Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Ascorbic acid synthesis and transportation capacity in old laying hens and the effects of dietary supplementation with ascorbic acid

Ascorbic acid synthesis and transportation capacity in old laying hens and the effects of dietary... Background: Laying hens over 75 weeks of age commonly show great declines in immunity and production performance. It is unclear whether these declines can be relieved by supplementing with ascorbic acid (AA) in feed. Two trials were conducted to investigate the synthesis and metabolism of AA in layers of different ages and the effects of dietary supplemental AA on the performance and the immune and antioxidant statuses of 78 weeks old hens. Methods: In Exp. 1, equal numbers (24 hens) of 35 weeks old (Young) and 75 weeks old (Old) layers were fed the same diet without AA supplementation for 4 weeks. In Exp. 2, 360 healthy 78 weeks old laying hens were randomly assigned to 4 treatments (basal diet supplemented with 0, 0.25, 0.5, or 1 g AA/kg diet) in an 8-week feeding trial. Results: The old hens tended to have decreased L-gulonolactone oxidase (GLO) synthase activity in the kidney and liver than that of the young hens (P = 0.07 and P = 0.05, respectively). Compared with the young hens, the old hens had lower hepatic antioxidant capacity allowing for the lower thioredoxin (TXN), thioredoxin reductase (TXNR) and cytochrome b5 reductase (CYB5R) gene expression (P < 0.05), whereas increased sodium-dependent vitamin C transporter (SVCT) 1 expression levels in the ileum and kidney and enhanced splenic and hepatic AA concentrations (P < 0.05). Dietary supplementation with AA significantly decreased GLO enzyme activity but increased splenic AA concentration and anti-bovine serum albumin IgG levels (P < 0.05) and tended to increase CD4 T lymphocyte numbers (P = 0.06) in serum. Supplementation of 0.25 g AA/kg diet significantly increased hepatic total antioxidant capacity (T-AOC, P < 0.05) relative to the control group. Conclusions: Laying hens could synthesize AA in both the kidney and the liver, though the GLO enzyme activities were 100 times greater in kidneys than in livers. The old laying hens had greater absorption and reabsorption capacity and higher AA retention in some tissues that did the young hens. Dietary supplementation of AA can improve the health of old layers by enhancing immunity and antioxidant capacity. Keywords: Ascorbic acid, Antioxidant capacity, Immunity, L-gulonolactone oxidase, Old laying hens * Correspondence: guoyum@cau.edu.cn The State Key Laboratory of Animal Nutrition, College of Animal Science and Technology, China Agricultural University, Beijing 100193, People’s Republic of China © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 2 of 12 Background the production performance, egg quality, antioxidant status, Maintaining excellent immune status, production per- and immunity of old laying hens. formance, and egg quality in old laying hens (i.e. until 80 to 100 weeks of age) is an ongoing interest in poultry pro- Methods duction [1]. In general, laying rate and egg quality begin to Animals, experimental design, and diets decline in layers after 60 weeks of age, with larger num- Exp. 1 bers of abnormal eggs produced and increased breakage A total of 48 healthy commercial Hy-line Brown laying rates. These declines cause substantial economic losses hens (35 and 75 weeks of age, 24 of each group) of simi- [2]. Thus, it is important to develop nutritional solutions lar weight were used in a controlled trial (young hens vs. to mitigate the decrease in laying rate in old layers. old hens). All of the birds were raised in cages, with two Some previous studies have suggested that the decline birds per cage, and were fed the same standard commer- in laying rate in old layers is related to oxidant stress cial layer diet without AA supplementation for 4 weeks and decreased immunity [2–4]. Ascorbic acid (AA) is a before sample collection. Feed and fresh water were potent antioxidant that is usually supplemented in feed available ad libitum. Twelve hens were randomly se- to alleviate oxidative stress and improve immunity [5, 6]. lected from each group and sacrificed using pentobar- After a cascade of two-round oxidation and the loss of bital anaesthesia. The same position from the left side of two electrons, the oxidized form of AA, termed dehy- the kidney, along with the liver, spleen, brain, shell droascorbic acid (DHA), is formed. Poultry have the gland, and ovary, were sampled, wrapped in aluminium capacity to synthesize AA in the kidney through the foil, immediately frozen in liquid N , and then main- glucuronatexylulose-xylulose cycle in the presence of tained at − 80 °C for further analysis. Then, the mucosae L-gulonolactone oxidase ([EC 1.1.3.8], GLO). All AAs from the duodenal, jejuna, and ileal segments were are transported to cells by sodium-dependent vitamin C collected and rapidly frozen in liquid N and preserved transporter 1 (SVCT1) and sodium-dependent vitamin C at − 80 °C until analysis. transporter 2 (SVCT2), while DHA enters and leaves cells via facilitated glucose transporters [7–9]. The AA Exp. 2 requirements of laying hens are met in two ways: syn- A total of 360 healthy, 78 weeks old laying hens with thesis in vivo (endogenous) and absorption from feed similar performance were randomly distributed among (exogenous). Dietary supplementation with AA im- 120 cages, with three hens per cage. All hens were ran- proved the production performance and immunity status domly assigned to four dietary treatments, with 6 repli- of old laying hens (72 weeks old) subjected to severe cates of 15 hens each (90 hens per treatment). Five cages heat stress conditions [10]. However, some results have of 15 layers were considered to compose one replicate shown that the supplementation of AA was found to unit. One group was fed the basal diet only (control). have no effect on the production performance of laying The remaining three groups were fed one of the hens (31 weeks old) under oxidant stress [11] and broiler AA-supplemented diets (supplemented AA at a dose of breeder chickens [12]. Such inconsistent results regard- 0.25, 0.5, or 1 g AA/kg diet) over the 8-week feeding ing AA supplementation prompted an examination of trial. the changes in distribution and transportation of AA in Batches of the experimental diets were produced every different tissues and GLO enzyme activity in poultry of 4 weeks to limit the loss of AA activity during feed stor- different ages. In poultry production, old layers (over age. The composition and nutrient level of the basal diet 75 weeks of age) that are subjected to a variety of are shown in Table 1. All of the hens had free access to stresses generally present decreases in immunity and water and feed during the 8-week trial. The hens were laying rate. Few studies have focused on the effects of housed in an environmentally controlled room main- AA supplementation on immune function, antioxidant tained at 24 °C and had a daily lighting schedule of 16 h status, and production performance in old layers. This light and 8 h dark. At the end of the experiment, six information is essential for understanding AA metabol- layers were randomly selected from each treatment ism and developing strategies for sustaining optimum before laying eggs in the morning and sacrificed with performance in old laying hens. We hypothesized that pentobarbital anaesthesia. The kidney, spleen, and liver old laying hens have lower abilities than do young hens of the laying hens were sampled, wrapped in aluminium to synthesize and absorb AA and that dietary supplementa- foil, frozen in liquid N , and maintained at − 80 °C until tion with AA can improve AA content in tissues, antioxi- analysis. dant state, and production performance. Two consecutive trials were carried out to ascertain 1) the ability of old lay- Production performance and egg quality (Exp. 2) ing hens to synthesize, absorb, transport, and utilize AA The production performance of the laying hens was mea- and 2) the effects of dietary supplementation with AA on sured from 78 to 85 weeks of age. Daily egg production Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 3 of 12 Table 1 Composition and nutrient level of the basal diet carefully layered on top of Histopaque 1077 (Sigma-Al- drich Corporation, Burlington, Vermont, USA) in a Items Content, g/kg Nutrient level 10-mL centrifuge tube at a 2:1 ratio. After centrifugation Corn 596 AME, MJ/kg 10.9 for 30 min at 3,000 r/min at 20 °C, the PBMCs at the Soybean meal 236 Crude protein, g/kg 155 plasma–Ficoll interface were collected and then washed Wheat 41.3 Lysine, g/kg 7.4 three times with cold RPMI-1640 medium. Lymphocytes Soybean oil 10.0 Methionine, g/kg 3.3 were stained with anti-CD3-SPRD, anti-CD4-FITC and Calcium carbonate 95.0 Calcium, g/kg 40 anti-CD8-PE for 30 min on ice. All staining was per- Calcium phosphate 14.0 Available phosphorus, g/kg 3.4 formed using 0.1 μg of each antibody for 100,000 cells. After that, cells were washed and resuspended in PBS. DL-methionine 0.8 Total phosphorus, g/kg 5.8 a Propidium iodide was added to cells, and portion of Vitamin premix 0.2 + + CD4 and CD8 T lymphocytes were analysed by flow Mineral premix 2.0 cytometry (Navios, Beckman-CouIter, USA). Sodium chloride 3.0 Choline chloride 1.5 Measurement of ascorbic acid and dehydroascorbic acid Antioxidants 0.2 (Exp. 1 and 2) Ascorbic acid was measured using a high-performance Provided per kilogram of diet: vitamin A, 10,000 IU; vitamin D , 2,400 IU; vitamin E, 40 IU; vitamin K , 2 mg; vitamin B , 2 mg; vitamin B , 6.4 mg; 3 1 2 liquid chromatography (HPLC)-ultraviolet (UV) light de- vitamin B , 3 mg; vitamin B , 0.02 mg; folic acid, 1 mg; niacin, 30 mg; Ca- 6 12 tection method as described by Robitaille et al. [15] and pantothenate acid, 10 mg Provided per kilogram of diet: Cu, 8 mg; Zn, 75 mg; Fe, 80 mg; Mn, 100 mg; Amano et al. [16], with some modifications. The spleen, Se, 0.15 mg; I, 0.35 mg liver, kidney, brain, shell gland, and ovary tissue samples in Exp. 1 and the spleen tissues in Exp. 2 (approximately and egg weight were determined per replicate unit. Ab- 100–120 mg) were homogenized in 1.6 mL of 5.4% normal eggs, including soft-shelled, cracked, and broken metaphosphoric acid and centrifuged at 16,000 × g for samples, were also recorded daily. Feed intake was mea- 15 min at 4 °C. The centrifugal supernatants were di- sured on a weekly basis. The feed conversion ratio (FCR, vided into two aliquots of 600 μL in 1.5 mL plastic feed intake/egg weight) was calculated from egg produc- Eppendorf tubes. For the measurement of total AA (AA tion and feed intake. At 4-week intervals and at the end of plus DHA), an equal volume of 5 mmol/L Tris (2-car- the experiment, eggs from each treatment were selected boxy ethyl) phosphine hydrochloride (TCEP) in water for quality analysis. Eggshell strength, egg weight, egg yolk (pH 2) was added. Then, the samples were allowed to colour, Haugh unit, and albumen height were tested using react for 2 h at 4 °C in the dark. To measure AA, an a digital egg tester (NABEL, DET-6000). Eggshell thick- equal volume of water was added instead of TCEP, and ness was measured at the large end, equatorial region, and the samples were maintained on ice in the dark. Both small end using an Eggshell Thickness Gauge. samples were then centrifuged at 12,000 × g for 10 min at 4 °C. Next, the resultant supernatants were trans- Antibody response of immunoglobulin G against bovine ferred to auto-injection vials and injected immediately serum albumin (Exp. 2) onto the HPLC column (10 μL injection volume) for fur- One bird (82 weeks of age) from each replicate was im- ther analysis. munized with 1 mL 1% bovine serum albumin (BSA). The analysis was carried out using a Waters 2695 Blood samples (1.5 mL) were collected from the wing Separations Module equipped with a Waters 717 plus rd th th veins of the immunized birds on the 3 ,6 ,10 , and Autosampler and a Waters 2487 dual wavelength UV th 14 day after immunization. The detection of specific detector set to 246 nm. The column was a reverse-phase systemic antibody response of immunoglobulin G (IgG) Dikma Diamonsil C18 (4.6 mm × 150 mm, 5 μm) fitted against BSA in serum was performed by indirect with a Dikma Diamonsil C18 guard column. The col- enzyme-linked immunosorbent assay as described by umn temperature was maintained at 25 °C. The mobile Alizadeh et al. [13]. phase consisted of 50 mmol/L KH PO (pH 2.8), 2 4 1 mmol/L EDTA, and 5% methanol at a flow rate of Flow cytometric analysis of the classification of T 0.8 mL/min. The retention time was 3.89 min. A 7-min lymphocytes (Exp. 2) delay was provided between injections to produce a Peripheral blood mononuclear cells (PBMCs) were iso- smooth baseline. For both methods, a standard curve lated using a Ficoll density centrifugation [14]. Briefly, was developed by using a peak area linear regression heparinized blood was diluted with Hank’s balanced salt equation from six AA standards made in metaphos- solution at a ratio of 1:1 (no calcium and no magnesium, phoric acid and EDTA ranging in concentration from 2 Life Technologies, Burlington, Vermont, USA) and was to 50 mg/L. Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 4 of 12 Measurement of L-gulonolactone oxidase activity (Exp. 1 Quantitative real-time polymerase chain reaction (qRT- and 2) PCR) analysis (Exp. 1) L-gulonolactone oxidase enzyme activity was measured by Total RNA was isolated from the liver, spleen, kidney, determining the rate of total AA synthesized in liver or kid- and intestinal samples using TRIzol reagent (TAKARA, ney tissues by adding the substrate (L-gulonolactone). Max- Dalian, Laoning, China) according to the manufacturer’s imum GLO synthesis in chick kidney was attained after protocol. The cDNA synthesis was performed using a supplementation of 5 mmol/L of L-gulonolactone [17]. The PrimeScript RT reagent kit with gDNA eraser (TaKaRa, procedures of Hooper et al. [18]andChingetal.[19]were Dalian, Liaoning, China) according to the manufacturer’s followed, with some modifications. Approximately 100 mg instructions. The primer sequences for the target and of liverorkidneysamplewas homogenizedin1.6 mL reference genes are shown in Table 2. All of the mea- 50 mmol/L sodium phosphate buffer (PB) at pH 7.4 con- surements were performed in triplicate, and the average taining 0.2% sodium deoxycholate (TCI, Shanghai, China) values were calculated. Relative mRNA expression levels and 1 mmol/L EDTA and centrifuged at 20,000 × g for of GLO, SVCT1, SVCT2, thioredoxin (TXN), thioredoxin 30 min at 4 °C. The supernatants were divided into 2 reductase (TXNR), and cytochrome b5 reductase aliquots of 400 μL in 5-mL plastic tubes. To detect GLO (CYB5R) genes were normalized to the expression of the –ΔΔCt activity, 200 μL 50 mmol/L L-gulonolactone and housekeeping gene GAPDH using the 2 method 1,400 μL PB were added to one of the aliquots, mixed, and [20, 21]. The products were separated on 1.2% agarose incubated in water for 30 min at 37 °C in the dark. A blank gel and stained with Gelred. was run with each sample to correct for endogenous AA. Phosphate buffer (1,600 μL) was added to the supernatants Antioxidant activity assay (Exp. 1 and 2) to a total volume of 2 mL. The resulting solution was incu- In Exp. 1, the gene expression levels of TXN, TXNR, and bated in water for 30 min at 37 °C in the dark. The reaction CYB5R in the liver were tested using qPCR as described was stopped with 2 mL 5% trichloroacetic acid (TCI, above. The GSH and GSSG contents in the liver (both Shanghai, China). Then, the mixture was incubated in the experiments) were detected using GSH/GSSG reagent dark for 20 min at room temperature and centrifuged at kits (Beyotime, S0053, Shanghai, China) according to the 4 °C, 10,000 × g for 5 min. The supernatants were used to manufacturer’s guidelines. In Exp. 2, total antioxidant detect GLO-synthesized AA. The procedure for measur- capacity (T-AOC) and malondialdehyde content in the ing AA was as described above. liver were detected by a biochemical method following Table 2 Primer sequences of housekeeping and target genes Genes Prime sequence NCBI number Product size, bp GAPDH F GACCCCAGCAACATCAAATG NM_204305.1 110 R TTAGCACCACCCTTCAGATG GLO F TCTCCTCTGGATCAGCACCT XM_015285218.1 131 R AGCGGCACTCGTAGTTGAAG SVCT1 F GGGATACCCACGGTGACCTC XM_004944768.2 100 R GCCGTGCACAGGAGTAGTAA SVCT2 F TGTCTTGTGCTCCTCCTCCT NM_001145227.1 101 R TCCATTCCCTGTCCCAAATA GLUT1 F TAGTACTGGAGCAGGTGGCAGA NM_205209.1 124 R CGGCACAAGAATGGATGAAA GLUT3 F TGCTGATAATTGGGCGCTTC NM_205511.1 150 R CCACCAGGATGCCTACAACT TXN F GATTTCTCTGCCACATGGTGT NM_205453.1 117 R ATCTTGGGCATCATCCACAT TXNR F GCTTCCTATGTTGCCTTGGA NM_001030762.2 112 R TGTTTGCCATATCCTGGTCA CYB5R F GTGGATCACGTTCTGGGTCT NM_001291805.1 119 R ACGAAGCCCTTGTCATCATC Primer sequences are displayed in the 5′→ 3′ direction F forward primer, R reverse primer Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 5 of 12 the instructions provided with the reagent kits (T-AOC, with AA significantly reduced GLO activity in the kidneys A015; malondialdehyde, A003) purchased from Nanjing of old laying hens (P < 0.05). Moreover, GLO activity in Jiancheng Bioengineering Institute of China. the kidney decreased linearly with increasing AA supple- mentation (Fig. 1c). A small amount of AA was synthe- Statistical analysis sized in the liver of old laying hens in Exp. 2 (0~ 0.12 μg/h In Exp. 1, the significance of differences between experi- per mg protein). The addition of 0.5 and 1 g AA/kg diet mental groups was assessed by independent sample significantly enhanced GLO enzyme activity in the liver of t-tests performed with SPSS statistical software (SPSS old hens (Fig. 1d). for Windows, version 22; IBM). All of the data in Exp. 2 were analysed using One-way ANOVA (SPSS for Win- Ascorbic acid and dehydroascorbic acid contents in dows, version 22; IBM). Linear and quadratic polynomial different tissues contrasts were used to evaluate the effects of the differ- The concentrations of AA, DHA, and total AA (both ent dietary levels of AA. Statistical differences were con- AA and DHA) in different tissues are presented in sidered significant at P < 0.05, and 0.05 < P < 0.10 was Fig. 2. Old hens had higher concentrations of AA and viewed as a trend towards significance. total AA in the liver and spleen than did young hens (P < 0.05). In contrast, the young layers had higher Results AA retention in the shell gland than did old layers L-gulonolactone oxidase gene expression and enzyme (P < 0.05). However, the levels of AA in the brain and activity in liver and kidney tissues kidney were similar (P > 0.05) between the young and In Exp. 1 as shown in Fig. 1a and b, GLO gene ex- old layers.InExp.2,irrespective of the amount of AA pression in the liver and kidney was higher in the old supplemented in the diet, AA supplementation significantly hens than in the young layers (P <0.05 and P = 0.05, enhanced (P < 0.05) total AA concentration in the respectively). However, GLO activity in the livers and spleen relative to that in the control treatment. How- kidneys of the old layers showed a decreased ten- ever, AA content did not differ among the treatments. dency compared with the corresponding activity in Dehydroascorbic acid contents tended to decrease as the young birds (P = 0.07 and 0.05, respectively). In Exp. amount of AA supplementation increased. Supplementa- 2, regardless of concentration, dietary supplementation tion with 0.25 and 0.5 g AA/kg diet significantly increased Fig. 1 GLO gene expression and activities in kidney and liver. a GLO gene expression and b GLO enzyme activity in the kidney and liver of 35- week-old laying hens (Young) and 75-week-old laying hens (Old) in Exp. 1. *means P < 0.05. c-d Effects of dietary supplementation of AA on GLO activity in the kidney and liver of the old laying hens in Exp. 2. Within each panel, means without a common letter differ at P < 0.05 Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 6 of 12 Fig. 2 AA contents in different tissues. a–f Total AA, AA, and DHA contents in the kidney, liver, shell gland, ovary, spleen and brain of the old and young layers in Exp. 1. *means P < 0.05; **means P < 0.01. g Effects of dietary supplementation of AA on splenic total AA, AA, and DHA concentrations of old laying hens in Exp. 2. Within each panel, means without a common letter differ at P <0.05 DHA content in the spleen relative to that of the control in theileum wasmarkedlyhigherin theoldhens treatment (P < 0.05, Fig. 2g). than in the young hens (P < 0.05, Fig. 3a). In the small intestine, SVCT1 had the highest expression Relative mRNA expression of ascorbic acid and level in the ileum. There were no differences in dehydroascorbic acid transporters in different tissues SVCTs gene expression levels in the duodenum and The expression levels of AA transporter genes of SVCT1 jejunum (data not shown). In addition, old hens had and SVCT2 in the liver, kidney, spleen, and intestinal significantly higher gene expression of SVCT1 and segments are shown in Fig. 3.The SVCT1 expression SVCT2 in the kidney than did young hens (P < 0.05). Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 7 of 12 The SVCTs gene expression levels in the spleen and Exp. 2, old hens on diets supplemented with 0.25 g liver did not significantly differ between the old and AA/kg had increased T-AOC and total GSH con- young hens. The young hens had elevated SVCT1 tents in the liver relative to the control hens (P < expression (P < 0.05) in their spleens. No significant 0.05 and P = 0.06, respectively). However, AA sup- difference in SVCT2 expression was observed among plemented at 0.5 or 1 g/kg diet had no significant the old hens. In addition, no differences between the effect on T-AOC (P > 0.05). Similarly, no significant young and old hens were observed in hepatic SVCT1 differences in malondialdehyde levels among the four and SVCT2 gene expression (data not shown). treatments (P > 0.05) were observed (as shown in Fig. 4c and d). Antioxidant capacity in the liver and spleen As showninFig. 4a,inExp.1,the younghens showed higher TXN, TXNR,and CYb5R gene expres- Production performance and egg quality in Exp. 2 sion levels (P < 0.05) in the liver than did the old The effects of dietary AA supplementation on the hens. Elevated GSSG concentrations (P < 0.05) were performance of laying hens are shown in Table 3.No found in the livers of old hens (shown in Fig. 4b). In significant difference in production performance or egg Fig. 3 Transporter gene expression levels of the old and young hens in Exp. 1. a-d Sodium dependent vitamin C transporter (SVCT) 1 and SVCT2 gene expression levels in the ileum, kidney, spleen and liver of old hens (Old) and young hens (Young). e The SVCT1 gene expression levels in the duodenum, jejunum, and ileum. *means P < 0.05; **means P < 0.01 Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 8 of 12 Fig. 4 Antioxidant status and immunity of laying hens. a Gene expression levels of thioredoxin (TXN), thioredoxin reductase (TXNR), and cytochrome b5 reductase (CYB5R) and b GSH/GSSG contents in the liver of the old and young hens in Exp. 1. *means P < 0.05; **means P < 0.01. c Effects of dietary supplementation of AA on T-AOC and malonaldehyde (MDA) level and d Total GSH, GSSG, and GSH concentrations in the liver of old laying hens in Exp. 2. Within each panel, means without a common letter differ at P < 0.05 quality was observed among treatments over the experi- with 1 g AA/kg diet significantly increased serum mental period (P > 0.05). IgG level (P < 0.05) relative to the levels in the con- Serum immunoglobulin G against bovine serum trol and other treatment groups. Based on the ob- + + albumin and the portion of CD4 and CD8 Tlym- servations at d 10 and d 14 after immunization with phocytes. As shown in Fig. 5b,atd6after BSA, IgG level increased linearly with increasing immunization with BSA, dietary supplementation AA amount (P < 0.05). Table 3 Effects of supplementation with AA on performance and egg quality in old laying hens Items Treatment, g AA/kg diet SEM P-value 0 0.25 0.5 1 Main effect Linear Quadratic Performance Laying rate, % 86.0 86.5 86.0 81.9 0.80 0.144 0.075 0.138 Egg weight, g 65.4 64.4 64.6 65.0 0.28 0.597 0.674 0.222 ADFI , g 117 118 117 119 0.6 0.672 0.492 0.611 FCR 2.13 2.13 2.12 2.20 0.023 0.170 0.097 0.126 Egg quality Eggshell thickness, mm 0.34 0.34 0.34 0.34 0.002 0.107 0.106 0.798 Eggshell strength, kg/cm 3.10 3.14 3.03 3.01 0.031 0.773 0.382 0.734 Albumen height, mm 6.39 6.32 6.92 6.39 0.079 0.738 0.761 0.598 Haugh unit 76.7 77.0 76.6 76.4 0.60 0.988 0.807 0.825 Yolk colour 6.82 6.80 6.83 6.85 0.029 0.959 0.653 0.807 Eggshell portion, % 9.88 9.91 9.81 9.73 0.059 0.748 0.322 0.650 Data represent the mean of 30 cages (three old laying hens per cage) per treatment ADFI average daily feed intake, FCR feed conversion rate The SEM values represent the overall standard errors of the mean in each row Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 9 of 12 Fig. 5 Effects of dietary AA on the portion of T lymphocytes a and the IgG levels at 3, 6, 10, and 14 d post-immunity with BSA b in serum in Exp. 2. Within each panel, means without a common letter differ at P < 0.05 An increasing trend (P = 0.06) in CD4 T lymphocyte acquisition and storage [25, 26]. However, the very low numbers was recorded after the addition of the 0.25 and activity of GLO in the liver contributes minimally to 0.5 g AA/kg diets for the old laying hens. However, the overall AA synthesis in poultry. portion of CD8 T lymphocytes were not influenced Endogenous synthesis, absorption from the diet and among all the treatment groups, and these results are reabsorption from the urine are the main mechanisms presented in Fig. 5a. by which poultry meet the demand for AA [27, 28]. The present work indicated that exogenous AA via the diet Discussion decreases GLO activity in the kidney and reduces the Ascorbic acid is an essential nutrient for poultry to endogenous synthesis of AA. This suggests the presence maintain optimal production and resist the effects of of an internal feedback mechanism of regulation in hens various stresses. It is generally believed that poultry can whereby dietary supplementation of AA reduces the synthesize AA in kidney with the action of the GLO par- requirement for endogenous AA production, thereby tially meeting the requirement [7, 22]. An interesting reducing AA synthesis in vivo by decreasing GLO finding of the present study was that gene expression activity. The suggested mechanism is consistent with and GLO activity in the kidney did not differ between Hooper et al. [25], who reported that the addition of 1 g old (over 75 weeks of age) and young layers (35– AA/kg diet into broiler diets decreased GLO activity in 39 weeks of age). In addition, in this study, GLO enzyme the kidney. activities were detected in the liver (the activities of It has been reported that SVCT1 is primarily distributed GLO in the liver account for only 0.5–0.7% of that in in the epithelial cells of some tissues, such as intestine and the kidney), suggesting that laying hens have the capacity kidney, participating in whole-body homeostasis and meta- to synthesize small quantities of AA in the liver. This bolic requirements through intestinal absorption and renal finding contradicts reports that AA cannot be synthe- tubular reabsorption of AA [8, 22]. This study showed that sized in the poultry liver [18]. The inconsistent results the mRNA expression of the transporter SVCT1 was might be related to the different methods of AA detec- greaterinthe ileumthaninthe duodenum andjejunum, tion. The HPLC method used in this experiment is more indicating that the main absorption site of AA is the ileum. sensitive and accurate in detecting low levels of AA than However, the transporter results are inconsistent with our is the spectrophotometric assay used in previous reports hypothesis that the expression of SVCT1 in the ileum and [18, 23, 24]. In addition, GLO enzyme activity can be in- kidney and SVCT2 in the kidney are higher in old hens fluenced by multiple factors, including the environment, than in young hens. Our results suggest that compared with feed, age, strain of poultry, and the methods of sample young layers, old layers had greater capacities to absorb AA Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 10 of 12 from the digestive tract and to reabsorb AA from their Unexpectedly, inclusion of AA in the diet of 78 weeks urine. Through the increased abilities to absorb and re- old layers did not increase production performance but absorb AA, rather than through endogenous synthesis, old did enhance antioxidant status and immunity. Dietary layers improved AA retention in some tissues. This addition of 0.25 g AA/kg diet increased the contents of phenomenon might be an intrinsic physiological mechan- T-AOC and the total GSH in the liver of old laying hens. ism to regulate AA metabolism in old layers. Excessive supplementation (above 1 g/kg diet) may have In various tissues, such as kidney, liver, spleen, and negative-feedback inhibition on the secretion of various glands, AA plays important roles in reducing the endogenous antioxidant enzymes such as T-AOC and accumulation of peroxidant compounds and maintaining GSH. However, the increased tendency of total GSH and the physiological function in organs [29]. Moreover, increased T-AOC levels in the liver of old laying hens prior studies have documented that the distribution and following dietary supplementation of AA indicated an retention of AA in organs vary with animal age [30]. elevated antioxidant status of these hens. Similarly, The increased AA contents in the liver and spleen in Wang et al. [3] reported that inclusion of AA in duckling Exp. 1 might reflect a defence mechanism of old hens in diets significantly increased antioxidant status. The en- responding to stresses, with the hens enhancing the anti- hanced antioxidant capacity of the old laying hens likely oxidant capabilities of immune organs. The shell gland decreased their vulnerability, disability, and risk of mor- plays an important role in the production of the egg tality. The current study was limited by the small num- shell. The higher AA content in the egg-shell glands of ber (360) of laying hens and the short trial period due to young layers than in those of old layers enhances anti- restrictions imposed by the research facility. The limited oxidant status, which is favourable for eggshell quality. experimental period might have led to the lack of an ob- In Exp. 2, dietary supplementation of exogenous AA served effect on production performance. It is well elevated the concentration of AA in the spleen, suggest- known that hydrogen peroxide, formed during the ing the presence of enhanced antioxidant and immune capacities. The spleen plays vital roles in the immune systems of old laying hens because of the age-related involution of the thymus [31]. It has been documented that AA can promote the differentiation of B cells and IgM production [32], scavenge free radicals produced by macrophages during the bacteria-fighting process [33], and accelerate the maturation of T lymphocytes [34]. Thus, the increases in the AA and DHA concentrations in the spleen resulting from dietary AA supplementation might contribute to the elevated CD4 T lymphocyte numbers and the increased anti-BSA IgG concentrations in the sera of the 78-week-old laying hens. CD40 ligand, usually expressed on the surface of CD4 T lymphocytes, plays vital roles in activating B cells through binding to CD40, which is expressed on the surfaces of B cells [35]. There is an increasing trend in the CD4 T lymphocyte numbers in AA supplemental treatments. Moreover, the elevated CD4 T lymphocyte numbers might have greater capacity to activate B cells, resulting in greater levels of Fig. 6 The mechanisms of AA metabolism and transport in old anti-BSA IgG production in the serum. The results of laying hens. In Exp. 1, higher absorption and reabsorption capacities increased IgG levels in this study are in agreement with were found in 75 weeks old old laying hens compared with the 35 the observation that AA can promote antibody production weeks old young hens. Small amounts of AA synthesized in liver as part of the immune response [32]. Thus, the results were found. The four sources of AA (intestinal absorption, renal re- absorption, and synthesis in kidney (primary) and liver (small indicate that dietary supplementation with AA can en- quality)) facilitate the higher AA contents in the liver and spleen and hance humoral immunity in old laying hens. Similarly, the greater antioxidant capacity of the old laying hens. In Exp. 2, supplementation of 1 g AA/kg diet has been found to re- supplementation with exogenous AA contributed to the enhanced verse the immunosuppression caused by IBDV vaccination retention of AA in the spleen and the increased portion of CD4 T and improve the humoral and cellular immune responses lymphocytes and IgG concentration in the sera of 78 weeks old laying hens, suggesting a strengthened immune status. Dietary of chickens [36]. Increased IgG levels are important in supplementation of AA improved antioxidant capacity and immune protecting old laying hens from bacterial invasion and status, indicating the enhanced health condition of the old laying hens other stresses [32, 34]. Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 11 of 12 period when GLO catalyses the last step of AA synthe- WN: gave advise to the manuscript writing and experiment designing; All authors read and approved the final manuscript. sis, would be metabolized at the expense of antioxidants such as catalase and GSH [37]. Exogenous supplementa- Ethics approval tion of AA can reduce the amount of AA synthesised in The experimental animal protocol for this study was approved by and vivo, thus decreasing the accumulation of hydrogen per- conducted in accordance with the Animal Care and Use Committee of China oxide, contributing to the improved antioxidant status. Agricultural University (No. CAU20160910–2). This effect was consistent with our finding that the old laying hens had improved immune and antioxidant sta- Consent for publication Not applicable. tuses but decreased GLO enzyme activity due to the in- corporation of AA in the diet. Therefore, it would be Competing interests feasible to add dietary AA for the improvement of the All authors approved the submission of this manuscript and declare no health conditions of laying hens. In practice, the nutrient conflicts of interest. The manuscript has not been previously published and requirement of AA for laying hens varies greatly due to is not under consideration for publication elsewhere. variation in feeding conditions. Further studies of the ef- Received: 7 May 2018 Accepted: 15 August 2018 fects of AA on old laying hens and the optimal dosages under different rearing conditions should be conducted to confirm the findings of this study. References 1. Molnar A, Maertens L, Ampe B, Buyse J, Zoons J, Delezie E. Supplementation of fine and coarse limestone in different ratios in a split feeding system: Conclusions effects on performance, egg quality, and bone strength in old laying hens. In summary, laying hens can synthesize a small quantity Poult Sci. 2017;96:1659–71. https://doi.org/10.3382/ps/pew424. 2. Molnar A, Maertens L, Ampe B, Buyse J, Kempen I, Zoons J, et al. Changes in of AA in the liver. By up-regulating the expression levels egg quality traits during the last phase of production: is there potential for of transporter genes, the old laying hens enhanced their an extended laying cycle? Br Poult Sci. 2016;57:842–7. capacities for intestinal AA absorption and renal AA re- 3. Wang A, Xie F, Wang YH, Wu JL. Effects of vitamin C supplementation on growth performance and antioxidant status of layer ducklings. J Anim absorption, which led to greater concentrations of AA in Physiol Anim Nutr. 2011;95:533–9. immunological tissues. Dietary supplementation of AA 4. Keshavarz K. The effect of different levels of vitamin C and cholecalciferol improved the health of the old laying hens by increasing with adequate or marginal levels of dietary calcium on performance and eggshell quality of laying hens. Poult Sci. 1996;75:1227–35. their antioxidant status and immunity, as evidenced by 5. Zhou Q, Wang L, Wang H, Xie F, Wang T. Effect of dietary vitamin C on the the increased activities of antioxidant enzymes, increased growth performance and innate immunity of juvenile cobia (Rachycentron IgG levels, and increased AA retention in the spleen canadum). Fish Shellfish Immunol. 2012;32:969–75. 6. Monacelli F, Acquarone E, Giannotti C, Borghi R, Nencioni A. Vitamin C, (Fig. 6). Considering all of the investigated variables, the aging and Alzheimer's disease. Nutrients. 2017;9:670. optimum amount of dietary AA supplementation for lay- 7. Chaudhuri CR, Chatterjee IB. Ascorbic acid synthesis in birds. Science. 1969; ing hens appears to be approximately 0.25 g AA/kg diet. 164:435–6. 8. Corti A, Casini AF, Pompella A. Cellular pathways for transport and efflux of ascorbate and dehydroascorbate. Arch Biochem Biophys. 2010;500:107–15. Abbreviations 9. Young JI, Zuchner S, Wang G. Regulation of the epigenome by vitamin C. AA: Ascorbic acid; BSA: Bovine serum antigen; CYB5R: Cytochrome b5 Annu Rev Nutr. 2015;35:545–64. reductase; DHA: Dehydroascorbic acid; GLO: L-gulonolactone oxidase; 10. Ahmed W, Ahmad S, Ahsan-ul-haq KZ. Response of laying hens to vitamin MDA: Malonaldehyde; PB: Sodium phosphate buffer; SVCTs: Sodium- C supplementation through drinking water under sub-tropical conditions. dependent vitamin C transporters; T-AOC: Total antioxidant capacity; Avian Biol Res. 2008;1:59–63. TXN: Thioredoxin; TXNR: Thioredoxin reductase 11. Wang JP, He KR, Ding XM, Luo YH, Bai SP, Zeng QF, et al. Effect of dietary vanadium and vitamin C on egg quality and antioxidant status in laying Acknowledgements hens. J Anim Physiol Anim Nutr. 2016;100:440–7. The authors are grateful to the staff of the Department of Animal Science 12. Creel LH, Maurice DV, Lightsey SF, Grimes LW. Stability of dietary ascorbic and Technology of the China Agricultural University for their valuable acid and the effect of supplementation on reproductive performance of assistance in sample collecting. We thank American Journal Experts (http:// broiler breeder chickens. Br Poult Sci. 2001;42:96–101. www.aje.com) for its linguistic assistance during the preparation of this 13. Alizadeh M, Munyaka P, Yitbarek A, Echeverry H, Rodriguez-Lecompte JC. manuscript. Maternal antibody decay and antibody-mediated immune responses in chicken pullets fed prebiotics and synbiotics. Poult Sci. 2017;96:58–64. Funding 14. Fan H, Lv Z, Gan L, Guo Y. Transcriptomics-related mechanisms of The State Key Development Program (2016YFD0501202) supported this study. supplementing laying broiler breeder hens with dietary Daidzein to improve the immune function and growth performance of offspring. J Availability of data and materials Agric Food Chem. 2018;66:2049–60. All data generated or analysed during this study are available from the 15. Robitaille L, Hoffer LJ. A simple method for plasma total vitamin C analysis corresponding author by request. The datasets supporting the conclusions of suitable for routine clinical laboratory use. Nutr J. 2016;15:40. this article are included in the article. 16. Amano A, Aigaki T, Maruyama N, Ishigami A. Ascorbic acid depletion enhances expression of the sodium-dependent vitamin C transporters, Authors’ contributions SVCT1 and SVCT2, and uptake of ascorbic acid in livers of SMP30/GNL The authors’ responsibilities were as follows—YMG: designed the research, knockout mice. Arch Biochem Biophys. 2010;496:38–44. interpreted the data, and had primary responsibility for the final content; 17. Chatterjee IB, Chatterjee GC, Ghosh NC, Ghosh JJ, Guha BC. Biological LPG: carried out the animal experiment, performed sample analysis and synthesis of L-ascorbic acid in animal tissues: conversion of L-gulonolactone wrote the manuscript; HF: assisted with sample collection and data analysis; into L-ascorbic acid. Biochem J. 1960;74:193–203. Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 12 of 12 18. Hooper CL, Maurice DV, Lightsey SF, Toler JE. Factors affecting ascorbic acid biosynthesis in chickens. I. Adaptation of an assay and the effect of age, sex, and food deprivation. J Anim Physiol Anim Nutr. 2000;84:48–56. 19. Ching S, Mahan DC, Moreau R, Dabrowski K. Modification of analytical procedures for determining vitamin C enzyme (L-gulonolactone oxidase) activity in swine liver. J Nutr Biochem. 2003;14:139–46. 20. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 2001;25:402–8. 21. Li C, Guo S, Zhang M, Gao J, Guo Y. DNA methylation and histone modification patterns during the late embryonic and early postnatal development of chickens. Poult Sci. 2015;94:706–21. 22. Figueroa-Méndez R, Rivas-Arancibia S. Vitamin C in health and disease: its role in the metabolism of cells and redox state in the brain. Front Physiol. 2015;6:397. 23. Zannoni V, Lynch M, Goldstein S, Sato P. A rapid micromethod for the determination of ascorbic acid in plasma and tissues. Biochem Med. 1974;11:41–8. 24. Dabrowski K, Hinterleitner S. Applications of a simultaneous assay of ascorbic acid, dehydroascorbic acid and ascorbic sulphate in biological materials. Analyst. 1989;114:83–7. 25. Hooper CL, Maurice DV, Lightsey SF, Toler JE. Factors affecting ascorbic acid (AsA) biosynthesis in chickens. II.Effect of dietary AsA and strain of chicken. J Anim Physiol Anim Nutr. 2002;86:326–32. 26. Maurice DV, Lightsey SF, Abudabos A, Toler JE. Factors affecting ascorbic acid biosynthesis in chickens. III. Effectof dietary fluoride on L-gulonolactone oxidase activity and tissueascorbic acid (AsA) concentration. J Anim Physiol Anim Nutr. 2002;86:383–8. 27. Kuo S-M, Tan C-H, Dragan M, Wilson JX. Endotoxin increases ascorbate recycling and concentration in mouse liver. J Nutr. 2005;135:2411–6. 28. Corpe CP, Tu H, Eck P, Wang J, Faulhaber-Walter R, Schnermann J, et al. Vitamin C transporter Slc23a1 links renal reabsorption, vitamin C tissue accumulation, and perinatal survival in mice. J Clin Invest. 2010;120:1069–83. 29. Aumailley L, Warren A, Garand C, Dubois MJ, Paquet ER, Le Couteur DG, et al. Vitamin C modulates the metabolic and cytokine profiles, alleviates hepatic endoplasmic reticulum stress, and increases the life span of Gulo −/− mice. Aging. 2016;8:458–83. 30. Iwama M, Amano A, Shimokado K, Maruyama N, Ishigami A. Ascorbic acid levels in various tissues, plasma and urine of mice during aging. J Nutr Sci Vitaminol. 2012;58:169–74. 31. Uchio R, Hirose Y, Murosaki S, Yamamoto Y, Ishigami A. High dietary intake of vitamin C suppresses age-related thymic atrophy and contributes to the maintenance of immune cells in vitamin C-deficient senescence marker protein-30 knockout mice. Br J Nutr. 2015;113:603–9. 32. Ichiyama K, Mitsuzumi H, Zhong M, Tai A, Tsuchioka A, Kawai S, et al. Promotion of IL-4- and IL-5-dependent differentiation of anti-mu-primed B cells by ascorbic acid 2-glucoside. Immunol Lett. 2009;122:219–26. 33. Mohammed BM, Fisher BJ, Huynh QK, Wijesinghe DS, Chalfant CE, Brophy DF, et al. Resolution of sterile inflammation: role for vitamin C. Mediat Inflamm. 2014;2014:173403. 34. Manning J, Mitchell B, Appadurai DA, Shakya A, Pierce LJ, Wang H, et al. Vitamin C promotes maturation of T-cells. Antioxid Redox Signal. 2013;19:2054–67. 35. Chen Q, Ross AC. Retinoic acid promotes mouse splenic B cell surface IgG expression and maturation stimulated by CD40 and IL-4. Cell Immunol. 2007;249:37–45. 36. Wu CC, D T, Lin TL. Effect of ascorbic acid supplementation on the immune response of chickens vaccinated and challenged with infectious bursal disease virus. Vet Immunol Immunopathol. 2000;74:145–52. 37. Linster CL, Van Schaftingen E, Vitamin C. Biosynthesis, recycling and degradation in mammals. FEBS J. 2007;274:1–22. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Animal Science and Biotechnology Springer Journals

Ascorbic acid synthesis and transportation capacity in old laying hens and the effects of dietary supplementation with ascorbic acid

Loading next page...
 
/lp/springer-journals/ascorbic-acid-synthesis-and-transportation-capacity-in-old-laying-hens-0jjWkHEppE
Publisher
Springer Journals
Copyright
Copyright © 2018 by The Author(s).
Subject
Life Sciences; Agriculture; Biotechnology; Food Science; Animal Genetics and Genomics; Animal Physiology
eISSN
2049-1891
DOI
10.1186/s40104-018-0284-7
Publisher site
See Article on Publisher Site

Abstract

Background: Laying hens over 75 weeks of age commonly show great declines in immunity and production performance. It is unclear whether these declines can be relieved by supplementing with ascorbic acid (AA) in feed. Two trials were conducted to investigate the synthesis and metabolism of AA in layers of different ages and the effects of dietary supplemental AA on the performance and the immune and antioxidant statuses of 78 weeks old hens. Methods: In Exp. 1, equal numbers (24 hens) of 35 weeks old (Young) and 75 weeks old (Old) layers were fed the same diet without AA supplementation for 4 weeks. In Exp. 2, 360 healthy 78 weeks old laying hens were randomly assigned to 4 treatments (basal diet supplemented with 0, 0.25, 0.5, or 1 g AA/kg diet) in an 8-week feeding trial. Results: The old hens tended to have decreased L-gulonolactone oxidase (GLO) synthase activity in the kidney and liver than that of the young hens (P = 0.07 and P = 0.05, respectively). Compared with the young hens, the old hens had lower hepatic antioxidant capacity allowing for the lower thioredoxin (TXN), thioredoxin reductase (TXNR) and cytochrome b5 reductase (CYB5R) gene expression (P < 0.05), whereas increased sodium-dependent vitamin C transporter (SVCT) 1 expression levels in the ileum and kidney and enhanced splenic and hepatic AA concentrations (P < 0.05). Dietary supplementation with AA significantly decreased GLO enzyme activity but increased splenic AA concentration and anti-bovine serum albumin IgG levels (P < 0.05) and tended to increase CD4 T lymphocyte numbers (P = 0.06) in serum. Supplementation of 0.25 g AA/kg diet significantly increased hepatic total antioxidant capacity (T-AOC, P < 0.05) relative to the control group. Conclusions: Laying hens could synthesize AA in both the kidney and the liver, though the GLO enzyme activities were 100 times greater in kidneys than in livers. The old laying hens had greater absorption and reabsorption capacity and higher AA retention in some tissues that did the young hens. Dietary supplementation of AA can improve the health of old layers by enhancing immunity and antioxidant capacity. Keywords: Ascorbic acid, Antioxidant capacity, Immunity, L-gulonolactone oxidase, Old laying hens * Correspondence: guoyum@cau.edu.cn The State Key Laboratory of Animal Nutrition, College of Animal Science and Technology, China Agricultural University, Beijing 100193, People’s Republic of China © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 2 of 12 Background the production performance, egg quality, antioxidant status, Maintaining excellent immune status, production per- and immunity of old laying hens. formance, and egg quality in old laying hens (i.e. until 80 to 100 weeks of age) is an ongoing interest in poultry pro- Methods duction [1]. In general, laying rate and egg quality begin to Animals, experimental design, and diets decline in layers after 60 weeks of age, with larger num- Exp. 1 bers of abnormal eggs produced and increased breakage A total of 48 healthy commercial Hy-line Brown laying rates. These declines cause substantial economic losses hens (35 and 75 weeks of age, 24 of each group) of simi- [2]. Thus, it is important to develop nutritional solutions lar weight were used in a controlled trial (young hens vs. to mitigate the decrease in laying rate in old layers. old hens). All of the birds were raised in cages, with two Some previous studies have suggested that the decline birds per cage, and were fed the same standard commer- in laying rate in old layers is related to oxidant stress cial layer diet without AA supplementation for 4 weeks and decreased immunity [2–4]. Ascorbic acid (AA) is a before sample collection. Feed and fresh water were potent antioxidant that is usually supplemented in feed available ad libitum. Twelve hens were randomly se- to alleviate oxidative stress and improve immunity [5, 6]. lected from each group and sacrificed using pentobar- After a cascade of two-round oxidation and the loss of bital anaesthesia. The same position from the left side of two electrons, the oxidized form of AA, termed dehy- the kidney, along with the liver, spleen, brain, shell droascorbic acid (DHA), is formed. Poultry have the gland, and ovary, were sampled, wrapped in aluminium capacity to synthesize AA in the kidney through the foil, immediately frozen in liquid N , and then main- glucuronatexylulose-xylulose cycle in the presence of tained at − 80 °C for further analysis. Then, the mucosae L-gulonolactone oxidase ([EC 1.1.3.8], GLO). All AAs from the duodenal, jejuna, and ileal segments were are transported to cells by sodium-dependent vitamin C collected and rapidly frozen in liquid N and preserved transporter 1 (SVCT1) and sodium-dependent vitamin C at − 80 °C until analysis. transporter 2 (SVCT2), while DHA enters and leaves cells via facilitated glucose transporters [7–9]. The AA Exp. 2 requirements of laying hens are met in two ways: syn- A total of 360 healthy, 78 weeks old laying hens with thesis in vivo (endogenous) and absorption from feed similar performance were randomly distributed among (exogenous). Dietary supplementation with AA im- 120 cages, with three hens per cage. All hens were ran- proved the production performance and immunity status domly assigned to four dietary treatments, with 6 repli- of old laying hens (72 weeks old) subjected to severe cates of 15 hens each (90 hens per treatment). Five cages heat stress conditions [10]. However, some results have of 15 layers were considered to compose one replicate shown that the supplementation of AA was found to unit. One group was fed the basal diet only (control). have no effect on the production performance of laying The remaining three groups were fed one of the hens (31 weeks old) under oxidant stress [11] and broiler AA-supplemented diets (supplemented AA at a dose of breeder chickens [12]. Such inconsistent results regard- 0.25, 0.5, or 1 g AA/kg diet) over the 8-week feeding ing AA supplementation prompted an examination of trial. the changes in distribution and transportation of AA in Batches of the experimental diets were produced every different tissues and GLO enzyme activity in poultry of 4 weeks to limit the loss of AA activity during feed stor- different ages. In poultry production, old layers (over age. The composition and nutrient level of the basal diet 75 weeks of age) that are subjected to a variety of are shown in Table 1. All of the hens had free access to stresses generally present decreases in immunity and water and feed during the 8-week trial. The hens were laying rate. Few studies have focused on the effects of housed in an environmentally controlled room main- AA supplementation on immune function, antioxidant tained at 24 °C and had a daily lighting schedule of 16 h status, and production performance in old layers. This light and 8 h dark. At the end of the experiment, six information is essential for understanding AA metabol- layers were randomly selected from each treatment ism and developing strategies for sustaining optimum before laying eggs in the morning and sacrificed with performance in old laying hens. We hypothesized that pentobarbital anaesthesia. The kidney, spleen, and liver old laying hens have lower abilities than do young hens of the laying hens were sampled, wrapped in aluminium to synthesize and absorb AA and that dietary supplementa- foil, frozen in liquid N , and maintained at − 80 °C until tion with AA can improve AA content in tissues, antioxi- analysis. dant state, and production performance. Two consecutive trials were carried out to ascertain 1) the ability of old lay- Production performance and egg quality (Exp. 2) ing hens to synthesize, absorb, transport, and utilize AA The production performance of the laying hens was mea- and 2) the effects of dietary supplementation with AA on sured from 78 to 85 weeks of age. Daily egg production Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 3 of 12 Table 1 Composition and nutrient level of the basal diet carefully layered on top of Histopaque 1077 (Sigma-Al- drich Corporation, Burlington, Vermont, USA) in a Items Content, g/kg Nutrient level 10-mL centrifuge tube at a 2:1 ratio. After centrifugation Corn 596 AME, MJ/kg 10.9 for 30 min at 3,000 r/min at 20 °C, the PBMCs at the Soybean meal 236 Crude protein, g/kg 155 plasma–Ficoll interface were collected and then washed Wheat 41.3 Lysine, g/kg 7.4 three times with cold RPMI-1640 medium. Lymphocytes Soybean oil 10.0 Methionine, g/kg 3.3 were stained with anti-CD3-SPRD, anti-CD4-FITC and Calcium carbonate 95.0 Calcium, g/kg 40 anti-CD8-PE for 30 min on ice. All staining was per- Calcium phosphate 14.0 Available phosphorus, g/kg 3.4 formed using 0.1 μg of each antibody for 100,000 cells. After that, cells were washed and resuspended in PBS. DL-methionine 0.8 Total phosphorus, g/kg 5.8 a Propidium iodide was added to cells, and portion of Vitamin premix 0.2 + + CD4 and CD8 T lymphocytes were analysed by flow Mineral premix 2.0 cytometry (Navios, Beckman-CouIter, USA). Sodium chloride 3.0 Choline chloride 1.5 Measurement of ascorbic acid and dehydroascorbic acid Antioxidants 0.2 (Exp. 1 and 2) Ascorbic acid was measured using a high-performance Provided per kilogram of diet: vitamin A, 10,000 IU; vitamin D , 2,400 IU; vitamin E, 40 IU; vitamin K , 2 mg; vitamin B , 2 mg; vitamin B , 6.4 mg; 3 1 2 liquid chromatography (HPLC)-ultraviolet (UV) light de- vitamin B , 3 mg; vitamin B , 0.02 mg; folic acid, 1 mg; niacin, 30 mg; Ca- 6 12 tection method as described by Robitaille et al. [15] and pantothenate acid, 10 mg Provided per kilogram of diet: Cu, 8 mg; Zn, 75 mg; Fe, 80 mg; Mn, 100 mg; Amano et al. [16], with some modifications. The spleen, Se, 0.15 mg; I, 0.35 mg liver, kidney, brain, shell gland, and ovary tissue samples in Exp. 1 and the spleen tissues in Exp. 2 (approximately and egg weight were determined per replicate unit. Ab- 100–120 mg) were homogenized in 1.6 mL of 5.4% normal eggs, including soft-shelled, cracked, and broken metaphosphoric acid and centrifuged at 16,000 × g for samples, were also recorded daily. Feed intake was mea- 15 min at 4 °C. The centrifugal supernatants were di- sured on a weekly basis. The feed conversion ratio (FCR, vided into two aliquots of 600 μL in 1.5 mL plastic feed intake/egg weight) was calculated from egg produc- Eppendorf tubes. For the measurement of total AA (AA tion and feed intake. At 4-week intervals and at the end of plus DHA), an equal volume of 5 mmol/L Tris (2-car- the experiment, eggs from each treatment were selected boxy ethyl) phosphine hydrochloride (TCEP) in water for quality analysis. Eggshell strength, egg weight, egg yolk (pH 2) was added. Then, the samples were allowed to colour, Haugh unit, and albumen height were tested using react for 2 h at 4 °C in the dark. To measure AA, an a digital egg tester (NABEL, DET-6000). Eggshell thick- equal volume of water was added instead of TCEP, and ness was measured at the large end, equatorial region, and the samples were maintained on ice in the dark. Both small end using an Eggshell Thickness Gauge. samples were then centrifuged at 12,000 × g for 10 min at 4 °C. Next, the resultant supernatants were trans- Antibody response of immunoglobulin G against bovine ferred to auto-injection vials and injected immediately serum albumin (Exp. 2) onto the HPLC column (10 μL injection volume) for fur- One bird (82 weeks of age) from each replicate was im- ther analysis. munized with 1 mL 1% bovine serum albumin (BSA). The analysis was carried out using a Waters 2695 Blood samples (1.5 mL) were collected from the wing Separations Module equipped with a Waters 717 plus rd th th veins of the immunized birds on the 3 ,6 ,10 , and Autosampler and a Waters 2487 dual wavelength UV th 14 day after immunization. The detection of specific detector set to 246 nm. The column was a reverse-phase systemic antibody response of immunoglobulin G (IgG) Dikma Diamonsil C18 (4.6 mm × 150 mm, 5 μm) fitted against BSA in serum was performed by indirect with a Dikma Diamonsil C18 guard column. The col- enzyme-linked immunosorbent assay as described by umn temperature was maintained at 25 °C. The mobile Alizadeh et al. [13]. phase consisted of 50 mmol/L KH PO (pH 2.8), 2 4 1 mmol/L EDTA, and 5% methanol at a flow rate of Flow cytometric analysis of the classification of T 0.8 mL/min. The retention time was 3.89 min. A 7-min lymphocytes (Exp. 2) delay was provided between injections to produce a Peripheral blood mononuclear cells (PBMCs) were iso- smooth baseline. For both methods, a standard curve lated using a Ficoll density centrifugation [14]. Briefly, was developed by using a peak area linear regression heparinized blood was diluted with Hank’s balanced salt equation from six AA standards made in metaphos- solution at a ratio of 1:1 (no calcium and no magnesium, phoric acid and EDTA ranging in concentration from 2 Life Technologies, Burlington, Vermont, USA) and was to 50 mg/L. Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 4 of 12 Measurement of L-gulonolactone oxidase activity (Exp. 1 Quantitative real-time polymerase chain reaction (qRT- and 2) PCR) analysis (Exp. 1) L-gulonolactone oxidase enzyme activity was measured by Total RNA was isolated from the liver, spleen, kidney, determining the rate of total AA synthesized in liver or kid- and intestinal samples using TRIzol reagent (TAKARA, ney tissues by adding the substrate (L-gulonolactone). Max- Dalian, Laoning, China) according to the manufacturer’s imum GLO synthesis in chick kidney was attained after protocol. The cDNA synthesis was performed using a supplementation of 5 mmol/L of L-gulonolactone [17]. The PrimeScript RT reagent kit with gDNA eraser (TaKaRa, procedures of Hooper et al. [18]andChingetal.[19]were Dalian, Liaoning, China) according to the manufacturer’s followed, with some modifications. Approximately 100 mg instructions. The primer sequences for the target and of liverorkidneysamplewas homogenizedin1.6 mL reference genes are shown in Table 2. All of the mea- 50 mmol/L sodium phosphate buffer (PB) at pH 7.4 con- surements were performed in triplicate, and the average taining 0.2% sodium deoxycholate (TCI, Shanghai, China) values were calculated. Relative mRNA expression levels and 1 mmol/L EDTA and centrifuged at 20,000 × g for of GLO, SVCT1, SVCT2, thioredoxin (TXN), thioredoxin 30 min at 4 °C. The supernatants were divided into 2 reductase (TXNR), and cytochrome b5 reductase aliquots of 400 μL in 5-mL plastic tubes. To detect GLO (CYB5R) genes were normalized to the expression of the –ΔΔCt activity, 200 μL 50 mmol/L L-gulonolactone and housekeeping gene GAPDH using the 2 method 1,400 μL PB were added to one of the aliquots, mixed, and [20, 21]. The products were separated on 1.2% agarose incubated in water for 30 min at 37 °C in the dark. A blank gel and stained with Gelred. was run with each sample to correct for endogenous AA. Phosphate buffer (1,600 μL) was added to the supernatants Antioxidant activity assay (Exp. 1 and 2) to a total volume of 2 mL. The resulting solution was incu- In Exp. 1, the gene expression levels of TXN, TXNR, and bated in water for 30 min at 37 °C in the dark. The reaction CYB5R in the liver were tested using qPCR as described was stopped with 2 mL 5% trichloroacetic acid (TCI, above. The GSH and GSSG contents in the liver (both Shanghai, China). Then, the mixture was incubated in the experiments) were detected using GSH/GSSG reagent dark for 20 min at room temperature and centrifuged at kits (Beyotime, S0053, Shanghai, China) according to the 4 °C, 10,000 × g for 5 min. The supernatants were used to manufacturer’s guidelines. In Exp. 2, total antioxidant detect GLO-synthesized AA. The procedure for measur- capacity (T-AOC) and malondialdehyde content in the ing AA was as described above. liver were detected by a biochemical method following Table 2 Primer sequences of housekeeping and target genes Genes Prime sequence NCBI number Product size, bp GAPDH F GACCCCAGCAACATCAAATG NM_204305.1 110 R TTAGCACCACCCTTCAGATG GLO F TCTCCTCTGGATCAGCACCT XM_015285218.1 131 R AGCGGCACTCGTAGTTGAAG SVCT1 F GGGATACCCACGGTGACCTC XM_004944768.2 100 R GCCGTGCACAGGAGTAGTAA SVCT2 F TGTCTTGTGCTCCTCCTCCT NM_001145227.1 101 R TCCATTCCCTGTCCCAAATA GLUT1 F TAGTACTGGAGCAGGTGGCAGA NM_205209.1 124 R CGGCACAAGAATGGATGAAA GLUT3 F TGCTGATAATTGGGCGCTTC NM_205511.1 150 R CCACCAGGATGCCTACAACT TXN F GATTTCTCTGCCACATGGTGT NM_205453.1 117 R ATCTTGGGCATCATCCACAT TXNR F GCTTCCTATGTTGCCTTGGA NM_001030762.2 112 R TGTTTGCCATATCCTGGTCA CYB5R F GTGGATCACGTTCTGGGTCT NM_001291805.1 119 R ACGAAGCCCTTGTCATCATC Primer sequences are displayed in the 5′→ 3′ direction F forward primer, R reverse primer Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 5 of 12 the instructions provided with the reagent kits (T-AOC, with AA significantly reduced GLO activity in the kidneys A015; malondialdehyde, A003) purchased from Nanjing of old laying hens (P < 0.05). Moreover, GLO activity in Jiancheng Bioengineering Institute of China. the kidney decreased linearly with increasing AA supple- mentation (Fig. 1c). A small amount of AA was synthe- Statistical analysis sized in the liver of old laying hens in Exp. 2 (0~ 0.12 μg/h In Exp. 1, the significance of differences between experi- per mg protein). The addition of 0.5 and 1 g AA/kg diet mental groups was assessed by independent sample significantly enhanced GLO enzyme activity in the liver of t-tests performed with SPSS statistical software (SPSS old hens (Fig. 1d). for Windows, version 22; IBM). All of the data in Exp. 2 were analysed using One-way ANOVA (SPSS for Win- Ascorbic acid and dehydroascorbic acid contents in dows, version 22; IBM). Linear and quadratic polynomial different tissues contrasts were used to evaluate the effects of the differ- The concentrations of AA, DHA, and total AA (both ent dietary levels of AA. Statistical differences were con- AA and DHA) in different tissues are presented in sidered significant at P < 0.05, and 0.05 < P < 0.10 was Fig. 2. Old hens had higher concentrations of AA and viewed as a trend towards significance. total AA in the liver and spleen than did young hens (P < 0.05). In contrast, the young layers had higher Results AA retention in the shell gland than did old layers L-gulonolactone oxidase gene expression and enzyme (P < 0.05). However, the levels of AA in the brain and activity in liver and kidney tissues kidney were similar (P > 0.05) between the young and In Exp. 1 as shown in Fig. 1a and b, GLO gene ex- old layers.InExp.2,irrespective of the amount of AA pression in the liver and kidney was higher in the old supplemented in the diet, AA supplementation significantly hens than in the young layers (P <0.05 and P = 0.05, enhanced (P < 0.05) total AA concentration in the respectively). However, GLO activity in the livers and spleen relative to that in the control treatment. How- kidneys of the old layers showed a decreased ten- ever, AA content did not differ among the treatments. dency compared with the corresponding activity in Dehydroascorbic acid contents tended to decrease as the young birds (P = 0.07 and 0.05, respectively). In Exp. amount of AA supplementation increased. Supplementa- 2, regardless of concentration, dietary supplementation tion with 0.25 and 0.5 g AA/kg diet significantly increased Fig. 1 GLO gene expression and activities in kidney and liver. a GLO gene expression and b GLO enzyme activity in the kidney and liver of 35- week-old laying hens (Young) and 75-week-old laying hens (Old) in Exp. 1. *means P < 0.05. c-d Effects of dietary supplementation of AA on GLO activity in the kidney and liver of the old laying hens in Exp. 2. Within each panel, means without a common letter differ at P < 0.05 Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 6 of 12 Fig. 2 AA contents in different tissues. a–f Total AA, AA, and DHA contents in the kidney, liver, shell gland, ovary, spleen and brain of the old and young layers in Exp. 1. *means P < 0.05; **means P < 0.01. g Effects of dietary supplementation of AA on splenic total AA, AA, and DHA concentrations of old laying hens in Exp. 2. Within each panel, means without a common letter differ at P <0.05 DHA content in the spleen relative to that of the control in theileum wasmarkedlyhigherin theoldhens treatment (P < 0.05, Fig. 2g). than in the young hens (P < 0.05, Fig. 3a). In the small intestine, SVCT1 had the highest expression Relative mRNA expression of ascorbic acid and level in the ileum. There were no differences in dehydroascorbic acid transporters in different tissues SVCTs gene expression levels in the duodenum and The expression levels of AA transporter genes of SVCT1 jejunum (data not shown). In addition, old hens had and SVCT2 in the liver, kidney, spleen, and intestinal significantly higher gene expression of SVCT1 and segments are shown in Fig. 3.The SVCT1 expression SVCT2 in the kidney than did young hens (P < 0.05). Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 7 of 12 The SVCTs gene expression levels in the spleen and Exp. 2, old hens on diets supplemented with 0.25 g liver did not significantly differ between the old and AA/kg had increased T-AOC and total GSH con- young hens. The young hens had elevated SVCT1 tents in the liver relative to the control hens (P < expression (P < 0.05) in their spleens. No significant 0.05 and P = 0.06, respectively). However, AA sup- difference in SVCT2 expression was observed among plemented at 0.5 or 1 g/kg diet had no significant the old hens. In addition, no differences between the effect on T-AOC (P > 0.05). Similarly, no significant young and old hens were observed in hepatic SVCT1 differences in malondialdehyde levels among the four and SVCT2 gene expression (data not shown). treatments (P > 0.05) were observed (as shown in Fig. 4c and d). Antioxidant capacity in the liver and spleen As showninFig. 4a,inExp.1,the younghens showed higher TXN, TXNR,and CYb5R gene expres- Production performance and egg quality in Exp. 2 sion levels (P < 0.05) in the liver than did the old The effects of dietary AA supplementation on the hens. Elevated GSSG concentrations (P < 0.05) were performance of laying hens are shown in Table 3.No found in the livers of old hens (shown in Fig. 4b). In significant difference in production performance or egg Fig. 3 Transporter gene expression levels of the old and young hens in Exp. 1. a-d Sodium dependent vitamin C transporter (SVCT) 1 and SVCT2 gene expression levels in the ileum, kidney, spleen and liver of old hens (Old) and young hens (Young). e The SVCT1 gene expression levels in the duodenum, jejunum, and ileum. *means P < 0.05; **means P < 0.01 Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 8 of 12 Fig. 4 Antioxidant status and immunity of laying hens. a Gene expression levels of thioredoxin (TXN), thioredoxin reductase (TXNR), and cytochrome b5 reductase (CYB5R) and b GSH/GSSG contents in the liver of the old and young hens in Exp. 1. *means P < 0.05; **means P < 0.01. c Effects of dietary supplementation of AA on T-AOC and malonaldehyde (MDA) level and d Total GSH, GSSG, and GSH concentrations in the liver of old laying hens in Exp. 2. Within each panel, means without a common letter differ at P < 0.05 quality was observed among treatments over the experi- with 1 g AA/kg diet significantly increased serum mental period (P > 0.05). IgG level (P < 0.05) relative to the levels in the con- Serum immunoglobulin G against bovine serum trol and other treatment groups. Based on the ob- + + albumin and the portion of CD4 and CD8 Tlym- servations at d 10 and d 14 after immunization with phocytes. As shown in Fig. 5b,atd6after BSA, IgG level increased linearly with increasing immunization with BSA, dietary supplementation AA amount (P < 0.05). Table 3 Effects of supplementation with AA on performance and egg quality in old laying hens Items Treatment, g AA/kg diet SEM P-value 0 0.25 0.5 1 Main effect Linear Quadratic Performance Laying rate, % 86.0 86.5 86.0 81.9 0.80 0.144 0.075 0.138 Egg weight, g 65.4 64.4 64.6 65.0 0.28 0.597 0.674 0.222 ADFI , g 117 118 117 119 0.6 0.672 0.492 0.611 FCR 2.13 2.13 2.12 2.20 0.023 0.170 0.097 0.126 Egg quality Eggshell thickness, mm 0.34 0.34 0.34 0.34 0.002 0.107 0.106 0.798 Eggshell strength, kg/cm 3.10 3.14 3.03 3.01 0.031 0.773 0.382 0.734 Albumen height, mm 6.39 6.32 6.92 6.39 0.079 0.738 0.761 0.598 Haugh unit 76.7 77.0 76.6 76.4 0.60 0.988 0.807 0.825 Yolk colour 6.82 6.80 6.83 6.85 0.029 0.959 0.653 0.807 Eggshell portion, % 9.88 9.91 9.81 9.73 0.059 0.748 0.322 0.650 Data represent the mean of 30 cages (three old laying hens per cage) per treatment ADFI average daily feed intake, FCR feed conversion rate The SEM values represent the overall standard errors of the mean in each row Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 9 of 12 Fig. 5 Effects of dietary AA on the portion of T lymphocytes a and the IgG levels at 3, 6, 10, and 14 d post-immunity with BSA b in serum in Exp. 2. Within each panel, means without a common letter differ at P < 0.05 An increasing trend (P = 0.06) in CD4 T lymphocyte acquisition and storage [25, 26]. However, the very low numbers was recorded after the addition of the 0.25 and activity of GLO in the liver contributes minimally to 0.5 g AA/kg diets for the old laying hens. However, the overall AA synthesis in poultry. portion of CD8 T lymphocytes were not influenced Endogenous synthesis, absorption from the diet and among all the treatment groups, and these results are reabsorption from the urine are the main mechanisms presented in Fig. 5a. by which poultry meet the demand for AA [27, 28]. The present work indicated that exogenous AA via the diet Discussion decreases GLO activity in the kidney and reduces the Ascorbic acid is an essential nutrient for poultry to endogenous synthesis of AA. This suggests the presence maintain optimal production and resist the effects of of an internal feedback mechanism of regulation in hens various stresses. It is generally believed that poultry can whereby dietary supplementation of AA reduces the synthesize AA in kidney with the action of the GLO par- requirement for endogenous AA production, thereby tially meeting the requirement [7, 22]. An interesting reducing AA synthesis in vivo by decreasing GLO finding of the present study was that gene expression activity. The suggested mechanism is consistent with and GLO activity in the kidney did not differ between Hooper et al. [25], who reported that the addition of 1 g old (over 75 weeks of age) and young layers (35– AA/kg diet into broiler diets decreased GLO activity in 39 weeks of age). In addition, in this study, GLO enzyme the kidney. activities were detected in the liver (the activities of It has been reported that SVCT1 is primarily distributed GLO in the liver account for only 0.5–0.7% of that in in the epithelial cells of some tissues, such as intestine and the kidney), suggesting that laying hens have the capacity kidney, participating in whole-body homeostasis and meta- to synthesize small quantities of AA in the liver. This bolic requirements through intestinal absorption and renal finding contradicts reports that AA cannot be synthe- tubular reabsorption of AA [8, 22]. This study showed that sized in the poultry liver [18]. The inconsistent results the mRNA expression of the transporter SVCT1 was might be related to the different methods of AA detec- greaterinthe ileumthaninthe duodenum andjejunum, tion. The HPLC method used in this experiment is more indicating that the main absorption site of AA is the ileum. sensitive and accurate in detecting low levels of AA than However, the transporter results are inconsistent with our is the spectrophotometric assay used in previous reports hypothesis that the expression of SVCT1 in the ileum and [18, 23, 24]. In addition, GLO enzyme activity can be in- kidney and SVCT2 in the kidney are higher in old hens fluenced by multiple factors, including the environment, than in young hens. Our results suggest that compared with feed, age, strain of poultry, and the methods of sample young layers, old layers had greater capacities to absorb AA Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 10 of 12 from the digestive tract and to reabsorb AA from their Unexpectedly, inclusion of AA in the diet of 78 weeks urine. Through the increased abilities to absorb and re- old layers did not increase production performance but absorb AA, rather than through endogenous synthesis, old did enhance antioxidant status and immunity. Dietary layers improved AA retention in some tissues. This addition of 0.25 g AA/kg diet increased the contents of phenomenon might be an intrinsic physiological mechan- T-AOC and the total GSH in the liver of old laying hens. ism to regulate AA metabolism in old layers. Excessive supplementation (above 1 g/kg diet) may have In various tissues, such as kidney, liver, spleen, and negative-feedback inhibition on the secretion of various glands, AA plays important roles in reducing the endogenous antioxidant enzymes such as T-AOC and accumulation of peroxidant compounds and maintaining GSH. However, the increased tendency of total GSH and the physiological function in organs [29]. Moreover, increased T-AOC levels in the liver of old laying hens prior studies have documented that the distribution and following dietary supplementation of AA indicated an retention of AA in organs vary with animal age [30]. elevated antioxidant status of these hens. Similarly, The increased AA contents in the liver and spleen in Wang et al. [3] reported that inclusion of AA in duckling Exp. 1 might reflect a defence mechanism of old hens in diets significantly increased antioxidant status. The en- responding to stresses, with the hens enhancing the anti- hanced antioxidant capacity of the old laying hens likely oxidant capabilities of immune organs. The shell gland decreased their vulnerability, disability, and risk of mor- plays an important role in the production of the egg tality. The current study was limited by the small num- shell. The higher AA content in the egg-shell glands of ber (360) of laying hens and the short trial period due to young layers than in those of old layers enhances anti- restrictions imposed by the research facility. The limited oxidant status, which is favourable for eggshell quality. experimental period might have led to the lack of an ob- In Exp. 2, dietary supplementation of exogenous AA served effect on production performance. It is well elevated the concentration of AA in the spleen, suggest- known that hydrogen peroxide, formed during the ing the presence of enhanced antioxidant and immune capacities. The spleen plays vital roles in the immune systems of old laying hens because of the age-related involution of the thymus [31]. It has been documented that AA can promote the differentiation of B cells and IgM production [32], scavenge free radicals produced by macrophages during the bacteria-fighting process [33], and accelerate the maturation of T lymphocytes [34]. Thus, the increases in the AA and DHA concentrations in the spleen resulting from dietary AA supplementation might contribute to the elevated CD4 T lymphocyte numbers and the increased anti-BSA IgG concentrations in the sera of the 78-week-old laying hens. CD40 ligand, usually expressed on the surface of CD4 T lymphocytes, plays vital roles in activating B cells through binding to CD40, which is expressed on the surfaces of B cells [35]. There is an increasing trend in the CD4 T lymphocyte numbers in AA supplemental treatments. Moreover, the elevated CD4 T lymphocyte numbers might have greater capacity to activate B cells, resulting in greater levels of Fig. 6 The mechanisms of AA metabolism and transport in old anti-BSA IgG production in the serum. The results of laying hens. In Exp. 1, higher absorption and reabsorption capacities increased IgG levels in this study are in agreement with were found in 75 weeks old old laying hens compared with the 35 the observation that AA can promote antibody production weeks old young hens. Small amounts of AA synthesized in liver as part of the immune response [32]. Thus, the results were found. The four sources of AA (intestinal absorption, renal re- absorption, and synthesis in kidney (primary) and liver (small indicate that dietary supplementation with AA can en- quality)) facilitate the higher AA contents in the liver and spleen and hance humoral immunity in old laying hens. Similarly, the greater antioxidant capacity of the old laying hens. In Exp. 2, supplementation of 1 g AA/kg diet has been found to re- supplementation with exogenous AA contributed to the enhanced verse the immunosuppression caused by IBDV vaccination retention of AA in the spleen and the increased portion of CD4 T and improve the humoral and cellular immune responses lymphocytes and IgG concentration in the sera of 78 weeks old laying hens, suggesting a strengthened immune status. Dietary of chickens [36]. Increased IgG levels are important in supplementation of AA improved antioxidant capacity and immune protecting old laying hens from bacterial invasion and status, indicating the enhanced health condition of the old laying hens other stresses [32, 34]. Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 11 of 12 period when GLO catalyses the last step of AA synthe- WN: gave advise to the manuscript writing and experiment designing; All authors read and approved the final manuscript. sis, would be metabolized at the expense of antioxidants such as catalase and GSH [37]. Exogenous supplementa- Ethics approval tion of AA can reduce the amount of AA synthesised in The experimental animal protocol for this study was approved by and vivo, thus decreasing the accumulation of hydrogen per- conducted in accordance with the Animal Care and Use Committee of China oxide, contributing to the improved antioxidant status. Agricultural University (No. CAU20160910–2). This effect was consistent with our finding that the old laying hens had improved immune and antioxidant sta- Consent for publication Not applicable. tuses but decreased GLO enzyme activity due to the in- corporation of AA in the diet. Therefore, it would be Competing interests feasible to add dietary AA for the improvement of the All authors approved the submission of this manuscript and declare no health conditions of laying hens. In practice, the nutrient conflicts of interest. The manuscript has not been previously published and requirement of AA for laying hens varies greatly due to is not under consideration for publication elsewhere. variation in feeding conditions. Further studies of the ef- Received: 7 May 2018 Accepted: 15 August 2018 fects of AA on old laying hens and the optimal dosages under different rearing conditions should be conducted to confirm the findings of this study. References 1. Molnar A, Maertens L, Ampe B, Buyse J, Zoons J, Delezie E. Supplementation of fine and coarse limestone in different ratios in a split feeding system: Conclusions effects on performance, egg quality, and bone strength in old laying hens. In summary, laying hens can synthesize a small quantity Poult Sci. 2017;96:1659–71. https://doi.org/10.3382/ps/pew424. 2. Molnar A, Maertens L, Ampe B, Buyse J, Kempen I, Zoons J, et al. Changes in of AA in the liver. By up-regulating the expression levels egg quality traits during the last phase of production: is there potential for of transporter genes, the old laying hens enhanced their an extended laying cycle? Br Poult Sci. 2016;57:842–7. capacities for intestinal AA absorption and renal AA re- 3. Wang A, Xie F, Wang YH, Wu JL. Effects of vitamin C supplementation on growth performance and antioxidant status of layer ducklings. J Anim absorption, which led to greater concentrations of AA in Physiol Anim Nutr. 2011;95:533–9. immunological tissues. Dietary supplementation of AA 4. Keshavarz K. The effect of different levels of vitamin C and cholecalciferol improved the health of the old laying hens by increasing with adequate or marginal levels of dietary calcium on performance and eggshell quality of laying hens. Poult Sci. 1996;75:1227–35. their antioxidant status and immunity, as evidenced by 5. Zhou Q, Wang L, Wang H, Xie F, Wang T. Effect of dietary vitamin C on the the increased activities of antioxidant enzymes, increased growth performance and innate immunity of juvenile cobia (Rachycentron IgG levels, and increased AA retention in the spleen canadum). Fish Shellfish Immunol. 2012;32:969–75. 6. Monacelli F, Acquarone E, Giannotti C, Borghi R, Nencioni A. Vitamin C, (Fig. 6). Considering all of the investigated variables, the aging and Alzheimer's disease. Nutrients. 2017;9:670. optimum amount of dietary AA supplementation for lay- 7. Chaudhuri CR, Chatterjee IB. Ascorbic acid synthesis in birds. Science. 1969; ing hens appears to be approximately 0.25 g AA/kg diet. 164:435–6. 8. Corti A, Casini AF, Pompella A. Cellular pathways for transport and efflux of ascorbate and dehydroascorbate. Arch Biochem Biophys. 2010;500:107–15. Abbreviations 9. Young JI, Zuchner S, Wang G. Regulation of the epigenome by vitamin C. AA: Ascorbic acid; BSA: Bovine serum antigen; CYB5R: Cytochrome b5 Annu Rev Nutr. 2015;35:545–64. reductase; DHA: Dehydroascorbic acid; GLO: L-gulonolactone oxidase; 10. Ahmed W, Ahmad S, Ahsan-ul-haq KZ. Response of laying hens to vitamin MDA: Malonaldehyde; PB: Sodium phosphate buffer; SVCTs: Sodium- C supplementation through drinking water under sub-tropical conditions. dependent vitamin C transporters; T-AOC: Total antioxidant capacity; Avian Biol Res. 2008;1:59–63. TXN: Thioredoxin; TXNR: Thioredoxin reductase 11. Wang JP, He KR, Ding XM, Luo YH, Bai SP, Zeng QF, et al. Effect of dietary vanadium and vitamin C on egg quality and antioxidant status in laying Acknowledgements hens. J Anim Physiol Anim Nutr. 2016;100:440–7. The authors are grateful to the staff of the Department of Animal Science 12. Creel LH, Maurice DV, Lightsey SF, Grimes LW. Stability of dietary ascorbic and Technology of the China Agricultural University for their valuable acid and the effect of supplementation on reproductive performance of assistance in sample collecting. We thank American Journal Experts (http:// broiler breeder chickens. Br Poult Sci. 2001;42:96–101. www.aje.com) for its linguistic assistance during the preparation of this 13. Alizadeh M, Munyaka P, Yitbarek A, Echeverry H, Rodriguez-Lecompte JC. manuscript. Maternal antibody decay and antibody-mediated immune responses in chicken pullets fed prebiotics and synbiotics. Poult Sci. 2017;96:58–64. Funding 14. Fan H, Lv Z, Gan L, Guo Y. Transcriptomics-related mechanisms of The State Key Development Program (2016YFD0501202) supported this study. supplementing laying broiler breeder hens with dietary Daidzein to improve the immune function and growth performance of offspring. J Availability of data and materials Agric Food Chem. 2018;66:2049–60. All data generated or analysed during this study are available from the 15. Robitaille L, Hoffer LJ. A simple method for plasma total vitamin C analysis corresponding author by request. The datasets supporting the conclusions of suitable for routine clinical laboratory use. Nutr J. 2016;15:40. this article are included in the article. 16. Amano A, Aigaki T, Maruyama N, Ishigami A. Ascorbic acid depletion enhances expression of the sodium-dependent vitamin C transporters, Authors’ contributions SVCT1 and SVCT2, and uptake of ascorbic acid in livers of SMP30/GNL The authors’ responsibilities were as follows—YMG: designed the research, knockout mice. Arch Biochem Biophys. 2010;496:38–44. interpreted the data, and had primary responsibility for the final content; 17. Chatterjee IB, Chatterjee GC, Ghosh NC, Ghosh JJ, Guha BC. Biological LPG: carried out the animal experiment, performed sample analysis and synthesis of L-ascorbic acid in animal tissues: conversion of L-gulonolactone wrote the manuscript; HF: assisted with sample collection and data analysis; into L-ascorbic acid. Biochem J. 1960;74:193–203. Gan et al. Journal of Animal Science and Biotechnology (2018) 9:71 Page 12 of 12 18. Hooper CL, Maurice DV, Lightsey SF, Toler JE. Factors affecting ascorbic acid biosynthesis in chickens. I. Adaptation of an assay and the effect of age, sex, and food deprivation. J Anim Physiol Anim Nutr. 2000;84:48–56. 19. Ching S, Mahan DC, Moreau R, Dabrowski K. Modification of analytical procedures for determining vitamin C enzyme (L-gulonolactone oxidase) activity in swine liver. J Nutr Biochem. 2003;14:139–46. 20. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 2001;25:402–8. 21. Li C, Guo S, Zhang M, Gao J, Guo Y. DNA methylation and histone modification patterns during the late embryonic and early postnatal development of chickens. Poult Sci. 2015;94:706–21. 22. Figueroa-Méndez R, Rivas-Arancibia S. Vitamin C in health and disease: its role in the metabolism of cells and redox state in the brain. Front Physiol. 2015;6:397. 23. Zannoni V, Lynch M, Goldstein S, Sato P. A rapid micromethod for the determination of ascorbic acid in plasma and tissues. Biochem Med. 1974;11:41–8. 24. Dabrowski K, Hinterleitner S. Applications of a simultaneous assay of ascorbic acid, dehydroascorbic acid and ascorbic sulphate in biological materials. Analyst. 1989;114:83–7. 25. Hooper CL, Maurice DV, Lightsey SF, Toler JE. Factors affecting ascorbic acid (AsA) biosynthesis in chickens. II.Effect of dietary AsA and strain of chicken. J Anim Physiol Anim Nutr. 2002;86:326–32. 26. Maurice DV, Lightsey SF, Abudabos A, Toler JE. Factors affecting ascorbic acid biosynthesis in chickens. III. Effectof dietary fluoride on L-gulonolactone oxidase activity and tissueascorbic acid (AsA) concentration. J Anim Physiol Anim Nutr. 2002;86:383–8. 27. Kuo S-M, Tan C-H, Dragan M, Wilson JX. Endotoxin increases ascorbate recycling and concentration in mouse liver. J Nutr. 2005;135:2411–6. 28. Corpe CP, Tu H, Eck P, Wang J, Faulhaber-Walter R, Schnermann J, et al. Vitamin C transporter Slc23a1 links renal reabsorption, vitamin C tissue accumulation, and perinatal survival in mice. J Clin Invest. 2010;120:1069–83. 29. Aumailley L, Warren A, Garand C, Dubois MJ, Paquet ER, Le Couteur DG, et al. Vitamin C modulates the metabolic and cytokine profiles, alleviates hepatic endoplasmic reticulum stress, and increases the life span of Gulo −/− mice. Aging. 2016;8:458–83. 30. Iwama M, Amano A, Shimokado K, Maruyama N, Ishigami A. Ascorbic acid levels in various tissues, plasma and urine of mice during aging. J Nutr Sci Vitaminol. 2012;58:169–74. 31. Uchio R, Hirose Y, Murosaki S, Yamamoto Y, Ishigami A. High dietary intake of vitamin C suppresses age-related thymic atrophy and contributes to the maintenance of immune cells in vitamin C-deficient senescence marker protein-30 knockout mice. Br J Nutr. 2015;113:603–9. 32. Ichiyama K, Mitsuzumi H, Zhong M, Tai A, Tsuchioka A, Kawai S, et al. Promotion of IL-4- and IL-5-dependent differentiation of anti-mu-primed B cells by ascorbic acid 2-glucoside. Immunol Lett. 2009;122:219–26. 33. Mohammed BM, Fisher BJ, Huynh QK, Wijesinghe DS, Chalfant CE, Brophy DF, et al. Resolution of sterile inflammation: role for vitamin C. Mediat Inflamm. 2014;2014:173403. 34. Manning J, Mitchell B, Appadurai DA, Shakya A, Pierce LJ, Wang H, et al. Vitamin C promotes maturation of T-cells. Antioxid Redox Signal. 2013;19:2054–67. 35. Chen Q, Ross AC. Retinoic acid promotes mouse splenic B cell surface IgG expression and maturation stimulated by CD40 and IL-4. Cell Immunol. 2007;249:37–45. 36. Wu CC, D T, Lin TL. Effect of ascorbic acid supplementation on the immune response of chickens vaccinated and challenged with infectious bursal disease virus. Vet Immunol Immunopathol. 2000;74:145–52. 37. Linster CL, Van Schaftingen E, Vitamin C. Biosynthesis, recycling and degradation in mammals. FEBS J. 2007;274:1–22.

Journal

Journal of Animal Science and BiotechnologySpringer Journals

Published: Oct 1, 2018

References