Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Chromosomal Location of HWA1 and HWA2, Complementary Hybrid Weakness Genes in Rice

Chromosomal Location of HWA1 and HWA2, Complementary Hybrid Weakness Genes in Rice Rice (2011) 4:29–38 DOI 10.1007/s12284-011-9062-2 Chromosomal Location of HWA1 and HWA2, Complementary Hybrid Weakness Genes in Rice Katsuyuki Ichitani & Satoru Taura & Takahiro Tezuka & Yuuya Okiyama & Tsutomu Kuboyama Received: 2 April 2011 /Accepted: 9 June 2011 /Published online: 24 June 2011 Springer Science+Business Media, LLC 2011 Abstract Hybrid weakness phenomena in rice reportedly Introduction have two causes: those of HWC1 and HWC2 genes and those of HWA1 and HWA2 genes. No detailed study of the Many postzygotic reproductive barrier forms have been latter has been reported. For this study, we first produced reported in rice (Oryza sativa), such as hybrid weakness crosses among cultivars carrying the weakness-causing (e.g., Oka 1957), hybrid pollen sterility (e.g., Long et al. allele on the HWA1 and HWA2 loci to confirm the 2008), and hybrid sterility causing female gamete abortion phenotype of the hybrid weakness and the genotypes of (e.g., Chen et al. 2008). Among them, hybrid weakness is the cultivars on the two loci, as reported earlier. We then definable as weak growth occurring in F hybrids derived confirmed that these cultivars belong to Indica. Subsequent from crosses between two normal strains. According to its linkage analysis of HWA1 and HWA2 genes conducted degree or symptom, it is also called hybrid lethality, hybrid using DNA markers revealed that both genes are located in abnormality, or hybrid necrosis. Hybrid weakness is also the 1,637-kb region, surrounded by the same DNA markers apparent in many other plant species including Arabidopsis on the long arm of chromosome 11. The possibility of thaliana (Bomblies et al. 2007), Phaseolus vulgaris (Shii et allelic interaction inducing hybrid weakness is discussed. al. 1980), interspecific crosses among Gossypium (Lee 1981), and interspecific crosses among Nicotiana (Tezuka . . Keywords Reproductive barrier Linkage analysis Hybrid et al. 2007). weakness Varietal differentiation In rice, two hybrid weakness phenomena from different intraspecific cross combinations have been reported: one by K. Ichitani (*) Oka (1957) and the other by Amemiya and Akemine (1963). Faculty of Agriculture, Kagoshima University, The hybrid weakness reported by Oka (1957)resulted from 1-21-24 Korimoto, use of a set of complementary dominant genes: L and L . 1 2 Kagoshima, Kagoshima 890–0065, Japan They were renamed L-1-a and L-1-b by Kinoshita (1984); e-mail: ichitani@agri.kagoshima-u.ac.jp then Hwa-1 and Hwa-2 by Sato et al. (1987). According to S. Taura the new gene nomenclature system for rice (McCouch and Institute of Gene Research, Kagoshima University, Committee on Gene Symbolization, Nomenclature and 1-21-24 Korimoto, Linkage, Rice Genetics Cooperative (CGSNL) 2008), the Kagoshima, Kagoshima 890–0065, Japan new gene symbols HWA1 and HWA2 are used respectively T. Tezuka for reference to Hwa-1 and Hwa-2, as presented in Table 1. Graduate School of Life and Environmental Sciences, The latter phenomenon results from the use of a set of Osaka Prefecture University, complementary dominant genes: Hybrid weakness C1 1–1 Gakuen-cho, Nakaku, Sakai, Osaka 599–8531, Japan (HWC1)and Hybrid weakness C2 (HWC2). We have detected the chromosomal locations of these genes and have Y. Okiyama T. Kuboyama performed fine mapping (Ichitani et al. 2001;Ichitani etal. College of Agriculture, Ibaraki University, 2007;Kuboyama et al. 2009). However, the chromosomal 3-21-1 Chuo, locations of HWA1 and HWA2 have remained unknown. Ami, Ibaraki 300–0393, Japan 30 Rice (2011) 4:29–38 Table 1 Gene symbols frequently used in this study according to the new gene nomenclature system for rice (McCouch and CGSNL 2008) Gene symbol Oka (1957)Kinoshita(1984) Sato et al. (1987) This study Gene full name Carrier of weakness- causing gene Locus/gene HWA1 HYBRID WEAKNESS A1 Dominant allele L L-1-a Hwa-1 Hwa1-1 Hybrid weakness a1-1 P.T.B.10, A.D.T.4, A.D.T.14, M.T.U.9, P.T.B.8 Recessive allele + + Hwa-1 hwa1-2 hybrid weakness a1-2 Locus/gene HWA2 HYBRID WEAKNESS A2 Dominant allele L L-1-b Hwa-2 Hwa2-1 Hybrid weakness a2-1 P.T.B.7, accession 418 Recessive allele + + Hwa-2 hwa2-2 hybrid weakness a2-2 According to Oka (1957), hybrids carrying both Hwa1-1 Results and Hwa2-1 showed the following symptoms: germination and growth in the seedling stage were quite normal until the Confirmation of the experiment by Oka (1957) seedlings had developed three to four leaves, at which time growth stopped and the leaves yellowed. The phenotype Indian cultivars carrying Hwa1-1 or Hwa2-1 gene, P.T.B.10, differs considerably from that of hybrids carrying both P.T.B.7, and A.D.T.14, were provided by the Genebank of Hwc1-1 and Hwc2-1, of which the symptoms are charac- the National Institute of Agrobiological Sciences, Japan. We terized by root growth inhibition appearing just 5 days after produced crosses among these three cultivars and con- germination (Ichitani et al. 2001; Saito et al. 2007). firmed that the F hybrids from the cross between P.T.B.7 The distribution of Hwa1-1 and Hwa2-1 genes was and P.T.B.10, and those from the cross between P.T.B.7 and limited to some Indian cultivars (Oka 1957). Based on A.D.T.14 showed the weakness symptom, as reported by results of three-way cross combinations, Oka (1957)reported Oka (1957)(Fig. 1). The F hybrids from the cross between that P.T.B.10 (accession 414) and P.T.B.7 (accession 419) P.T.B.10 and A.D.T.14 showed normal growth. These carry Hwa1-1 and Hwa2-1, respectively, whereas Pei-ku results indicate that these Indian cultivars carry one of the (accession 108), Padi ase banda (accession 647), and Kissin hybrid-weakness-causing genes reported by Oka (1957). (accession 521) carry neither Hwa1-1 nor Hwa2-1.Oka Oka (1957) reported that all cultivars related to this (1957) examined many different cultivars for the distribution hybrid weakness belong to Indica. If that is true, then the of these genes. The four Indian cultivars––A.D.T.4 (acces- mapping population of HWA1 and HWA2 should be sion 415), A.D.T.14 (accession 417), M.T.U.9 (accession constructed from the cross between these cultivars and 420), and P.T.B.8 (accession 421)––showed weakness in Japonica cultivars because DNA polymorphism between hybrids with P.T.B.7, indicating that these four cultivars also Indica cultivars and Japonica cultivars is frequently carry Hwa1-1. Actually, accession 418, an Indian cultivar observed. To confirm the classification by Oka (1957), the whose name is unknown, showed weakness in the hybrid three Indian cultivars were compared with 13 reference with P.T.B.10, indicating that accession 418 carries Hwa2-1. cultivars (see Materials and methods for details) with All cultivars relating to this hybrid weakness belong to respect to the banding patterns of polyacrylamide gel Indica. The other cultivars that were examined carry neither electrophoresis of 39 PCR-based insertion/deletion (indel) Hwa1-1 nor Hwa2-1. Information about the gene carriers of markers covering all 12 rice chromosomes (Fig. 2, Table 2). Hwa1-1 and Hwa2-1 is presented in Table 1. The relations among the 16 cultivars were revealed by The molecular mechanism of the hybrid weakness has UPGMA cluster analysis (Fig. 2). The 16 cultivars were remained unknown. Elucidating the mechanism necessitates classified clearly into two groups corresponding to Japonica clarification of the causal genes and their gene products. We and Indica. All cultivars related to this hybrid weakness selected a map-based cloning strategy to identify the two causal belong to Indica, which is consistent with the report by Oka genes. As a starting point of map-based cloning, this report (1957). The Japonica group was divided into temperate describes the chromosomal locations of HWA1 and HWA2 Japonica and tropical Japonica. The four cultivars in genes. It is particularly interesting that both genes are located in temperate Japonica showed the same banding patterns with the 1,637-kb region, surrounded by the same DNA markers on 39 DNA markers, except that J-147 showed a different the long arm of chromosome 11. The possibility of allelic pattern with KGS1797. The three cultivars in tropical interaction inducing hybrid weakness is discussed in this report. Japonica showed the same banding patterns as temperate Rice (2011) 4:29–38 31 cultivars with high frequency (Fig. 2). We selected a Taiwanese temperate Japonica cultivar Taichung 65 (T65) and produced hybrids among the three Indian cultivars and T65 because much polymorphism has been noted among the three Indian cultivars and T65. Furthermore, because it is weakly photoperiod sensitive, hybridization between T65 and other cultivars can be accomplished more easily. All hybrids from crosses between T65 and the three cultivars showed normal growth, indicating that T65 carries neither Hwa1-1 nor Hwa2-1. Then, linkage analysis of HWA1 and HWA2 was conducted using a three-way cross population. For the location of HWA1, the F plants derived from the cross between T65 and P.T.B.10 were crossed with P.T.B.7. The three-way cross population [P.T.B.7×(T65×P.T.B.10)] (n= 176) was divided into 105 weak plants carrying both Hwa1-1 and Hwa2-1, and 71 normal plants carrying only the Hwa2-1 gene. The observed ratio did not fit the expected ratio 1:1 (χ =6.57, P=0.01038). We inferred that the deviation from the expected ratio was probably caused by the linkage between HWA1 gene and gametophytic reproductive barrier gene(s), which is often found in crosses between Indica and Japonica (see Discussion). Six typical weak plants and six typical normal plants were selected from the three-way cross population. They were subjected to preliminary linkage analysis with 83 DNA markers distributed on the whole rice genome (for details, see Materials and methods). A clear linkage was detected between HWA1 and DNA markers on the long arm of Fig. 1 Hybrid weakness caused by two complementary genes: Hwa1- chromosome 11, RM5349 (McCouch et al. 2002), and 1 and Hwa2-1. Seedlings are shown 40 days after sowing date: from RM224 (Chen et al. 1997). Linkage of HWA1 with left to right, P.T.B.10, F derived from the cross between P.T.B.10 and RM5349 and RM224 was confirmed by adding the 82 P.T.B.7, and P.T.B.7. The F 's developed leaves have turned yellow three-way cross plants (Fig. 3). from the tip. Bar shows 10 cm. Along with the mapping of HWA1, linkage analysis of Japonica does with 28 DNA markers. The Indica group was HWA2 was performed using the same strategy. The F divided into two subgroups, with one subgroup comprising plants derived from the cross between T65 and P.T.B.7 IR36, IR24, Guangluai 4, and A.D.T.14, and the other were crossed with A.D.T.14. The three-way cross popula- comprising Kasalath, Kele, Dular, P.T.B.10, and P.T.B.7. tion [A.D.T.14×(T65×P.T.B.7)] (n=175) was divided into Garris et al. (2005) classified 234 rice cultivars into five 110weakplantscarryingboth Hwa1-1 and Hwa2-1,and groups: indica, aus, aromatic, temperate japonica, and 65 normal plants carrying only the Hwa1-1 gene. The tropical japonica. Then IR36 was categorized into indica, observed ratio did not fit the expected ratio 1:1 (χ =11.57, and Kasalath into aus. In the present study, according to P=0.00067), probably because of the reproductive Garris et al. (2005), the subgroup comprising Kasalath and barrier, as described above. Six typical weak plants the other subgroup comprising IR36 will be designated and six typical normal plants that had been selected respectively hereinafter as aus and indica (Fig. 2). Regard- from the three-way cross population were subjected to ing the three cultivars related to this hybrid weakness, A.D. preliminary linkage analysis with 84 DNA markers T.14 was found to belong to indica, whereas P.T.B.7 and P.T. distributed throughout the rice genome (see Materials B.10 belong to aus. and methods), indicating that HWA2 was also linked with RM5349 and RM224. Linkage of HWA2 with RM5349 Mapping of HWA1 and HWA2 and RM224 was confirmed by adding the 84 three-way cross plants (Fig. 3). The three cultivars proved to belong to Indica, as reported We selected seven and eight polymorphic simple by Oka (1957). They showed polymorphism with Japonica sequence repeats (SSR) markers reported by the Interna- 32 Rice (2011) 4:29–38 Fig. 2 Classification of the 1.00 Japonica Indica Indian cultivars carrying Hwa1-1 or Hwa2-1 gene and 13 0.75 reference cultivars into four va- rietal groups based on banding Coefficient patterns of 39 DNA markers temperate tropical 0.50 indica aus covering all 12 rice chromo- Japonica Japonica somes. DNA markers with an 0.25 asterisk (*) were developed by RGP (http://rgp.dna.affrc.go.jp/ E/publicdata/caps/index.html); 0.00 those without an asterisk were developed in this study (Table 2). The same banding patterns as Nipponbare are indi- cated as solid rectangles. Other patterns are shown as open and shaded rectangles. Shown above are genetic relations among the 16 cultivars obtained using UPGMA cluster analysis. Each fragment size of the 39 markers was treated as a unique charac- teristic and scored as present (1) or absent (0). The data matrix was used to calculate genetic similarities using the Jaccard (1908) coefficient. tional Rice Genome Sequencing Project (IRGSP) (2005), indel between Nipponbare and Kasalath by comparing respectively, for mapping of HWA1 and HWA2.Linkage the genome sequence of Nipponbare and the BAC-end analysis using these markers revealed a large gap sequence of Kasalath in the chromosomal region. The separating RM26943 and RM27051 (Fig. 3). Although PCR products from the primer pair encompassing the we also examined several published SSR markers in indel showed clear banding patterns. Polymorphism IRGSP (2005), they were not applicable to the linkage between Nipponbare and Kasalath was conserved be- analysis. To fill the gap, we detected a four-base-pair tween T65 and the three Indian cultivars. The DNA Rice (2011) 4:29–38 33 Table 2 Primer sequences and locations of the indel markers designed for this study Location on IRGSP pseudomolecules Build05 Marker name Primer sequences (5′–3′) Chromosome Position Source of DNA polymorphism information From To KGR1M47 F CACAAATAGAATTACTGATGAAACCTT 1 38529588 38529747 Shen et al. 2004 R CGTTACCGCTTATGTAGAGTCATC KGR2M10 F CATACATGGATGTCTAGTCGAAGA 2 6465517 6465683 Shen et al. 2004 R CAGTTCCAGTAAGTACATGGGTTT KGS0328 F ATCTAGCAAAATTATTCGAGCAGAA 3 31067890 31068058 Monna et al. 2006 R ACTTTACAGTAACAAGGGGTGCAA KGR4M30 F CAAAATAGGGAGGCAGATAGACA 4 18395635 18395794 Shen et al. 2004 R CTCCTGGTTGTATGCTCGTAAAT KGS0049 F AAATTATACTTCCAATCAAGCATCAAG 4 22809557 22809823 Monna et al. 2006 R AATTGTATTGGATTGGAGCTGGT KGR4M43 F GAGGTTATCCTCCCTAACACCAG 4 25116441 25116556 Shen et al. 2004 R TGCCAAATACAATATGACCACAA KGS0051 F CGAAAACAGTTAGGTGTTTGTTAGG 4 35483948 35484104 Monna et al. 2006 R CTTACATGTAGTACAAACAACCCACA KGS0494 F GATGGCTAGCTTGACTCCTGAATA 6 22083785 22084001 Monna et al. 2006 R CTCTAGGATACAATCATGGCAAACT KGS0135 F ACCTCATTTTATTTCAACATTGCAG 8 6028192 6028300 Monna et al. 2006 R CTTCCTGACCAAGTTAAACCCCTA KGR8M46 F CGAATAATTTGTAGCCGAGAAAA 8 28228891 28229086 Shen et al. 2004 R GCAGAGTCCAGAGAAGATCCAT KGR10M40 F CGTTTAATTTACGTGCGAATAGG 10 19966648 19966807 Shen et al. 2004 R AACCTGAGGCACTAGTTCGTTATC KGS0342 F ATACACACAGCAGACATAAGGTGAT 10 14305320 14305584 Monna et al. 2006 R AATAACCGTTTGATTGGACTAAAAA KGS0185 F TGACTACAGAAATAGTGCAGCTTCT 11 24091407 24091582 Monna et al. 2006 R CCCCCTCCTTGACTTTGG KGC11M1 F GGCAGGAGAGGAGAAACTGA 11 25263891 25263963 This study R GAAGAAAGTGACCATGGATGAA KGS1797 F AGTGGTGAGCTGCTAACAAATCTCT 11 29167452 29167572 Monna et al. 2006 R GCCGAGCGAGCTGAGTATC KGS1739 F AGAGACGCAGGAGCTGCTTA 12 1999528 1999818 Monna et al. 2006 R CATGACCCTTCTATGGCAATTAT marker using this indel was named KGC11M1 (Table 2), Discussion which we added to the linkage analysis. The linkage analysis of HWA1 and eight DNA markers using 176 In this study, both HWA1 and HWA2 were located between the two DNA markers on chromosome 11: KGC11M1 and three-way cross plants showed that HWA1 was located between KGC11M1 and RM27122, and that it cosegre- RM27122. Harushima et al. (1998) constructed an often- gated with RM27051 and RM27068 (Fig. 3). Linkage cited restriction fragment length polymorphism (RFLP) analysis of HWA2 and nine DNA markers using 175 three- marker-based high-density linkage map for rice, in which way cross plants showed that HWA2 was also located some RFLP markers have been sequenced. Based on between KGC11M1 and RM27122, and that it cosegre- Nipponbare genome sequence, KGC11M1 and RM27122 gatedwithRM27051 andRM27068(Fig. 3). To sum up, were close to the two RFLP markers R2458 and G1465, both HWA1 and HWA2 genes cosegregated with RM27051 which were reported respectively at positions 89.8 and 98.4 and RM27068, located on the 1,637-kb region surrounded in the map by Harushima et al. (1998). That location by KGC11M1 and RM27122 on the long arm of indicates that HWA1 and HWA2 are in the chromosomal chromosome 11. region surrounded by these markers (Fig. 3). 34 Rice (2011) 4:29–38 Fig. 3 Linkage map showing the a b c location of HWA1 and HWA2 on rice chromosome 11. a RFLP cM Loci cM Loci framework map of chromosome 11S 11 quoted from Harushima et al. (1998). b Linkage map of HWA1 RM5349 *** RM5349 constructed from the three-way cross population [P.T.B.7× 7.8 (T65×P.T.B.10)] (n=176). c 10.6 Linkage map of HWA2 con- RM26931 **** 1.7 structed from the three-way RM26931 * RM26943 **** cross population [A.D.T.14× 1.1 (T65×P.T.B.7)] (n=175). Geno- RM26943 ** 8.9 5.8 types of RM5349 and RM224 were analyzed for 94 plants in CEN KGC11M1 ** KGC11M1 ** HWA1 mapping and for 96 2.9 R728 3.5 RM27051 *** plants in HWA2 mapping to 63.8 RM27051 ** 0.0 C459B know if these genes are located 65.2 0.0 HWA2 *** 0.0 between the two markers. *, **, HWA1 * 0.0 RM27068 *** ***,and **** mean that the 3.5 RM27068 * 5.8 gene segregation was signifi- RM27122 *** 1.8 R2458 RM27122 cantly deviated from the 89.8 3.5 RM27150 ** expected ratio (1: 1) at 0.05, 3.0 RM27150 98.5 G1465 RM27181 ** 0.01, 0.001, and 0.0001 levels, 5.8 5.9 respectively. RM27230 * RM27230 3.1 3.0 RM224 RM224 11L In the three-way cross-mapping populations, gene Two genetic models can explain hybrid weakness. segregation was not fitted to the expected ratio, but it was According to one model, hybrid weakness results from skewed toward weakness-causing alleles for both HWA1 interaction among non-allelic genes: the causal genes of and HWA2 loci. Sawamura and Sano (1997) reported that P. another hybrid weakness in rice, HWC1 and HWC2, are T.B.10 carries a gamete eliminator of S (t), which is linked located on the different chromosomes (Ichitani et al. 2007; to la on chromosome 11. The P.T.B.10 allele S (t) induces Kuboyama et al. 2009). This case is true for the A. thaliana abortion of gametes carrying the T65 allele S (t) only in case (Bomblies et al. 2007). The candidate genes in the heterozygotes. The recombination value between S and la mapped regions of HWC1 and HWC2 do not mutually (lazy habit) was estimated to be 0.06±0.03 to 0.23±0.23. overlap; they belong to distinct gene families. The other Miura et al. (2003) conducted linkage analysis of la with model suggests allelic interaction: a hybrid necrosis RFLP markers. The la gene was located between R728 and symptom observed in interspecific crosses among Gos- C459B, of which the positions were 63.8 and 65.2, sypium was explained by interlocus and intralocus interac- dav respectively, in the map by Harushima et al. (1998). These tion, shown respectively by the dominant Le gene from experimentally obtained results suggest that distorted segre- Gossypium davidsonii at Le locus and Le and/or Le , 2 1 2 gation at the HWA1 locus in the three-way cross [P.T.B.7× dominant alleles from Gossypium hirsutum at the Le and (T65×P.T.B.10)] is attributable to S (t) linked to Hwa1-1. Le loci (Lee 1981). These two loci are thought to be on 11 2 Distorted segregation at the HWA2 locus in the three-way mutually homoeologous chromosomal segments on the G. cross [A.D.T.14×(T65×P.T.B.7)] reports that P.T.B.7 might hirsutum allotetraploid genome (Samora et al. 1994). dav carry the S (t) allele at S (t) locus. The heterozygote (S (t) Increased gene dosage of Le and Le with Le 11 11 11 1 2 2 S (t)) induces female and male infertility (Sawamura and reportedly hastens necrosis (Rooney and Stelly 1990). In Sano 1997). The fact that F plants from the cross (T65×P.T. the Gossypium case, no candidate gene information was B.10) and those from the cross (T65×P.T.B.7) both showed reported. Regarding the reproductive barrier in rice, causal semi-sterile panicles (Ichitani et al. unpublished results) also genes were cloned in an allelic interaction case: hetero- suggests that a gamete eliminator such as S (t) is attributable zygotes of Indica allele S5-i and Japonica allele S5-j at the to the segregating distortion in both cross combinations. S5 locus induce embryo-sac semi-sterility caused by partial However, the peaks of distortion differed between the two abortion of female gametes carrying the Japonica alleles. populations, implying that a gene(s) other than S (t) was Chen et al. (2008) cloned the S5 gene, demonstrating that responsible for the distortion in the three-way cross [A.D. S5 encodes an aspartic protease conditioning embryo-sac T.14×(T65×P.T.B.7)]. fertility, the allelic difference being very small at the Rice (2011) 4:29–38 35 sequence level. Chen et al. (2008) did not explain the Results of cluster analysis show that A.D.T.14 carrying molecular mechanism caused by the heterozygous form at Hwa1-1 belongs to indica, whereas P.T.B.10 carrying the S5 locus. In another case, causal genes of reproductive Hwa1-1 and P.T.B.7 carrying Hwa2-1 belong to aus, which barrier in rice, which had been thought to be allelic before, suggests a lack of relation between varietal differentiation proved to be a complex of two very tightly linked genes. At and the genotypes at the HWA1 and HWA2. However, the the hybrid male sterility locus Sa, heterozygotes of Indica three cultivars are insufficient to support discussion of the i j allele Sa and Japonica allele Sa exhibited male semi- distribution of these genes. Having learned recently that all sterility. Long et al. (2008) cloned the Sa gene, finding that the plant materials used by Oka (1957)havebeen it comprises two adjacently located genes, SaM and SaF, maintained in the National Institute of Genetics, Japan, we which respectively encode a small ubiquitin-like modifier plan to use these cultivars to find Hwa1-1-or Hwa2-1- E3 ligase-like protein and an F-box protein. Most Indica specific conserved haplotypes of DNA markers. Regarding + + cultivars contain a haplotype SaM SaF , whereas all HWC2 genes, we found that the DNA marker banding − − − Japonica cultivars have SaM SaF . Interaction of SaM patterns of 14 markers surrounding the HWC2 locus were + + and SaF in the presence of SaM is necessary for this male conserved completely among the 13 Hwc2-1 carriers sterility. (Kuboyama et al. 2009). We will find potential carriers In this study, the physical distance between the with the aid of DNA markers from our rice germplasm KGC11M1 and RM27122 markers was found to be collection and make test crosses to determine whether they 1,637 kb. According to the Rice Genome Annotation really carry the genes if such a haplotype is found in the Project (Ouyang et al. 2007, http://rice.plantbiology.msu. Hwa1-1 or Hwa2-1 carriers. We plan to add these gene edu/), more than 100 genes are located in the region. We carriers in the cluster analysis to confirm the relation were unable to determine whether Hwa1-1 and Hwa2-1 are between varietal differentiation and these genes. The allelic or not, but the possibility exists that heterozygotes increase in the number of gene carriers might disclose induce the hybrid weakness symptom. To elucidate their conserved haplotypes in the HWA1 or HWA2 locus, which relations, whether by tight linkage or allelism, larger help to identify the causal genes. mapping populations must be analyzed. To identify the causal genes and to confirm whether they A causal gene controlling hybrid necrosis in Arabidopsis are allelic or not, we are undertaking high-resolution was cloned. Reportedly, it encodes an NB-LRR protein mapping and linkage disequilibrium analysis of both (Bomblies et al. 2007). We fine-mapped HWC2 gene in HWA1 and HWA2 genes. We have also started physiological rice, and narrowed down the area of interest to 19 kb, and close morphological analyses of the hybrid weakness. identifying five candidate genes, one of which encodes an In three-way cross populations, there existed a few NB-LRR protein (Kuboyama et al. 2009). Alcázar et al. intermediate type plants between normal and weak ones, (2009) fine mapped a causal gene of incompatibility or partly because of diverse genetic backgrounds in the hybrid breakdown to a cluster of TIR-NB-LRR genes in populations (see Materials and methods). We are introduc- Arabidopsis. Yamamoto et al. (2010) reported that hbd3,a ing the Hwa1-1 gene from P.T.B.10 and A.D.T.14, and the causal gene controlling hybrid breakdown in rice, is located Hwa2-1 gene from P.T.B.7 in T65 genetic background by on the cluster of NB-LRR genes. These reports suggest that backcrossing to develop near-isogenic lines of these genes. plant immune systems conditioned by NB-LRR protein(s) Using these near-isogenic lines, we will evaluate the effects induce hybrid weakness, as reported by Bomblies and of these genes more exactly. Weigel (2007). According to the Rice Genome Annotation Project (Ouyang et al. 2007, http://rice.plantbiology.msu. edu/), two NB-LRR disease-resistance gene homologs, Materials and methods LOC_Os11g39160 and LOC_Os11g39260, and ten disease resistance-related genes containing NB-ARC domain are Plant materials located on the target region of HWA1 and HWA2, implying that these genes are causal genes. However, many other The three cultivars related to this hybrid weakness, P.T.B.7, genes are also located in the target region. No NB-LRR P.T.B.10, and A.D.T.14, were compared with the 13 disease resistance gene homolog is located in the HWC1 reference cultivars with regard to the banding patterns of target region (Ichitani et al. 2007). To clarify the funda- polyacrylamide gel electrophoresis of 39 PCR-based indel mental mechanism causing hybrid weakness, many cross markers (Fig. 2). Among the cultivars, Nipponbare and combinations causing hybrid weakness in various species Koshihikari are improved Japanese cultivars, and T65 is an should be studied at the molecular level. The cloning of improved Taiwanese cultivar. These three cultivars are HWA1 and HWA2 might provide new information related to generally classified as temperate Japonica. J-147 is a native hybrid weakness. cultivar in Japan (Sato and Morishima 1988). Ketan 36 Rice (2011) 4:29–38 Nangka, Azucena, and Jamaica are native cultivars respec- 30 s, 55°C for 30 s, and 72°C for 30 s with subsequent final tively originating in Malaysia, the Philippines, and Peru. extension of 72°C for 1 min. The PCR mixture (5 μl) They are generally classified as tropical Japonica. Three contained 1 ml of template DNA, 200 mM of each dNTP, cultivars generally classified as Indica are Guangluai 4, an 0.2 μM of primers, 0.25 units of Taq polymerase (AmpliTaq improved Chinese cultivar, and IR36 and IR24 developed Gold; Applied BioSystems), and 1× buffer containing by the International Rice Research Institute. Kele, Dular, MgCl . The PCR products were analyzed using electro- and Kasalath cultivars are native to India. Kele and Dular phoresis in 10% (29:1) polyacrylamide gel with subsequent are categorized as aus in Wan and Ikehashi (1997). Kasalath ethidium bromide staining and were viewed under ultravi- has been categorized as Indica in many studies; DNA olet light irradiation. Most PCR–based DNA markers used marker polymorphism has been observed with high for this study have already been published: Markers with an frequency between Kasalath and Japonica cultivars. asterisk in Fig. 2 were designed by RGP (http://rgp.dna. According to classification by Garris et al. (2005) based affrc.go.jp/E/publicdata/caps/index.html). Information relat- on SSR markers or Zhao et al. (2010) based on single ed to SSR markers was obtained from Panaud et al. (1996), nucleotide polymorphism—which divided rice cultivars Chen et al. (1997), Temnykh et al. (2001), McCouch et al. into temperate japonica, tropical japonica, indica, aus, (2002), and IRGSP (2005). Some primer pairs did not and one more group—Nipponbare and Koshihikari were perform well. Therefore, we redesigned them or developed classified as temperate japonica, Azucena as tropical new DNA markers. japonica, IR36 as indica, Kasalath as aus, and Dular as Most of the new markers were based on the indel between admixed. Nipponbare and an indica cultivar 93–11 (Shen et al. 2004)or For hybridization, flowering times of plant materials those between Nipponbare and Kasalath or an indica cultivar were mutually synchronized by the use of many sowing Guangluai 4 (Monna et al. 2006). Markers were named by dates. Seeds were sown in nurseries with plant spacing of adding KG to the original indel information ID, R*** (Shen 3×3 cm. One month after sowing, seedlings were trans- et al. 2004) or S**** (Monna et al. 2006). In redesigning or planted in a paddy field in the experimental farm of developing DNA markers, we made alignments of Nippon- Kagoshima University. bare genome sequence (IRGSP 2005), 93–11 genome The three-way cross populations in which HWA1 or sequence (Yu et al. 2002) and/or BAC-end sequence HWA2 gene segregated were grown in nurseries along with of Kasalath (http://rgp.dna.affrc.go.jp/blast/runblast.html, parental cultivars and F plants inducing the weakness. Katagiri et al. 2004) using DNAsis Pro (Hitachi Software Plant spacing was 3×6 cm. Engineering Co.). Primer design was performed using Primer 3(Rozen andSkaletsky 2000). The sequences of primers DNA marker analysis designed in this study are presented in Table 2. The DNA of the cultivars used in the cluster analysis was Cluster analysis extracted according to Dellaporta et al. (1983) with some modifications. The DNA of the mapping populations was Genetic relations among the 16 cultivars (Fig. 2) were extracted according to the experimental protocols of Rice evaluated using the 39 DNA markers. Each fragment size Genome Research Program (RGP) (http://rgp.dna.affrc.go. was treated as a unique characteristic, and scored as present jp/E/rgp/protocols/index.html, written in Japanese) with (1) or absent (0). The data matrix was used to calculate some modifications. Briefly, each young leaf tip, 2 cm long genetic similarities using the Jaccard coefficient (Jaccard from a single plant, was put on a well in a 96-deep well 1908). A phenogram was constructed using the unweighted plate. Then 100 μl of extraction buffer (100 mM Tris–HCl pair-group method with the arithmetic mean (UPGMA) (pH 8.0), 1 M KCl, and 10 mM EDTA) were added with a with software (NTSYS-pc ver. 2.2; Exeter Software). 5-mm-diameter stainless steel ball in a well. After covering with a hard lid, the plate was shaken hard (ShakeMaster ver. Mapping strategy 1.2; BioMedical Science Inc.) for a minute to grind the leaves. After centrifuging, a plate was incubated at 70°C for About 1 month after the sowing date, the seedlings in the an hour. Then 9 μl of supernatant was recovered and 7 μlof three-way cross populations, [P.T.B.7×(T65×P.T.B.10)] (n= 2-propanol was added. After centrifuging, the supernatant 176) and [A.D.T.14×(T65×P.T.B.7)] (n=175), developed was discarded and the DNA pellet was rinsed with 50 μlof three to four leaves. Plants of two types appeared. One type 70% ethanol. The DNA pellet was dried and dissolved in was characterized by the yellowing of leaf tips and weak 50 μl of sterilized distilled water. growth as F plants (Fig. 1). It was categorized as a weak The PCR conditions for indel and SSR markers used for plant carrying both Hwa1-1 and Hwa2-1 genes. Another this study were 95°C for 10 min, 40 cycles of 94°C for type showed normal growth as parental cultivars. It was Rice (2011) 4:29–38 37 Bomblies K, Weigel D. Hybrid necrosis: autoimmunity as a potential categorized as a normal plant carrying only Hwa1-1 or gene-flow barrier in plant species. Nat Rev Genet. 2007;8:382–93. Hwa2-1. The tips of lower leaves of normal plants Chen J, Ding J, Ouyang Y, Du H, Yang J, Cheng K, et al. A triallelic sometimes yellowed also, but the tips of upper leaves system of S5 is a major regulator of the reproductive barrier and remained green. In contrast, in weak plants, all leaf tips compatibility of indica–japonica hybrids in rice. Proc Natl Acad Sci USA. 2008;105:11436–41. except those of the youngest (still expanding) ones Chen X, Temnykh S, Xu Y, Cho YG, McCouch SR. Development of a yellowed. Therefore, the difference between weak plants microsatellite framework map providing genome-wide coverage and normal plants was clear in most cases. A few in rice (Oryza sativa L.). Theor Appl Genet. 1997;95:553–67. intermediate type plants could not be categorized into the Dellaporta SL, Wood J, Hicks JB. A plant DNA minipreparation: version II. Plant Mol Biol Rep. 1983;1:19–21. above two types. They were excluded from analyses. Garris AJ, Tai TH, Coburn J, Kresovich S, McCouch S. Genetic For HWA1 mapping, a total of 83 DNA markers structure and diversity in Oryza sativa L. Genetics. distributed on the whole rice genome were used: 24 2005;169:1631–8. polymorphic indel markers in Fig. 2, an indel marker Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y, et al. A high-density rice genetic linkage map with 2275 markers named S21074 designed by RGP, another indel marker using a single F population. Genetics. 1998;148:479–94. named Knindel1 (Matsubara et al. 2007), a sequence Ichitani K, Fukuta Y, Taura S, Sato M. Chromosomal location of characterized amplified region (SCAR) marker named d Hwc2, one of the complementary hybrid weakness genes, in rice. (Ueda et al. 2005), and 56 published SSR markers. For Plant Breeding. 2001;120:523–5. Ichitani K, Namigoshi K, Sato M, Taura S, Aoki M, Matsumoto Y, et HWA2 mapping, a total of 84 DNA markers distributed on al. Fine mapping and allelic dosage effect of Hwc1,a the whole rice genome were used: the 23 polymorphic indel complementary hybrid weakness gene in rice. Theor Appl Genet. markers presented in Fig. 2, 59 SSR markers, and two indel 2007;114:1407–15. markers designed by RGP—S21074 and S5865. International Rice Genome Sequencing Project (IRGSP). The map- based sequence of the rice genome. Nature. 2005;436:793–800. In each mapping population, six typical weak plants and Jaccard P. Nouvelles recherches sur la distribution florale. Bull Soc six typical normal plants were selected and subjected to Vaudoise Sci Nat. 1908;44:223–70. preliminary linkage analysis with DNA markers, with the Katagiri S, Wu J, Ito Y, Karasawa W, Shibata M, Kanamori H, et al. result that the linkage of HWA1 and HWA2 with RM5349 End sequencing and chromosomal in silico mapping of BAC clones derived from an indica rice cultivar, Kasalath. Breed Sci. (McCouch et al. 2002) and RM224 (Chen et al. 1997) was 2004;54:273–9. visible on the long arm of chromosome 11. Then linkage Kinoshita T. Proposal for rules of gene symbolization. Rice Genet analysis using all the plants in the mapping populations and Newsl. 1984;1:4–15. polymorphic DNA markers surrounded by RM5349 and Kosambi D. The estimation of map distance from recombination values. Ann Eugen. 1944;12:172–5. RM224 was conducted using a computer program (Map- Kuboyama T, Saito T, Matsumoto T, Wu J, Kanamori H, Taura S, et al. Disto ver. 1.7; Lorieux 2007). Map distances were Fine Mapping of HWC2, a complementary hybrid weakness estimated using the Kosambi function (Kosambi 1944). gene, and haplotype analysis around the locus in rice. Rice. 2009;2:93–103. Lee JA. Genetics of D complementary lethality in Gossypium Acknowledgments We gratefully acknowledge Dr. Atsushi hirsutum and G. barbadense. J Hered. 1981;72:299–300. Yoshimura of Kyushu University and Dr. Lisa Monna of the Plant Long Y, Zhao L, Niu B, Su J, Wu H, Chen Y, et al. Hybrid male Genome Center for valuable information related to DNA polymor- sterility in rice controlled by interaction between divergent alleles phism in rice. We are also grateful to Dr. Yo-Ichiro Sato of the of two adjacent genes. Proc Natl Acad Sci USA. Research Institute for Humanity and Nature, the Genebank of the 2008;105:18871–6. National Institute of Agrobiological Sciences for the kind provision of Lorieux M. 2007. MapDisto, a free user-friendly program for rice cultivars. This work was funded by the Ministry of Education, computing genetic maps. Computer demonstration (p958) given Culture, Sports, Science and Technology. at the plant and animal genome XV conference, Jan 13–17 2007, San Diego, CA. URL: http://mapdisto.free.fr/. Matsubara K, Ito S, Nonoue Y, Ando T, Yano M. A novel gene responsible for hybrid breakdown found in a cross between japonica and indica References cultivars in rice. Rice Genet Newsl. 2007;23:11–3. McCouch SR, Teytelman L, Xu Y, Lobos KB, Clare K, Walton M, et Alcázar R, García AV, Parker JE, Reymond M. Incremental steps al. Development and mapping of 2240 new SSR markers for rice toward incompatibility revealed by Arabidopsis epistatic inter- (Oryza sativa L.). DNA Res. 2002;9:199–207. actions modulating salicylic acid pathway activation. Proc Natl McCouch SR, Committee on Gene Symbolization, Nomenclature and Acad Sci USA. 2009;106:334–9. Linkage, Rice Genetics Cooperative (CGSNL). Gene nomencla- Amemiya A, Akemine H. Biochemical genetic studies on the root ture system for rice. Rice. 2008;1:72–84. growth inhibiting complementary lethals in rice plant (Studies on Miura K, Ashikari M, Matsuoka M, Hsing YIC. Mapping of the lazy the embryo culture in rice plant. 3). Bull Nat Inst Agric Sci D. gene, la. Rice Genet Newsl. 2003;20:29–30. 1963;10:139–226. in Japanese with English summary. Monna L, Ohta R, Masuda H, Koike A, Minobe Y. Genome-wide Bomblies K, Lempe J, Epple P, Warthmann N, Lanz C, Dangl JL, et al. searching of single-nucleotide polymorphisms among eight Autoimmune response as a mechanism for a Dobzhansky-Muller- distantly and closely related rice cultivars (Oryza sativa L.) and type incompatibility syndrome in plants. PLoS Biol. 2007; a wild accession (Oryza rufipogon Griff.). DNA Res. 9:1962–72. 2006;13:43–51. 38 Rice (2011) 4:29–38 Oka HI. Phylogenetic differentiation of cultivated rice. XV. Comple- Shii CT, Mok MC, Temple SR, Mok DWS. Expression of develop- mentary lethal genes in rice. Jpn J Genet. 1957;32:83–7. mental abnormalities of Phaseolus vulgaris L. Interaction Ouyang S, Zhu W, Hamilton J, Lin H, Campbell M, Childs K, et al. between temperature and allelic dosage. J Hered. 1980;71:219– The TIGR rice genome annotation resource: improvements and 22. new features. Nucleic Acid Res. 2007;35:D883–7. Temnykh S, DeClerck G, Lukashova A, Lipovich L, Cartinhour S, Panaud O, Chen X, McCouch SR. Development of microsatellite McCouch S. Computational and experimental analysis of micro- markers and characterization of simple sequence length poly- satellites in rice (Oryza sativa L.): frequency, length variation, morphism (SSLP) in rice (Oryza sativa L.). Mol Gen Genet. transposon associations, and genetic marker potential. Genome 1996;252:597–607. Res. 2001;11:1441–52. dav Rooney WL, Stelly DM. Genetic effects on the timing of Le Tezuka T, Kuboyama T, Matsuda T, Marubashi W. Possible involve- induced necrosis of cotton. Crop Sci. 1990;30:70–4. ment of genes on the Q chromosome of Nicotiana tabacum in Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and expression of hybrid lethality and programmed cell death during for biologist programmers. In: Krawetz S, Misener S, editors. interspecific hybridization to Nicotiana debneyi.Planta. Bioinformatics methods and protocols: methods in molecular 2007;226:753–64. biology. Totowa: Humana Press; 2000. p. 365–86. Ueda T, Sato T, Hidema J, Hirouchi T, Yamamoto K, Kumagai T, et al. Saito T, Ichitani K, Suzuki T, Marubashi W, Kuboyama T. Develop- qUVR-10, a major quantitative locus for ultraviolet-B resistance mental observation and high temperature rescue from hybrid in rice, encodes cyclobutane pyrimidine dimer photolyase. weakness in a cross between Japanese rice cultivars and Peruvian Genetics. 2005;171:1941–50. rice cultivar ‘Jamaica’. Breed Sci. 2007;57:281–8. Wan J, Ikehashi H. Identification of two types of differentiation in Samora PJ, Stelly DM, Kohel RJ. Localization and mapping of the Le and cultivated rice (Oryza sativa L.) detected by polymorphism of Gl loci of cotton (Gossypium hirsutum L.). J Hered. 1994;85:152–7. isozymes and hybrid sterility. Euphytica. 1997;94:151–61. Sato YI, Sano Y, Nakagahra M. Gene symbols for gametic effect, Yamamoto E, Takashi T, Morinaka Y, Lin S, Wu J, Matsumoto T, et al. sterility and weakness. Rice Genet Newsl. 1987;4:46–51. Gain of deleterious function causes an autoimmune response and Sato YI, Morishima H. Distribution of the genes causing F chlorosis Bateson–Dobzhansky–Muller incompatibility in rice. Mol Genet in rice cultivars of the Indica and Japonica types. Theor Appl Genomics. 2010;283:305–15. Genet. 1988;75:723–727. Yu J, Hu S, Wang J, Wong GK, Li S, Liu B, et al. A draft sequence of Sawamura N, Sano Y. Chromosomal location of gamete eliminator, the rice genome (Oryza sativa L. spp. indica). Science. S (t), found in an Indica-Japonica hybrid. Rice Genet Newsl. 2002;296:79–92. 1996;13:70–2. Zhao K, Wright M, Kimball J, Eizenga G, McClung A, Kovach M, et Shen YJ, Jiang H, Jin JP, Zhang ZB, Xi B, He YY, et al. Development al. Genomic diversity and introgression in O. sativa reveal the of genome-wide DNA polymorphism database for map-based impact of domestication and breeding on the rice genome. PLoS cloning of rice genes. Plant Physiol. 2004;135:1198–205. One. 2010;5:e10780. doi:10.1371/journal.pone.0010780. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Rice Springer Journals

Chromosomal Location of HWA1 and HWA2, Complementary Hybrid Weakness Genes in Rice

Download PDF
10 pages

Loading next page...
 
/lp/springer-journals/chromosomal-location-of-hwa1-and-hwa2-complementary-hybrid-weakness-VnaHPzp0Pj

References (43)

Publisher
Springer Journals
Copyright
Copyright © 2011 by Springer Science + Business Media, LLC
Subject
Life Sciences; Plant Sciences; Plant Genetics & Genomics; Plant Breeding/Biotechnology; Agriculture; Plant Ecology
ISSN
1939-8425
eISSN
1939-8433
DOI
10.1007/s12284-011-9062-2
Publisher site
See Article on Publisher Site

Abstract

Rice (2011) 4:29–38 DOI 10.1007/s12284-011-9062-2 Chromosomal Location of HWA1 and HWA2, Complementary Hybrid Weakness Genes in Rice Katsuyuki Ichitani & Satoru Taura & Takahiro Tezuka & Yuuya Okiyama & Tsutomu Kuboyama Received: 2 April 2011 /Accepted: 9 June 2011 /Published online: 24 June 2011 Springer Science+Business Media, LLC 2011 Abstract Hybrid weakness phenomena in rice reportedly Introduction have two causes: those of HWC1 and HWC2 genes and those of HWA1 and HWA2 genes. No detailed study of the Many postzygotic reproductive barrier forms have been latter has been reported. For this study, we first produced reported in rice (Oryza sativa), such as hybrid weakness crosses among cultivars carrying the weakness-causing (e.g., Oka 1957), hybrid pollen sterility (e.g., Long et al. allele on the HWA1 and HWA2 loci to confirm the 2008), and hybrid sterility causing female gamete abortion phenotype of the hybrid weakness and the genotypes of (e.g., Chen et al. 2008). Among them, hybrid weakness is the cultivars on the two loci, as reported earlier. We then definable as weak growth occurring in F hybrids derived confirmed that these cultivars belong to Indica. Subsequent from crosses between two normal strains. According to its linkage analysis of HWA1 and HWA2 genes conducted degree or symptom, it is also called hybrid lethality, hybrid using DNA markers revealed that both genes are located in abnormality, or hybrid necrosis. Hybrid weakness is also the 1,637-kb region, surrounded by the same DNA markers apparent in many other plant species including Arabidopsis on the long arm of chromosome 11. The possibility of thaliana (Bomblies et al. 2007), Phaseolus vulgaris (Shii et allelic interaction inducing hybrid weakness is discussed. al. 1980), interspecific crosses among Gossypium (Lee 1981), and interspecific crosses among Nicotiana (Tezuka . . Keywords Reproductive barrier Linkage analysis Hybrid et al. 2007). weakness Varietal differentiation In rice, two hybrid weakness phenomena from different intraspecific cross combinations have been reported: one by K. Ichitani (*) Oka (1957) and the other by Amemiya and Akemine (1963). Faculty of Agriculture, Kagoshima University, The hybrid weakness reported by Oka (1957)resulted from 1-21-24 Korimoto, use of a set of complementary dominant genes: L and L . 1 2 Kagoshima, Kagoshima 890–0065, Japan They were renamed L-1-a and L-1-b by Kinoshita (1984); e-mail: ichitani@agri.kagoshima-u.ac.jp then Hwa-1 and Hwa-2 by Sato et al. (1987). According to S. Taura the new gene nomenclature system for rice (McCouch and Institute of Gene Research, Kagoshima University, Committee on Gene Symbolization, Nomenclature and 1-21-24 Korimoto, Linkage, Rice Genetics Cooperative (CGSNL) 2008), the Kagoshima, Kagoshima 890–0065, Japan new gene symbols HWA1 and HWA2 are used respectively T. Tezuka for reference to Hwa-1 and Hwa-2, as presented in Table 1. Graduate School of Life and Environmental Sciences, The latter phenomenon results from the use of a set of Osaka Prefecture University, complementary dominant genes: Hybrid weakness C1 1–1 Gakuen-cho, Nakaku, Sakai, Osaka 599–8531, Japan (HWC1)and Hybrid weakness C2 (HWC2). We have detected the chromosomal locations of these genes and have Y. Okiyama T. Kuboyama performed fine mapping (Ichitani et al. 2001;Ichitani etal. College of Agriculture, Ibaraki University, 2007;Kuboyama et al. 2009). However, the chromosomal 3-21-1 Chuo, locations of HWA1 and HWA2 have remained unknown. Ami, Ibaraki 300–0393, Japan 30 Rice (2011) 4:29–38 Table 1 Gene symbols frequently used in this study according to the new gene nomenclature system for rice (McCouch and CGSNL 2008) Gene symbol Oka (1957)Kinoshita(1984) Sato et al. (1987) This study Gene full name Carrier of weakness- causing gene Locus/gene HWA1 HYBRID WEAKNESS A1 Dominant allele L L-1-a Hwa-1 Hwa1-1 Hybrid weakness a1-1 P.T.B.10, A.D.T.4, A.D.T.14, M.T.U.9, P.T.B.8 Recessive allele + + Hwa-1 hwa1-2 hybrid weakness a1-2 Locus/gene HWA2 HYBRID WEAKNESS A2 Dominant allele L L-1-b Hwa-2 Hwa2-1 Hybrid weakness a2-1 P.T.B.7, accession 418 Recessive allele + + Hwa-2 hwa2-2 hybrid weakness a2-2 According to Oka (1957), hybrids carrying both Hwa1-1 Results and Hwa2-1 showed the following symptoms: germination and growth in the seedling stage were quite normal until the Confirmation of the experiment by Oka (1957) seedlings had developed three to four leaves, at which time growth stopped and the leaves yellowed. The phenotype Indian cultivars carrying Hwa1-1 or Hwa2-1 gene, P.T.B.10, differs considerably from that of hybrids carrying both P.T.B.7, and A.D.T.14, were provided by the Genebank of Hwc1-1 and Hwc2-1, of which the symptoms are charac- the National Institute of Agrobiological Sciences, Japan. We terized by root growth inhibition appearing just 5 days after produced crosses among these three cultivars and con- germination (Ichitani et al. 2001; Saito et al. 2007). firmed that the F hybrids from the cross between P.T.B.7 The distribution of Hwa1-1 and Hwa2-1 genes was and P.T.B.10, and those from the cross between P.T.B.7 and limited to some Indian cultivars (Oka 1957). Based on A.D.T.14 showed the weakness symptom, as reported by results of three-way cross combinations, Oka (1957)reported Oka (1957)(Fig. 1). The F hybrids from the cross between that P.T.B.10 (accession 414) and P.T.B.7 (accession 419) P.T.B.10 and A.D.T.14 showed normal growth. These carry Hwa1-1 and Hwa2-1, respectively, whereas Pei-ku results indicate that these Indian cultivars carry one of the (accession 108), Padi ase banda (accession 647), and Kissin hybrid-weakness-causing genes reported by Oka (1957). (accession 521) carry neither Hwa1-1 nor Hwa2-1.Oka Oka (1957) reported that all cultivars related to this (1957) examined many different cultivars for the distribution hybrid weakness belong to Indica. If that is true, then the of these genes. The four Indian cultivars––A.D.T.4 (acces- mapping population of HWA1 and HWA2 should be sion 415), A.D.T.14 (accession 417), M.T.U.9 (accession constructed from the cross between these cultivars and 420), and P.T.B.8 (accession 421)––showed weakness in Japonica cultivars because DNA polymorphism between hybrids with P.T.B.7, indicating that these four cultivars also Indica cultivars and Japonica cultivars is frequently carry Hwa1-1. Actually, accession 418, an Indian cultivar observed. To confirm the classification by Oka (1957), the whose name is unknown, showed weakness in the hybrid three Indian cultivars were compared with 13 reference with P.T.B.10, indicating that accession 418 carries Hwa2-1. cultivars (see Materials and methods for details) with All cultivars relating to this hybrid weakness belong to respect to the banding patterns of polyacrylamide gel Indica. The other cultivars that were examined carry neither electrophoresis of 39 PCR-based insertion/deletion (indel) Hwa1-1 nor Hwa2-1. Information about the gene carriers of markers covering all 12 rice chromosomes (Fig. 2, Table 2). Hwa1-1 and Hwa2-1 is presented in Table 1. The relations among the 16 cultivars were revealed by The molecular mechanism of the hybrid weakness has UPGMA cluster analysis (Fig. 2). The 16 cultivars were remained unknown. Elucidating the mechanism necessitates classified clearly into two groups corresponding to Japonica clarification of the causal genes and their gene products. We and Indica. All cultivars related to this hybrid weakness selected a map-based cloning strategy to identify the two causal belong to Indica, which is consistent with the report by Oka genes. As a starting point of map-based cloning, this report (1957). The Japonica group was divided into temperate describes the chromosomal locations of HWA1 and HWA2 Japonica and tropical Japonica. The four cultivars in genes. It is particularly interesting that both genes are located in temperate Japonica showed the same banding patterns with the 1,637-kb region, surrounded by the same DNA markers on 39 DNA markers, except that J-147 showed a different the long arm of chromosome 11. The possibility of allelic pattern with KGS1797. The three cultivars in tropical interaction inducing hybrid weakness is discussed in this report. Japonica showed the same banding patterns as temperate Rice (2011) 4:29–38 31 cultivars with high frequency (Fig. 2). We selected a Taiwanese temperate Japonica cultivar Taichung 65 (T65) and produced hybrids among the three Indian cultivars and T65 because much polymorphism has been noted among the three Indian cultivars and T65. Furthermore, because it is weakly photoperiod sensitive, hybridization between T65 and other cultivars can be accomplished more easily. All hybrids from crosses between T65 and the three cultivars showed normal growth, indicating that T65 carries neither Hwa1-1 nor Hwa2-1. Then, linkage analysis of HWA1 and HWA2 was conducted using a three-way cross population. For the location of HWA1, the F plants derived from the cross between T65 and P.T.B.10 were crossed with P.T.B.7. The three-way cross population [P.T.B.7×(T65×P.T.B.10)] (n= 176) was divided into 105 weak plants carrying both Hwa1-1 and Hwa2-1, and 71 normal plants carrying only the Hwa2-1 gene. The observed ratio did not fit the expected ratio 1:1 (χ =6.57, P=0.01038). We inferred that the deviation from the expected ratio was probably caused by the linkage between HWA1 gene and gametophytic reproductive barrier gene(s), which is often found in crosses between Indica and Japonica (see Discussion). Six typical weak plants and six typical normal plants were selected from the three-way cross population. They were subjected to preliminary linkage analysis with 83 DNA markers distributed on the whole rice genome (for details, see Materials and methods). A clear linkage was detected between HWA1 and DNA markers on the long arm of Fig. 1 Hybrid weakness caused by two complementary genes: Hwa1- chromosome 11, RM5349 (McCouch et al. 2002), and 1 and Hwa2-1. Seedlings are shown 40 days after sowing date: from RM224 (Chen et al. 1997). Linkage of HWA1 with left to right, P.T.B.10, F derived from the cross between P.T.B.10 and RM5349 and RM224 was confirmed by adding the 82 P.T.B.7, and P.T.B.7. The F 's developed leaves have turned yellow three-way cross plants (Fig. 3). from the tip. Bar shows 10 cm. Along with the mapping of HWA1, linkage analysis of Japonica does with 28 DNA markers. The Indica group was HWA2 was performed using the same strategy. The F divided into two subgroups, with one subgroup comprising plants derived from the cross between T65 and P.T.B.7 IR36, IR24, Guangluai 4, and A.D.T.14, and the other were crossed with A.D.T.14. The three-way cross popula- comprising Kasalath, Kele, Dular, P.T.B.10, and P.T.B.7. tion [A.D.T.14×(T65×P.T.B.7)] (n=175) was divided into Garris et al. (2005) classified 234 rice cultivars into five 110weakplantscarryingboth Hwa1-1 and Hwa2-1,and groups: indica, aus, aromatic, temperate japonica, and 65 normal plants carrying only the Hwa1-1 gene. The tropical japonica. Then IR36 was categorized into indica, observed ratio did not fit the expected ratio 1:1 (χ =11.57, and Kasalath into aus. In the present study, according to P=0.00067), probably because of the reproductive Garris et al. (2005), the subgroup comprising Kasalath and barrier, as described above. Six typical weak plants the other subgroup comprising IR36 will be designated and six typical normal plants that had been selected respectively hereinafter as aus and indica (Fig. 2). Regard- from the three-way cross population were subjected to ing the three cultivars related to this hybrid weakness, A.D. preliminary linkage analysis with 84 DNA markers T.14 was found to belong to indica, whereas P.T.B.7 and P.T. distributed throughout the rice genome (see Materials B.10 belong to aus. and methods), indicating that HWA2 was also linked with RM5349 and RM224. Linkage of HWA2 with RM5349 Mapping of HWA1 and HWA2 and RM224 was confirmed by adding the 84 three-way cross plants (Fig. 3). The three cultivars proved to belong to Indica, as reported We selected seven and eight polymorphic simple by Oka (1957). They showed polymorphism with Japonica sequence repeats (SSR) markers reported by the Interna- 32 Rice (2011) 4:29–38 Fig. 2 Classification of the 1.00 Japonica Indica Indian cultivars carrying Hwa1-1 or Hwa2-1 gene and 13 0.75 reference cultivars into four va- rietal groups based on banding Coefficient patterns of 39 DNA markers temperate tropical 0.50 indica aus covering all 12 rice chromo- Japonica Japonica somes. DNA markers with an 0.25 asterisk (*) were developed by RGP (http://rgp.dna.affrc.go.jp/ E/publicdata/caps/index.html); 0.00 those without an asterisk were developed in this study (Table 2). The same banding patterns as Nipponbare are indi- cated as solid rectangles. Other patterns are shown as open and shaded rectangles. Shown above are genetic relations among the 16 cultivars obtained using UPGMA cluster analysis. Each fragment size of the 39 markers was treated as a unique charac- teristic and scored as present (1) or absent (0). The data matrix was used to calculate genetic similarities using the Jaccard (1908) coefficient. tional Rice Genome Sequencing Project (IRGSP) (2005), indel between Nipponbare and Kasalath by comparing respectively, for mapping of HWA1 and HWA2.Linkage the genome sequence of Nipponbare and the BAC-end analysis using these markers revealed a large gap sequence of Kasalath in the chromosomal region. The separating RM26943 and RM27051 (Fig. 3). Although PCR products from the primer pair encompassing the we also examined several published SSR markers in indel showed clear banding patterns. Polymorphism IRGSP (2005), they were not applicable to the linkage between Nipponbare and Kasalath was conserved be- analysis. To fill the gap, we detected a four-base-pair tween T65 and the three Indian cultivars. The DNA Rice (2011) 4:29–38 33 Table 2 Primer sequences and locations of the indel markers designed for this study Location on IRGSP pseudomolecules Build05 Marker name Primer sequences (5′–3′) Chromosome Position Source of DNA polymorphism information From To KGR1M47 F CACAAATAGAATTACTGATGAAACCTT 1 38529588 38529747 Shen et al. 2004 R CGTTACCGCTTATGTAGAGTCATC KGR2M10 F CATACATGGATGTCTAGTCGAAGA 2 6465517 6465683 Shen et al. 2004 R CAGTTCCAGTAAGTACATGGGTTT KGS0328 F ATCTAGCAAAATTATTCGAGCAGAA 3 31067890 31068058 Monna et al. 2006 R ACTTTACAGTAACAAGGGGTGCAA KGR4M30 F CAAAATAGGGAGGCAGATAGACA 4 18395635 18395794 Shen et al. 2004 R CTCCTGGTTGTATGCTCGTAAAT KGS0049 F AAATTATACTTCCAATCAAGCATCAAG 4 22809557 22809823 Monna et al. 2006 R AATTGTATTGGATTGGAGCTGGT KGR4M43 F GAGGTTATCCTCCCTAACACCAG 4 25116441 25116556 Shen et al. 2004 R TGCCAAATACAATATGACCACAA KGS0051 F CGAAAACAGTTAGGTGTTTGTTAGG 4 35483948 35484104 Monna et al. 2006 R CTTACATGTAGTACAAACAACCCACA KGS0494 F GATGGCTAGCTTGACTCCTGAATA 6 22083785 22084001 Monna et al. 2006 R CTCTAGGATACAATCATGGCAAACT KGS0135 F ACCTCATTTTATTTCAACATTGCAG 8 6028192 6028300 Monna et al. 2006 R CTTCCTGACCAAGTTAAACCCCTA KGR8M46 F CGAATAATTTGTAGCCGAGAAAA 8 28228891 28229086 Shen et al. 2004 R GCAGAGTCCAGAGAAGATCCAT KGR10M40 F CGTTTAATTTACGTGCGAATAGG 10 19966648 19966807 Shen et al. 2004 R AACCTGAGGCACTAGTTCGTTATC KGS0342 F ATACACACAGCAGACATAAGGTGAT 10 14305320 14305584 Monna et al. 2006 R AATAACCGTTTGATTGGACTAAAAA KGS0185 F TGACTACAGAAATAGTGCAGCTTCT 11 24091407 24091582 Monna et al. 2006 R CCCCCTCCTTGACTTTGG KGC11M1 F GGCAGGAGAGGAGAAACTGA 11 25263891 25263963 This study R GAAGAAAGTGACCATGGATGAA KGS1797 F AGTGGTGAGCTGCTAACAAATCTCT 11 29167452 29167572 Monna et al. 2006 R GCCGAGCGAGCTGAGTATC KGS1739 F AGAGACGCAGGAGCTGCTTA 12 1999528 1999818 Monna et al. 2006 R CATGACCCTTCTATGGCAATTAT marker using this indel was named KGC11M1 (Table 2), Discussion which we added to the linkage analysis. The linkage analysis of HWA1 and eight DNA markers using 176 In this study, both HWA1 and HWA2 were located between the two DNA markers on chromosome 11: KGC11M1 and three-way cross plants showed that HWA1 was located between KGC11M1 and RM27122, and that it cosegre- RM27122. Harushima et al. (1998) constructed an often- gated with RM27051 and RM27068 (Fig. 3). Linkage cited restriction fragment length polymorphism (RFLP) analysis of HWA2 and nine DNA markers using 175 three- marker-based high-density linkage map for rice, in which way cross plants showed that HWA2 was also located some RFLP markers have been sequenced. Based on between KGC11M1 and RM27122, and that it cosegre- Nipponbare genome sequence, KGC11M1 and RM27122 gatedwithRM27051 andRM27068(Fig. 3). To sum up, were close to the two RFLP markers R2458 and G1465, both HWA1 and HWA2 genes cosegregated with RM27051 which were reported respectively at positions 89.8 and 98.4 and RM27068, located on the 1,637-kb region surrounded in the map by Harushima et al. (1998). That location by KGC11M1 and RM27122 on the long arm of indicates that HWA1 and HWA2 are in the chromosomal chromosome 11. region surrounded by these markers (Fig. 3). 34 Rice (2011) 4:29–38 Fig. 3 Linkage map showing the a b c location of HWA1 and HWA2 on rice chromosome 11. a RFLP cM Loci cM Loci framework map of chromosome 11S 11 quoted from Harushima et al. (1998). b Linkage map of HWA1 RM5349 *** RM5349 constructed from the three-way cross population [P.T.B.7× 7.8 (T65×P.T.B.10)] (n=176). c 10.6 Linkage map of HWA2 con- RM26931 **** 1.7 structed from the three-way RM26931 * RM26943 **** cross population [A.D.T.14× 1.1 (T65×P.T.B.7)] (n=175). Geno- RM26943 ** 8.9 5.8 types of RM5349 and RM224 were analyzed for 94 plants in CEN KGC11M1 ** KGC11M1 ** HWA1 mapping and for 96 2.9 R728 3.5 RM27051 *** plants in HWA2 mapping to 63.8 RM27051 ** 0.0 C459B know if these genes are located 65.2 0.0 HWA2 *** 0.0 between the two markers. *, **, HWA1 * 0.0 RM27068 *** ***,and **** mean that the 3.5 RM27068 * 5.8 gene segregation was signifi- RM27122 *** 1.8 R2458 RM27122 cantly deviated from the 89.8 3.5 RM27150 ** expected ratio (1: 1) at 0.05, 3.0 RM27150 98.5 G1465 RM27181 ** 0.01, 0.001, and 0.0001 levels, 5.8 5.9 respectively. RM27230 * RM27230 3.1 3.0 RM224 RM224 11L In the three-way cross-mapping populations, gene Two genetic models can explain hybrid weakness. segregation was not fitted to the expected ratio, but it was According to one model, hybrid weakness results from skewed toward weakness-causing alleles for both HWA1 interaction among non-allelic genes: the causal genes of and HWA2 loci. Sawamura and Sano (1997) reported that P. another hybrid weakness in rice, HWC1 and HWC2, are T.B.10 carries a gamete eliminator of S (t), which is linked located on the different chromosomes (Ichitani et al. 2007; to la on chromosome 11. The P.T.B.10 allele S (t) induces Kuboyama et al. 2009). This case is true for the A. thaliana abortion of gametes carrying the T65 allele S (t) only in case (Bomblies et al. 2007). The candidate genes in the heterozygotes. The recombination value between S and la mapped regions of HWC1 and HWC2 do not mutually (lazy habit) was estimated to be 0.06±0.03 to 0.23±0.23. overlap; they belong to distinct gene families. The other Miura et al. (2003) conducted linkage analysis of la with model suggests allelic interaction: a hybrid necrosis RFLP markers. The la gene was located between R728 and symptom observed in interspecific crosses among Gos- C459B, of which the positions were 63.8 and 65.2, sypium was explained by interlocus and intralocus interac- dav respectively, in the map by Harushima et al. (1998). These tion, shown respectively by the dominant Le gene from experimentally obtained results suggest that distorted segre- Gossypium davidsonii at Le locus and Le and/or Le , 2 1 2 gation at the HWA1 locus in the three-way cross [P.T.B.7× dominant alleles from Gossypium hirsutum at the Le and (T65×P.T.B.10)] is attributable to S (t) linked to Hwa1-1. Le loci (Lee 1981). These two loci are thought to be on 11 2 Distorted segregation at the HWA2 locus in the three-way mutually homoeologous chromosomal segments on the G. cross [A.D.T.14×(T65×P.T.B.7)] reports that P.T.B.7 might hirsutum allotetraploid genome (Samora et al. 1994). dav carry the S (t) allele at S (t) locus. The heterozygote (S (t) Increased gene dosage of Le and Le with Le 11 11 11 1 2 2 S (t)) induces female and male infertility (Sawamura and reportedly hastens necrosis (Rooney and Stelly 1990). In Sano 1997). The fact that F plants from the cross (T65×P.T. the Gossypium case, no candidate gene information was B.10) and those from the cross (T65×P.T.B.7) both showed reported. Regarding the reproductive barrier in rice, causal semi-sterile panicles (Ichitani et al. unpublished results) also genes were cloned in an allelic interaction case: hetero- suggests that a gamete eliminator such as S (t) is attributable zygotes of Indica allele S5-i and Japonica allele S5-j at the to the segregating distortion in both cross combinations. S5 locus induce embryo-sac semi-sterility caused by partial However, the peaks of distortion differed between the two abortion of female gametes carrying the Japonica alleles. populations, implying that a gene(s) other than S (t) was Chen et al. (2008) cloned the S5 gene, demonstrating that responsible for the distortion in the three-way cross [A.D. S5 encodes an aspartic protease conditioning embryo-sac T.14×(T65×P.T.B.7)]. fertility, the allelic difference being very small at the Rice (2011) 4:29–38 35 sequence level. Chen et al. (2008) did not explain the Results of cluster analysis show that A.D.T.14 carrying molecular mechanism caused by the heterozygous form at Hwa1-1 belongs to indica, whereas P.T.B.10 carrying the S5 locus. In another case, causal genes of reproductive Hwa1-1 and P.T.B.7 carrying Hwa2-1 belong to aus, which barrier in rice, which had been thought to be allelic before, suggests a lack of relation between varietal differentiation proved to be a complex of two very tightly linked genes. At and the genotypes at the HWA1 and HWA2. However, the the hybrid male sterility locus Sa, heterozygotes of Indica three cultivars are insufficient to support discussion of the i j allele Sa and Japonica allele Sa exhibited male semi- distribution of these genes. Having learned recently that all sterility. Long et al. (2008) cloned the Sa gene, finding that the plant materials used by Oka (1957)havebeen it comprises two adjacently located genes, SaM and SaF, maintained in the National Institute of Genetics, Japan, we which respectively encode a small ubiquitin-like modifier plan to use these cultivars to find Hwa1-1-or Hwa2-1- E3 ligase-like protein and an F-box protein. Most Indica specific conserved haplotypes of DNA markers. Regarding + + cultivars contain a haplotype SaM SaF , whereas all HWC2 genes, we found that the DNA marker banding − − − Japonica cultivars have SaM SaF . Interaction of SaM patterns of 14 markers surrounding the HWC2 locus were + + and SaF in the presence of SaM is necessary for this male conserved completely among the 13 Hwc2-1 carriers sterility. (Kuboyama et al. 2009). We will find potential carriers In this study, the physical distance between the with the aid of DNA markers from our rice germplasm KGC11M1 and RM27122 markers was found to be collection and make test crosses to determine whether they 1,637 kb. According to the Rice Genome Annotation really carry the genes if such a haplotype is found in the Project (Ouyang et al. 2007, http://rice.plantbiology.msu. Hwa1-1 or Hwa2-1 carriers. We plan to add these gene edu/), more than 100 genes are located in the region. We carriers in the cluster analysis to confirm the relation were unable to determine whether Hwa1-1 and Hwa2-1 are between varietal differentiation and these genes. The allelic or not, but the possibility exists that heterozygotes increase in the number of gene carriers might disclose induce the hybrid weakness symptom. To elucidate their conserved haplotypes in the HWA1 or HWA2 locus, which relations, whether by tight linkage or allelism, larger help to identify the causal genes. mapping populations must be analyzed. To identify the causal genes and to confirm whether they A causal gene controlling hybrid necrosis in Arabidopsis are allelic or not, we are undertaking high-resolution was cloned. Reportedly, it encodes an NB-LRR protein mapping and linkage disequilibrium analysis of both (Bomblies et al. 2007). We fine-mapped HWC2 gene in HWA1 and HWA2 genes. We have also started physiological rice, and narrowed down the area of interest to 19 kb, and close morphological analyses of the hybrid weakness. identifying five candidate genes, one of which encodes an In three-way cross populations, there existed a few NB-LRR protein (Kuboyama et al. 2009). Alcázar et al. intermediate type plants between normal and weak ones, (2009) fine mapped a causal gene of incompatibility or partly because of diverse genetic backgrounds in the hybrid breakdown to a cluster of TIR-NB-LRR genes in populations (see Materials and methods). We are introduc- Arabidopsis. Yamamoto et al. (2010) reported that hbd3,a ing the Hwa1-1 gene from P.T.B.10 and A.D.T.14, and the causal gene controlling hybrid breakdown in rice, is located Hwa2-1 gene from P.T.B.7 in T65 genetic background by on the cluster of NB-LRR genes. These reports suggest that backcrossing to develop near-isogenic lines of these genes. plant immune systems conditioned by NB-LRR protein(s) Using these near-isogenic lines, we will evaluate the effects induce hybrid weakness, as reported by Bomblies and of these genes more exactly. Weigel (2007). According to the Rice Genome Annotation Project (Ouyang et al. 2007, http://rice.plantbiology.msu. edu/), two NB-LRR disease-resistance gene homologs, Materials and methods LOC_Os11g39160 and LOC_Os11g39260, and ten disease resistance-related genes containing NB-ARC domain are Plant materials located on the target region of HWA1 and HWA2, implying that these genes are causal genes. However, many other The three cultivars related to this hybrid weakness, P.T.B.7, genes are also located in the target region. No NB-LRR P.T.B.10, and A.D.T.14, were compared with the 13 disease resistance gene homolog is located in the HWC1 reference cultivars with regard to the banding patterns of target region (Ichitani et al. 2007). To clarify the funda- polyacrylamide gel electrophoresis of 39 PCR-based indel mental mechanism causing hybrid weakness, many cross markers (Fig. 2). Among the cultivars, Nipponbare and combinations causing hybrid weakness in various species Koshihikari are improved Japanese cultivars, and T65 is an should be studied at the molecular level. The cloning of improved Taiwanese cultivar. These three cultivars are HWA1 and HWA2 might provide new information related to generally classified as temperate Japonica. J-147 is a native hybrid weakness. cultivar in Japan (Sato and Morishima 1988). Ketan 36 Rice (2011) 4:29–38 Nangka, Azucena, and Jamaica are native cultivars respec- 30 s, 55°C for 30 s, and 72°C for 30 s with subsequent final tively originating in Malaysia, the Philippines, and Peru. extension of 72°C for 1 min. The PCR mixture (5 μl) They are generally classified as tropical Japonica. Three contained 1 ml of template DNA, 200 mM of each dNTP, cultivars generally classified as Indica are Guangluai 4, an 0.2 μM of primers, 0.25 units of Taq polymerase (AmpliTaq improved Chinese cultivar, and IR36 and IR24 developed Gold; Applied BioSystems), and 1× buffer containing by the International Rice Research Institute. Kele, Dular, MgCl . The PCR products were analyzed using electro- and Kasalath cultivars are native to India. Kele and Dular phoresis in 10% (29:1) polyacrylamide gel with subsequent are categorized as aus in Wan and Ikehashi (1997). Kasalath ethidium bromide staining and were viewed under ultravi- has been categorized as Indica in many studies; DNA olet light irradiation. Most PCR–based DNA markers used marker polymorphism has been observed with high for this study have already been published: Markers with an frequency between Kasalath and Japonica cultivars. asterisk in Fig. 2 were designed by RGP (http://rgp.dna. According to classification by Garris et al. (2005) based affrc.go.jp/E/publicdata/caps/index.html). Information relat- on SSR markers or Zhao et al. (2010) based on single ed to SSR markers was obtained from Panaud et al. (1996), nucleotide polymorphism—which divided rice cultivars Chen et al. (1997), Temnykh et al. (2001), McCouch et al. into temperate japonica, tropical japonica, indica, aus, (2002), and IRGSP (2005). Some primer pairs did not and one more group—Nipponbare and Koshihikari were perform well. Therefore, we redesigned them or developed classified as temperate japonica, Azucena as tropical new DNA markers. japonica, IR36 as indica, Kasalath as aus, and Dular as Most of the new markers were based on the indel between admixed. Nipponbare and an indica cultivar 93–11 (Shen et al. 2004)or For hybridization, flowering times of plant materials those between Nipponbare and Kasalath or an indica cultivar were mutually synchronized by the use of many sowing Guangluai 4 (Monna et al. 2006). Markers were named by dates. Seeds were sown in nurseries with plant spacing of adding KG to the original indel information ID, R*** (Shen 3×3 cm. One month after sowing, seedlings were trans- et al. 2004) or S**** (Monna et al. 2006). In redesigning or planted in a paddy field in the experimental farm of developing DNA markers, we made alignments of Nippon- Kagoshima University. bare genome sequence (IRGSP 2005), 93–11 genome The three-way cross populations in which HWA1 or sequence (Yu et al. 2002) and/or BAC-end sequence HWA2 gene segregated were grown in nurseries along with of Kasalath (http://rgp.dna.affrc.go.jp/blast/runblast.html, parental cultivars and F plants inducing the weakness. Katagiri et al. 2004) using DNAsis Pro (Hitachi Software Plant spacing was 3×6 cm. Engineering Co.). Primer design was performed using Primer 3(Rozen andSkaletsky 2000). The sequences of primers DNA marker analysis designed in this study are presented in Table 2. The DNA of the cultivars used in the cluster analysis was Cluster analysis extracted according to Dellaporta et al. (1983) with some modifications. The DNA of the mapping populations was Genetic relations among the 16 cultivars (Fig. 2) were extracted according to the experimental protocols of Rice evaluated using the 39 DNA markers. Each fragment size Genome Research Program (RGP) (http://rgp.dna.affrc.go. was treated as a unique characteristic, and scored as present jp/E/rgp/protocols/index.html, written in Japanese) with (1) or absent (0). The data matrix was used to calculate some modifications. Briefly, each young leaf tip, 2 cm long genetic similarities using the Jaccard coefficient (Jaccard from a single plant, was put on a well in a 96-deep well 1908). A phenogram was constructed using the unweighted plate. Then 100 μl of extraction buffer (100 mM Tris–HCl pair-group method with the arithmetic mean (UPGMA) (pH 8.0), 1 M KCl, and 10 mM EDTA) were added with a with software (NTSYS-pc ver. 2.2; Exeter Software). 5-mm-diameter stainless steel ball in a well. After covering with a hard lid, the plate was shaken hard (ShakeMaster ver. Mapping strategy 1.2; BioMedical Science Inc.) for a minute to grind the leaves. After centrifuging, a plate was incubated at 70°C for About 1 month after the sowing date, the seedlings in the an hour. Then 9 μl of supernatant was recovered and 7 μlof three-way cross populations, [P.T.B.7×(T65×P.T.B.10)] (n= 2-propanol was added. After centrifuging, the supernatant 176) and [A.D.T.14×(T65×P.T.B.7)] (n=175), developed was discarded and the DNA pellet was rinsed with 50 μlof three to four leaves. Plants of two types appeared. One type 70% ethanol. The DNA pellet was dried and dissolved in was characterized by the yellowing of leaf tips and weak 50 μl of sterilized distilled water. growth as F plants (Fig. 1). It was categorized as a weak The PCR conditions for indel and SSR markers used for plant carrying both Hwa1-1 and Hwa2-1 genes. Another this study were 95°C for 10 min, 40 cycles of 94°C for type showed normal growth as parental cultivars. It was Rice (2011) 4:29–38 37 Bomblies K, Weigel D. Hybrid necrosis: autoimmunity as a potential categorized as a normal plant carrying only Hwa1-1 or gene-flow barrier in plant species. Nat Rev Genet. 2007;8:382–93. Hwa2-1. The tips of lower leaves of normal plants Chen J, Ding J, Ouyang Y, Du H, Yang J, Cheng K, et al. A triallelic sometimes yellowed also, but the tips of upper leaves system of S5 is a major regulator of the reproductive barrier and remained green. In contrast, in weak plants, all leaf tips compatibility of indica–japonica hybrids in rice. Proc Natl Acad Sci USA. 2008;105:11436–41. except those of the youngest (still expanding) ones Chen X, Temnykh S, Xu Y, Cho YG, McCouch SR. Development of a yellowed. Therefore, the difference between weak plants microsatellite framework map providing genome-wide coverage and normal plants was clear in most cases. A few in rice (Oryza sativa L.). Theor Appl Genet. 1997;95:553–67. intermediate type plants could not be categorized into the Dellaporta SL, Wood J, Hicks JB. A plant DNA minipreparation: version II. Plant Mol Biol Rep. 1983;1:19–21. above two types. They were excluded from analyses. Garris AJ, Tai TH, Coburn J, Kresovich S, McCouch S. Genetic For HWA1 mapping, a total of 83 DNA markers structure and diversity in Oryza sativa L. Genetics. distributed on the whole rice genome were used: 24 2005;169:1631–8. polymorphic indel markers in Fig. 2, an indel marker Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y, et al. A high-density rice genetic linkage map with 2275 markers named S21074 designed by RGP, another indel marker using a single F population. Genetics. 1998;148:479–94. named Knindel1 (Matsubara et al. 2007), a sequence Ichitani K, Fukuta Y, Taura S, Sato M. Chromosomal location of characterized amplified region (SCAR) marker named d Hwc2, one of the complementary hybrid weakness genes, in rice. (Ueda et al. 2005), and 56 published SSR markers. For Plant Breeding. 2001;120:523–5. Ichitani K, Namigoshi K, Sato M, Taura S, Aoki M, Matsumoto Y, et HWA2 mapping, a total of 84 DNA markers distributed on al. Fine mapping and allelic dosage effect of Hwc1,a the whole rice genome were used: the 23 polymorphic indel complementary hybrid weakness gene in rice. Theor Appl Genet. markers presented in Fig. 2, 59 SSR markers, and two indel 2007;114:1407–15. markers designed by RGP—S21074 and S5865. International Rice Genome Sequencing Project (IRGSP). The map- based sequence of the rice genome. Nature. 2005;436:793–800. In each mapping population, six typical weak plants and Jaccard P. Nouvelles recherches sur la distribution florale. Bull Soc six typical normal plants were selected and subjected to Vaudoise Sci Nat. 1908;44:223–70. preliminary linkage analysis with DNA markers, with the Katagiri S, Wu J, Ito Y, Karasawa W, Shibata M, Kanamori H, et al. result that the linkage of HWA1 and HWA2 with RM5349 End sequencing and chromosomal in silico mapping of BAC clones derived from an indica rice cultivar, Kasalath. Breed Sci. (McCouch et al. 2002) and RM224 (Chen et al. 1997) was 2004;54:273–9. visible on the long arm of chromosome 11. Then linkage Kinoshita T. Proposal for rules of gene symbolization. Rice Genet analysis using all the plants in the mapping populations and Newsl. 1984;1:4–15. polymorphic DNA markers surrounded by RM5349 and Kosambi D. The estimation of map distance from recombination values. Ann Eugen. 1944;12:172–5. RM224 was conducted using a computer program (Map- Kuboyama T, Saito T, Matsumoto T, Wu J, Kanamori H, Taura S, et al. Disto ver. 1.7; Lorieux 2007). Map distances were Fine Mapping of HWC2, a complementary hybrid weakness estimated using the Kosambi function (Kosambi 1944). gene, and haplotype analysis around the locus in rice. Rice. 2009;2:93–103. Lee JA. Genetics of D complementary lethality in Gossypium Acknowledgments We gratefully acknowledge Dr. Atsushi hirsutum and G. barbadense. J Hered. 1981;72:299–300. Yoshimura of Kyushu University and Dr. Lisa Monna of the Plant Long Y, Zhao L, Niu B, Su J, Wu H, Chen Y, et al. Hybrid male Genome Center for valuable information related to DNA polymor- sterility in rice controlled by interaction between divergent alleles phism in rice. We are also grateful to Dr. Yo-Ichiro Sato of the of two adjacent genes. Proc Natl Acad Sci USA. Research Institute for Humanity and Nature, the Genebank of the 2008;105:18871–6. National Institute of Agrobiological Sciences for the kind provision of Lorieux M. 2007. MapDisto, a free user-friendly program for rice cultivars. This work was funded by the Ministry of Education, computing genetic maps. Computer demonstration (p958) given Culture, Sports, Science and Technology. at the plant and animal genome XV conference, Jan 13–17 2007, San Diego, CA. URL: http://mapdisto.free.fr/. Matsubara K, Ito S, Nonoue Y, Ando T, Yano M. A novel gene responsible for hybrid breakdown found in a cross between japonica and indica References cultivars in rice. Rice Genet Newsl. 2007;23:11–3. McCouch SR, Teytelman L, Xu Y, Lobos KB, Clare K, Walton M, et Alcázar R, García AV, Parker JE, Reymond M. Incremental steps al. Development and mapping of 2240 new SSR markers for rice toward incompatibility revealed by Arabidopsis epistatic inter- (Oryza sativa L.). DNA Res. 2002;9:199–207. actions modulating salicylic acid pathway activation. Proc Natl McCouch SR, Committee on Gene Symbolization, Nomenclature and Acad Sci USA. 2009;106:334–9. Linkage, Rice Genetics Cooperative (CGSNL). Gene nomencla- Amemiya A, Akemine H. Biochemical genetic studies on the root ture system for rice. Rice. 2008;1:72–84. growth inhibiting complementary lethals in rice plant (Studies on Miura K, Ashikari M, Matsuoka M, Hsing YIC. Mapping of the lazy the embryo culture in rice plant. 3). Bull Nat Inst Agric Sci D. gene, la. Rice Genet Newsl. 2003;20:29–30. 1963;10:139–226. in Japanese with English summary. Monna L, Ohta R, Masuda H, Koike A, Minobe Y. Genome-wide Bomblies K, Lempe J, Epple P, Warthmann N, Lanz C, Dangl JL, et al. searching of single-nucleotide polymorphisms among eight Autoimmune response as a mechanism for a Dobzhansky-Muller- distantly and closely related rice cultivars (Oryza sativa L.) and type incompatibility syndrome in plants. PLoS Biol. 2007; a wild accession (Oryza rufipogon Griff.). DNA Res. 9:1962–72. 2006;13:43–51. 38 Rice (2011) 4:29–38 Oka HI. Phylogenetic differentiation of cultivated rice. XV. Comple- Shii CT, Mok MC, Temple SR, Mok DWS. Expression of develop- mentary lethal genes in rice. Jpn J Genet. 1957;32:83–7. mental abnormalities of Phaseolus vulgaris L. Interaction Ouyang S, Zhu W, Hamilton J, Lin H, Campbell M, Childs K, et al. between temperature and allelic dosage. J Hered. 1980;71:219– The TIGR rice genome annotation resource: improvements and 22. new features. Nucleic Acid Res. 2007;35:D883–7. Temnykh S, DeClerck G, Lukashova A, Lipovich L, Cartinhour S, Panaud O, Chen X, McCouch SR. Development of microsatellite McCouch S. Computational and experimental analysis of micro- markers and characterization of simple sequence length poly- satellites in rice (Oryza sativa L.): frequency, length variation, morphism (SSLP) in rice (Oryza sativa L.). Mol Gen Genet. transposon associations, and genetic marker potential. Genome 1996;252:597–607. Res. 2001;11:1441–52. dav Rooney WL, Stelly DM. Genetic effects on the timing of Le Tezuka T, Kuboyama T, Matsuda T, Marubashi W. Possible involve- induced necrosis of cotton. Crop Sci. 1990;30:70–4. ment of genes on the Q chromosome of Nicotiana tabacum in Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and expression of hybrid lethality and programmed cell death during for biologist programmers. In: Krawetz S, Misener S, editors. interspecific hybridization to Nicotiana debneyi.Planta. Bioinformatics methods and protocols: methods in molecular 2007;226:753–64. biology. Totowa: Humana Press; 2000. p. 365–86. Ueda T, Sato T, Hidema J, Hirouchi T, Yamamoto K, Kumagai T, et al. Saito T, Ichitani K, Suzuki T, Marubashi W, Kuboyama T. Develop- qUVR-10, a major quantitative locus for ultraviolet-B resistance mental observation and high temperature rescue from hybrid in rice, encodes cyclobutane pyrimidine dimer photolyase. weakness in a cross between Japanese rice cultivars and Peruvian Genetics. 2005;171:1941–50. rice cultivar ‘Jamaica’. Breed Sci. 2007;57:281–8. Wan J, Ikehashi H. Identification of two types of differentiation in Samora PJ, Stelly DM, Kohel RJ. Localization and mapping of the Le and cultivated rice (Oryza sativa L.) detected by polymorphism of Gl loci of cotton (Gossypium hirsutum L.). J Hered. 1994;85:152–7. isozymes and hybrid sterility. Euphytica. 1997;94:151–61. Sato YI, Sano Y, Nakagahra M. Gene symbols for gametic effect, Yamamoto E, Takashi T, Morinaka Y, Lin S, Wu J, Matsumoto T, et al. sterility and weakness. Rice Genet Newsl. 1987;4:46–51. Gain of deleterious function causes an autoimmune response and Sato YI, Morishima H. Distribution of the genes causing F chlorosis Bateson–Dobzhansky–Muller incompatibility in rice. Mol Genet in rice cultivars of the Indica and Japonica types. Theor Appl Genomics. 2010;283:305–15. Genet. 1988;75:723–727. Yu J, Hu S, Wang J, Wong GK, Li S, Liu B, et al. A draft sequence of Sawamura N, Sano Y. Chromosomal location of gamete eliminator, the rice genome (Oryza sativa L. spp. indica). Science. S (t), found in an Indica-Japonica hybrid. Rice Genet Newsl. 2002;296:79–92. 1996;13:70–2. Zhao K, Wright M, Kimball J, Eizenga G, McClung A, Kovach M, et Shen YJ, Jiang H, Jin JP, Zhang ZB, Xi B, He YY, et al. Development al. Genomic diversity and introgression in O. sativa reveal the of genome-wide DNA polymorphism database for map-based impact of domestication and breeding on the rice genome. PLoS cloning of rice genes. Plant Physiol. 2004;135:1198–205. One. 2010;5:e10780. doi:10.1371/journal.pone.0010780.

Journal

Rice – Springer Journals

Published: Jun 24, 2011

There are no references for this article.