Get 20M+ Full-Text Papers For Less Than $1.50/day. Subscribe now for You or Your Team.

Learn More →

ANISERP: a new serpin from the parasite Anisakis simplex

ANISERP: a new serpin from the parasite Anisakis simplex Background: Serine proteinase inhibitors (serpins) finely regulate serine proteinase activity via a suicide substrate-like inhibitory mechanism. In parasitic nematodes, some serpins interact with host physiological processes; however, little is known about these essential molecules in Anisakis. This article reports the gene sequencing, cloning, expression and preliminary biochemical and bioinformatically-based structural characterization of a new Anisakis serpin (ANISERP). Methods: The full AniSerp gene was cloned by specific RACE-PCR after screening an Anisakis simplex (L3) cDNA library. For biochemical assays, the AniSerp gene was subcloned into both prokaryotic and eukaryotic vectors, and the recombinant proteins were purified. The inhibitory properties of the proteins were tested in classical biochemical assays using human serine peptidases and AMC substrates. Immunolocalization of ANISERP, theoretical structural analysis and bioinformatically-based structural modelling of the ANISERP protein were also conducted. Results: The AniSerp gene was found to have 1194 nucleotides, coding for a protein of 397 amino acid residues plus a putative N-terminal signal peptide. It showed significant similarity to other nematode, arthropod and mammalian serpins. The recombinant ANISERP expressed in the prokaryotic and eukaryotic systems inhibited the human serine proteases thrombin, trypsin and cathepsin G in a concentration-dependent manner. No inhibitory activity against Factor Xa, Factor XIa, Factor XIIa, elastase, plasmin or chymotrypsin was observed. ANISERP also acted on the cysteine protease cathepsin L. ANISERP was mainly localized in the nematode pseudocoelomic fluid, somatic muscle cell bodies and intestinal cells. The findings of molecular dynamics studies suggest that ANISERP inhibits thrombin via a suicide substrate-like inhibitory mechanism, similar to the mechanism of action of mammalian coagulation inhibitors. In contrast to findings concerning human antithrombin III, heparin had no effect on ANISERP anticoagulant inhibitory activity. Conclusions: Our findings suggest that ANISERP is an internal Anisakis regulatory serpin and that the inhibitory activity against thrombin depends on a suicide substrate-like inhibitory mechanism, similar to that described for human antithrombin (AT)-III. The fact that heparin does not modulate the anticoagulant activity of ANISERP might be explained by the absence in the latter of five of the six positively charged residues usually seen at the AT-III-heparin binding site. Keywords: Serpin, Proteinase, Anisakis, Trypsin, Thrombin, Cathepsin L, Anticoagulant properties, Modelling analysis, Heparin * Correspondence: chus.perteguer@isciii.es Equal contributors Servicio de Parasitología, Centro Nacional de Microbiología, Instituto de Salud Carlos III, 28220 Majadahonda, Madrid, Spain Parasitology Department, Centro Nacional de Microbiología, Instituto de Salud Carlos III, 28220 Majadahonda, Madrid, Spain Full list of author information is available at the end of the article © 2015 Valdivieso et al. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http:// creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 2 of 10 Background GGAAACGACCAATAAACAGAATGCG 3′). The gene Anisakis spp. are parasitic nematodes that infect the was named AniSerp. Standard amplification protocols were gastrointestinal tract of sea mammals [1], producing gastric used in all cases [19]. ulcers and haemorrhagic exudates; they can also penetrate the abdominal cavity by crossing the gastrointestinal Bioinformatic analysis wall [2]. Humans are accidental hosts that become affected The theoretical molecular weight and isoelectric point of via the ingestion of Anisakis larvae present in raw or the full ANISERP protein were obtained using the undercooked fish and seafood. Human Anisakis infec- Expasy Compute pI/Mw tool (http://web.expasy.org/ tion causes gastrointestinal disease with mild to severe compute_pi/). The protein sequence was also compared clinical symptoms such as nausea, vomiting, diarrhoea, with sequences included in the GenBank database, by and abdominal and epigastric pain [3]. Occult blood is using the BLASTp program [20], and its motifs were often present in the gastric juice and faeces [4]. Gastro- characterised using ScanProsite software (ExPASY intestinal symptoms are often associated with allergic Bioinformatics Resource Server; http://www.expasy.org/ reactions involving specific IgE responses to parasite proteomics). The putative N-terminal signal peptide in allergens [5–7]. the protein was predicted using the SignalP 4.1 Server The serpins belong to the superfamily of serine peptidase program [21]. inhibitors and are expressed by many organisms ranging from plants to vertebrates. They help to control proteolysis Subcloning, expression in Escherichia coli and purification in molecular pathways associated with tissue homeostasis/ of recombinant ANISERP protein cell survival, development, and host defence [8]. Some The AniSerp gene without the sequence coding for the have cross-class activity and can inhibit cysteine proteinases predicted putative N-terminal signal peptide was sub- [9, 10]; others may even behave as non-inhibitory chaper- cloned into the pGEX4T2 expression vector (GE Health- ones, tumour suppressors or transport molecules [8]. care Life Sciences) and further transformed into the Serpin expression in parasites, especially helminths, is BL21 strain of E. coli (F-, ompT, hsdS [rb-, mb-], gal) the subject of intense study [11–13]. In nematodes, serpins (GE Healthcare Life Sciences). Recombinant protein ex- interact with endogenous parasite proteinases and some are pression was induced by different protocols to obtain a also believed to play important roles in defence against soluble fusion protein similar to the native protein, digestion by host proteinases, inhibition of the host im- which was subsequently purified. Expression protocols mune response, and even as immunomodulators [12, 14]. including different combinations of incubation tempera- In Anisakis, only four serine proteinase inhibitors have tures (16 and 37 °C), concentrations of isopropyl β-D-1- been characterized to date: Anisakis ASP1, ASP2 and thiogalactopyranoside (ITPG) (0.01, 0.1, 0.5 and 1 mM) Ani s 6, which belong to a unique class of nematode in- and incubation times (4-16 h) were used. Once the re- hibitors (smapins), and Ani s 1, an allergen belonging to combinant ANISERP protein was obtained in its soluble the Kunitz-type family [15–18]. The present article re- form, it was purified by glutathione-Sepharose 4B bead ports the molecular and biochemical characterization of affinity chromatography and eluted with 15 mM gluta- ANISERP, a new Anisakis serpin [GenBank™: FR694897]. thione, 100 mMTris-HCl pH 8, 0.1 % Triton X-100 elu- tion buffer. The purified recombinant protein was then Methods dialyzed. The protein concentration was determined AniSerp gene cloning using the BCA Protein Assay Kit (Thermo Scientific), An Anisakis simplex truncated cDNA that showed notable with bovine serum albumin (BSA) as a standard [22]. similarity to serpin genes (NCBI) was obtained by screen- The expressed protein was then subjected to SDS-PAGE ing a cDNA library obtained from the L3 stage larvae. analysis and Coomassie staining, plus Western blot ana- Amplification of the 5′ end was performed by RACE-PCR lysis with an anti-GST antibody (GE Healthcare Life and using a parasite cDNA collection prepared with the Sciences). Marathon cDNA amplification kit (Clontech) and the forward primer AP1 (5′ CTAATACGACTCACTATAG Subcloning, expression in Sf9 insect cells, and purification GGC 3′), which corresponds to the AP1 adaptor sequence of recombinant His-tagged ANISERP protein. Mass of the A.simplex cDNA collection, and reverse primer SR1 spectrometry analysis (5′ ACCCGCAGTAGTTTTATCCATTTGTTCG 3′), the The AniSerp gene was amplified using the oligonucleotides design of which was based on the truncated cDNA AniSerp_Fw 5′ GGGGACAAGTTTGTACAAAAAAGCA sequence. On the basis of the information obtained, two GGCTTCATGCAGCAGACAATCGATGATGCCCAAGC new primers were used to amplify the full gene by PCR: the 3′ and AniSerp_Rv 5′ GGGGACCACTTTGTACAAGAA forward primer SER5′ (5′ ATGATGACAGCATTACCGT AGCTGGGTTCAGTGGAAACGACCAATAAACAGA TTTTAAC 3′) and the reverse primer SER3′ (5′ TCAGT ATGCG 3′ (Sigma Genosys). A recombinant bacmid Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 3 of 10 carrying the AniSerp gene was obtained using the appropriate reaction buffer. In all cases, the enzyme Gateway Cloning System (Life Technologies), follow- concentrations used in the assays were linearly related ing the manufacturer’s instructions. The bacmid DNA to the reaction time (30 min). The inhibition controls (1–2 μg) was transfected into Sf9 insect cells with used were AEBSF (1 mM) (serine-proteinases inhibitor) Cellfectin® II Reagent (Invitrogen), following the man- and E-64 (10 μM; acysteineproteinaseinhibitor), both ufacturer’s instructions, yielding infectious recombin- obtained from Sigma-Aldrich. After addition of the ant baculovirus particles. The transfected Sf9 insect substrate (final concentration 250 μM) to the reaction cells were cultured in TC100-Insect Medium (Sigma- mixture, the residual enzyme activity was measured by Aldrich), containing 10 % FBS (Gibco), to produce continuous monitoring for AMC substrates at excitation large amounts of the recombinant ANISERP protein. and emission wavelengths of 380 and 460 nm respectively, Soluble His-tagged ANISERP protein was then purified in a Victor 3 1420 Perkin Elmer Fluorescence microplate by affinity chromatography, with a 1 ml HiTrapTM FF reader (Perkin Elmer España S.L.). Reactions with the crude column (GE Healthcare) and an ÅKTA FPLC system pNA substrate were monitored, at 405 nm, in an ELX (GE Healthcare), according to standard procedures. 800TM Bioteck Absorbance microplate reader (Bioteck). Fractions were analyzed in SDS-PAGE gels stained Purified GST was also used as a negative control for pro- with Coomassie Brilliant Blue (Bio-Rad). The ANISERP teinase inhibition when ANISERP was produced in protein from different fractions was pooled, dialyzed against pGEX4T2/E. coli. PBS, quantified by the BCA method, and stored at−80 °C until use. Finally, the identity of the recombinant protein Anti-ANISERP hyperimmune sera was confirmed by MALDI-TOF mass spectrometry, ac- A female New Zealand rabbit was immunized, via sub- cording to standard procedures [19]. cutaneous injection, with ANISERP recombinant pro- tein fused to GST (glutathione transferase), by using Inhibitory assays the following protocol: 75 μg/ ml of ANISERP recom- The inhibitory activity of ANISERP against 10 protein- binant protein was equally emulsified with Freund ases (trypsin, chymotrypsin, plasmin, elastase, FXa, FXIa, Adjuvant and administered in three doses, a single dose FXIIa, thrombin, cathepsin G and cathepsin L) was ex- with Freund Complete Adjuvant (ACF) and the amined by measuring the residual proteolytic activity on remaining two with Freund Incomplete Adjuvant (FIA) specific proteinase substrates after the incubation of 20 and 40 days after the first injection. Blood samples each enzyme with purified recombinant ANISERP. were collected prior to the first injection and two Table 1 includes the reaction conditions for each pro- months after the last injection. Serum samples were teinase tested. In addition, and taking into account the collected after centrifugation of clotted blood and report by Morris and Sakanari [15], ANISERP inhib- stored at−20 °C until use. ition of serine proteinase activity in A. simplex crude extract was determined using Z-Gly-Pro-Arg-AMC in 50 mMTris/HCl pH 7.5 plus 20 mMNaCl as a sub- Ethical approval strate. All substrates were purchased from Sigma The rabbit was maintained and immunized in accord- Aldrich. Assays were performed after incubation of ance with institutional and national guidelines. The ANISERPwith eachenzymefor 10 minat37°Cinthe protocol was approved by the Ethics Committee for Table 1 Enzymes, substrates and reaction conditions for each proteinase tested Enzyme [Enzyme] [Substrate] 250 μM Activity buffer Thrombin 74 nM Boc-Val-Arg -AMC 50 mM Tris–HCl pH 8, 100 mM NaCl Trypsin 54 nM Boc-Gln-Ala-Arg-AMC 50 mM Tris–HCl pH 8, 1 mM CaCl2, 0.15 M NaCl Cathepsin G 0.33 nM N-Succinyl-Ala-Ala-Phe-AMC. 50 mM HEPES/NaOH pH 7.5 Cathepsin L 0.83 nM Z-Phe-Arg-AMC Sodium acetate 100 mM pH 5.5, 1 mM EDTA, 4 mM DTT, 0.001% BSA Plasmine 333 nM Nt-Boc-Val-Leu-Lys-AMC 50 mM Tris–HCl pH 8, 50 mM NaCl Elastase 1.2 nM N-Methoxysuccinyl-Ala-Ala-Pro-Val-7 amido AMC 25 mM Tris–HCl pH 8, 100 mM NaCl, 1 mM CaCl2 Chymotrypsin 0.012 nM N-succinyl-Lelu-Leu-Val-Tyr-7 amido AMC 100 mM HEPES/ NaOH pH 7.5 Factor Xa 0.054 nM Boc-Ile-Glu-Gly-Arg-7 amido AMC 50 mM Tris–HCl pH 8.3, 5 mM CaCl2, 0.2 mM NaCl Factor XIa 14,000 nM Boc-Phe-Ser-Arg-7 amido AMC 50 mM Tris–HCl pH 8, 100 mM NaCl, 1 mM CaCl2 Factor XIIa 0.0017 nM Boc-Val-Arg-AMC 4 mM Sodium Acetate-HCl/0.15 M NaCl/pH 5.3 Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 4 of 10 Research and Animal Welfare (CEIyBA) of the ISCIII Modelling procedures (CBA N# 09_2014_v2). Structural three-dimensional models for ANISERP were constructed by homology modelling procedures based on Protein Data Bank structures (selected on the basis Immunohistochemical localization of ANISERP of strong sequence similarity, coverage and sequence- Live third-stage larvae of A. simplex were collected from to-structure compatibility), using both BLAST [20] and thebodycavityof bluewhiting (Micromesistiuspoutassou) threading (Phyre server [25]) procedures. The template purchased at a local market, washed several times in selected was 1JMO (the structure of the human heparin physiological saline, cut into two portions (of which the cofactor II [HCII]-thrombin complex) [26]. The model anterior one-third includes the ventricle and part of the was produced using the SWISS-MODEL server facil- intestine) and fixed in 10 % buffered formalin for 12 h. ities [27–29]athttp://swissmodel.expasy.org/SWISS- After fixation, the samples were washed with PBS, MODEL.html. The structural quality of the models was dehydrated, embedded in paraffin and cut into 5 μm- checked using the analytical programs provided by the thick sections, as previously described [23]. Once same server (Anolea/Gromos/Verify3D). For geometric deparaffinized and hydrated, the slides were blocked optimization, the models were energy minimized using with PBS containing 0.05 % Tween 20 and 1 % dry the DeepView GROMOS 43B1 force field routine [30], skimmed milk (PBS-T-SM) for 2 h at room temperature by applying 500 steps of steepest descent minimization (RT).AsANISERPwas expressedasaGST-fusion pro- followed by 500 steps of conjugate-gradient minimization. tein, and to inhibit any potential cross-reactivity with The structure of human thrombin, included in PDB file GST from Anisakis, rabbit hyperimmune serum raised 1JMO, was also re-modelled to include a serine residue at against recombinant ANISERP and preimmune serum catalytic position 205, which is an alanine in the crystal- (as negative control) were diluted 1/100 and preincu- lized protein. Finally, in order to produce a high quality bated with or without GST, at 50 μg/ml, in PBS-T-SM model for the proposed contact between human thrombin for 1 h at RT. The samples were then placed on the and ANISERP, the structure resulting from homology slides and incubated for 2 h at RT. The slides were modelling was subjected to a 2 ns standard molecular dy- washed three times with PBS-T (for 5 min each time) namics simulation using the PMEMD module of the and then incubated with 0.3 % hydrogen peroxide in AMBER9 software package [31] and the parm99 param- PBS for 30 min RT to quench endogenous peroxidase eter set for the same distribution. activity. The sections were washed and incubated with To compare the 3D positions of putative heparin bind- peroxidase-conjugated goatanti-rabbitIgG (Bio-Rad) ing sites, structural alignment between the ANISERP diluted 1/200 in PBS-T-SM for 1 h at RT. The slides model (after molecular dynamics procedures) and the were washed again, and bound antibodies were revealed Protein Data Bank structures of human HCII (1JMO) with 0.5 mg/ml 4-chloro-1-naphthol (Sigma-Aldrich) in [26] and human AT-III (1 ATH_A) [32]) was performed TBS with 0.005 % hydrogen peroxide. Finally, sections using the Dali program [33]. Structure plots were gener- were washed with TBS and mounted with glass cover- ated using the PyMOL program (DeLano Scientific). slips in PBS-glycerol (1:1) for examination and photog- raphy. The slides were then stained with Wheatley’s Results and discussion trichrome, as described elsewhere [24]. The truncated AniSerp gene was cloned during the screening of an A. simplex L3 cDNA library. The frag- Effect of heparin on the thrombin inhibition assay ment was 1005 nt long (334 aa) and lacked the 5′ end. It Assays were performed with 200 μl of 50 mMTris/HCl, showed notable similarity to serine proteinase inhibitors 100 mMNaCl, pH 8. Inhibition reaction mixtures con- (GenBank). Amplification of the 5′ end was then per- tained from 0.1 μg/ml to 100 μg/ml (0.1, 5, 15, 25, 45, formed by RACE-PCR with new primers based on the 70 and 100 μg/ml) heparin and 2.7 nM ANISERP. The truncated gene, and the full sequence was isolated in the reaction was initiated by adding 74 nM thrombin. After same way. The novel sequence contained 1194 nucleo- incubation of the plates for 5 min, 50 μl of a solution tides and expressed a deduced amino acid backbone of containing 250 μM Boc-Val-Arg-AMC and 0.33 mg/ml 397 residues (with a predicted molecular weight of Polybrene (Sigma-Aldrich) was added. Residual throm- 44.6 kDa) plus a putative N-terminal signal peptide of 25 bin activity was determined by measuring the hydrolysis residues. Bioinformatic analysis showed that the gene of the fluorescent substrate (Boc-Val-Pro-Arg-AMC) in included a serpin signature (374–384 residues: FIADHP- a Victor 3 1420 Perkin Elmer fluorescent microplate FIFTI) and a potential reactive centre loop (RCL) (p17 reader. As a positive control, the same experiment was [E]-p16 [E/K/R]-p15 [G]-p14 [T/S]-p13[X]-p12-9[A/G/ performed with antithrombin (AT) (0.1 mg/ml) instead S]-p8-1 [X]-p1′-4′). Database comparisons showed similar- of ANISERP. ities between ANISERP and different serine proteinase Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 5 of 10 inhibitors of nematodes and other organisms. The highest systems. ANISERP has two potential N-glycosylation similarity scores were obtained for the serpins described in sites, 87-NDSA and 327-NDSL, which do not appear to Toxocaracanis (putative serpin-like protein [2e-141, 59 %; influence its inhibitory effect. ANISERP inhibited throm- KHN 72249.1]), Ascarissuum (putative serpin-like protein bin (IC 152 nM), trypsin (IC 173 nM), cathepsin G 50 50 [1e-103, 45 %; ERG 78895.1] and serpin b6 [3e-102, 46 %; (IC 542 nM) and cathepsin L (IC 217 nM) in a 50 50 ERG 82472.1]). ANISERP also showed similarity to the concentration-dependent manner (Fig. 1). No other pro- Bostaurus serpin peptidase inhibitor (4e-69, 38 %, teinase, including the parasite peptidase, was affected. NP001193642.1), mouse (Mus musculus) serpin 3b (3e-68, This suggests that the Anisakis peptidase described by 37 %, NP941373.1) and mouse squamous cell carcinoma Morris & Sakanari [15] is not the biological target of antigen 2-related protein 1 (2e-67, 36 %, AAN62872.1). ANISERP. Complete inhibition of cysteine and serine These findings were used together to design ANISERP proteinases was observed when E-64 (10 μM) and functional characterization experiments. AEBSF (1 mM) were used as positive controls (data not To obtain the recombinant ANISERP protein, the gene shown). The inhibition of cathepsin L activity confirmed without the putative N-terminal signal peptide was sub- the cross-class nature of ANISERP. cloned into pGEX, and the full sequence was subcloned To locate the possible site of synthesis and final destin- into the baculovirus vector system. These genes were ation of ANISERP, an immunohistochemical study was per- expressed in prokaryotic and eukaryotic cells respect- formed on A. simplex L3 tissuesbyusing ahyperimmune ively, and they were then purified. To collect the pro- serum raised against recombinant ANISERP-GST. Pre- teins in functional form, different expression conditions incubation of the serum with GST did not inhibit the were tested. For the E. coli system, the conditions were intensity of staining by immunohistochemistry or the 0.01 mM IPTG and incubation at 16 °C for 16 h. For the signal obtained by indirect ELISA against A. simplex baculovirus system, the conditions were a multiplicity of crude extracts (data not shown), indicating that recog- infection of 0.1 (virus titre 5×10 pfu/ml), incubation at nition was specific to ANISERP. As shown in Fig. 2a 27 °C and collection at 72 h. and c, ANISERP was highly concentrated in the pseu- The effect of the recombinant ANISERP on proteolytic docoelomic fluid (haemolymph) and in non-contractile activity was the same in both prokaryotic and eukaryotic cell bodies (myocytons) of the somatic musculature, Fig. 1 Effect of ANISERP on the proteolytic activity of human thrombin, trypsin, cathepsin L and cathepsin G. Inhibitory effect of different doses of recombinant ANISERP, expressed in a baculovirus system, on the enzymatic activity of a Thrombin (74 nM) on Boc-Val-Arg-AMC, b Trypsin (54 nM) on Boc-Gln-Ala-Arg-AMC, c Cathepsin L (0.83 nM) on Z-Phe-Arg-AMC, and d Cathepsin G (0.33 nM) on N-succinyl-Ala-Ala-Phe-AMC Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 6 of 10 Table 2 Summary of the immunohistochemical staining results indicating the tissue distribution of ANISERP a a Structures Staining Structures Staining Dorsal oesophageal gland - Excretory cell - Subventral muscular sectors ++ Excretory canal - of oesophagus Ventricle - Hypodermis ± Intestine ++ Lateral hypodermal ± cords Intestinal lumen - Cuticle - Pseudocoelom fluid +++ Somatic muscle cell +++ bodies -,no staining; ±, weak staining; +, ++ and +++, increasing intensity of positive staining the mouth/anus, and iii) secretory antigens, which are released by the excretory cell through the excretory pore, located at the base of subventral lips; the latter constitutes the main source of known Anisakis allergens. Somatic antigens can also come into contact with host tissues, but only in cases in which larvae die and remain in tissues (typically in chronic infections). The absence Fig. 2 Immunolocalization of ANISERP in sections of Anisakis simplex L3 with a rabbit hyperimmune serum. a Cross section at the level of of staining in the dorsal oesophageal gland, intestinal the oesophagus showing strongly positive staining in SM and PF, lumen, excretory cell and cuticle (Table 2) clearly indi- moderate staining in SOM and slight staining of LC. No staining cates that ANISERP is not released to the external was observed in the EC. b The negative control incubated with medium and, consequently, its inhibitory action is prob- the preimmune serum did not stain. c Cross section through the ably directed against endogenous proteases. This explains intestinal level showing in detail strongly positive immunostaining in the SM, which is restricted to the nSM; no staining was observed in why the recombinant ANISERP was not recognized by the cSM, the C or EC, including the ca. Less intense staining was also sera from patients infected with Anisakis during the acute observed in IC. d Section C was decolorized to remove the 4CN stain phase (data not shown). and subsequently stained with Wheatley’s trichrome. DOG, dorsal As the strongest staining was observed in myocytons oesophageal gland; SOM, subventral muscular sectors of oesophagus; and pseudocoelomic fluid, we can hypothesize that som- SM, somatic musculature; LC, lateral hypodermal cords; PF, pseudocoelomic fluid; EC, excretory cell; V, ventricle; IC, intestinal atic muscle cells are the major source of ANISERP, cells; nSM, non-contractile portion of somatic muscle cells (myocytons); which can be then released to the haemolymph. cSM, contractile portion of somatic muscle cells; C, cuticle; ca, excretory Although the putative secretory functions of somatic canal; n, nucleus muscle cells in Anisakis have not been reported before, this type of activity has been reported in muscular cells and it was absent in the contractile portion of these of Caenorhabditis elegans transfected with a plasmid cells (see Fig. 2d for better identification of the struc- encoding a signal peptide fused to green fluorescent protein tures). Positive staining was also found to a lesser [34]. The presence of a putative signal peptide in ANISERP extent in cells belonging to subventral muscular sectors is consistent with this hypothesis. of the oesophagus and intestine, and weak staining was In addition to myocytons and pseudocoelomic fluid, observed in the lateral hypodermal cords and hypoder- staining for ANISERP was also intense in intestinal cells. mis. In addition to the contractile portion of somatic As intestinal and muscular cells originate from different muscle cells, other structures that did not stain germinal layers (i.e. endoderm and mesoderm respect- included the cuticle, the dorsal oesophageal gland, the ively), we can also hypothesize that more than one Ani- excretory cell (including the excretory canal), the intes- sakis serpin is recognized by the polyclonal antibody. tinal lumen and the ventricle (Fig. 2a and c, and Although this possibility merits further investigation, the Table 2). fact that other similar serpins exist in the Anisakis tran- When marine mammals or humans are infected by L3 scriptome (unpublished results) is consistent with the Anisakis larvae, three sources of parasite antigens can be hypothesis. delivered to host tissues while larvae remain alive: i) Finally, an in silico analysis of the ANISERP molecule cuticle antigens, which are in direct contact with host was performed to predict its tertiary structure and help tissues, ii) gut antigens, which can be released through to determine how it might interact with the serin Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 7 of 10 proteases that it inhibits, based on characteristic and acids from Met358 to Phe374. Contacts between resi- conserved serpin folding. Thrombin protease was chosen dues of the two proteins in this region involve hydro- as a model as it yielded the lowest IC . To obtain a reli- phobic clusters and the junctions at the active centre, able representation of the actual interactions between including contact between the thrombin catalytic triad proteins, a homology-based 3D model of ANISERP His43, Asp99 and Ser205 and the ANISERP Arg361 (P1) bound to thrombin was generated. To obtain an even and Ser362 (P1′) residues (Fig. 3c). more realistic molecular model for the Anisakis serpin, In the human coagulation cascade, AT III inhibits the the Ala205 located at the catalytic centre of human serine proteinases trypsin and plasmin along with the thrombin was substituted by a Ser residue (model coagulation factors thrombin and FXa. The effect of 1JMO). On the basis of the initial interaction model, ANISERP on FXa was therefore tested. No inhibition short-step (2 ns) molecular dynamics were applied to was observed, as indicated above (data not shown). In the whole structure to help the amino acid side chains contrast, HCII inhibits the serine proteases thrombin, and the reactive centre loop (RCL) backbone achieve a chymotrypsin and cathepsin G. The distinct enzyme stable, low-energy conformation that would allow ana- specificities of ATand HCII appear to be the result of lysis of specific contacts between the two proteins amino acid changes in P1 and the immediately adja- (Fig. 3a). The ANISERP model showed all the character- cent residues of the RCL-enzyme recognition sequence. istics described for classic mammalian serpins, i.e. mixed AT, which has an Arg at P1, is an inhibitor of the Arg- parallel and antiparallel six-stranded β-sheets with the proteinases thrombin and FXa, while HCII is a specific central strand containing several residues from the RCL. thrombin inhibitor with an unfavourable Leu residue at P1 This observation is consistent with that reported by [36]. The inhibitory activity of ANISERP, which selectively Zang & Maizels [35], i.e. although overall nematode ser- blocks human thrombin without affecting FXa, may be pins show less primary sequence similarity to their explained by considering that it has an Arg at P1, as does mammalian homologues, they can acquire a common, AT. In addition, the 14 amino acid changes in the adjacent highly ordered tertiary structure. Figure 3b shows the residues of theRCL mayberesponsible forthe different thrombin substrate groove involving ANISERP amino specificities of ANISERP, including the lack of FXa activity. A B Fig. 3 Model for ANISERP-human thrombin binding. a General view of the model for ANISERP binding to human thrombin. The location of the ANISERP reactive centre loop (RCL [green]) in the structural groove of the thrombin is indicated. The thrombin surface is coloured according to its theoretical electrostatic properties (blue = positive, red = negative). b Residues in the heavy chain of human thrombin; binding of amino acids Met358 and Phe374 in ANISERP. c Position of residues in the catalytic triad of human thrombin (His43, Asp99 and Ser205) and their positions relative to ANISERP residues Arg361 and Ser362 (P1 and P1′ respectively). Distances between active residues and atoms in the peptide bond of the substrate, compatible with proteinase activity, are indicated Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 8 of 10 Fig. 4 Effect of heparin on ANISERP inhibition of human thrombin proteolytic activity. Residual activity of thrombin after incubation with recombinant ANISERP (circles)orAT(squares) with increasing concentrations of heparin (0.1-100 μg/ ml). ANISERP was used at a fixed concentration of 2.17 nM (IC : 152 nM) Fig. 5 Sequence and structural alignment of ANISERP, human antithrombin III (1 ATH_A), and human heparin cofactor-II (1JMO). The key residues involved in heparin binding described for human antithrombin III (Arg 47, Lys114, Lys125, Arg 129, Arg132 and Lys133) are shown as purple boxes and spheres. The key residues involved in heparin binding described for heparin cofactor-II (Lys173, Arg184, Lys185, Arg189, Arg192 and Arg193) are shown as blue spheres. The positions of the P1-P1’residues in the ANISERP sequence are indicated. The residues in the 1JMO and 1ATH_A sequences are numbered according to Baglin et al. [26] Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 9 of 10 Nevertheless, experiments with ANISERP variants con- holds a predoctoral fellowship from the Spanish Ministerio de Educación, Cultura y Deporte (Programa de Formación del Profesorado Universitario). structed by site-directed mutagenesis should be conducted The funders did not have any role in the design of the study, data collection, to assess whether these changes in the RCL are involved in analysis, decision to publish, or preparation of the manuscript. the specific reaction between ANISERP and thrombin. Author details As thereissomeevidence[37,38] that theactivityof the Servicio de Parasitología, Centro Nacional de Microbiología, Instituto de AT and HCII inhibitors is greatly potentiated by heparin, Salud Carlos III, 28220 Majadahonda, Madrid, Spain. Laboratorio de Biología the effect of heparin on ANISERP inhibitory activity on Celular de Parásitos, Instituto de Biología Experimental, Facultad de Ciencias, Universidad Central de Venezuela, 47069, Caracas 1041-A, Venezuela. thrombin was also studied. Heparin (0.1 to 100 μg/ml) did Departamento de Bioquímica y Biología Molecular I, Facultad de Químicas, not affect the ANISERP inhibitory activity, although it did Universidad Complutense, Madrid, Spain. Laboratorio de Parasitología, increase the inhibitory activity of the AT control in a Facultad de Farmacia, Universidad de Santiago de Compostela, A Coruña, Spain. Centro de Biología Molecular “Severo Ochoa” (CSIC-UAM) Campus concentration-dependent manner (Fig. 4). UAM. Cantoblanco, 28049 Madrid, Spain. Parasitology Department, Centro In an attempt to understand the lack of effect of hep- Nacional de Microbiología, Instituto de Salud Carlos III, 28220 Majadahonda, arin on the ANISERP anticoagulant action, the hypo- Madrid, Spain. Present Address: Departamento de Ciencias Farmacéuticas y de la Salud, Facultad de Farmacia, Universidad San Pablo-CEU, Campus de thetical heparin binding site residues were aligned with Montepríncipe, Urb. Montepríncipe, 28668 Madrid, Spain. the AT and HCII heparin binding site residues described elsewhere [26]. Figure 5 shows the sequence and structural Received: 17 November 2014 Accepted: 11 July 2015 alignments of the three proteins. Five residues (Lys173, Arg184, Lys185, Arg189, and Arg192 blue spheres in Fig. 5) References out of six critical for HCII/heparin binding appear to be 1. Audícana MT, del Pozo MD, Iglesias R, Ubeira FM. Anisakis simplex and absent/altered in ANISERP. Pseudoterranova decipiens. In: Miliotis M, Bier J, editors. International handbook on foodbornepathogens.New York:Marcell Dekker; 2003.p.613–36. 2. Geraci JR, St Aubin DJ. Effects of parasites on marine mammals. Int J Parasitol. Conclusions 1987;17:407–14. ANISERP is an internally-secreted Anisakis serpin that 3. Ishikura H, Kikuchi K, Nagasawa K, Ooiwa T, Takamiya H, Sato N, et al. Anisakidae and anisakidosis. Prog Clin Parasitol. 1993;3:43–102. displays in vitro inhibitory activity. The inhibitory action 4. Bier JW. Anisakiasis. Laboratory diagnosis of infectious diseases. In: Balows A, of ANISERP against thrombin appears to depend on a Hausler Jr WJ, Ohashi M, Turano A, editors. Bacterial, mycotic and parasitic suicide substrate-like inhibitory mechanism, similar to diseases, vol. I. New York: Springer; 1988. p. 768–74. 5. Valiñas B, Lorenzo S, Eiras A, Figueiras A, Sanmartín ML, Ubeira FM. that displayed by human AT-III. The fact that heparin Prevalence of and risk factors for IgE sensitization to Anisakis simplex in a does not modulate the anticoagulant activity of ANI- Spanish population. Allergy. 2001;56:667–71. SERP might be explained by the absence in its structure 6. Audicana MT, Kennedy MW. Anisakis simplex: from obscure infectious worm to inducer of immune hypersensitivity. Clin Microbiol Rev. 2008;21:360–79. of five of the six positively charged residues usually seen 7. Anadón AM, Romarís F, Escalante M, Rodríguez E, Gárate T, Cuéllar C, et al. in the AT-III-heparin binding site. The findings of the The Anisakis simplex Ani s 7 major allergen as an indicator of true Anisakis immunolocalization study indicate that ANISERP exerts infections. Clin Exp Immunol. 2009;156:471–8. 8. Silverman GA, Whisstock JC, Bottomley SP, Huntington JA, Kaiserman D, its function as an internal regulatory serpin and rule out Luke CJ, et al. Serpins flex their muscle: I. Putting the clamps on proteolysis a role at the parasite-host interface. in diverse biological systems. J Biol Chem. 2010;285:24299–305. 9. Sakata Y, Arima K, Takai T, Sakurai W, Masumoto K, Yuyama N, et al. The Competing interests squamous cell carcinoma antigen 2 inhibits the cysteine proteinase activity The authors have no interests that conflict with the publication of this work. of a major mite allergen, Der p 1. J Biol Chem. 2004;279:5081–7. 10. Law RH, Zhang Q, McGowan S, Buckle AM, Silverman GA, Wong W, et al. An Authors’ contributions overview of the serpin superfamily. Genome Biol. 2006;7:216. Conception and design of experiments: EV, MJP, CH, ER, AS, VMS, PGP, FMU, 11. Yi D, Xu L, Yan R, Li X. Haemonchuscontortus: cloning and characterization TG. Experimental work: EV, MJP, CH, PC, ER, VMS, PGP. Data analysis: EV, MJP, of serpin. Exp Parasitol. 2010;125:363–70. CH, AS, VMS, PGP, FMU, TG. Contribution of reagents/materials/analysis tools: 12. Molehin AJ, Gobert GN, Driguez P, McManus DP. Characterisation of a EV, MJP, ER, PGP, FMU, TG. Manuscript preparation: EV, MJP, CH, VMS, PGP, secretory serine protease inhibitor (SjB6) from Schistosomajaponicum. Parasit FMU, TG. All authors read and approved the final version of the manuscript. Vectors. 2014;14:7–330. 13. Molehin AJ, Gobert GN, McManus DP. Serine protease inhibitors of parasitic Acknowledgements helminths. Parasitology. 2012;139:681–95. We thank Biomol-Informatics SL (http://www.biomol-informatics.com/) for 14. Zang X, Yazdanbakhsh M, Jiang H, Kanost MR, Maizels RM. A novel serpin bioinformatic consultation. We also thank Juan Francisco Alcaide and Julia expressed by blood-borne microfilariae of the parasitic nematode Medrano for their invaluable help in the ANISERP patenting process. We thank Brugiamalayi inhibits human neutrophil serine proteinases. Blood. Dr Raúl Iglesias (Laboratorio de Parasitología, Facultad de Biología, Universidad 1999;94:1418–28. de Vigo) for his helpful comments on the interpretation of the IHQ studies. 15. Morris SR, Sakanari JA. Characterization of the serine protease and serine protease inhibitor from the tissue-penetrating nematode Anisakis simplex. Financial disclosure J Biol Chem. 1994;269:27650–6. This work was funded by the Spanish Ministry of Science and Innovation 16. Nguyen TT, Qasim MA, Morris S, Lu CC, Hill D, Laskowski Jr M, et al. (SAF2002-04057-CO2-01) and the Instituto de Salud Carlos III (ISCIII) as part of Expression and characterization of elastase inhibitors from the ascarid project MPY 1404/09, and ISCIII-AESI project MPY 1279/15. Carolina Hurtado nematodes Anisakis simplex and Ascaris suum. Mol Biochem Parasitol. and Pamela Campioli were supported by grants from the ISCIII (Fondo de 1999;30(102):79–89. InvestigacionesSanitarias), through VI NP of I + D + I (2008–2011), ISCIII- 17. Kobayashi Y, Ishizaki S, Shimakura K, Nagashima Y, Shiomi K. Molecular General Sub-Direction of Networks and Centers for Collaborative Research cloning and expression of two new allergens from Anisakis simplex. Parasitol (RETIC-RICET, RD06/0021/0019, RD12/0018/011). Victoria Martínez Sernández Res. 2007;100:1233–41. Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 10 of 10 18. Kobayashi Y, Ishizaki S, Nagashima Y, Shiomi K. Ani s 1, the major allergen of Anisakis simplex: purification by affinity chromatography and functional expression in Escherichia coli. Parasitol Int. 2008;57:314–9. 19. Perteguer MJ, Gómez-Puertas P, Cañavate C, Dagger F, Gárate T, Valdivieso E. Ddi1-like protein from Leishmania major is an active aspartyl proteinase. Cell Stress Chaperones. 2013;18:171–81. 20. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–402. 21. Petersen TN, Brunak S, von Heijne G, Nielsen H. Locating proteins in the cell using TargetP, SignalP, and related tools. Nat Methods. 2011;8:785–6. 22. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, et al. Measurement of protein using bicinchoninic acid. Anal Biochem. 1985;150:76–85. 23. Martínez-Sernández V, Mezo M, González-Warleta M, Perteguer MJ, Muiño L, Guitián E, et al. The MF6p/FhHDM-1 major antigen secreted by the trematode parasite Fasciola hepatica is a heme-binding protein. J Biol Chem. 2014;289:1441–56. 24. Sanmartín ML, Iglesias R, Santamarina MT, Leiro J, Ubeira FM. Anatomical location of phosphorylcholine and other antigens on encysted Trichinella using immunohistochemistry followed by Wheatley’s trichrome stain. Parasitol Res. 1991;77:301–6. 25. Bennett-Lovsey RM, Herbert AD, Sternberg MJ, Kelley LA. Exploring the extremes of sequence/structure space with ensemble fold recognition in the program Phyre. Proteins. 2008;70:611–25. 26. Baglin TP, Carrell RW, Church FC, Esmon CT, Huntington JA. Crystal structures of native and thrombin-complexed heparin cofactor II reveal a multistep allosteric mechanism. Proc Natl Acad Sci USA. 2002;99:11079–84. 27. Guex N, Diemand A, Peitsch MC. Protein modelling for all. Trends Biochem Sci. 1999;24:364–7. 28. Peitsch MC. ProMod and Swiss-Model: Internet-based tools for automated comparative protein modelling. Biochem Soc Trans. 1996;24:274–9. 29. Schwede T, Kopp J, Guex N, Peitsch MC. SWISS-MODEL: An automated protein homology-modeling server. Nucleic Acids Res. 2003;31:3381–5. 30. Guex N, Peitsch MC. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis. 1997;18:2714–23. 31. Case DA, Cheatham 3rd TE, Darden T, Gohlke H, Luo R, Merz Jr KM, et al. The Amber biomolecular simulation programs. J Comput Chem. 2005;26:1668–71. 32. Schreuder HA, de Boer B, Dijkema R, Mulders J, Theunissen HJ, Grootenhuis PD, et al. The intact and cleaved human antithrombin III complex as a model for serpin-proteinase interactions. Nat Struct Biol. 1994;1:48–54. 33. Holm L, Kaariainen S, Rosenstrom P, Schenkel A. Searching protein structure databases with DaliLite v. 3. Bioinformatics. 2008;24:2780–1. 34. Fares H, Greenwald I. Genetic analysis of endocytosis in Caenorhabditis elegans: coelomocyte uptake defective mutants. Genetics. 2001;159:133–45. 35. Zang X, Maizels RM. Serine proteinase inhibitors from nematodes and the arms race between host and pathogen. Trends Biochem Sci. 2001;26:191–7. 36. Gettins PG, Olson ST. Exosite determinants of serpin specificity. J Biol Chem. 2009;284:20441–5. 37. Dementiev A, Petitou M, Herbert JM, Gettins PG. The ternary complex of antithrombin-anhydrothrombin-heparin reveals the basis of inhibitor specificity. Nat Struct Mol Biol. 2004;11:863–7. 38. Rossi EB, Duboscq CL, Kordich LC. Heparin cofactor II, a thrombin inhibitor with a still not clarified physiologic role. Medicina (B Aires). 1999;59:95–104. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Parasites & Vectors Springer Journals

Loading next page...
 
/lp/springer-journals/aniserp-a-new-serpin-from-the-parasite-anisakis-simplex-2E8Pxnr10w

References (40)

Publisher
Springer Journals
Copyright
Copyright © 2015 by Valdivieso et al.
Subject
Biomedicine; Parasitology; Infectious Diseases; Tropical Medicine; Entomology
eISSN
1756-3305
DOI
10.1186/s13071-015-1006-z
pmid
26215984
Publisher site
See Article on Publisher Site

Abstract

Background: Serine proteinase inhibitors (serpins) finely regulate serine proteinase activity via a suicide substrate-like inhibitory mechanism. In parasitic nematodes, some serpins interact with host physiological processes; however, little is known about these essential molecules in Anisakis. This article reports the gene sequencing, cloning, expression and preliminary biochemical and bioinformatically-based structural characterization of a new Anisakis serpin (ANISERP). Methods: The full AniSerp gene was cloned by specific RACE-PCR after screening an Anisakis simplex (L3) cDNA library. For biochemical assays, the AniSerp gene was subcloned into both prokaryotic and eukaryotic vectors, and the recombinant proteins were purified. The inhibitory properties of the proteins were tested in classical biochemical assays using human serine peptidases and AMC substrates. Immunolocalization of ANISERP, theoretical structural analysis and bioinformatically-based structural modelling of the ANISERP protein were also conducted. Results: The AniSerp gene was found to have 1194 nucleotides, coding for a protein of 397 amino acid residues plus a putative N-terminal signal peptide. It showed significant similarity to other nematode, arthropod and mammalian serpins. The recombinant ANISERP expressed in the prokaryotic and eukaryotic systems inhibited the human serine proteases thrombin, trypsin and cathepsin G in a concentration-dependent manner. No inhibitory activity against Factor Xa, Factor XIa, Factor XIIa, elastase, plasmin or chymotrypsin was observed. ANISERP also acted on the cysteine protease cathepsin L. ANISERP was mainly localized in the nematode pseudocoelomic fluid, somatic muscle cell bodies and intestinal cells. The findings of molecular dynamics studies suggest that ANISERP inhibits thrombin via a suicide substrate-like inhibitory mechanism, similar to the mechanism of action of mammalian coagulation inhibitors. In contrast to findings concerning human antithrombin III, heparin had no effect on ANISERP anticoagulant inhibitory activity. Conclusions: Our findings suggest that ANISERP is an internal Anisakis regulatory serpin and that the inhibitory activity against thrombin depends on a suicide substrate-like inhibitory mechanism, similar to that described for human antithrombin (AT)-III. The fact that heparin does not modulate the anticoagulant activity of ANISERP might be explained by the absence in the latter of five of the six positively charged residues usually seen at the AT-III-heparin binding site. Keywords: Serpin, Proteinase, Anisakis, Trypsin, Thrombin, Cathepsin L, Anticoagulant properties, Modelling analysis, Heparin * Correspondence: chus.perteguer@isciii.es Equal contributors Servicio de Parasitología, Centro Nacional de Microbiología, Instituto de Salud Carlos III, 28220 Majadahonda, Madrid, Spain Parasitology Department, Centro Nacional de Microbiología, Instituto de Salud Carlos III, 28220 Majadahonda, Madrid, Spain Full list of author information is available at the end of the article © 2015 Valdivieso et al. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http:// creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 2 of 10 Background GGAAACGACCAATAAACAGAATGCG 3′). The gene Anisakis spp. are parasitic nematodes that infect the was named AniSerp. Standard amplification protocols were gastrointestinal tract of sea mammals [1], producing gastric used in all cases [19]. ulcers and haemorrhagic exudates; they can also penetrate the abdominal cavity by crossing the gastrointestinal Bioinformatic analysis wall [2]. Humans are accidental hosts that become affected The theoretical molecular weight and isoelectric point of via the ingestion of Anisakis larvae present in raw or the full ANISERP protein were obtained using the undercooked fish and seafood. Human Anisakis infec- Expasy Compute pI/Mw tool (http://web.expasy.org/ tion causes gastrointestinal disease with mild to severe compute_pi/). The protein sequence was also compared clinical symptoms such as nausea, vomiting, diarrhoea, with sequences included in the GenBank database, by and abdominal and epigastric pain [3]. Occult blood is using the BLASTp program [20], and its motifs were often present in the gastric juice and faeces [4]. Gastro- characterised using ScanProsite software (ExPASY intestinal symptoms are often associated with allergic Bioinformatics Resource Server; http://www.expasy.org/ reactions involving specific IgE responses to parasite proteomics). The putative N-terminal signal peptide in allergens [5–7]. the protein was predicted using the SignalP 4.1 Server The serpins belong to the superfamily of serine peptidase program [21]. inhibitors and are expressed by many organisms ranging from plants to vertebrates. They help to control proteolysis Subcloning, expression in Escherichia coli and purification in molecular pathways associated with tissue homeostasis/ of recombinant ANISERP protein cell survival, development, and host defence [8]. Some The AniSerp gene without the sequence coding for the have cross-class activity and can inhibit cysteine proteinases predicted putative N-terminal signal peptide was sub- [9, 10]; others may even behave as non-inhibitory chaper- cloned into the pGEX4T2 expression vector (GE Health- ones, tumour suppressors or transport molecules [8]. care Life Sciences) and further transformed into the Serpin expression in parasites, especially helminths, is BL21 strain of E. coli (F-, ompT, hsdS [rb-, mb-], gal) the subject of intense study [11–13]. In nematodes, serpins (GE Healthcare Life Sciences). Recombinant protein ex- interact with endogenous parasite proteinases and some are pression was induced by different protocols to obtain a also believed to play important roles in defence against soluble fusion protein similar to the native protein, digestion by host proteinases, inhibition of the host im- which was subsequently purified. Expression protocols mune response, and even as immunomodulators [12, 14]. including different combinations of incubation tempera- In Anisakis, only four serine proteinase inhibitors have tures (16 and 37 °C), concentrations of isopropyl β-D-1- been characterized to date: Anisakis ASP1, ASP2 and thiogalactopyranoside (ITPG) (0.01, 0.1, 0.5 and 1 mM) Ani s 6, which belong to a unique class of nematode in- and incubation times (4-16 h) were used. Once the re- hibitors (smapins), and Ani s 1, an allergen belonging to combinant ANISERP protein was obtained in its soluble the Kunitz-type family [15–18]. The present article re- form, it was purified by glutathione-Sepharose 4B bead ports the molecular and biochemical characterization of affinity chromatography and eluted with 15 mM gluta- ANISERP, a new Anisakis serpin [GenBank™: FR694897]. thione, 100 mMTris-HCl pH 8, 0.1 % Triton X-100 elu- tion buffer. The purified recombinant protein was then Methods dialyzed. The protein concentration was determined AniSerp gene cloning using the BCA Protein Assay Kit (Thermo Scientific), An Anisakis simplex truncated cDNA that showed notable with bovine serum albumin (BSA) as a standard [22]. similarity to serpin genes (NCBI) was obtained by screen- The expressed protein was then subjected to SDS-PAGE ing a cDNA library obtained from the L3 stage larvae. analysis and Coomassie staining, plus Western blot ana- Amplification of the 5′ end was performed by RACE-PCR lysis with an anti-GST antibody (GE Healthcare Life and using a parasite cDNA collection prepared with the Sciences). Marathon cDNA amplification kit (Clontech) and the forward primer AP1 (5′ CTAATACGACTCACTATAG Subcloning, expression in Sf9 insect cells, and purification GGC 3′), which corresponds to the AP1 adaptor sequence of recombinant His-tagged ANISERP protein. Mass of the A.simplex cDNA collection, and reverse primer SR1 spectrometry analysis (5′ ACCCGCAGTAGTTTTATCCATTTGTTCG 3′), the The AniSerp gene was amplified using the oligonucleotides design of which was based on the truncated cDNA AniSerp_Fw 5′ GGGGACAAGTTTGTACAAAAAAGCA sequence. On the basis of the information obtained, two GGCTTCATGCAGCAGACAATCGATGATGCCCAAGC new primers were used to amplify the full gene by PCR: the 3′ and AniSerp_Rv 5′ GGGGACCACTTTGTACAAGAA forward primer SER5′ (5′ ATGATGACAGCATTACCGT AGCTGGGTTCAGTGGAAACGACCAATAAACAGA TTTTAAC 3′) and the reverse primer SER3′ (5′ TCAGT ATGCG 3′ (Sigma Genosys). A recombinant bacmid Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 3 of 10 carrying the AniSerp gene was obtained using the appropriate reaction buffer. In all cases, the enzyme Gateway Cloning System (Life Technologies), follow- concentrations used in the assays were linearly related ing the manufacturer’s instructions. The bacmid DNA to the reaction time (30 min). The inhibition controls (1–2 μg) was transfected into Sf9 insect cells with used were AEBSF (1 mM) (serine-proteinases inhibitor) Cellfectin® II Reagent (Invitrogen), following the man- and E-64 (10 μM; acysteineproteinaseinhibitor), both ufacturer’s instructions, yielding infectious recombin- obtained from Sigma-Aldrich. After addition of the ant baculovirus particles. The transfected Sf9 insect substrate (final concentration 250 μM) to the reaction cells were cultured in TC100-Insect Medium (Sigma- mixture, the residual enzyme activity was measured by Aldrich), containing 10 % FBS (Gibco), to produce continuous monitoring for AMC substrates at excitation large amounts of the recombinant ANISERP protein. and emission wavelengths of 380 and 460 nm respectively, Soluble His-tagged ANISERP protein was then purified in a Victor 3 1420 Perkin Elmer Fluorescence microplate by affinity chromatography, with a 1 ml HiTrapTM FF reader (Perkin Elmer España S.L.). Reactions with the crude column (GE Healthcare) and an ÅKTA FPLC system pNA substrate were monitored, at 405 nm, in an ELX (GE Healthcare), according to standard procedures. 800TM Bioteck Absorbance microplate reader (Bioteck). Fractions were analyzed in SDS-PAGE gels stained Purified GST was also used as a negative control for pro- with Coomassie Brilliant Blue (Bio-Rad). The ANISERP teinase inhibition when ANISERP was produced in protein from different fractions was pooled, dialyzed against pGEX4T2/E. coli. PBS, quantified by the BCA method, and stored at−80 °C until use. Finally, the identity of the recombinant protein Anti-ANISERP hyperimmune sera was confirmed by MALDI-TOF mass spectrometry, ac- A female New Zealand rabbit was immunized, via sub- cording to standard procedures [19]. cutaneous injection, with ANISERP recombinant pro- tein fused to GST (glutathione transferase), by using Inhibitory assays the following protocol: 75 μg/ ml of ANISERP recom- The inhibitory activity of ANISERP against 10 protein- binant protein was equally emulsified with Freund ases (trypsin, chymotrypsin, plasmin, elastase, FXa, FXIa, Adjuvant and administered in three doses, a single dose FXIIa, thrombin, cathepsin G and cathepsin L) was ex- with Freund Complete Adjuvant (ACF) and the amined by measuring the residual proteolytic activity on remaining two with Freund Incomplete Adjuvant (FIA) specific proteinase substrates after the incubation of 20 and 40 days after the first injection. Blood samples each enzyme with purified recombinant ANISERP. were collected prior to the first injection and two Table 1 includes the reaction conditions for each pro- months after the last injection. Serum samples were teinase tested. In addition, and taking into account the collected after centrifugation of clotted blood and report by Morris and Sakanari [15], ANISERP inhib- stored at−20 °C until use. ition of serine proteinase activity in A. simplex crude extract was determined using Z-Gly-Pro-Arg-AMC in 50 mMTris/HCl pH 7.5 plus 20 mMNaCl as a sub- Ethical approval strate. All substrates were purchased from Sigma The rabbit was maintained and immunized in accord- Aldrich. Assays were performed after incubation of ance with institutional and national guidelines. The ANISERPwith eachenzymefor 10 minat37°Cinthe protocol was approved by the Ethics Committee for Table 1 Enzymes, substrates and reaction conditions for each proteinase tested Enzyme [Enzyme] [Substrate] 250 μM Activity buffer Thrombin 74 nM Boc-Val-Arg -AMC 50 mM Tris–HCl pH 8, 100 mM NaCl Trypsin 54 nM Boc-Gln-Ala-Arg-AMC 50 mM Tris–HCl pH 8, 1 mM CaCl2, 0.15 M NaCl Cathepsin G 0.33 nM N-Succinyl-Ala-Ala-Phe-AMC. 50 mM HEPES/NaOH pH 7.5 Cathepsin L 0.83 nM Z-Phe-Arg-AMC Sodium acetate 100 mM pH 5.5, 1 mM EDTA, 4 mM DTT, 0.001% BSA Plasmine 333 nM Nt-Boc-Val-Leu-Lys-AMC 50 mM Tris–HCl pH 8, 50 mM NaCl Elastase 1.2 nM N-Methoxysuccinyl-Ala-Ala-Pro-Val-7 amido AMC 25 mM Tris–HCl pH 8, 100 mM NaCl, 1 mM CaCl2 Chymotrypsin 0.012 nM N-succinyl-Lelu-Leu-Val-Tyr-7 amido AMC 100 mM HEPES/ NaOH pH 7.5 Factor Xa 0.054 nM Boc-Ile-Glu-Gly-Arg-7 amido AMC 50 mM Tris–HCl pH 8.3, 5 mM CaCl2, 0.2 mM NaCl Factor XIa 14,000 nM Boc-Phe-Ser-Arg-7 amido AMC 50 mM Tris–HCl pH 8, 100 mM NaCl, 1 mM CaCl2 Factor XIIa 0.0017 nM Boc-Val-Arg-AMC 4 mM Sodium Acetate-HCl/0.15 M NaCl/pH 5.3 Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 4 of 10 Research and Animal Welfare (CEIyBA) of the ISCIII Modelling procedures (CBA N# 09_2014_v2). Structural three-dimensional models for ANISERP were constructed by homology modelling procedures based on Protein Data Bank structures (selected on the basis Immunohistochemical localization of ANISERP of strong sequence similarity, coverage and sequence- Live third-stage larvae of A. simplex were collected from to-structure compatibility), using both BLAST [20] and thebodycavityof bluewhiting (Micromesistiuspoutassou) threading (Phyre server [25]) procedures. The template purchased at a local market, washed several times in selected was 1JMO (the structure of the human heparin physiological saline, cut into two portions (of which the cofactor II [HCII]-thrombin complex) [26]. The model anterior one-third includes the ventricle and part of the was produced using the SWISS-MODEL server facil- intestine) and fixed in 10 % buffered formalin for 12 h. ities [27–29]athttp://swissmodel.expasy.org/SWISS- After fixation, the samples were washed with PBS, MODEL.html. The structural quality of the models was dehydrated, embedded in paraffin and cut into 5 μm- checked using the analytical programs provided by the thick sections, as previously described [23]. Once same server (Anolea/Gromos/Verify3D). For geometric deparaffinized and hydrated, the slides were blocked optimization, the models were energy minimized using with PBS containing 0.05 % Tween 20 and 1 % dry the DeepView GROMOS 43B1 force field routine [30], skimmed milk (PBS-T-SM) for 2 h at room temperature by applying 500 steps of steepest descent minimization (RT).AsANISERPwas expressedasaGST-fusion pro- followed by 500 steps of conjugate-gradient minimization. tein, and to inhibit any potential cross-reactivity with The structure of human thrombin, included in PDB file GST from Anisakis, rabbit hyperimmune serum raised 1JMO, was also re-modelled to include a serine residue at against recombinant ANISERP and preimmune serum catalytic position 205, which is an alanine in the crystal- (as negative control) were diluted 1/100 and preincu- lized protein. Finally, in order to produce a high quality bated with or without GST, at 50 μg/ml, in PBS-T-SM model for the proposed contact between human thrombin for 1 h at RT. The samples were then placed on the and ANISERP, the structure resulting from homology slides and incubated for 2 h at RT. The slides were modelling was subjected to a 2 ns standard molecular dy- washed three times with PBS-T (for 5 min each time) namics simulation using the PMEMD module of the and then incubated with 0.3 % hydrogen peroxide in AMBER9 software package [31] and the parm99 param- PBS for 30 min RT to quench endogenous peroxidase eter set for the same distribution. activity. The sections were washed and incubated with To compare the 3D positions of putative heparin bind- peroxidase-conjugated goatanti-rabbitIgG (Bio-Rad) ing sites, structural alignment between the ANISERP diluted 1/200 in PBS-T-SM for 1 h at RT. The slides model (after molecular dynamics procedures) and the were washed again, and bound antibodies were revealed Protein Data Bank structures of human HCII (1JMO) with 0.5 mg/ml 4-chloro-1-naphthol (Sigma-Aldrich) in [26] and human AT-III (1 ATH_A) [32]) was performed TBS with 0.005 % hydrogen peroxide. Finally, sections using the Dali program [33]. Structure plots were gener- were washed with TBS and mounted with glass cover- ated using the PyMOL program (DeLano Scientific). slips in PBS-glycerol (1:1) for examination and photog- raphy. The slides were then stained with Wheatley’s Results and discussion trichrome, as described elsewhere [24]. The truncated AniSerp gene was cloned during the screening of an A. simplex L3 cDNA library. The frag- Effect of heparin on the thrombin inhibition assay ment was 1005 nt long (334 aa) and lacked the 5′ end. It Assays were performed with 200 μl of 50 mMTris/HCl, showed notable similarity to serine proteinase inhibitors 100 mMNaCl, pH 8. Inhibition reaction mixtures con- (GenBank). Amplification of the 5′ end was then per- tained from 0.1 μg/ml to 100 μg/ml (0.1, 5, 15, 25, 45, formed by RACE-PCR with new primers based on the 70 and 100 μg/ml) heparin and 2.7 nM ANISERP. The truncated gene, and the full sequence was isolated in the reaction was initiated by adding 74 nM thrombin. After same way. The novel sequence contained 1194 nucleo- incubation of the plates for 5 min, 50 μl of a solution tides and expressed a deduced amino acid backbone of containing 250 μM Boc-Val-Arg-AMC and 0.33 mg/ml 397 residues (with a predicted molecular weight of Polybrene (Sigma-Aldrich) was added. Residual throm- 44.6 kDa) plus a putative N-terminal signal peptide of 25 bin activity was determined by measuring the hydrolysis residues. Bioinformatic analysis showed that the gene of the fluorescent substrate (Boc-Val-Pro-Arg-AMC) in included a serpin signature (374–384 residues: FIADHP- a Victor 3 1420 Perkin Elmer fluorescent microplate FIFTI) and a potential reactive centre loop (RCL) (p17 reader. As a positive control, the same experiment was [E]-p16 [E/K/R]-p15 [G]-p14 [T/S]-p13[X]-p12-9[A/G/ performed with antithrombin (AT) (0.1 mg/ml) instead S]-p8-1 [X]-p1′-4′). Database comparisons showed similar- of ANISERP. ities between ANISERP and different serine proteinase Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 5 of 10 inhibitors of nematodes and other organisms. The highest systems. ANISERP has two potential N-glycosylation similarity scores were obtained for the serpins described in sites, 87-NDSA and 327-NDSL, which do not appear to Toxocaracanis (putative serpin-like protein [2e-141, 59 %; influence its inhibitory effect. ANISERP inhibited throm- KHN 72249.1]), Ascarissuum (putative serpin-like protein bin (IC 152 nM), trypsin (IC 173 nM), cathepsin G 50 50 [1e-103, 45 %; ERG 78895.1] and serpin b6 [3e-102, 46 %; (IC 542 nM) and cathepsin L (IC 217 nM) in a 50 50 ERG 82472.1]). ANISERP also showed similarity to the concentration-dependent manner (Fig. 1). No other pro- Bostaurus serpin peptidase inhibitor (4e-69, 38 %, teinase, including the parasite peptidase, was affected. NP001193642.1), mouse (Mus musculus) serpin 3b (3e-68, This suggests that the Anisakis peptidase described by 37 %, NP941373.1) and mouse squamous cell carcinoma Morris & Sakanari [15] is not the biological target of antigen 2-related protein 1 (2e-67, 36 %, AAN62872.1). ANISERP. Complete inhibition of cysteine and serine These findings were used together to design ANISERP proteinases was observed when E-64 (10 μM) and functional characterization experiments. AEBSF (1 mM) were used as positive controls (data not To obtain the recombinant ANISERP protein, the gene shown). The inhibition of cathepsin L activity confirmed without the putative N-terminal signal peptide was sub- the cross-class nature of ANISERP. cloned into pGEX, and the full sequence was subcloned To locate the possible site of synthesis and final destin- into the baculovirus vector system. These genes were ation of ANISERP, an immunohistochemical study was per- expressed in prokaryotic and eukaryotic cells respect- formed on A. simplex L3 tissuesbyusing ahyperimmune ively, and they were then purified. To collect the pro- serum raised against recombinant ANISERP-GST. Pre- teins in functional form, different expression conditions incubation of the serum with GST did not inhibit the were tested. For the E. coli system, the conditions were intensity of staining by immunohistochemistry or the 0.01 mM IPTG and incubation at 16 °C for 16 h. For the signal obtained by indirect ELISA against A. simplex baculovirus system, the conditions were a multiplicity of crude extracts (data not shown), indicating that recog- infection of 0.1 (virus titre 5×10 pfu/ml), incubation at nition was specific to ANISERP. As shown in Fig. 2a 27 °C and collection at 72 h. and c, ANISERP was highly concentrated in the pseu- The effect of the recombinant ANISERP on proteolytic docoelomic fluid (haemolymph) and in non-contractile activity was the same in both prokaryotic and eukaryotic cell bodies (myocytons) of the somatic musculature, Fig. 1 Effect of ANISERP on the proteolytic activity of human thrombin, trypsin, cathepsin L and cathepsin G. Inhibitory effect of different doses of recombinant ANISERP, expressed in a baculovirus system, on the enzymatic activity of a Thrombin (74 nM) on Boc-Val-Arg-AMC, b Trypsin (54 nM) on Boc-Gln-Ala-Arg-AMC, c Cathepsin L (0.83 nM) on Z-Phe-Arg-AMC, and d Cathepsin G (0.33 nM) on N-succinyl-Ala-Ala-Phe-AMC Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 6 of 10 Table 2 Summary of the immunohistochemical staining results indicating the tissue distribution of ANISERP a a Structures Staining Structures Staining Dorsal oesophageal gland - Excretory cell - Subventral muscular sectors ++ Excretory canal - of oesophagus Ventricle - Hypodermis ± Intestine ++ Lateral hypodermal ± cords Intestinal lumen - Cuticle - Pseudocoelom fluid +++ Somatic muscle cell +++ bodies -,no staining; ±, weak staining; +, ++ and +++, increasing intensity of positive staining the mouth/anus, and iii) secretory antigens, which are released by the excretory cell through the excretory pore, located at the base of subventral lips; the latter constitutes the main source of known Anisakis allergens. Somatic antigens can also come into contact with host tissues, but only in cases in which larvae die and remain in tissues (typically in chronic infections). The absence Fig. 2 Immunolocalization of ANISERP in sections of Anisakis simplex L3 with a rabbit hyperimmune serum. a Cross section at the level of of staining in the dorsal oesophageal gland, intestinal the oesophagus showing strongly positive staining in SM and PF, lumen, excretory cell and cuticle (Table 2) clearly indi- moderate staining in SOM and slight staining of LC. No staining cates that ANISERP is not released to the external was observed in the EC. b The negative control incubated with medium and, consequently, its inhibitory action is prob- the preimmune serum did not stain. c Cross section through the ably directed against endogenous proteases. This explains intestinal level showing in detail strongly positive immunostaining in the SM, which is restricted to the nSM; no staining was observed in why the recombinant ANISERP was not recognized by the cSM, the C or EC, including the ca. Less intense staining was also sera from patients infected with Anisakis during the acute observed in IC. d Section C was decolorized to remove the 4CN stain phase (data not shown). and subsequently stained with Wheatley’s trichrome. DOG, dorsal As the strongest staining was observed in myocytons oesophageal gland; SOM, subventral muscular sectors of oesophagus; and pseudocoelomic fluid, we can hypothesize that som- SM, somatic musculature; LC, lateral hypodermal cords; PF, pseudocoelomic fluid; EC, excretory cell; V, ventricle; IC, intestinal atic muscle cells are the major source of ANISERP, cells; nSM, non-contractile portion of somatic muscle cells (myocytons); which can be then released to the haemolymph. cSM, contractile portion of somatic muscle cells; C, cuticle; ca, excretory Although the putative secretory functions of somatic canal; n, nucleus muscle cells in Anisakis have not been reported before, this type of activity has been reported in muscular cells and it was absent in the contractile portion of these of Caenorhabditis elegans transfected with a plasmid cells (see Fig. 2d for better identification of the struc- encoding a signal peptide fused to green fluorescent protein tures). Positive staining was also found to a lesser [34]. The presence of a putative signal peptide in ANISERP extent in cells belonging to subventral muscular sectors is consistent with this hypothesis. of the oesophagus and intestine, and weak staining was In addition to myocytons and pseudocoelomic fluid, observed in the lateral hypodermal cords and hypoder- staining for ANISERP was also intense in intestinal cells. mis. In addition to the contractile portion of somatic As intestinal and muscular cells originate from different muscle cells, other structures that did not stain germinal layers (i.e. endoderm and mesoderm respect- included the cuticle, the dorsal oesophageal gland, the ively), we can also hypothesize that more than one Ani- excretory cell (including the excretory canal), the intes- sakis serpin is recognized by the polyclonal antibody. tinal lumen and the ventricle (Fig. 2a and c, and Although this possibility merits further investigation, the Table 2). fact that other similar serpins exist in the Anisakis tran- When marine mammals or humans are infected by L3 scriptome (unpublished results) is consistent with the Anisakis larvae, three sources of parasite antigens can be hypothesis. delivered to host tissues while larvae remain alive: i) Finally, an in silico analysis of the ANISERP molecule cuticle antigens, which are in direct contact with host was performed to predict its tertiary structure and help tissues, ii) gut antigens, which can be released through to determine how it might interact with the serin Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 7 of 10 proteases that it inhibits, based on characteristic and acids from Met358 to Phe374. Contacts between resi- conserved serpin folding. Thrombin protease was chosen dues of the two proteins in this region involve hydro- as a model as it yielded the lowest IC . To obtain a reli- phobic clusters and the junctions at the active centre, able representation of the actual interactions between including contact between the thrombin catalytic triad proteins, a homology-based 3D model of ANISERP His43, Asp99 and Ser205 and the ANISERP Arg361 (P1) bound to thrombin was generated. To obtain an even and Ser362 (P1′) residues (Fig. 3c). more realistic molecular model for the Anisakis serpin, In the human coagulation cascade, AT III inhibits the the Ala205 located at the catalytic centre of human serine proteinases trypsin and plasmin along with the thrombin was substituted by a Ser residue (model coagulation factors thrombin and FXa. The effect of 1JMO). On the basis of the initial interaction model, ANISERP on FXa was therefore tested. No inhibition short-step (2 ns) molecular dynamics were applied to was observed, as indicated above (data not shown). In the whole structure to help the amino acid side chains contrast, HCII inhibits the serine proteases thrombin, and the reactive centre loop (RCL) backbone achieve a chymotrypsin and cathepsin G. The distinct enzyme stable, low-energy conformation that would allow ana- specificities of ATand HCII appear to be the result of lysis of specific contacts between the two proteins amino acid changes in P1 and the immediately adja- (Fig. 3a). The ANISERP model showed all the character- cent residues of the RCL-enzyme recognition sequence. istics described for classic mammalian serpins, i.e. mixed AT, which has an Arg at P1, is an inhibitor of the Arg- parallel and antiparallel six-stranded β-sheets with the proteinases thrombin and FXa, while HCII is a specific central strand containing several residues from the RCL. thrombin inhibitor with an unfavourable Leu residue at P1 This observation is consistent with that reported by [36]. The inhibitory activity of ANISERP, which selectively Zang & Maizels [35], i.e. although overall nematode ser- blocks human thrombin without affecting FXa, may be pins show less primary sequence similarity to their explained by considering that it has an Arg at P1, as does mammalian homologues, they can acquire a common, AT. In addition, the 14 amino acid changes in the adjacent highly ordered tertiary structure. Figure 3b shows the residues of theRCL mayberesponsible forthe different thrombin substrate groove involving ANISERP amino specificities of ANISERP, including the lack of FXa activity. A B Fig. 3 Model for ANISERP-human thrombin binding. a General view of the model for ANISERP binding to human thrombin. The location of the ANISERP reactive centre loop (RCL [green]) in the structural groove of the thrombin is indicated. The thrombin surface is coloured according to its theoretical electrostatic properties (blue = positive, red = negative). b Residues in the heavy chain of human thrombin; binding of amino acids Met358 and Phe374 in ANISERP. c Position of residues in the catalytic triad of human thrombin (His43, Asp99 and Ser205) and their positions relative to ANISERP residues Arg361 and Ser362 (P1 and P1′ respectively). Distances between active residues and atoms in the peptide bond of the substrate, compatible with proteinase activity, are indicated Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 8 of 10 Fig. 4 Effect of heparin on ANISERP inhibition of human thrombin proteolytic activity. Residual activity of thrombin after incubation with recombinant ANISERP (circles)orAT(squares) with increasing concentrations of heparin (0.1-100 μg/ ml). ANISERP was used at a fixed concentration of 2.17 nM (IC : 152 nM) Fig. 5 Sequence and structural alignment of ANISERP, human antithrombin III (1 ATH_A), and human heparin cofactor-II (1JMO). The key residues involved in heparin binding described for human antithrombin III (Arg 47, Lys114, Lys125, Arg 129, Arg132 and Lys133) are shown as purple boxes and spheres. The key residues involved in heparin binding described for heparin cofactor-II (Lys173, Arg184, Lys185, Arg189, Arg192 and Arg193) are shown as blue spheres. The positions of the P1-P1’residues in the ANISERP sequence are indicated. The residues in the 1JMO and 1ATH_A sequences are numbered according to Baglin et al. [26] Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 9 of 10 Nevertheless, experiments with ANISERP variants con- holds a predoctoral fellowship from the Spanish Ministerio de Educación, Cultura y Deporte (Programa de Formación del Profesorado Universitario). structed by site-directed mutagenesis should be conducted The funders did not have any role in the design of the study, data collection, to assess whether these changes in the RCL are involved in analysis, decision to publish, or preparation of the manuscript. the specific reaction between ANISERP and thrombin. Author details As thereissomeevidence[37,38] that theactivityof the Servicio de Parasitología, Centro Nacional de Microbiología, Instituto de AT and HCII inhibitors is greatly potentiated by heparin, Salud Carlos III, 28220 Majadahonda, Madrid, Spain. Laboratorio de Biología the effect of heparin on ANISERP inhibitory activity on Celular de Parásitos, Instituto de Biología Experimental, Facultad de Ciencias, Universidad Central de Venezuela, 47069, Caracas 1041-A, Venezuela. thrombin was also studied. Heparin (0.1 to 100 μg/ml) did Departamento de Bioquímica y Biología Molecular I, Facultad de Químicas, not affect the ANISERP inhibitory activity, although it did Universidad Complutense, Madrid, Spain. Laboratorio de Parasitología, increase the inhibitory activity of the AT control in a Facultad de Farmacia, Universidad de Santiago de Compostela, A Coruña, Spain. Centro de Biología Molecular “Severo Ochoa” (CSIC-UAM) Campus concentration-dependent manner (Fig. 4). UAM. Cantoblanco, 28049 Madrid, Spain. Parasitology Department, Centro In an attempt to understand the lack of effect of hep- Nacional de Microbiología, Instituto de Salud Carlos III, 28220 Majadahonda, arin on the ANISERP anticoagulant action, the hypo- Madrid, Spain. Present Address: Departamento de Ciencias Farmacéuticas y de la Salud, Facultad de Farmacia, Universidad San Pablo-CEU, Campus de thetical heparin binding site residues were aligned with Montepríncipe, Urb. Montepríncipe, 28668 Madrid, Spain. the AT and HCII heparin binding site residues described elsewhere [26]. Figure 5 shows the sequence and structural Received: 17 November 2014 Accepted: 11 July 2015 alignments of the three proteins. Five residues (Lys173, Arg184, Lys185, Arg189, and Arg192 blue spheres in Fig. 5) References out of six critical for HCII/heparin binding appear to be 1. Audícana MT, del Pozo MD, Iglesias R, Ubeira FM. Anisakis simplex and absent/altered in ANISERP. Pseudoterranova decipiens. In: Miliotis M, Bier J, editors. International handbook on foodbornepathogens.New York:Marcell Dekker; 2003.p.613–36. 2. Geraci JR, St Aubin DJ. Effects of parasites on marine mammals. Int J Parasitol. Conclusions 1987;17:407–14. ANISERP is an internally-secreted Anisakis serpin that 3. Ishikura H, Kikuchi K, Nagasawa K, Ooiwa T, Takamiya H, Sato N, et al. Anisakidae and anisakidosis. Prog Clin Parasitol. 1993;3:43–102. displays in vitro inhibitory activity. The inhibitory action 4. Bier JW. Anisakiasis. Laboratory diagnosis of infectious diseases. In: Balows A, of ANISERP against thrombin appears to depend on a Hausler Jr WJ, Ohashi M, Turano A, editors. Bacterial, mycotic and parasitic suicide substrate-like inhibitory mechanism, similar to diseases, vol. I. New York: Springer; 1988. p. 768–74. 5. Valiñas B, Lorenzo S, Eiras A, Figueiras A, Sanmartín ML, Ubeira FM. that displayed by human AT-III. The fact that heparin Prevalence of and risk factors for IgE sensitization to Anisakis simplex in a does not modulate the anticoagulant activity of ANI- Spanish population. Allergy. 2001;56:667–71. SERP might be explained by the absence in its structure 6. Audicana MT, Kennedy MW. Anisakis simplex: from obscure infectious worm to inducer of immune hypersensitivity. Clin Microbiol Rev. 2008;21:360–79. of five of the six positively charged residues usually seen 7. Anadón AM, Romarís F, Escalante M, Rodríguez E, Gárate T, Cuéllar C, et al. in the AT-III-heparin binding site. The findings of the The Anisakis simplex Ani s 7 major allergen as an indicator of true Anisakis immunolocalization study indicate that ANISERP exerts infections. Clin Exp Immunol. 2009;156:471–8. 8. Silverman GA, Whisstock JC, Bottomley SP, Huntington JA, Kaiserman D, its function as an internal regulatory serpin and rule out Luke CJ, et al. Serpins flex their muscle: I. Putting the clamps on proteolysis a role at the parasite-host interface. in diverse biological systems. J Biol Chem. 2010;285:24299–305. 9. Sakata Y, Arima K, Takai T, Sakurai W, Masumoto K, Yuyama N, et al. The Competing interests squamous cell carcinoma antigen 2 inhibits the cysteine proteinase activity The authors have no interests that conflict with the publication of this work. of a major mite allergen, Der p 1. J Biol Chem. 2004;279:5081–7. 10. Law RH, Zhang Q, McGowan S, Buckle AM, Silverman GA, Wong W, et al. An Authors’ contributions overview of the serpin superfamily. Genome Biol. 2006;7:216. Conception and design of experiments: EV, MJP, CH, ER, AS, VMS, PGP, FMU, 11. Yi D, Xu L, Yan R, Li X. Haemonchuscontortus: cloning and characterization TG. Experimental work: EV, MJP, CH, PC, ER, VMS, PGP. Data analysis: EV, MJP, of serpin. Exp Parasitol. 2010;125:363–70. CH, AS, VMS, PGP, FMU, TG. Contribution of reagents/materials/analysis tools: 12. Molehin AJ, Gobert GN, Driguez P, McManus DP. Characterisation of a EV, MJP, ER, PGP, FMU, TG. Manuscript preparation: EV, MJP, CH, VMS, PGP, secretory serine protease inhibitor (SjB6) from Schistosomajaponicum. Parasit FMU, TG. All authors read and approved the final version of the manuscript. Vectors. 2014;14:7–330. 13. Molehin AJ, Gobert GN, McManus DP. Serine protease inhibitors of parasitic Acknowledgements helminths. Parasitology. 2012;139:681–95. We thank Biomol-Informatics SL (http://www.biomol-informatics.com/) for 14. Zang X, Yazdanbakhsh M, Jiang H, Kanost MR, Maizels RM. A novel serpin bioinformatic consultation. We also thank Juan Francisco Alcaide and Julia expressed by blood-borne microfilariae of the parasitic nematode Medrano for their invaluable help in the ANISERP patenting process. We thank Brugiamalayi inhibits human neutrophil serine proteinases. Blood. Dr Raúl Iglesias (Laboratorio de Parasitología, Facultad de Biología, Universidad 1999;94:1418–28. de Vigo) for his helpful comments on the interpretation of the IHQ studies. 15. Morris SR, Sakanari JA. Characterization of the serine protease and serine protease inhibitor from the tissue-penetrating nematode Anisakis simplex. Financial disclosure J Biol Chem. 1994;269:27650–6. This work was funded by the Spanish Ministry of Science and Innovation 16. Nguyen TT, Qasim MA, Morris S, Lu CC, Hill D, Laskowski Jr M, et al. (SAF2002-04057-CO2-01) and the Instituto de Salud Carlos III (ISCIII) as part of Expression and characterization of elastase inhibitors from the ascarid project MPY 1404/09, and ISCIII-AESI project MPY 1279/15. Carolina Hurtado nematodes Anisakis simplex and Ascaris suum. Mol Biochem Parasitol. and Pamela Campioli were supported by grants from the ISCIII (Fondo de 1999;30(102):79–89. InvestigacionesSanitarias), through VI NP of I + D + I (2008–2011), ISCIII- 17. Kobayashi Y, Ishizaki S, Shimakura K, Nagashima Y, Shiomi K. Molecular General Sub-Direction of Networks and Centers for Collaborative Research cloning and expression of two new allergens from Anisakis simplex. Parasitol (RETIC-RICET, RD06/0021/0019, RD12/0018/011). Victoria Martínez Sernández Res. 2007;100:1233–41. Valdivieso et al. Parasites & Vectors (2015) 8:399 Page 10 of 10 18. Kobayashi Y, Ishizaki S, Nagashima Y, Shiomi K. Ani s 1, the major allergen of Anisakis simplex: purification by affinity chromatography and functional expression in Escherichia coli. Parasitol Int. 2008;57:314–9. 19. Perteguer MJ, Gómez-Puertas P, Cañavate C, Dagger F, Gárate T, Valdivieso E. Ddi1-like protein from Leishmania major is an active aspartyl proteinase. Cell Stress Chaperones. 2013;18:171–81. 20. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–402. 21. Petersen TN, Brunak S, von Heijne G, Nielsen H. Locating proteins in the cell using TargetP, SignalP, and related tools. Nat Methods. 2011;8:785–6. 22. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, et al. Measurement of protein using bicinchoninic acid. Anal Biochem. 1985;150:76–85. 23. Martínez-Sernández V, Mezo M, González-Warleta M, Perteguer MJ, Muiño L, Guitián E, et al. The MF6p/FhHDM-1 major antigen secreted by the trematode parasite Fasciola hepatica is a heme-binding protein. J Biol Chem. 2014;289:1441–56. 24. Sanmartín ML, Iglesias R, Santamarina MT, Leiro J, Ubeira FM. Anatomical location of phosphorylcholine and other antigens on encysted Trichinella using immunohistochemistry followed by Wheatley’s trichrome stain. Parasitol Res. 1991;77:301–6. 25. Bennett-Lovsey RM, Herbert AD, Sternberg MJ, Kelley LA. Exploring the extremes of sequence/structure space with ensemble fold recognition in the program Phyre. Proteins. 2008;70:611–25. 26. Baglin TP, Carrell RW, Church FC, Esmon CT, Huntington JA. Crystal structures of native and thrombin-complexed heparin cofactor II reveal a multistep allosteric mechanism. Proc Natl Acad Sci USA. 2002;99:11079–84. 27. Guex N, Diemand A, Peitsch MC. Protein modelling for all. Trends Biochem Sci. 1999;24:364–7. 28. Peitsch MC. ProMod and Swiss-Model: Internet-based tools for automated comparative protein modelling. Biochem Soc Trans. 1996;24:274–9. 29. Schwede T, Kopp J, Guex N, Peitsch MC. SWISS-MODEL: An automated protein homology-modeling server. Nucleic Acids Res. 2003;31:3381–5. 30. Guex N, Peitsch MC. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis. 1997;18:2714–23. 31. Case DA, Cheatham 3rd TE, Darden T, Gohlke H, Luo R, Merz Jr KM, et al. The Amber biomolecular simulation programs. J Comput Chem. 2005;26:1668–71. 32. Schreuder HA, de Boer B, Dijkema R, Mulders J, Theunissen HJ, Grootenhuis PD, et al. The intact and cleaved human antithrombin III complex as a model for serpin-proteinase interactions. Nat Struct Biol. 1994;1:48–54. 33. Holm L, Kaariainen S, Rosenstrom P, Schenkel A. Searching protein structure databases with DaliLite v. 3. Bioinformatics. 2008;24:2780–1. 34. Fares H, Greenwald I. Genetic analysis of endocytosis in Caenorhabditis elegans: coelomocyte uptake defective mutants. Genetics. 2001;159:133–45. 35. Zang X, Maizels RM. Serine proteinase inhibitors from nematodes and the arms race between host and pathogen. Trends Biochem Sci. 2001;26:191–7. 36. Gettins PG, Olson ST. Exosite determinants of serpin specificity. J Biol Chem. 2009;284:20441–5. 37. Dementiev A, Petitou M, Herbert JM, Gettins PG. The ternary complex of antithrombin-anhydrothrombin-heparin reveals the basis of inhibitor specificity. Nat Struct Mol Biol. 2004;11:863–7. 38. Rossi EB, Duboscq CL, Kordich LC. Heparin cofactor II, a thrombin inhibitor with a still not clarified physiologic role. Medicina (B Aires). 1999;59:95–104. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit

Journal

Parasites & VectorsSpringer Journals

Published: Jul 28, 2015

There are no references for this article.