Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/springer-journals/characterisation-ofescherichia-coli-isolated-from-raw-milk-cheeses-fGrcEOrZTr
- Publisher
- Springer Journals
- Copyright
- Copyright © 2007 by University of Milan and Springer
- Subject
- Life Sciences; Microbiology; Microbial Genetics and Genomics; Microbial Ecology; Fungus Genetics; Medical Microbiology; Applied Microbiology
- ISSN
- 1590-4261
- eISSN
- 1869-2044
- DOI
- 10.1007/BF03175049
- Publisher site
- See Article on Publisher Site
Abstract
Annals of Microbiology, 57 (1) 49-54 (2007) 1 1 2 3 1 1* Miriam ZAGO , Barbara BONVINI , Antonio M. MARTÍN PLATERO , Germano MUCCHETTI , Domenico CARMINATI , Giorgio GIRAFFA 1 2 C.R.A.-Istituto Sperimentale Lattiero-Caseario, Via Lombardo 11, 26900 Lodi, Italy; Department of Microbiology, University of Granada, Avda. Fuentenueva s/n., 18071 Granada, Spain; Department of Industrial Engineering, University of Parma, Parco Area delle Scienze 181/A, 43100 Parma, Italy Received 25 July 2006 / Accepted 28 November 2006 Abstract - The aim of this work was: (i) to verify the level of Escherichia coli in Pannerone and Valtrompia Formaggella, two artisanal Italian raw-milk cheeses ripened for less than 60 days; (ii) to phenotypically and genotipycally type the E. coli isolates; (iii) to detect the presence of E. coli O157:H7 and of intestinal enteropathogenic E. coli by PCR. The levels of E. coli in the cheeses ranged from 3.89 -1 to 8.47 log CFU g . No E. coli O157:H7 was detected in 25 g of cheese. The 76 E. coli strains (68 cheese isolates and 8 reference TM strains) were widely diverse, since a high number of both PCR fingerprinting profiles and PhenePlate phenotypes were shown. Within the 68 cheese isolates, no toxin production and virulence-associated genes were shown by multiplex PCR. Non-pathogenic E. coli were isolated at high levels in raw-milk cheeses, where they may contribute to the development of desirable characteristics of some of these products, e.g. Pannerone. Key words: Escherichia coli, virulence genes, multiplex PCR, raw milk cheeses. INTRODUCTION Kaspar, 1997; CDSC, 1998). Since the presence of VTEC O157 has been reported in cow, goat, and ewe milk Escherichia coli is a common part of the normal facultative (Conedera et al., 2004; Picozzi et al., 2005) and given the anaerobic microflora in the intestinal tract of humans and particular resistance of O157:H7 and other EHEC strains to warm-blooded animals. They are excreted by faeces mak- environmental conditions (especially to low pH values) ing these microorganisms useful indicators of faecal con- (Meng et al., 2001), some milk products may increase the tamination. Most E. coli strains are harmless; however, risk of pathogenic E. coli contamination. many strains (intestinal but also extra intestinal In Italy, some traditional soft cheeses, ripened less pathogens) can cause human diseases. Intestinal patho- than 60 days, are still produced with raw milk. Some of genic E. coli strains are associated with food-borne infec- them, which are characteristics of peculiar areas of pro- tions and have been involved in different disease out- duction, are obtained without the use of lactic acid bacte- breaks (Meng et al., 2001). On the basis of the virulence ria (LAB) starters (Ottogalli et al., 1975; Turi et al., 1997; factors, intestinal pathogenic E. coli can be divided into Grassi et al., 2002). On the other side, growth and meta- enteropathogenic (EPEC), enterotoxigenic (ETEC), bolic activities linked to gas and aroma formation by col- enteroinvasive (EIEC), diffuse-adhering (DAEC), enteroag- iforms and non-pathogenic E. coli have been considered gregative (EAEC), enterohemorrhagic (EHEC), and verocy- elements of typicality (Ottogalli et al., 1975; Addeo and totoxigenic/shigatoxigenic (VTEC/STEC) (Meng et al., Coppola, 1983). The EEC Council Directive 92/46 intro- -1 2001; Mainil and Daube, 2005). Particular attention is paid duced maximum E. coli levels of 5.0 log CFU g for raw- to VTEC infections because of the risk of haemolytic milk cheeses and stated that, once the above limits were uraemic syndrome (HUS). In Italy, the mean annual inci- exceeded, the absence of pathogenic E. coli should be ver- dence of HUS in young people from 1988 to 2000 was 0.28 ified. The new EC Commission Regulation 2005/2073 did per 100,000 population, and the most frequent serogroup not confirm the former limit for the raw milk cheeses, was O157, although other serogroups were found to be excluding the control of the presence of E. coli in raw milk involved in a considerable number of cases (Tozzi et al., cheeses from the criteria provided. However, the absence 2003). Several examples of EHEC and VTEC/STEC out- of pathogenic bacteria and/or their toxins is an obvious breaks associated with raw foods of animal origin (espe- safety criterion. cially meat products) and vegetables have been reported Our work had different objectives: (i) to verify the level (Meng et al., 2001; Mainil and Daube, 2005). Milk and milk of E. coli in Pannerone and Valtrompia Formaggella, two products have been involved in few cases (Ansay and artisanal Italian raw-milk cheeses ripened for less than 60 days; (ii) to phenotypically and genotypically type 68 E. coli strains isolated; and (iii) to detect the presence of E. coli O157:H7 and of intestinal enteropathogenic E. coli by * Corresponding author. Phone: +39-037145011; Fax: +39-037135579; E-mail: ggiraffa@ilclodi.it PCR. 50 M. Zago et al. MATERIALS AND METHODS Strain typing. All strains were typed both phenotypically and genotypically. Phenotyping was made by the TM Cheese manufacture and characteristics. Pannerone is PhenePlate system for E. coli (PhP-EC, PhPPlate an unsalted semi-hard (Moisture Free Fat basis = 62%) Microplate Techniques AB, Stockholm, Sweden), which is cheese from the Lodi province, in the Po Valley (Italy). It is based on the different kinetics of sugar fermentation produced with raw not refrigerated milk from one milking, between different strains. After reading all plates with the without starter addition, coagulated at 30 °C with calf ren- flatbed scanner (Scanjet 7400C, Hewlett Packard Italia, net. The curd is manually moulded and the acidification Milano, Italy), images of PhP-EC profiles were saved in process takes place in a warm cellar at 30 ± 2 °C for 4-5 d. .bmp format. Genotyping was carried out by PCR finger- The cheese is then transferred to a cold store at 4 °C and, printing, using as a primer the M13 minisatellite core th within the 8 day from cheese making, is ready to eat. Shelf sequence (Huey and Hall, 1989). Genomic DNA was life is about 30-40 d. Valtrompia Formaggella is a soft extracted by a chelex-based procedure according to the TM cheese (MFFb = 67%) from the mountains of Trompia method described in the MicroSeq protocol (Applera Valley in Lombardy (Italy). It is produced with raw milk from Italia, Monza, Italy). Thermal cycling parameters and other one or two milking, sometimes partially skimmed by natu- PCR conditions were similar to those previously described ral creaming, without starter addition, coagulated at 36 °C (Giraffa et al., 2000). PCR profiles were visualised after -1 with calf rennet. The curd is cooked at 40-42 °C and, after overnight electrophoresis (1.5 V cm ) in agarose gels -1 dry salting, the cheese is ripened for 10 to 20 d. This two (1.5% w vol l ; Celbio, Milano, Italy) and staining with cheeses could belong to the class C of the group Formatica ethidium bromide. One-kb plus DNA Ladder (Invitrogen, according to the cheese classification of Ottogalli (Ottogalli, Milano, Italy) was used as a DNA molecular weight mark- 2000) even if Pannerone and Valtrompia Formaggella have er. The reproducibility of the PCR fingerprinting patterns peculiar technology processes as described above. were evaluated by repeatedly running DNA samples of the type strain E. coli ATCC 11775 . The images of the RAPD- Sampling and microbiological analysis. Six Pannerone PCR gels were captured using the Kodak Electrophoresis cheeses (10-12 kg of weight), which were representatives Documentation and Analysis System 290 (EDAS 290, of different batches, were purchased at different times from Celbio) equipped with the EDAS 290 imaging cabinet, and the retail store of the producer. One Pannerone cheese was saved as TIFF files. Both gel images and PhP-EC profiles experimentally produced in the cheese factory of CRA-ISLC were exported into the pattern analysis software package TM following the same technology. Three Formaggella cheeses BioNumerics (version 3.0; Applied Maths BVBA, Sint- (about 2 kg of weight) of different brands were purchased Martens-Latem, Belgium) for processing. Calculation of from a store in the Trompia Valley. Cheese samples (10 g) similarity of PCR fingerprinting profiles was based on the were homogenized with 90 ml of a sterile 2% sodium citrate Pearson product-moment correlation coefficient. The iden- solution by means of a Stomacher 400 Circulator (Seward tity level of the PCR fingerprints was set at a similarity level Laboratory, London, England). Decimal dilutions were pre- of 82%, which corresponded to the experimental repro- pared in Ringer solution and pour-plated in duplicate for ducibility of the technique. Identity level of PhP-EC profiles microbial enumerations. was set at 97% similarity as suggested by the PhPwin4 Escherichia coli counts were determined in Coli ID agar software (PhPPlate Microplate Techniques AB) and verified (BioMérieux Italia, Rome, Italy) at 37 °C for 24 h according in our study. Dendrograms were deduced from the matrix to manufacturer instructions. Escherichia coli was discrimi- of similarities by the unweighted pair group method using nated from total coliforms by their different chromogenic arithmetic average (UPGMA) clustering algorithm (Vauterin characteristics in this medium. Lactic acid bacteria (LAB) and Vauterin, 1992). counts were determined both in MRS agar (Merck, Darmstadt, Germany) and M17 agar (Scharlau Chemie, Detection of virulence genes. Two previously described Barcelona, Spain) at 37 °C for 24-48 h. The detection of E. multiplex PCR assays were applied. The three primer sets coli O157:H7 was carried out through selective enrichment of described by Wang et al. (2002) were used to simultane- 25 g of sample in modified Tryptone Soya Broth medium ously detect internal fragments of the genes encoding the E. (mTSB; Oxoid, Garbagnate Milanese, Italy) supplemented coli somatic antigen O157, the E. coli structural flagella anti- -1 with novobiocin 20 mg l (41 °C for 24 h) followed by streak- gen H7, and the enterohaemorrhagic E. coli haemolysin ing on O157:H7 ID agar (BioMérieux) at 37 °C for 24 h. (EHEC hlyA). For ETEC, EIEC, EPEC, and VTEC strains, the primer sets described by Toma et al. (2003) were applied. Escherichia coli strains, media, and growth condi- Table 3 summarizes the primer sequences, the target tions. Sixty-eight E. coli isolates, 46 from Pannerone and genes, their corresponding pathotypes, and the expected 22 from Formaggella, were studied (Table 1). Presumptive amplicon size. colonies of E. coli were isolated from the Coli ID agar plates used to enumerate total coliforms and E. coli. The isolates were confirmed as E. coli after biochemical identification RESULTS AND DISCUSSION with the API 20E system (BioMérieux). Eight reference strains from various collections (Table 2) were also included The Italian raw-milk cheeses studied contained high levels and used as positive controls in the PCR tests (see below) of both LAB and E. coli, underlining the high presence of E. (Strain DSM 9025 indicated as H- by DSMZ, has been coli in the analysed raw milk cheeses. The levels of pre- ascribed to H7 serotype with these PCR primers). The cul- sumptive E. coli in the ten raw milk cheese samples inves- tures were maintained at –80 °C in TSB supplemented with tigated ranged from 3.89 ± 0.01 to 8.47 ± 0.12 log CFU -1 15% (v /v) glycerol, and were revitalized in the same medi- g (Table 1). Seventy suspect colonies were randomly iso- um by overnight growth at 37 °C. lated from plates of Coli ID agar and, after API identifica- Ann. Microbiol., 57 (1), 49-54 (2007) 51 TABLE 1 - Counts of lactic acid bacteria (LAB) at 37 °C and Escherichia coli in the raw milk cheeses. Mean values (± standard deviation) are indicated. Identification codes of E. coli cheese isolates are reported Sample* Cheese LAB at 37 °C Escherichia coli -1 denomination (log CFU g ) -1 (log CFU g ) Code of cheese isolates 1 Pannerone 8.33 ± 0.03 5.22 ± 0.06 1046, 1047, 1050, 1051, 1052, 1053, 1054 2 Pannerone 8.25 ± 0.02 3.92 ± 0.03 1048, 1049, 1055, 1056, 1057, 1058, 1059 3 Pannerone 7.70 ± 0.03 5.96 ± 0.08 1083, 1084, 1085, 1086, 1087, 1088, 1095, 1096 4 Pannerone 7.81 ± 0.03 6.10 ± 0.03 1089, 1090, 1091, 1092, 1093, 1094 5 Pannerone 7.86 ± 0.03 3.89 ± 0.01 1159, 1160, 1161, 1162, 1163 6 Pannerone 7.90 ± 0.06 4.56 ± 0.00 1164, 1165, 1166, 1167 7 Valtrompia 8,28 ± 0.01 4.31 ± 0.01 1147, 1148, 1235, 1236, 1237, 1238, 1239 8 Valtrompia 8.02 ± 0.02 5.47 ± 0.02 1218, 1219, 1240, 1241, 1242, 1243, 1244 9 Valtrompia 7.78 ± 0.03 5.11 ± 0.10 1220, 1221, 1222, 1245, 1246, 1247, 1248, 1249 10* Pannerone 7.90 ± 0.06 8.47 ± 0.12 1250, 1253, 1254, 1255, 1256, 1257, 1258, 1259, 1260 * Pannerone of sample 10 was produced in our dairy plant. tion, 68 resulted as E. coli and two were ascribed to the twice that of the genotypes (41 clusters) (Fig. 1). In most genus Klebsiella. cases, this enabled us to obtain a better strain discrimina- The 76 E. coli strains studied (the 68 cheese isolates and tion. Generally, the strains showing single genotype showed eight reference strains) were genotypically and phenotypi- also single phenotype, whereas the strains falling into the cally characterised. Twenty distinct RAPD-PCR clusters were same genotype were subdivided into different phenotypes. formed at a similarity level of 82% (Fig. 1). Some peculiar In only one occasion, genotyping was more discriminatory E. coli strains becoming dominant within all the cheeses than phenotyping; strains 1159 and 1163, isolated from the were evidenced (e.g. strains isolated from different samples same sample (sample 9) of Pannerone cheese, both showed but with similar profile were evidenced in A, C, D, F RAPD- the phenotype ‘ap’ but were grouped into RAPD-PCR clus- PCR biotype). In particular, one biotype (corresponding to ters F and A, respectively (Fig. 1). Similarly to PCR finger- RAPD-PCR profile A) was the most frequent since it was iso- printing, the same phenotypes were found within all the lated from seven out of the 10 cheese samples analysed. cheeses; collection or reference strains did not cluster The ETEC strain E. coli DSM 10973 was the only reference together with cheese isolates. strain included into this cluster, whereas the other seven Multiplex PCR confirmed that no E. coli O157:H7 strains reference strains did not group with these cheese isolates were detected within the 68 cheese isolates, in fact all (Fig. 1). On the other hand only a minority of clusters these isolates resulted negative for the presence of the showed the presence of strains isolated from the same sam- genes coding for the somatic antigen O157 and structural ple (e.g. clusters E, G and T that grouped only strains com- flagella antigen H7 (data not shown). Moreover, no other ing respectively from samples 2, 9 and 3). pathogenic E. coli were recovered in the analysed cheeses The E. coli isolates were phenotypically typed by the by means of the classical methods of selective enrichment TM PhenePlate system, which is based on the different kinet- culture and multiplex PCR technique. These data match the ics of sugar fermentation. At a similarity level of 97% (sug- survey accomplished by Conedera et al. (2004) in dairy gested by the software), the number of phenotypes was products. TABLE 2 - PCR control strains of Escherichia coli used in this study Escherichia coli Serogroup Description strain code* O157 H7 EHEC ETEC EIEC5 EPEC STEC (somatic (structural (haemolysin) (heat-labile (Invasion (entero- (Shiga-like antigen) flagella enterotoxin) plasmid aggregative toxin) antigen) antigen H) protein) ATCC 11775 O1:K1:H7 + DSM 8696 O55:H6 + DSM 9025 O28:ac:H- + + DSM 10234 O111:K58:H- + DSM 10973 O6 + IZSLER 381 O157:H7 + + + + + ATCC 35150 O157:H7 + + + + + ATCC 43894 O157:H7 + + + + + * DSM: German National Resource Centre for Biological Material; ATCC: American Type Culture Collection; IZSLER: Istituto Zooprofilattico Sperimentale Lombardia-Emilia Romagna. 52 M. Zago et al. Correlation coefficient (%) Strain Cheese Cheese RAPD-PCR PhenePlate number type sample cluster cluster 80 100 90 1258 Pannerone-like cheese 10 ae 1259 Pannerone-like cheese 10 ae 1162 Pannerone cheese 5 i 1236 Val Trompia cheese 7 i 1238 Val Trompia cheese 7 i 1239 Val Trompia cheese 7 i 1256 Pannerone-like cheese 10 ah 1257 Pannerone-like cheese 10 ae 1250 Pannerone-like cheese 10 ae 1253 Pannerone-like cheese 10 d 1254 Pannerone-like cheese 10 d 1255 Pannerone-like cheese 10 d 1260 Pannerone-like cheese 10 d 1050 Pannerone cheese 1 an 1051 Pannerone cheese 1 l 1161 Pannerone cheese 5 aq 1163 Pannerone cheese 5 ap 1147 Val Trompia cheese 7 i 1148 Val Trompia cheese 7 i 1083 Pannerone cheese 3 am 1164 Pannerone cheese 6 al 1047 Pannerone cheese 1 al 1089 Pannerone cheese 4 ae 1056 Pannerone cheese 2 ai 1092 Pannerone cheese 4 ae ae 1093 Pannerone cheese 4 1091 Pannerone cheese 4 ae 1094 Pannerone cheese 4 ae 1090 Pannerone cheese 4 af 1237 Val Trompia cheese 7 o 10973 DSM at 1057 Pannerone cheese 2 m 1247 Val Trompia cheese 9 ar 1059 Pannerone cheese 2 ag 1160 Pannerone cheese 5 d 1046 Pannerone cheese 1 f 1088 Pannerone cheese 3 f 1243 Val Trompia cheese 8 f 1049 Pannerone cheese 2 e 1048 Pannerone cheese 2 n 1058 Pannerone cheese 2 n 1052 Pannerone cheese 1 ao 1159 Pannerone cheese 5 ap 1166 Pannerone cheese 6 ao 1167 Pannerone cheese 6 ao 1242 Val Trompia cheese 8 i 1246 Val Trompia cheese 9 u 1221 Val Trompia cheese 9 u 1245 Val Trompia cheese 9 u 1249 Val Trompia cheese 9 e 1220 Val Trompia cheese 9 e 1248 Val Trompia cheese 9 e 1222 Val Trompia cheese 9 e 1055 Pannerone cheese 2 H v 9025 DSM av 1054 Pannerone cheese 1 g 11775 ATCC L ad 1085 Pannerone cheese 3 aa 1240 Val Trompia cheese 8 ab 1241 Val Trompia cheese 8 ab 1244 Val Trompia cheese 8 ab 1218 Val Trompia cheese 8 N ab 1084 Pannerone cheese 3 r 1087 Pannerone cheese 3 p 1165 Pannerone cheese 6 O h 1086 Pannerone cheese 3 z 1053 Pannerone cheese 1 ac 10234 DSM b 8696 DSM c 35150 ATCC a 43894 ATCC a 381 ISZLER au 1095 Pannerone cheese 3 s 1096 Pannerone cheese 3 t 1219 Val Trompia cheese 8 U q 1235 Val Trompia cheese 7 as FIG. 1 - Cluster analysis of RAPD-PCR patterns of Escherichia coli isolated from different cheeses. Clustering was performed by an unweighted pair group method with an arithmetic average (UPGMA) of Pearson product moment correlation coefficient (expressed as a percentage value). The horizontal axis in the dendrogram shows the similarities between the isolates, and the vertical dotted line indicates that the identity level is set at of 82% correlation coefficient (minimum level of reproducibility). On the right hand side of the figure are reported the strain numbers of both cheese isolates and reference strains, the cheese denomination, the cheese sample (for an explanation, see Table 1), the labelling of the RAPD-PCR clusters, and the labelling of the PhenePlate clusters. These latter were obtained as described previously (see Materials and methods). Ann. Microbiol., 57 (1), 49-54 (2007) 53 TABLE 3 - PCR primers used to amplify internal fragments of the reported target genes Designation Sequence (5’ to 3’) Target gene Pathotype Amplicon size Reference (bp) HlyA-a AGCTGCAAGTGCGGGTCTG hlyA EHEC 569 Wang et al., 2002 HlyA-b TACGGGTTATGCCTGCAAGTTCAC RfbE- a CTACAGGTGAAGGTGGAATGG rfbE 0157 327 Wang et al., 2002 O157 RfbE-b ATTCCTCTCTTTCCTCTGCGG FliC-a TACCATCGCAAAAGCAACTCC FliC H7 247 Wang et al., 2002 H7 FliC-b GTCGGCAACGTTAGTGATACC AL65 TTAATAGCACCCGGTACAAGCAGG est ETEC 147 Toma et al., 2003 AL125 CCTGACTCTTCAAAAGAGAAAATTAC LT TCTCTATGTGCATACGGAGC elt ETEC 322 Toma et al., 2003 LT CCATACTGATTGCCGCAAT ipaIII GTTCCTTGACCGCCTTTCCGATACCGTC ipaH EIEC 619 Toma et al., 2003 ipaIV GCCGGTCAGCCACCCTCTGAGAGTAC SK1 CCCGAATTCGGCACAAGCATAAGC eae EPEC 881 Toma et al. 2003 SK2 CCCGGATCCGTCTCGCCAGTATTCG VTcom-u GAGCGAAATAATTTATATGTG stx STEC 518 Toma et al., 2003 VTcom-d TGATGATGGCAATTCAGTAT Raw-milk cheeses, particularly soft and semi-soft Acknowledgements cheeses, have been associated with pathogenic E. coli out- This work was partially supported by the Lombardy region through a research program (FORTISI), which is adminis- breaks (Altekruse et al., 1998; CDSC, 1998, 1999; Anonymous, 2000; Honish et al., 2005). In these cheeses, tered by the Agricultural Research Service. coliforms and non-pathogenic E. coli are secondary but con- stant, and often important components of the microflora, REFERENCES however potentially hazardous E. coli have not usually been found (Frank and Marth, 1978; Aureli et al., 1992; Ansay Addeo F., Coppola S. (1983). Aspetti tecnologici e microbiologici and Kaspar, 1997; Zarate et al., 1997; Coia et al., 2001; De della trasformazione del latte di bufala in mozzarella e ricot- Reu et al., 2002; Foschino et al., 2002). The cheese sam- ta. Il Latte, 8: 706-723. ples analysed in the present study contained high numbers Altekruse S.F., Timbo B.B., Mowbray J.C., Bean N.H., Potter M.E. of LAB and E. coli. Sixty percent of the cheeses showed lev- (1998). Cheese-associated outbreaks of human illness in the -1 els of E. coli higher than 5.0 log CFU g . United States, 1973-1992: sanitary manufacturing practices protect consumers. J. Food Prot., 61: 1405-1407. Isolates of E. coli were genotypically and phenotypically TM Anonymous (2000). Outbreak of Escherichia coli O157:H7 analysed with RAPD-PCR and the PhenePlate system. This Infection Associated With Eating Fresh Cheese Curds - latter is a very efficient and widely applied strain typing Wisconsin, June 1998. Morbility Mortality Weekly Reports, 49 method (Iversen et al., 2002). The combined application of (40): 911-913. Available from: the two methods allowed a better strain differentiation, due http://www.cdc.gov/mmwr/PDF/wk/mm4940.pdf to the higher discriminatory power of the PhenePlate typing. Ansay S.E., Kaspar C.W. (1997). Survey of retail cheeses, dairy The isolates belonged to several clonal groups, which rarely processing environments and raw milk for Escherichia coli O157:H7. Lett. Appl. Microbiol., 25: 131-134. were associated with a particular cheese type or sample, showing that some strains become dominant in the cheese Aureli P., Costantini A., Fenicia L., Gianfranceschi M., Rainaldi L. (1992). Occurrence of pathogenic Escherichia coli in available independently from the technology applied. Italian soft cheeses. Arch. Lebensmittelhyg., 43: 1-24. In conclusion, non-diarrheagenic E. coli were present at CDSC (1998). Cases of Escherichia coli O157 infection associated high levels in many raw-milk cheeses where they may con- with unpasteurised cream in England. Eurosurveillance tribute, together with many other bacteria, to the develop- Weekly Release, 10 (43) 981022. Available from: ment of desirable characteristics for some of these products http://www.eurosurveillance.org/ew/1998/981022.asp#3 (e.g. Pannerone). This “wild” microbiota, well adapted to the CDSC (1999). Escherichia coli O157 associated with eating cheese environment, may play a role in preventing survival unpasteurised cheese. Communication Disease Weekly Reports, 9: 113, 116. Available from: and multiplication of pathogenic strains in cheese (Conedera http://www.hpa.org.uk/cdr/archives/CDR99/cdr1399.pdf et al., 2004). The finding of E. coli strains with similar geno- Coia J.E., Johnston Y., Steers N.J., Hanson M.F. (2001). A survey typic and phenotypic pattern across the different cheeses of the prevalence of Escherichia coli O157 in raw meats, raw analysed and the different patterns between cheese isolates cow’s milk and raw-milk cheeses in south-east Scotland. Int. and diarrheagenic strains may support this statement. J. Food Microbiol., 66: 63-69. Another proof of evidence comes from literature data and Commission Regulation (EC) No 2073/2005 of 15 November 2005 concerns the lack of correlation between the presence of on microbiological criteria for foodstuffs. Official Journal of the pathogenic E. coli in raw milk and its recovery from cheese. European Union. 54 M. Zago et al. Conedera G., Dalvit P., Martini M., Galier, G., Gramaglia M., Ottogalli G., Galli A., Rondinini G., Volonterio G. (1975). La micro- Goffredo E., Loffredo G., Morabito S., Ottavini D., Paterlini F., biologia del formaggio Pannerone. Ind. Latte, 11 (1): 7-17. Pezzetti G., Pisanu M., Semprini P., Caprioli A. (2004). Ottogalli G. (2000). A global comparative method for the classifi- Verocytotoxin-producing Escherichia coli O157 in minced beef cation of world cheeses (with special reference of microbio- and dairy products in Italy. Int. J. Food Microbiol., 96: 67-73. logical criteria). Revised Edition. Annals of Microbiology, 50: De Reu K., Debeuckelaere W., Botteldoorn N., De Block J., 151-155. Herman L. (2002). Hygienic parameters, toxins and pathogen Picozzi C., Foschino R., Heuvelink A., Beumer R. (2005). occurrence in raw milk cheeses. J. Food Safety, 22: 183-196. Phenotypic and genotypic characterization of sorbitol-nega- Foschino R., Invernizzi A., Barucco R., Stradiotto K. (2002). tive or slow-fermenting (suspected O157) Escherichia coli iso- Microbial composition, including the incidence of pathogens, lated from milk samples in Lombardy region. Lett. Appl. of goat milk from the Bergamo region of Italy during a lacta- Microbiol., 40: 491-496. tion year. J. Dairy Res., 69: 213-225. Toma C., Lu Y., Higa N., Nakasone N., Chinen I., Baschkier A., Frank J.F., Marth E.H. (1978). Survey of soft and semisoft cheese Rivas M., Iwanaga M. (2003). Multiplex PCR assay for identi- for presence of fecal coliforms and serotypes of enteropatho- fication of human diarrheagenic Escherichia coli. J. Clin. genic Escherichia coli. J. Food Prot., 41: 198-200. Microbiol., 41: 2669-2671. Giraffa G., Rossetti L., Neviani E. (2000). An evaluation of chelex- Tozzi A.E., Caprioli A., Minelli F., Gianviti A., De Petris L., Edefonti based DNA purification protocols for the typing of lactic acid A., Montini G., Ferretti A., De Palo T., Gaido M., Tizzoni G. bacteria. J. Microbiol. Meth., 42: 175-184. (2003). Shiga toxin-producing Escherichia coli infections associated with hemolytic uremic syndrome, Italy, 1988- Grassi M.A., Civera T., Pattono D., Turi R.M. (2002). 2003. Emerg. Infect. Dis., 9: 106-108. Caratteristiche microbiologiche della Robiola di Roccaverano. Ind. Alim., 41: 1321-1327. Turi R.M., Giaccone V., Colavita G., Sacchi P., Cauvin E., Rasero R. (1997). Analisi microbiologica di un caratteristico formag- Honish L., Predy G., Hislop N., Kowalewska-Grochowska K., gio a pasta molle: la “Robiola delle Langhe”. Riv. Sci. Alim., Trottier L., Kreplin C., Zazulak I. (2005). An outbreak of 26 (1): 7-12. Escherichia coli O157:H7 hemorrhagic colitis associated with unpasteurized Gouda cheese. Can. J. Pub. Health, 96: 182- Vauterin L., Vauterin P. (1992). Computer aided objective com- 184. parison of electrophoresis patterns for grouping and identifi- cation of microorganisms. Eur. Microbiol., 1: 37-41. Huey B., Hall J. (1989). Hypervariable DNA fingerprinting in E. coli. minisatellite probe from bacteriophage M13. J. Bacteriol., Wang G., Clifford G.C., Rodgers F.G. (2002). Detection in 171: 2528-2532. Escherichia coli of the genes encoding the major virulence factors, the genes defining the O157:H7 serotype, and com- Iversen A., Kuhn I., Franklin A., Mollby R. (2002). High preva- ponents of the type 2 Shiga toxin family by multiplex PCR. J. lence of vancomycin-resistant enterococci in Swedish sewage. Clin. Microbiol., 40: 3613-3619. Appl. Environ. Microbiol., 68: 2838-2842. Zarate V., Belda F., Perez C., Cardell E. (1997). Changes in the Mainil J.G., Daube G. (2005). Verotoxigenic Escherichia coli from microbial flora of Tenerife goat’s milk cheese during ripening. animals, humans and foods: who’s who? J. Appl. Microbiol., Int. Dairy J., 7: 635-641. 98: 1332-1344. Meng J., Doyle M.P., Zhao T., Zhao S. (2001). Enterohemorrhagic Escherichia coli. In: Doyle, M.P., Beuchat, L.R., Montville, T.J., Eds, Food Microbiology: Fundamentals and Frontiers. ASM Press, Washington, pp. 193-213.
Journal
Annals of Microbiology – Springer Journals
Published: Nov 20, 2009