam- ples is probably linked to the process of paraffin removal More specifically, Harkins et al. [11] have conducted a that may result in formation of inhibitory substances study on 29 specimens of colorectal polyps and adenocar- N N 1 2 3 M 4 5 182 bp Nested PCR analysis Figure 2 of viral DNA from representative colorectal cancer samples Nested PCR analysis of viral DNA from representative colorectal cancer samples. DNA extracted from deparaffin- ised tissues was amplified with I-1/I-2 primers. Amplification of inner fragment yielded a band of 182 bp. Positive control (+); negative control (N); clinical samples, lanes 1–5; DNA molecular weight marker, M. Page 3 of 6 (page number not for citation purposes) Infectious Agents and Cancer 2009, 4:6 http://www.infectagentscancer.com/content/4/1/6 cinomas from different patients using immunohisto- Of interest is the detection of HCMV DNA in 20.8% of chemistry with two different antibodies, and reported the moderately differentiated adenocarcinomas, whereas it presence of HCMV proteins in about 80% of polyps and was undetectable in poorly and well-differentiated carci- 85% of adenocarcinomas, but not in adjacent healthy tis- nomas, similar to the findings of Knösel et al. [16]. It has sues. In addition, by means of PCR and DNA sequencing, been reported, in transformed HCMV cells, that the the presence of viral nucleic acids was detected in 6 HCMV infection could present a "hit and run" oncogenic- tumours (5 adenocarcinomas and 1 polyp) that were like mechanism [2,21], though viral DNA is undetectable immunoreactive for HCMV, whereas it was not detected in metastases. It's presence in earlier histological stages in healthy tissues from 3 of the same 6 patients. These may suggest that the presence of HCMV DNA might not results suggested a possible causative association between be essential to progress toward the transforming pheno- HCMV and colorectal cancer. Akintola-Ogunremi et al. type. Following the "hit and run" like mechanism, the [17] examined 23 colorectal hyperplastic polyps, 65 color- virus could mediate cellular transformation through an ectal adenomas and 51 colorectal adenocarcinomas by initial hit, while maintenance of the transformed state is immunohistochemical analysis with two different anti- compatible with the loss of viral molecules. Thus, the fact bodies. No nuclear HCMV antigen positivity was detecta- that we have detected viral DNA only in moderately differ- ble in any of the studied cases. In addition, PCR analysis entiated carcinomas may reflect the inability of HCMV to failed to detect viral DNA in 24 selected cases showing infect poorly differentiated cancer cells [22]. non-specific cytoplasmic immunostaining. These results are in stark contrast to those reported by Harkins et al The quantitative real time PCR analysis was validated on [11], since no evidence of HCMV DNA and proteins in HCMV DNA strains, but could not give reproducible data human colorectal adenocarcinomas and their precursor on DNA extracted from paraffin embedded samples. This lesions was found. could potentially be due to the presence of inhibitors in biopsy samples that can interfere with the PCR. Quantifi- Knösel et al [16] investigated the presence of HCMV DNA cation of HCMV viral load by real-time PCR can yield and antigens, by using PCR analysis and immunohisto- important information on the timing of HCMV infection. chemistry. Fifty seven primary tumours and 20 metastases Therefore, validation of the real-time PCR protocol in of fresh colorectal cancer tissue were tested, including 13 non-paraffin embedded samples could represent a useful tumour pairs (primary and metastases) from the same tool for the identification of HCMV in human cancer. patient. Four (7%) of 57 primary tumours were found positive for HCMV DNA by PCR, whereas all metastases Conclusion were negative. In addition, no specific staining was In conclusion, our observations, together with those of detected by immunohistochemistry analysis. Although other authors [16,17] suggest that there is no evidence of these results confirmed the results of Akintola-Ogunremi a direct association between HCMV and colorectal cancer. et al [17] indicating that there is no direct association Moreover, there is no evidence supporting that HCMV can between HCMV infection and progression or formation of fulfil the necessary criteria for defining a causative role in metastases in colorectal cancer, evidence of HCMV posi- the process of carcinogenesis and or progression of color- tivity in a small number of colorectal neoplasms was ectal cancer. One of these requirements is, in fact, the reg- found in the primary tumours. ular presence and persistence of the nucleic acid of the respective infectious agent in cells of the specific tumour Given the controversial conclusions of the reported type [23,24]. results, we further investigated the issue by establishing a specific qualitative PCR analysis and a quantitative PCR However, the fact that the virus may present a "hit and reaction for HCMV viral load determination. run" like-mechanism and that it was found only in a par- ticular stage of a processing adenocarcinomas, provides a The nested PCR analysis conducted in our laboratory useful indication that a certain type of adenocarcinoma allowed the identification of HCMV sequence in 6 have been infected by HCMV and that this could have (10.7%) of 56 tissue samples tested, and more precisely in contributed to trigger the oncogenic differentiation. 1 (5%) of 20 cases of adenoma and 5 (20.8%) of 24 cases of moderately differentiated adenocarcinomas. However, Methods there was no evidence of HCMV DNA in any of 5 cases of Specimen collection well-differentiated adenocarcinoma nor in 7 cases of The specimens included in this study consisted of 10% poorly differentiated adenocarcinoma, suggesting the lack FFPE tissue blocks of colorectal tumours from the archives of a causative association between virus infection and can- of the Pathology section of the Department of Pathology, cer development in these two groups of adenocarcinomas. University of Verona, Italy. Samples of 58 biopsies were obtained from different patients of which 20 were adeno- Page 4 of 6 (page number not for citation purposes) Infectious Agents and Cancer 2009, 4:6 http://www.infectagentscancer.com/content/4/1/6 mas and 38 adenocarcinomas. Of the 38 adenocarcino- The first-round of PCR amplification was performed in a mas, 5 were well differentiated, 25 moderately 20 μl reaction containing 2–5 μl of each genomic DNA differentiated and 8 poorly differentiated. sample. As positive controls for PCR reactions 3 different HCMV DNA samples were used: DNA extracted from Biopsies and histology human fibroblasts cultured in vitro and infected with an Samples were independently reviewed by two patholo- HCMV strain from a newborn baby with congenital infec- gists (AZ and FM) and classified according to the WHO tion and viral DNA of the two laboratory strains AD169 classification of tumours of the digestive system. In case of and Towne. Each experiment was conducted using posi- discrepancy, a consensus was reached by reviewing dis- tive and negative controls. cordant cases at a multi-head microscope. Representative tissue blocks were selected for DNA extraction, selecting For the first amplification round, after an initial denatur- blocks with high tumour content. ing step at 94°C for 5 min, 35 cycles of denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, extension Isolation of genomic DNA from paraffin-embedded tissues at 72°C for 30 sec, were made, followed by a final exten- Four 3 μm sections of each sample were deparaffinised sion at 72°C for 6 min. The amplified products were sub- with xylol/ethanol, collected into a 1.5 ml Eppendorf tube jected to the second round of PCR using the primer pair I- containing 100 μl of lysis solution: 0.1 M NaCl, 0.15 M 1/I-2 and 1 μl of the first round amplification product. EDTA pH 8.0, 0.1 M Tris-HCl pH 8.0, 1% SDS, 45.8 mM Cycling program was performed as follows: 94°C for 5 β-mercaptoethanol and 100 μg Proteinase K. The tubes min, 1 cycle; 94°C for 30 sec, 59°C for 30 sec, 72°C for were incubated at 55°C for 3 hours, followed by Protein- 30 sec, 40 cycles; 72°C for 5 min, 1 cycle. ase K heat inactivation. Samples were centrifuged at room temperature at 10.000 g for 5 min. The supernatants were At the end of the amplification 15–20 μl of each product collected and stored at -20°C, prior to the PCR amplifica- were analysed on 2.5% w/v agarose gels by electrophore- tion procedure. sis. Polymerase chain reaction analysis Real-time PCR Since DNA extracted from paraffin-embedded tissue The real-time quantitative PCR assay was performed on an might be partially degraded during formalin fixation or ABI Prism 7000 real time PCR instrument (Applied Bio- paraffin embedding [25], DNA quality was tested using systems). Primers used for amplification of HCMV US28 the following PCR primers specific for the human albumin gene in real-time reaction are summarised in Table 3 and gene: primer alb fw (5'gctgtcatctcttgtgggctgt 3') and primer were designed using Primer Express V2.0 software alb rv (5'actcatgggagctgctggttc 3'). A total of 56 samples (Applied Biosystems) on the basis of the sequence of were considered suitable to be tested for the presence of US28 gene of AD169 laboratory strain (GenBank acces- HCMV viral DNA. sion number: NC_001347) and then controlled by align- ing sequences with BLAST. The reaction mixture was set The analysis of HCMV in DNA samples was performed by using the Real Master Mix 2.5X (Eppendorf AG) contain- developing a nested PCR reaction with external and inter- ing SYBR Green I. Primers were used at a final concentra- nal primers specific for HCMV UL55 gene region that tion of 300 nM. Each sample was tested in triplicate. encodes for the envelope glycoprotein B. Oligonucleotide primers used to detect HCMV DNA have been described Reactions were performed under the following condi- previously [26] and are summarised in Table 2. External tions: 95°C for 5 min, followed by 45 cycles at 95°C for primers (E-1/E-2) amplify a 267 bp fragment, while inter- 20 sec and 60°C for 1 min. nal primers (I-1/I-2) amplify a 182 bp fragment. All sam- ples were tested in duplicate and samples positive for Data were collected and analysed by Sequence Detection HCM UL55 gene were tested at least in triplicate. System Software (Applied Biosystems). Table 2: Primers used for HCMV DNA amplification by nested PCR primer sequence amplicon length UL55 gene position E-1 TCCAACACCCACAGTACCCGT 267 bp 655 to 675 E-2 CGGAAACGATGGTGTAGTTCG 902 to 922 I-1 GTCAAGGATCAGTGGCACAGC 182 bp 685 to 705 I-2 GTAGCTGGCATTGCGATTGGT 847 to 867 Primers used for amplification of the HCMV glycoprotein B (UL55) gene in nested PCR. External primers amplify a 267 bp fragment, while internal primers amplify a 182 bp fragment Page 5 of 6 (page number not for citation purposes) Infectious Agents and Cancer 2009, 4:6 http://www.infectagentscancer.com/content/4/1/6 Table 3: Primers used for HCMV DNA amplification by real-time quantitative PCR primer sequence amplicon length gene position US28 S TCCATCGGCAACTTCTTGGT 65 bp 267671 to 267690 HHV5-US28As TCGCCGGAGCATTGAATC 267718 to 267735 Oligonucleotide primers used for amplification of the HCMV US28 gene in real-time PCR. Primers were designed using Primer Express V2.0 software (Applied Biosystems) on the sequence of US28 gene of the AD169 laboratory strain and controlled by aligning sequence with BLAST. nucleic acids and proteins in human colorectal cancer. Lancet Competing interests 2002, 360:1557-63. The authors declare that they have no competing interests. 12. Brichácek B, Hirsch I, Závadová H, Procházka M, Faltýn J, Vonka V: Absence of cytomegalovirus DNA from adenocarcinoma of the colon. Intervirology 1980, 14:223-7. Authors' contributions 13. Hart H, Neill WA, Norval M: Lack of association of cytomegalo- virus with adenocarcinoma of the colon. Gut 1982, 23:21-30. CB conducted the PCR analysis and optimisation, 14. Ruger R, Fleckenstein B: Cytomegalovirus DNA in colorectal designed the quantitative PCR study and drafted the carcinoma tissues. Klin Wochenschr 1985, 63:405-8. paper. DZ participated in the design and coordination of 15. Boguszaková L, Hirsch I, Brichácek B, Faltýn J, Fric P, Dvoráková H, Vonka V: Absence of cytomegalovirus, Epstein-Barr virus, and the study, contributed with the manuscript drafting. CB papillomavirus DNA from adenoma and adenocarcinoma of conducted DNA quality analysis. SC did DNA extractions. the colon. Acta Virol 1988, 32:303-8. 16. Knösel T, Schewe C, Dietel M, Petersen I: Cytomegalovirus is not AZ reviewed the cases and selected blocks for DNA stud- associated with progression and metastasis of colorectal ies. FM enrolled patients, collected samples and reviewed cancer. Cancer Lett 2004, 211:243-7. the cases. UB supervised the whole project and gave a sig- 17. Akintola-Ogunremi O, Luo Q, He TC, Wang HL: Is cytomegalovi- rus associated with human colorectal tumorigenesis? Am J nificant contribution in drafting the manuscript. All Clin Pathol 2005, 123:244-9. authors read and approved the final manuscript. 18. Lo Y-MD, Mehal WZ, Fleming KA: In vitro amplification of hepa- titis B virus sequences from liver tumor DNA and from par- affin wax embedded tissues using the polymerase chain Acknowledgements reaction. J Clin Pathol 1989, 42:840-846. We thank Dr. Sunwen Chou (Division of Infectious Diseases, Oregon 19. An SF, Fleming KA: Removal of inhibitor(s) of the polymerase Health Sciences University, Portland, USA) for providing AD169 and chain reaction from formalin fixed, paraffin wax embedded tissues. J Clin Pathol 1991, 44:924-927. Towne laboratory HCMV strains. We also thank the Division of Microbiol- 20. Coates PJ, d'Ardenne AJ, Khan G, Kangro HO, Slavin G: Simplified ogy, Immunology and Virology of the Ospedale Maggiore di Borgo Trento, procedures for applying the polymerase chain reaction to Verona, Italy, for providing a sample of HCMV infected human fibroblasts. routinely fixed paraffin wax sections. J Clin Pathol 1991, This study was supported in part by MIUR PRIN 2005 and Cariverona (to 44:115-118. U. Bertazzoni). 21. Galloway DA, McDougall JK: The oncogenic potential of herpes simplex viruses: evidence for a 'hit-and-run' mechanism. Nature 1983, 302:21-4. References 22. Jarvis MA, Wang CE, Meyers HL, Smith PP, Corless CL, Henderson 1. Landolfo S, Gariglio M, Gribaudo G, Lembo D: The human GJ, Vieira J, Britt WJ, Nelson GA: Human cytomegalovirus infec- cytomegalovirus. Pharmacol Ther 2003, 98:269-297. tion of caco-2 cells occurs at the basolateral membrane and 2. Cinatl J Jr, Cinatl J, Vogel JU, Rabenau H, Kornhuber B, Doerr HW: is differentiation state dependent. J Virol 1999, 73:4552-4560. Modulatory effects of human cytomegalovirus infection on 23. zur Hausen H: Molecular pathogenesis of cancer of the cervix malignant properties of cancer cells. Intervirology 1996, and its causation by specific human papillomavirus types. 39:259-69. Curr Top Microbiol Immunol 1994, 186:131-56. Review 3. Shen Y, Zhu H, Shenk T: Human cytomagalovirus IE1 and IE2 24. zur Hausen H: Viruses in human cancers. Eur J Cancer 1999, proteins are mutagenic and mediate "hit-and-run" onco- 35:1878-85. Review. genic transformation in cooperation with the adenovirus 25. Goelz SE, Hamilton SR, Vogelstein B: Purification of DNA from E1A proteins. Proc Natl Acad Sci USA 1997, 94:3341-5. formaldehyde fixed and paraffin embedded human tissue. 4. Doniger J, Muralidhar S, Rosenthal LJ: Human cytomegalovirus Biochem Biophys Res Commun 1985, 130:118-126. and human herpesvirus 6 genes that transform and transac- 26. Schafer P, Braun RW, Mohring K, Henco K, Kang J, Wendland T, tivate. Clin Microbiol Rev 1999, 12:367-82. Kuhn JE: Quantitative determination of human basolateral 5. Kalejta RF, Shenk T: Manipulation of the cell cycle by human membrane and is differentiation state dependent. J Virol 1999, cytomegalovirus. Front Biosci 2002, 7:295-306. 73:4552-4560. 6. Castillo JP, Kowalik TF: HCMV infection: modulation the cell cycle and cell death. Int Rev Immunol 2004, 23:113-139. 7. Huang ES, Roche JK: Cytomegalovirus D.N.A. and adenocarci- noma of the colon: Evidence for latent viral infection. Lancet 1978, 1:957-60. 8. Hashiro GM, Horikami S, Loh PC: Cytomegalovirus isolations from cell cultures of human adenocarcinomas of the colon. Intervirology 1979, 12:84-8. 9. Grail A, Norval M: Elution of cytomegalovirus antibodies from adenocarcinoma of the colon. Gut 1985, 26:1053-8. 10. Roche JK, Cheung KS, Boldogh I, Huang ES, Lang DJ: Cytomegalo- virus: detection in human colonic and circulating mononu- clear cells in association with gastrointestinal disease. Int J Cancer 1981, 27:659-67. 11. Harkins L, Volk AL, Samanta M, Mikolaenko I, Britt WJ, Bland KI, Cobbs CS: Specific localisation of human cytomegalovirus Page 6 of 6 (page number not for citation purposes) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Infectious Agents and Cancer Springer Journals

Analysis of colorectal cancers for human cytomegalovirus presence

Download PDF
6 pages

Loading next page...
 
/lp/springer-journals/analysis-of-colorectal-cancers-for-human-cytomegalovirus-presence-KyTA2PyM0C

References (28)

Publisher
Springer Journals
Copyright
Copyright © 2009 by Bender et al; licensee BioMed Central Ltd.
Subject
Biomedicine; Cancer Research; Infectious Diseases; Oncology
eISSN
1750-9378
DOI
10.1186/1750-9378-4-6
pmid
19371403
Publisher site
See Article on Publisher Site

Abstract

Background: A possible association between human cytomegalovirus (HCMV) infection and colorectal cancer progression has been inferred by the identification in tumour tissues of HCMV antigens and specific viral DNA or RNA sequences. To further investigate the relationship between HCMV and colorectal cancers we developed qualitative and quantitative PCR assay to detect HCMV DNA in 56 formalin-fixed paraffin-embedded (FFPE) tissue samples from patients belonging to 4 different histological phenotypes: adenoma; poorly, moderately and well differentiated adenocarcinomas. Results: Of the 56 FFPE tested tissue samples, 6 (11%) were positive for HCMV nested PCR amplification, and more precisely 1 (5%) of 20 cases of adenoma and 5 (21%) of 24 cases of moderately differentiated adenocarcinoma. No PCR positivity was obtained in samples from well and poorly differentiated adenocarcinomas. Conclusion: Our observations suggest that there is no evidence of a direct association between HCMV and colorectal cancer. Moreover, the results obtained are not supportive of a causal role of HCMV in the processes of carcinogenesis and/or progression of colorectal cancer. However, the fact that the virus may present a "hit and run" like-mechanism and HCMV can thus only be detectable at a particular stage of a processing adenocarcinoma, suggests that a significant number of colorectal cancers might have been the subject of HCMV infection that could contribute to trigger the oncogenic differentiation. Our analysis does not exclude the possibility of HCMV infection subsequent viral clearance. often asymptomatic but the latent virus can reactivate to Background HCMV is a member of the herpesvirus family and consti- cause severe diseases in immunocompromised individu- tutes a major public health problem. HCMV infection is als [1]. lifelong, and it manifests differently depending on the patient's underlying condition and immunological status. Evidence has already been obtained that HCMV gene Healthy young people with primary HCMV infection are products are capable of transforming cells in vitro and of Page 1 of 6 (page number not for citation purposes) Infectious Agents and Cancer 2009, 4:6 http://www.infectagentscancer.com/content/4/1/6 regulating the expression of important host genes, thus of albumin DNA was visualized as a band of 120 bp inducing a deregulation of cellular pathways relevant to obtained by using primers specific for albumin gene (see colon adenocarcinoma pathogenesis [1-6]. Methods). These data indicate that in all examined sam- ples a suitable amplification of albumin gene was Furthermore, the identification of HCMV nucleic acids obtained. and antigens in tumour tissues, combined with serologi- Nested PCR analysis of HCMV in adenomas and cal evidence, has led to a suggestion of a possible associa- tion between HCMV infection and the progression of adenocarcinomas certain malignancies. Indeed, HCMV infection has been The nested PCR reaction that amplifies a fragment of 180 associated with colon adenocarcinoma by several authors bp of the HCMV UL55 gene (see Methods) was carried out [7-11]. However, other studies have found no evidence of on 56 human DNA samples extracted from adenomas and a direct association between HCMV infection and adeno- adenocarcinomas. The results obtained by nested PCR carcinoma malignancy [12-17]. with primers I-1/I-2 are presented in Table 1. The UL55 gene was amplified in 1 (5%) of the 20 DNA samples The possible contribution of HCMV in the development from patients with adenoma, and in 5 (20.8%) of the 24 and progression of colorectal cancer is thus still controver- samples from patients with moderately differentiated ade- sial. To further investigate whether HCMV infection could nocarcinoma. No amplification was obtained in any of be responsible for the induction of colorectal cancers and the 5 cases of well-differentiated adenocarcinoma nor in to obtain a precise assessment of the presence of viral the 7 cases of poorly differentiated adenocarcinoma. DNA in tissue samples, we have performed qualitative and quantitative PCR analyses for HCMV. We have ana- Since the presence of HCMV DNA was found only in a lysed samples obtained from 58 different patients, includ- reduced subset of colorectal cancers, these results suggest ing 20 adenomas and 38 adenocarcinomas. In order to that there is no evidence of a direct causal association study the possible relationship between HCMV infection between HCMV infection and induction of poorly or well- and cancer differentiation we have compared adenomas differentiated adenocarcinomas. However, viral DNA was with adenocarcinomas belonging to 3 different histologi- found in approximately 21% of moderately differentiated cal phenotypes (poorly, moderately and well differenti- adenocarcinomas, suggesting that the virus, although not ated). essential to progression towards the transforming pheno- type, could conceivably have a role in the initiation of the Results tumorigenic event. Genomic DNA quality control DNA was purified from the histological tissues, and its In Figure 2 the results obtained for 5 of the 56 clinical quality was tested using PCR primers targeting for the samples tested in the second round of PCR are reported; human albumin gene. Fifty six DNA samples (96.5%) of samples 4 and 5 were considered positive since a 182 bp the 58 extracted with xylol/ethanol were positive by albu- band corresponding to the expected size of viral amplicon min PCR, and were thus considered suitable for subse- was found. quent analysis for the presence of HCMV DNA. A representative PCR analysis of albumin gene amplification in FFPE tissue samples is shown in Figure 1. The presence M 1 2 3 4 6 5 7 8 9 10  N 200 bp 120 bp 100 bp PCR an Figure 1 alysis of albumin gene PCR analysis of albumin gene. DNA extracted from FFPE samples was amplified for albumin gene using primers described in Methods. Amplification yielded a band of 120 bp. As positive control (+), human DNA from non-FFPE tissue was used; as neg- ative control (N), PCR master mix without DNA was used. Clinical samples, lanes 1–10. DNA molecular weight marker, M. Page 2 of 6 (page number not for citation purposes) Infectious Agents and Cancer 2009, 4:6 http://www.infectagentscancer.com/content/4/1/6 Table 1: Phenotype and PCR results for FFPE samples of colorectal cancer clinic phenotype number of samples HCMV PCR positive samples poorly differentiated adenocarcinomas 70 moderately differentiated adenocarcinomas 24 5 well differentiated adenocarcinomas 50 adenomas 20 1 total 56 6 Quantitative PCR analysis [18,19] which interfere with the PCR reaction and reduce We developed a real-time PCR quantitative analysis using PCR efficiency [20]. SYBR Green I to quantify the viral load in the nested PCR- HCMV positive samples. A standard curve was generated Although this method did not allow quantitation in by 10 fold serial dilutions (8 × 10 – 8 copies) of a plasmid deparaffinised samples, the real time PCR assay con- containing a single copy of HCMV US28 gene. The regres- firmed the qualitative positivity obtained by nested PCR sion curve analysis consisting of 5 points tested in tripli- in 2 tested samples (data not shown). cate gave a reaction with an efficiency of 100% and a Spearmann's correlation coefficient (R ) of 0.99. Quanti- Discussion tative PCR analysis of DNA extracts from FFPE tissues did The role of HCMV in the development and progression of not allow to obtain reproducible data since the efficiency colorectal cancers has not yet been clarified. The presence of PCR was lower (60%, R = 0.82) than the 100% stand- of HCMV antigens and nucleic acids in colorectal cancers ard required. Also the replicate values, from a paraffin- has been obtained by means of molecular and virologic embedded tissue, were discordant (C standard deviation studies and a direct relationship between the virus and ≥ 1) and the dissociation curve highlighted the presence of cancer was suggested [7-11]. However, in other studies, no non specific amplified products in target samples. evidence of a direct association between colorectal cancer and HCMV infection was found [12-17]. The difficulty in obtaining reliable data from clinical sam- ples is probably linked to the process of paraffin removal More specifically, Harkins et al. [11] have conducted a that may result in formation of inhibitory substances study on 29 specimens of colorectal polyps and adenocar- N N 1 2 3 M 4 5 182 bp Nested PCR analysis Figure 2 of viral DNA from representative colorectal cancer samples Nested PCR analysis of viral DNA from representative colorectal cancer samples. DNA extracted from deparaffin- ised tissues was amplified with I-1/I-2 primers. Amplification of inner fragment yielded a band of 182 bp. Positive control (+); negative control (N); clinical samples, lanes 1–5; DNA molecular weight marker, M. Page 3 of 6 (page number not for citation purposes) Infectious Agents and Cancer 2009, 4:6 http://www.infectagentscancer.com/content/4/1/6 cinomas from different patients using immunohisto- Of interest is the detection of HCMV DNA in 20.8% of chemistry with two different antibodies, and reported the moderately differentiated adenocarcinomas, whereas it presence of HCMV proteins in about 80% of polyps and was undetectable in poorly and well-differentiated carci- 85% of adenocarcinomas, but not in adjacent healthy tis- nomas, similar to the findings of Knösel et al. [16]. It has sues. In addition, by means of PCR and DNA sequencing, been reported, in transformed HCMV cells, that the the presence of viral nucleic acids was detected in 6 HCMV infection could present a "hit and run" oncogenic- tumours (5 adenocarcinomas and 1 polyp) that were like mechanism [2,21], though viral DNA is undetectable immunoreactive for HCMV, whereas it was not detected in metastases. It's presence in earlier histological stages in healthy tissues from 3 of the same 6 patients. These may suggest that the presence of HCMV DNA might not results suggested a possible causative association between be essential to progress toward the transforming pheno- HCMV and colorectal cancer. Akintola-Ogunremi et al. type. Following the "hit and run" like mechanism, the [17] examined 23 colorectal hyperplastic polyps, 65 color- virus could mediate cellular transformation through an ectal adenomas and 51 colorectal adenocarcinomas by initial hit, while maintenance of the transformed state is immunohistochemical analysis with two different anti- compatible with the loss of viral molecules. Thus, the fact bodies. No nuclear HCMV antigen positivity was detecta- that we have detected viral DNA only in moderately differ- ble in any of the studied cases. In addition, PCR analysis entiated carcinomas may reflect the inability of HCMV to failed to detect viral DNA in 24 selected cases showing infect poorly differentiated cancer cells [22]. non-specific cytoplasmic immunostaining. These results are in stark contrast to those reported by Harkins et al The quantitative real time PCR analysis was validated on [11], since no evidence of HCMV DNA and proteins in HCMV DNA strains, but could not give reproducible data human colorectal adenocarcinomas and their precursor on DNA extracted from paraffin embedded samples. This lesions was found. could potentially be due to the presence of inhibitors in biopsy samples that can interfere with the PCR. Quantifi- Knösel et al [16] investigated the presence of HCMV DNA cation of HCMV viral load by real-time PCR can yield and antigens, by using PCR analysis and immunohisto- important information on the timing of HCMV infection. chemistry. Fifty seven primary tumours and 20 metastases Therefore, validation of the real-time PCR protocol in of fresh colorectal cancer tissue were tested, including 13 non-paraffin embedded samples could represent a useful tumour pairs (primary and metastases) from the same tool for the identification of HCMV in human cancer. patient. Four (7%) of 57 primary tumours were found positive for HCMV DNA by PCR, whereas all metastases Conclusion were negative. In addition, no specific staining was In conclusion, our observations, together with those of detected by immunohistochemistry analysis. Although other authors [16,17] suggest that there is no evidence of these results confirmed the results of Akintola-Ogunremi a direct association between HCMV and colorectal cancer. et al [17] indicating that there is no direct association Moreover, there is no evidence supporting that HCMV can between HCMV infection and progression or formation of fulfil the necessary criteria for defining a causative role in metastases in colorectal cancer, evidence of HCMV posi- the process of carcinogenesis and or progression of color- tivity in a small number of colorectal neoplasms was ectal cancer. One of these requirements is, in fact, the reg- found in the primary tumours. ular presence and persistence of the nucleic acid of the respective infectious agent in cells of the specific tumour Given the controversial conclusions of the reported type [23,24]. results, we further investigated the issue by establishing a specific qualitative PCR analysis and a quantitative PCR However, the fact that the virus may present a "hit and reaction for HCMV viral load determination. run" like-mechanism and that it was found only in a par- ticular stage of a processing adenocarcinomas, provides a The nested PCR analysis conducted in our laboratory useful indication that a certain type of adenocarcinoma allowed the identification of HCMV sequence in 6 have been infected by HCMV and that this could have (10.7%) of 56 tissue samples tested, and more precisely in contributed to trigger the oncogenic differentiation. 1 (5%) of 20 cases of adenoma and 5 (20.8%) of 24 cases of moderately differentiated adenocarcinomas. However, Methods there was no evidence of HCMV DNA in any of 5 cases of Specimen collection well-differentiated adenocarcinoma nor in 7 cases of The specimens included in this study consisted of 10% poorly differentiated adenocarcinoma, suggesting the lack FFPE tissue blocks of colorectal tumours from the archives of a causative association between virus infection and can- of the Pathology section of the Department of Pathology, cer development in these two groups of adenocarcinomas. University of Verona, Italy. Samples of 58 biopsies were obtained from different patients of which 20 were adeno- Page 4 of 6 (page number not for citation purposes) Infectious Agents and Cancer 2009, 4:6 http://www.infectagentscancer.com/content/4/1/6 mas and 38 adenocarcinomas. Of the 38 adenocarcino- The first-round of PCR amplification was performed in a mas, 5 were well differentiated, 25 moderately 20 μl reaction containing 2–5 μl of each genomic DNA differentiated and 8 poorly differentiated. sample. As positive controls for PCR reactions 3 different HCMV DNA samples were used: DNA extracted from Biopsies and histology human fibroblasts cultured in vitro and infected with an Samples were independently reviewed by two patholo- HCMV strain from a newborn baby with congenital infec- gists (AZ and FM) and classified according to the WHO tion and viral DNA of the two laboratory strains AD169 classification of tumours of the digestive system. In case of and Towne. Each experiment was conducted using posi- discrepancy, a consensus was reached by reviewing dis- tive and negative controls. cordant cases at a multi-head microscope. Representative tissue blocks were selected for DNA extraction, selecting For the first amplification round, after an initial denatur- blocks with high tumour content. ing step at 94°C for 5 min, 35 cycles of denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, extension Isolation of genomic DNA from paraffin-embedded tissues at 72°C for 30 sec, were made, followed by a final exten- Four 3 μm sections of each sample were deparaffinised sion at 72°C for 6 min. The amplified products were sub- with xylol/ethanol, collected into a 1.5 ml Eppendorf tube jected to the second round of PCR using the primer pair I- containing 100 μl of lysis solution: 0.1 M NaCl, 0.15 M 1/I-2 and 1 μl of the first round amplification product. EDTA pH 8.0, 0.1 M Tris-HCl pH 8.0, 1% SDS, 45.8 mM Cycling program was performed as follows: 94°C for 5 β-mercaptoethanol and 100 μg Proteinase K. The tubes min, 1 cycle; 94°C for 30 sec, 59°C for 30 sec, 72°C for were incubated at 55°C for 3 hours, followed by Protein- 30 sec, 40 cycles; 72°C for 5 min, 1 cycle. ase K heat inactivation. Samples were centrifuged at room temperature at 10.000 g for 5 min. The supernatants were At the end of the amplification 15–20 μl of each product collected and stored at -20°C, prior to the PCR amplifica- were analysed on 2.5% w/v agarose gels by electrophore- tion procedure. sis. Polymerase chain reaction analysis Real-time PCR Since DNA extracted from paraffin-embedded tissue The real-time quantitative PCR assay was performed on an might be partially degraded during formalin fixation or ABI Prism 7000 real time PCR instrument (Applied Bio- paraffin embedding [25], DNA quality was tested using systems). Primers used for amplification of HCMV US28 the following PCR primers specific for the human albumin gene in real-time reaction are summarised in Table 3 and gene: primer alb fw (5'gctgtcatctcttgtgggctgt 3') and primer were designed using Primer Express V2.0 software alb rv (5'actcatgggagctgctggttc 3'). A total of 56 samples (Applied Biosystems) on the basis of the sequence of were considered suitable to be tested for the presence of US28 gene of AD169 laboratory strain (GenBank acces- HCMV viral DNA. sion number: NC_001347) and then controlled by align- ing sequences with BLAST. The reaction mixture was set The analysis of HCMV in DNA samples was performed by using the Real Master Mix 2.5X (Eppendorf AG) contain- developing a nested PCR reaction with external and inter- ing SYBR Green I. Primers were used at a final concentra- nal primers specific for HCMV UL55 gene region that tion of 300 nM. Each sample was tested in triplicate. encodes for the envelope glycoprotein B. Oligonucleotide primers used to detect HCMV DNA have been described Reactions were performed under the following condi- previously [26] and are summarised in Table 2. External tions: 95°C for 5 min, followed by 45 cycles at 95°C for primers (E-1/E-2) amplify a 267 bp fragment, while inter- 20 sec and 60°C for 1 min. nal primers (I-1/I-2) amplify a 182 bp fragment. All sam- ples were tested in duplicate and samples positive for Data were collected and analysed by Sequence Detection HCM UL55 gene were tested at least in triplicate. System Software (Applied Biosystems). Table 2: Primers used for HCMV DNA amplification by nested PCR primer sequence amplicon length UL55 gene position E-1 TCCAACACCCACAGTACCCGT 267 bp 655 to 675 E-2 CGGAAACGATGGTGTAGTTCG 902 to 922 I-1 GTCAAGGATCAGTGGCACAGC 182 bp 685 to 705 I-2 GTAGCTGGCATTGCGATTGGT 847 to 867 Primers used for amplification of the HCMV glycoprotein B (UL55) gene in nested PCR. External primers amplify a 267 bp fragment, while internal primers amplify a 182 bp fragment Page 5 of 6 (page number not for citation purposes) Infectious Agents and Cancer 2009, 4:6 http://www.infectagentscancer.com/content/4/1/6 Table 3: Primers used for HCMV DNA amplification by real-time quantitative PCR primer sequence amplicon length gene position US28 S TCCATCGGCAACTTCTTGGT 65 bp 267671 to 267690 HHV5-US28As TCGCCGGAGCATTGAATC 267718 to 267735 Oligonucleotide primers used for amplification of the HCMV US28 gene in real-time PCR. Primers were designed using Primer Express V2.0 software (Applied Biosystems) on the sequence of US28 gene of the AD169 laboratory strain and controlled by aligning sequence with BLAST. nucleic acids and proteins in human colorectal cancer. Lancet Competing interests 2002, 360:1557-63. The authors declare that they have no competing interests. 12. Brichácek B, Hirsch I, Závadová H, Procházka M, Faltýn J, Vonka V: Absence of cytomegalovirus DNA from adenocarcinoma of the colon. Intervirology 1980, 14:223-7. Authors' contributions 13. Hart H, Neill WA, Norval M: Lack of association of cytomegalo- virus with adenocarcinoma of the colon. Gut 1982, 23:21-30. CB conducted the PCR analysis and optimisation, 14. Ruger R, Fleckenstein B: Cytomegalovirus DNA in colorectal designed the quantitative PCR study and drafted the carcinoma tissues. Klin Wochenschr 1985, 63:405-8. paper. DZ participated in the design and coordination of 15. Boguszaková L, Hirsch I, Brichácek B, Faltýn J, Fric P, Dvoráková H, Vonka V: Absence of cytomegalovirus, Epstein-Barr virus, and the study, contributed with the manuscript drafting. CB papillomavirus DNA from adenoma and adenocarcinoma of conducted DNA quality analysis. SC did DNA extractions. the colon. Acta Virol 1988, 32:303-8. 16. Knösel T, Schewe C, Dietel M, Petersen I: Cytomegalovirus is not AZ reviewed the cases and selected blocks for DNA stud- associated with progression and metastasis of colorectal ies. FM enrolled patients, collected samples and reviewed cancer. Cancer Lett 2004, 211:243-7. the cases. UB supervised the whole project and gave a sig- 17. Akintola-Ogunremi O, Luo Q, He TC, Wang HL: Is cytomegalovi- rus associated with human colorectal tumorigenesis? Am J nificant contribution in drafting the manuscript. All Clin Pathol 2005, 123:244-9. authors read and approved the final manuscript. 18. Lo Y-MD, Mehal WZ, Fleming KA: In vitro amplification of hepa- titis B virus sequences from liver tumor DNA and from par- affin wax embedded tissues using the polymerase chain Acknowledgements reaction. J Clin Pathol 1989, 42:840-846. We thank Dr. Sunwen Chou (Division of Infectious Diseases, Oregon 19. An SF, Fleming KA: Removal of inhibitor(s) of the polymerase Health Sciences University, Portland, USA) for providing AD169 and chain reaction from formalin fixed, paraffin wax embedded tissues. J Clin Pathol 1991, 44:924-927. Towne laboratory HCMV strains. We also thank the Division of Microbiol- 20. Coates PJ, d'Ardenne AJ, Khan G, Kangro HO, Slavin G: Simplified ogy, Immunology and Virology of the Ospedale Maggiore di Borgo Trento, procedures for applying the polymerase chain reaction to Verona, Italy, for providing a sample of HCMV infected human fibroblasts. routinely fixed paraffin wax sections. J Clin Pathol 1991, This study was supported in part by MIUR PRIN 2005 and Cariverona (to 44:115-118. U. Bertazzoni). 21. Galloway DA, McDougall JK: The oncogenic potential of herpes simplex viruses: evidence for a 'hit-and-run' mechanism. Nature 1983, 302:21-4. References 22. Jarvis MA, Wang CE, Meyers HL, Smith PP, Corless CL, Henderson 1. Landolfo S, Gariglio M, Gribaudo G, Lembo D: The human GJ, Vieira J, Britt WJ, Nelson GA: Human cytomegalovirus infec- cytomegalovirus. Pharmacol Ther 2003, 98:269-297. tion of caco-2 cells occurs at the basolateral membrane and 2. Cinatl J Jr, Cinatl J, Vogel JU, Rabenau H, Kornhuber B, Doerr HW: is differentiation state dependent. J Virol 1999, 73:4552-4560. Modulatory effects of human cytomegalovirus infection on 23. zur Hausen H: Molecular pathogenesis of cancer of the cervix malignant properties of cancer cells. Intervirology 1996, and its causation by specific human papillomavirus types. 39:259-69. Curr Top Microbiol Immunol 1994, 186:131-56. Review 3. Shen Y, Zhu H, Shenk T: Human cytomagalovirus IE1 and IE2 24. zur Hausen H: Viruses in human cancers. Eur J Cancer 1999, proteins are mutagenic and mediate "hit-and-run" onco- 35:1878-85. Review. genic transformation in cooperation with the adenovirus 25. Goelz SE, Hamilton SR, Vogelstein B: Purification of DNA from E1A proteins. Proc Natl Acad Sci USA 1997, 94:3341-5. formaldehyde fixed and paraffin embedded human tissue. 4. Doniger J, Muralidhar S, Rosenthal LJ: Human cytomegalovirus Biochem Biophys Res Commun 1985, 130:118-126. and human herpesvirus 6 genes that transform and transac- 26. Schafer P, Braun RW, Mohring K, Henco K, Kang J, Wendland T, tivate. Clin Microbiol Rev 1999, 12:367-82. Kuhn JE: Quantitative determination of human basolateral 5. Kalejta RF, Shenk T: Manipulation of the cell cycle by human membrane and is differentiation state dependent. J Virol 1999, cytomegalovirus. Front Biosci 2002, 7:295-306. 73:4552-4560. 6. Castillo JP, Kowalik TF: HCMV infection: modulation the cell cycle and cell death. Int Rev Immunol 2004, 23:113-139. 7. Huang ES, Roche JK: Cytomegalovirus D.N.A. and adenocarci- noma of the colon: Evidence for latent viral infection. Lancet 1978, 1:957-60. 8. Hashiro GM, Horikami S, Loh PC: Cytomegalovirus isolations from cell cultures of human adenocarcinomas of the colon. Intervirology 1979, 12:84-8. 9. Grail A, Norval M: Elution of cytomegalovirus antibodies from adenocarcinoma of the colon. Gut 1985, 26:1053-8. 10. Roche JK, Cheung KS, Boldogh I, Huang ES, Lang DJ: Cytomegalo- virus: detection in human colonic and circulating mononu- clear cells in association with gastrointestinal disease. Int J Cancer 1981, 27:659-67. 11. Harkins L, Volk AL, Samanta M, Mikolaenko I, Britt WJ, Bland KI, Cobbs CS: Specific localisation of human cytomegalovirus Page 6 of 6 (page number not for citation purposes)

Journal

Infectious Agents and Cancer – Springer Journals

Published: Apr 16, 2009

There are no references for this article.