Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/springer-journals/delivery-of-microrna-302a-3p-by-aptes-modified-hydroxyapatite-7bJdr0EguK
- Publisher
- Springer Journals
- Copyright
- Copyright © The Author(s) 2023
- eISSN
- 2056-807X
- DOI
- 10.1038/s41405-023-00135-x
- Publisher site
- See Article on Publisher Site
Abstract
www.nature.com/bdjopen ARTICLE OPEN Delivery of microRNA-302a-3p by APTES modified hydroxyapatite nanoparticles to promote osteogenic differentiation in vitro 1,2 3 3✉ 1,2,4 Pirawish Limlawan , Laurine Marger , Stéphane Durual and Anjalee Vacharaksa © The Author(s) 2023 OBJECTIVE: To demonstrate the miRNA delivery by hydroxyapatite nanoparticles modified with APTES (HA-NPs-APTES) and promote osteogenic gene expression. MATERIALS AND METHODS: Osteosarcoma cells (HOS, MG-63) and primary human mandibular osteoblasts (HmOBs) were co- cultured with HA-NPs-APTES conjugated with miRNA-302a-3p. Resazurin reduction assay was performed to evaluate HA-NPs-APTES biocompatibility. Intracellular uptake was demonstrated by confocal fluorescent and scanning electron microscopy. The miRNA- 302a-3p and its mRNA targets expression levels including COUP-TFII and other osteogenic genes were assessed by qPCR on day1 or day5 post-delivery. Calcium deposition induced by the osteogenic gene upregulation was shown by alizarin red staining on day7 and 14 post-delivery. RESULTS: Proliferation of HOS cells treated with HA-NPs-APTES was similar to that of untreated cells. HA-NPs-APTES was visualized in cell cytoplasm within 24 hours. MiRNA-302a-3p level was upregulated in HOS, MG-63 and HmOBs as compared to untreated cells. As a result, COUP-TFII mRNA expression was reduced, followed by an increase of RUNX2 and other osteogenic genes mRNA expression. Calcium deposition induced by HA-NPs-APTES-miR-302a-3p in HmOBs was significantly higher than in untreated cells. CONCLUSION: HA-NPs-APTES may support the delivery of miRNA-302a-3p into bone cells, as assessed by osteogenic gene expression and differentiation improvement once this combination is used on osteoblast cultures. BDJ Open (2023) 9:8 ; https://doi.org/10.1038/s41405-023-00135-x INTRODUCTION diseases [9]. They function as post-transcriptional regulators The critical-sized bone defects after trauma, diseases, or surgical leading to mRNA degradation after binding to the untranslated procedures are defects that cannot be completely healed by the regions of mRNA [10]. The regulatory role of miRNAs has been physiological wound healing process. Thus, special surgical reported in many biological processes [11] including bone interventions mostly require bone tissue engineering to enhance formation [12]. Among the vast reservoir of the potentially healing [1]. Basically, bone tissue engineering principle consists in bioactive molecules, miRNA-302a-3p was reported to stimulate a triad composed of a bone scaffold, bioactive molecules and cells. murine osteoblast differentiation by blocking the repression The scaffold must be biocompatible and present physical and exercised from COUP-TFII on RUNX2 expression [13]. Its over- mechanical properties compatible with natural bone. Once placed expression is also active on osteoclastogenesis by regulating in a defect, it will act as a framework for cells to adhere and RANKL expression in human mandibular osteoblasts [14,15]. differentiate to finally form new bone tissue [2]. The scaffold may Beyond molecular effects, miRNAs suffer from poor biocompa- be supplemented with bioactive molecules such as growth factors tible—and efficient methods of delivery. The challenges of or oligonucleotides delivered by nanocarriers which play an delivering bare miRNAs include 1—poor cellular uptake of miRNA essential role in promoting the cell proliferation and differentia- due to an overall-negative charge, 2—a short half-life under tion at the defect sites [2, 3]. Nanoparticles act as carriers for drugs physiological conditions and 3—the triggering of a potentially and oligonucleotides to facilitate their cellular uptake. Several unfavorable immune response [16]. The delivery system should materials are being studied as nanocarriers such as Poly(DL- stabilize small RNAs from degradation by nuclease enzyme and lactide-co-glycolide) (PLGA) [4], gold [5], SiO [6], and chitosan [7], target them to the desired cell compartment within an optimal they represent a very active and actual field of study [8]. timing [17]. Cationic polyethyleneimine (PEI) or PLGA nanoparti- MicroRNAs (miRNAs) are small, non-coding, single-stranded cles served for example as excellent carriers for miRNA but RNA which are currently used in a therapeutic approach for many resulted in high cell cytotoxicity [18]. Lipid-based nanoparticles 1 2 Department of Microbiology, Faculty of Dentistry, Chulalongkorn University, Pathumwan, Bangkok 10330, Thailand. Research Unit on Oral Microbiology and Immunology, Faculty of Dentistry, Chulalongkorn University, Pathumwan, Bangkok 10330, Thailand. Biomaterials Laboratory, Division of Fixed Prosthodontics and Biomaterials, University Clinics of Dental Medicine, University of Geneva, 1 Rue Michel Servet, 1204 Geneva, Switzerland. Master of Science Program in Geriatric Dentistry and Special Patients Care, Faculty of Dentistry, Chulalongkorn University, Pathumwan, Bangkok 10330, Thailand. email: Stephane.Durual@unige.ch Received: 15 December 2022 Revised: 26 January 2023 Accepted: 6 February 2023 1234567890();,: P. Limlawan et al. Table 1. Primer sequence used in the study. Primer Sequence Forward Reverse miRNA-302a-3p UAAGUGCUUCCAUGUUUUGGUGA N/A RNU6-2 GTGCTCGCTTCGGCAGCACA N/A COUP-TFII CAAGGCCATAGTCCTGTTCACC CGTACTCTTCCAAAGCACACTGG RUNX2 CCGGAATGCCTCTGCTGTTATGA ACTGAGGCGGTCAGAGAACAAACT ALP CGAGATACAAGCACTCCCACTTC CTGTTCAGCTCGTACTGCATGTC OCN CTAGAGCGGGCCGTAGAAGCG ATGAGAGCCCTCACACTCCTC OSX CGGGACTCAACAACTCT CCATAGGGGTGTGTCAT GAPDH TCATGGGTGTGAACCATGAGA GCTAAGCAGTTGGTGGTGCA also efficiently deliver nucleic acid into the cell but may induce (FBS; Hyclone® Thermo scientific, Northumberland, UK), 1% antibiotic- antimycotic at 37 °C in a humidified atmosphere of 5% CO . To prepare immune responses, and their short half-life strongly limits their osteogenic medium, 0.05 mM ascorbic acid 2-phosphate, 100 nM dex- usage [19]. amethasone, 10 mM b-glycerophosphate (Sigma-Aldrich) was added to the Hydroxyapatite nanoparticles (HA-NPs) may represent an culture medium. Osteogenic medium was changed every 2-3 days. attractive solution [20, 21]. As they share common biochemical structures with natural bone, they present excellent biocompat- Conjugation of miRNA on HA-NPs-APTES and delivery to cells ibility and osteogenic properties. They bind efficiently to HOS, MG63 or HmOBs cells (10 cell/well) were cultured in 12-well plate for nucleotides via electrostatic forces between the positive charge 24 hours. To prepare HA-NPs-APTES-miR, 50 µg/ml HA-NPs-APTES mixed with of calcium ion and the negative charge of phosphate ions [22, 23]. 5 nM miRNA-302a-3p (Qiagen, Hilden, Germany) in 10 µl RNase free water Most of all, the nanoparticles are easily reproduced by common was dropped in 990 µl DMEM culture medium. Then, the suspension was laboratory reagents and procedures. We demonstrated in a added to the cultures. After 24 hours or 5 days, cells were harvested for RNA previous study that HA-NPs surface charge can be improved via extraction. HA-NPS-APTES without miRNA were also added as control group. a 3-aminopropyltriethoxysilane (APTES) chemical treatment. This modification resulted in a higher miRNA condensation and better Resazurin assay HA-NPs uptake by osteoblasts [21]. By taking advantage of To evaluate the effect of bare nanoparticles on cell metabolic activity and surface-modified HA-NPs properties, our purpose is to demon- proliferation, HOS cells (3000 cells/well) were cultured in 24-well plate for strate that miRNA-302a-3p may be delivered in osteoblasts 24 hours. Then, HA-NPs-APTES (20, 50 and 100 µg/ml) in DMEM was added resulting in stimulation of osteoblast differentiation promptly to the medium. Cells metabolic activity was assessed at day 4, 7, 11, 14 and in vitro. 21 by using resazurin assay as described in previous study [24]. Briefly, 0.1 µg/ml resazurin (Sigma-Aldrich, MO, USA) in DMEM was added to the cultures for 4 hours before the supernatant was collected for OD measurement at 570 and 630 nm. The percentage of resazurin reduction MATERIALS AND METHODS was then calculated. Hydroxyapatite modified with 3-aminopropyltriethoxysilane (APTES) nanoparticles synthesis HA-NPs were synthesized and then surface modified by APTES as Fluorescent microscopy imaging previously described [21]. Briefly, 4 mL oleic acid and 16 mL ethanol were HOS cells (10 cell/well) were cultured in 8-well culture slide (ibidi, added into 7.5 mL of the 0.25 M calcium nitrate solution containing 0.5 g Germany, Cat.No:80826) for 24 hour to reach 80% confluency. Then, FitC polyethylene glycol (PEG6000) to prepare the mixture. The phosphate tagged HA-NPs-APTES (50 µg/ml) were added and co-cultured for the next solution (0.15 M, 7.5 mL) was then dropped to the above mixture with 24 hours. Then, cells were washed and stained by 5 µg/ml FM® 4-64 agitation. The pH of the mixture was immediately adjusted to 10 with lipophilic styryl dye (Thermo Fisher scientific, MA, USA) on ice for ammonia solution, then was hydrothermally treated at 120 °C for 10 h in a 5 minutes, and fixed with 4% formaldehyde for 10 minutes on ice. Cells Teflon-lined autoclave, and finally water-cooled to room temperature. HA- were washed 3 times with Hanks’ balanced salt solution (HBSS; Invitrogen, NPs were collected by centrifugation, washed, and subsequently dried CA, USA, Cat.No:14175079). Nikon A1r (Nikon, Tokyo, Japan) Spectral overnight. For surface modification with APTES, HA-NPs (0.2 g) were confocal microscope was used to visualize nanoparticle inside cells by resuspended in 20 mL solution of APTES in anhydrous toluene (2.5% v/v) capturing Z-stack images with 50 µm distance between each image. The and stirred at room temperature for 3 h. Then, HA-NPs-APTES were 3D-constructed images and animation were processed by Imaris 9.5 collected by centrifugation, and washed with toluene to remove excess (Oxford instruments) software. APTES. HA-NPs were dried at 60 °C for 24 h to produce the HA-NPs presented with terminal –NH groups. Scanning electron microscopy (SEM) To facilitate HA-NPs-APTES visualization after being internalized in HOS, Scanning electron microscopy (Sigma 300 VP, Zeiss, Oberkochen, a fluorescent tag (FitC) was added. HA-NPs-APTES (50 mg) were dispersed Germany) was used to visualize morphology of HOS cells treated with in 0.2 mg/mL of FITC (Merck KGaA, Darmstadt, Germany) in ethanol and HA-NPs-APTES. HOS cells (1 × 10 /well) were cultured with 50 µg/ml HA- stirred for 24 h. Then, FITC-tagged particles were centrifuged and washed NPs-APTES for 24 hours. Before imaging, samples were fixed in 4% with ethanol. HA-NPs-APTES-FITC were dried at 60 °C for 24 h. formaldehyde for 10 min then rinsed with 0.9% normal saline and dehydrated with serial concentration of ethanol from 60 to 100% then Cell culture coated with a 20 µm thick layer of gold. The study was approved by the ethics committee, Faculty of Dentistry, Chulalongkorn University (HREC-DCU 2022-038). Human mandibular Reverse transcription and quantitative polymerase chain primary osteoblasts (HmOBs) were collected and cultured as previously reaction described [21]. The primary human osteoblasts from passage 5-8 were Total RNA was extracted by Trizol lysis reagent (Invitrogen, CA, USA,) used in the following experiments. Human osteosarcoma cell lines, HOS according to the manufacturer protocol. One microgram of total RNA was (CRL-1543, ATCC) and MG63 (CRL-1427, ATCC), were cultured with converted to cDNA by miScript II RT Kit (Qiagen, Hilden, Germany) on a Dulbecco’s Modified Eagle’s Medium with L-glutamine (DMEM; Gibco® thermal cycler (LifePro, Bioer, Hangzhou, China). For detection of miRNA, by Life Technologies, NY, USA) supplement with 10% fetal bovine serum BDJ Open (2023) 9:8 P. Limlawan et al. quantitative PCR was performed using Quantitect SYBR Green PCR Master APTES-miR. The nanoparticles were given only one time. The media was mix (Qiagen, Hilden, Germany) on PCR detection system (StepOnePlus, replaced every 2-3 days. After 7 or 14 days, the supernatant was removed Applied Biosystem, CA, USA). The sequences of miRNA-302a-3p and RNU6- and HmOBs were washed with PBS 2 times and then fixed with cold 2 primers are shown in Table 1. The PCR condition was 95 °C for 15 min methanol for 10 min. After fixing, cells were washed with deionized water followed by 40 cycles of amplification consisting of 94 °C for 15 sec, 55 °C then stain with Alizarin red stain for 2 min. After staining, cells were for 30 sec, and 70 °C for 30 sec. The expression level of miRNA was washed with deionized water and dried in room air. normalized to miScript PCR controls RNU6-2. Alizarin red was quantified by adding 20% methanol and 10% acetic For detection of other genes, quantitative PCR was performed using a acid in the stained plate. After 15 minutes, liquid is transferred to measure SensiFAST™ Kit (Meridian bioscience, MI, Italy, Cat.no BIO-82005) on PCR optical density at a wavelength of 405 nm. detection system (StepOnePlus, Applied Biosystem, CA, USA). Primer sequences for GAPDH, COUP-TFII, RUNX2, ALP, OCN, and OSX are shown in Statistical analysis Table 1. The PCR condition was 95 °C for 2 min, followed by 40 The data were expressed as the mean values ± standard deviation. Data amplification cycles consisting of 95 °C for 15 seconds, 60 °C for normalities were tested, and statistical analyses were performed by one 30 seconds. Reactions were performed in duplicate, and averages were way analysis of variance and Tukey post hoc or Student’s t-test by SPSS v used for analysis. GAPDH expression was used as an internal control. Fold 21.0 statistical software package. The differences were considered -ΔΔCT expressions were calculated by 2 method. statistically significant when p value is equal or less than 0.05. Alizarin red staining of calcium deposition HmOBs (10 cells/well) were cultured in 6-well plate overnight, then HA- RESULTS NPs-APTES or HA-NPs-APTES-miR were added in culture media. For Proliferation of HOS cells after HA-NPs-APTES treatment osteogenic media group, after cells seeding overnight the culture media The percentage of resazurin reduction, reflecting the number of was replaced with osteogenic media along with HA-NPs-APTES or HA-NPs- living cells, gradually increased from day 4 to day 21 in all concentrations of HA-NPs-APTES (Fig. 1). After 4 days of culture, decrease in resazurin reduction was observed with all HA-NPs-APTES concentrations when compared to untreated control (20 µg/ml = 21.34 ± 0.46%, 50 µg/ml = 21.32 ± 0.69%, 100 µg/ml = 19.76 ± 0.88%, control = 34.91 ± 7.97%). This difference remained visible only for 100 µg/ml HA-NPs-ATPES at day 7 (26.8 ± 1.52%, control = 38.89 ± 2.42%) and the whole conditions behave the same until day 21. The highest HA-NPs-APTES concentration with the lower effect on cell proliferation on day 7 was chosen to be tested for intracellular uptake and osteogenic differentiation. Therefore, 50 µg/ml HA-NPs-APTES were used in the following experiments for the rest of the study. Visualization of HA-NPs-APTES uptake by HOS Fig. 1 Resazurin reduction of HOS after treatment with HA-NPs- After 24 hours of culture with HA-NPs-APTES-FitC, cells were APTES. Three concentrations (20, 50 and 100 µg/ml) of HA-NPs- visualized by confocal microscopy. HA-NPs-APTES internalization APTES were added to culture medium. Resazurin assay were done at was confirmed by serial Z-stack images (Fig. 2, Supplementary day 4, 7, 11, 14 and 21. Graphs represent means from 3 replicates video 1-3). Particles were localized in cytoplasm compartment with standard deviation. Student’s t-test demonstrated significant outside the nucleus; however, it was not possible to discriminate differences of resazurin reduction in treated cells when compared to whether they were contained into organelles or in the cytoplasm. the control. *p ≤ 0.05. Fig. 2 3D construct image of HA-NPs-APTES uptake by HOS cells. Representative area from culture plate is selected. Serial Z-stack images were captured with range of 50 µm between each image. A 3D model from Z-stack images, B 3D model showed single cell, C Selected area of vertical section, D Vertical section of area selected in C. Scale bar = 5 µm. BDJ Open (2023) 9:8 P. Limlawan et al. Fig. 3 SEM imaging of HA-NPs-APTES uptake by HOS cells. Morphology of cells after treatment with HA-NPs-APTES for 24 hours. A 700× magnification showing multiple cells with HA-NPs-APTES. B 2500× magnification showing HA-NPs-APTES in one cell. C, D 10,000× magnification showing rod-shaped nanoparticles inside the cell. The dark squares seen in the figure were artifacts due to high voltage, the images were not modified. Internalization and localization in close vicinity to nuclei were using alizarin red staining (Fig. 5A). Effects of miRNA 302a-3p were confirmed in SEM images. Membrane integrity was preserved assessed in normal culture medium, or in osteogenic medium. above HA-NPs-APTES (Fig. 3). In normal medium (Fig. 5B), HmOBs showed a detectable level of mineralization that slightly increased from day 7 to 14. Upon Delivery of miRNA302a-3p by HA-NPs-APTES and its effect on stimulation with osteogenic medium (Fig. 5C), this expression was osteogenic differentiation improved by 2 and 5 folds on day 7 and 14, respectively. By Effects on gene expression. To demonstrate that HA-NPs-APTES contrast, HA-NPs-APTES induced higher cell mineralization in can deliver functional miRNA, miRNA 302a-3p conjugated to HA- normal culture medium which increased from day 7- 14. In NP-APTES (HA-NPs-APTES-miR) were suspended in the culture osteogenic medium, an additional effect on cell mineralization medium of the osteosarcoma cells, HOS and MG63, and the was induced by the HA-NPs-APTES alone, either on 7 or 14 days. primary human mandibular osteoblasts (HmOBs). After 1 and Increase of miRNA 302a-3p by adding HA-NPs-APTES-miR, how- 5 days of culture, the expression of miRNA 302a-3p and mRNAs ever, significantly improved cell mineralization induced by HA-NPs- including COUP-TFII, RUNX2, ALP, OCN and OSX were assessed by APTES alone, by approximately 20% on day 7 and 14, either in normal qPCR. Cells in contact with HA-NPs-APTES alone-without miR were or osteogenic medium. Whichever treatment applied on HmOBs, cell added for a control condition. morphology remained normal, depicting a confluent layer of fusiform On day 1, the expression of miRNA 302a-3p was significantly cells. Once cells were stained with alizarin red, calcium deposition 5 5 increased to 2.81 × 10 ± 0.90 × 10 folds in HOS and could be easily observed (Fig. 5D). HmOBs proliferation rate of cells 5 5 5.84 × 10 ± 2.76 × 10 folds in MG63, higher than the baseline with HA-NPs-APTES and HA-NPs-APTES-miR remained consistent control receiving HA-NPs-APTES alone-without miR (Fig. 4A, B). On with the control cells without any treatment. day 5, miRNA 302a-3p expression was slightly lower than day 1, however the relative expression remained significantly higher than the baseline control (Fig. 4A, B). In HmOBs, miRNA 302a-3p DISCUSSION 4 4 expression was increased to 8.81 × 10 ± 0.95 × 10 folds on day 1, In the present report, we conducted experiments to show that HA- 4 4 and to 6.49 × 10 ± 0.3 × 10 folds on day 5 (Fig. 4C). NPs-APTES were biocompatible to be internalized by osteoblastic An increase of miRNA 302a-3p in HOS, MG63 and HmOBs cells and therefore HA-NPs-APTES can serve as a carrier for miRNA resulted in a modulation of the target gene expression. Those delivery. After internalized, the miRNA-302a-3p was overexpressed included down regulation of COUP-TFII, up-regulation of RUNX2, and regulated osteogenic gene expression. ALP and OCN. By contrast, OSX expression was not modified. The The biocompatibility of the HA-NPs-APTES was assessed in HOS effect of miRNA 302a-3p on the target genes were more osteoblastic cells cultured with multiple concentrations of the pronounced on day 5 in HOS and day 1 in MG63 but remained nanoparticles. A delay in HOS proliferation was observed during stable over time in HmOBs (Fig. 4A–C). the initial stages, up to 4 days in culture. This delay was however surpassed after 7 days, except for the highest concentration Effects on cell differentiation—mineralization. Calcium deposition (100 µg/ml) that needed 3 more days for a complete restoration to induced by osteogenic gene expression was then visualized in normal cell proliferation. The high concentration of hydroxyapatite HmOBs treated with HA-NPs-APTES and HA-NPs-APTES-miR by nanoparticles at 1 mg/ml are known to reduce viability of BDJ Open (2023) 9:8 P. Limlawan et al. Fig. 4 Delivery of functional miRNA 302a-3p by HA-NPs-APTES. Expression of miRNA-302a-3p, COUP-TFII and osteogenic genes in HOS MG63 cell lines and HmOBs were measured by qPCR. A HOS cells at 1 and 5 days of treatment with HA-NPs-APTES-miRNA. B MG63 cells at 1 and 5 days of treatment with HA-NPs-APTES-miRNA. C HmOBs at 1 and 5 days of treatment with HA-NPs-APTES-miRNA. Student’s t-test demonstrated significant differences in miRNA and mRNA expression in HA-NPs-APTES-miR treated cells compared to HA-NPs-APTES treated cells at the same date. Expressions of miRNA were normalized to the RNU6-2 gene. Expressions of mRNA were normalized to GAPDH gene. *p ≤ 0.05, **p < 0.01, ***p < 0.001. osteoblast cells [25], which is consistent with our results. Likewise, The HA-NPs-APTES-miR were internalized in cell cytoplasm, as other study found that high concentrations of calcium ion coming shown by confocal microscopy and SEM images. MiRNA-302a-3p from HA-NPs dissolution could decrease proliferation of mesench- was then highly expressed inside the cells to function on its ymal stem cells [26]. Most of the HA-NPs-APTES in our conditions targets, as demonstrated by reduction of COUP-TFII mRNA were dissolved after 7 days in culture. Even if we did not measure expression and osteoblastic gene upregulation. As the mechanism Ca ions concentrations, we assume that it was largely decreased of delivery, we hypothesized that miRNA and HA-NPs-APTES from day 7 and that it may explain the concomitant proliferation escaped the endosomal pathway by the proton sponge effect [27]. recovery in treated cells. According to cell biocompatibility, this Indeed, cationic nanoparticles like HA-NPs-APTES are dissolved in study was conducted with the highest nanoparticle concentration acidic endosomes upon endocytosis. Increasing Ca concentration at 50 µg/ml that did not affect cell proliferation on day 7. Since our inside these particles creates an osmotic current of fluids inside previous study demonstrated that the maximal nanoparticles these particles whose membranes eventually rupture to release concentration allowed a maximal condensation of miRNA ,we their content inside the cytoplasm [28]. assumed that this concentration would be the most efficient in With the aim to create bone substitutes with osteoinductive terms of miRNA delivery as well as of cell proliferation and properties, we used the miRNA-302a-3p, a potent activator of differentiation. osteogenic differentiation of mouse osteoblasts [13]and that is BDJ Open (2023) 9:8 P. Limlawan et al. Fig. 5 Alizarin red staining of HmOBs treated with HA-NPs-APTES or HA-NPs-APTES-miR. A HmOBs were cultured with HA-NPs-APTES or HA-NPs-APTES-miR in normal culture medium or osteogenic medium. The culture plates were examined and photographed on day7 and day14. The quantity of alizarin red staining of HmOBs cultured (B) in normal media, or (C) osteogenic media was measured on the spectrophotometer at a wavelength of 405 nm. D Normal cell morphology and calcium deposition showing in red area of day7 cultures were observed through 40× magnification. Photographs of cells without treatment, or with HA-NPs-APTES, demonstrated calcium deposition area much smaller than cells with HA-NPs-APTES-miR. *p ≤ 0.05, **p < 0.01, ***p < 0.001. BDJ Open (2023) 9:8 P. Limlawan et al. released naturally in exosomes from mature-differentiated REFERENCES osteoblasts to induce mouse bone marrow-derived stromal cell 1. Nauth A, McKee MD, Einhorn TA, Watson JT, Li R, Schemitsch EH. Managing bone line, ST2 [29]. We assumed that miR-302a-3p would also activate defects. J Orthop Trauma. 2011;25:462–6. 2. Ansari M. Bone tissue regeneration: biology, strategies and interface studies. Prog human cells differentiation since the binding sites of the 3’-UTR Biomater. 2019;8:223–37. of COUP-TFII mRNA, the specific target of miRNA-302a-3p, are 3. Levingstone TJ, Herbaj S, Dunne NJ. Calcium phosphate nanoparticles conserved among species including human [13]. To our knowl- for therapeutic applications in bone regeneration. Nanomaterials 2019;9: edge, miRNA-302a-3p effects on human cells have never been described before. 4. Chung Y-I, Ahn K-M, Jeon S-H, Lee S-Y, Lee J-H, Tae G. Enhanced bone regen- The effect of miRNA-302a-3p on reducing COUP-TFII mRNA eration with BMP-2 loaded functional nanoparticle–hydrogel complex. J. Control level was equivalent in all cell types demonstrated in this study. Release. 2007;121:91–9. It was also effective on osteogenic gene upregulation, but with a 5. Heo DN, Ko W-K, Bae MS, Lee JB, Lee D-W, Byun W, et al. Enhanced bone time shift of about 5 days depending on the cell line. regeneration with a gold nanoparticle–hydrogel complex. J Mater Chem B. 2014;2:1584–93. Upregulation of the osteogenic profile was mostly observed 6. Roopavath UK, Soni R, Mahanta U, Deshpande AS, Rath SN. 3D printable SiO 2 after 1 day in MG63 and after 5 days in HOS. Increase of nanoparticle ink for patient specific bone regeneration. RSC Adv. nanoparticles uptake was shown during cell proliferation [30]. 2019;9:23832–42. MG63 are known as a fast-proliferative cell line when compared 7. Ibekwe CA, Oyatogun GM, Esan TA, Oluwasegun KM. Synthesis and character- to HOS [31]. Thus, the observed 5-dayshift maybeexplained by ization of chitosan/gum arabic nanoparticles for bone regeneration. Am J Mater the discrepancy in proliferation rates of these 2 cell types. Sci Eng. 2017;5:28–36. Furthermore, MG63 is a pre-osteoblastic cell line which is unable 8. Tautzenberger A, Kovtun A, Ignatius A. Nanoparticles and their potential for to differentiate into mature osteoblast [30]. Effects on gene application in bone. Int J Nanomed. 2012;7:4545–57. expression observed from day 1 may therefore have led to an 9. Chakraborty C, Sharma AR, Sharma G, Doss CGP, Lee S-S. Therapeutic miRNA and siRNA: moving from bench to clinic as next generation medicine. Mol Ther optimal differentiation level thanks to i. the miRNA and ii. the Nucleic Acids. 2017;8:132–43. culture conditions. The related transcriptional upregulations 10. Bushati N, Cohen SM. microRNA functions. Annu Rev Cell Dev Biol. may therefore have been reset. 2007;23:175–205. HmOBs are primary cells and therefore harbor proliferative, 11. Tüfekci KU, Meuwissen RLJ, Genç, Ş. The Role of MicroRNAs in Biological Pro- transcriptomic, and metabolic characteristics closer to bone cells cesses. In: Yousef M, Allmer J, editors. miRNomics: MicroRNA Biology in vivo. In general, these primary cells proliferate slower and are and Computational Analysis. vol 1107. New Jersey: Humana Press; 2014. more resistant to nucleic acid transfection than cell lines [32]. This pp 15–31. is probably the reason why miRNA-302a-3p expression level in 12. Lian JB, Stein GS, Van Wijnen AJ, Stein JL, Hassan MQ, Gaur T, et al. MicroRNA HmOBs was lower than in HOS and MG63. In addition, the miRNA- control of bone formation and homeostasis. Nat Rev Endocrinol. 2012;8:212–27. 302a-3p expression was absolutely the result of HA-NPs-APTES- 13. Kang IH, Jeong BC, Hur SW, Choi H, Choi SH, Ryu JH, et al. MicroRNA‐302a miR delivery, as the control cells only showed low constitutive stimulates osteoblastic differentiation by repressing COUP‐TFII expression. J Cell expression level at the same condition. Although the level in Physiol. 2015;230:911–21. primary bone cells was lower than in the bone cell lines, the 14. Irwandi RA, Khonsuphap P, Limlawan P, Vacharaksa A. miR‐302a‐3p regulates delivered miRNA-302a-3p in HmOBs was sufficient to stably RANKL expression in human mandibular osteoblast‐like cells. J Cell Biochem. regulate osteogenic genes over time from day 1 to 5. Finally, the 2018;119:4372–81. decrease of efficacy of miRNA-302a-3p on COUP-TFII mRNA 15. Takahashi N, Maeda K, Ishihara A, Uehara S, Kobayashi Y. Regulatory mechanism expression at day 5 may be due to its decreasing expression of osteoclastogenesis by RANKL and Wnt signals. Front Biosci Landmark. level. Even though the expression of miRNA is still high at day 5, It 2011;16:21–30. 16. Lee SWL, Paoletti C, Campisi M, Osaki T, Adriani G, Kamm RD, et al. MicroRNA may not totally escape endosomal pathway to reach an effective delivery through nanoparticles. J Control Release. 2019;313:80–95. amount in cytoplasm. A study by Gilleron et al. 2013 thus 17. Muthiah M, Park I-K, Cho C-S. Nanoparticle-mediated delivery of demonstrated that the amount of miRNA delivered into cells may therapeutic genes: focus on miRNA therapeutics. Expert Opin Drug Deliv. not be proportional to its function and that only 1–2% of siRNA 2013;10:1259–73. carried by lipid nanoparticles escape the endosomal compart- 18. Li J, Xue S, Mao Z-W. Nanoparticle delivery systems for siRNA-based therapeutics. ments to function in cytosol [33]. J Mater Chem B. 2016;4:6620–39. Osterix is a key transcription factor involved in late maturation 19. Zhang Y, Wang Z, Gemeinhart RA. Progress in microRNA delivery. J Control of bone cells, especially for mineralization [34]. In this study, HA- Release. 2013;172:962–74. NPs-APTES upregulated osterix, but an addition of miRNA-302a- 20. Zhao L, Zhao W, Liu Y, Chen X, Wang Y. Nano-hydroxyapatite-derived drug and gene co-delivery system for anti-angiogenesis therapy of breast cancer. Med Sci 3p did not significantly change the osterix mRNA level in all cell Monit. 2017;23:4723–32. types. Nonetheless, HA-NPs-APTES alone sufficiently activated 21. Limlawan P, Thepphanao N, Insin N, Vacharaksa A. Surface-modified hydro- high level of mineralization in HmOBs, even in cells cultured xyapatite nanoparticle for microRNA delivery to regulate gene without conditioned medium. Therefore, we postulated that HA- expression in human mandibular osteoblast cells. J Nanopart Res. NPs-APTES might stimulate osterix expression to its saturated 2021;23:1–15. level so that additional effect via miRNA-302a-3p activity could 22. Okazaki M, Yoshida Y, Yamaguchi S, Kaneno M, Elliott J. Affinity binding not be observed. A beneficial effect of miRNA-302a-3p on phenomena of DNA onto apatite crystals. Biomaterials 2001;22:2459–64. mineralization in HmOBs may be resulted from the function of 23. Uskoković V, Uskoković DP. Nanosized hydroxyapatite and other calcium phos- other osteogenic genes, especially in earlier phases of bone cells phates: chemistry of formation and application as drug and gene delivery agents. J Biomed Mater Res Part B. 2011;96:152–91. differentiation. 24. Moussa M, Banakh O, Wehrle-Haller B, Fontana P, Scherrer S, Cattani M, et al. TiNxOy coatings facilitate the initial adhesion of osteoblasts to create a suitable environment for their proliferation and the recruitment of endothelial cells. CONCLUSION Biomed Mater. 2017;12:025001. MicroRNA can be delivered efficiently by using HA-NPs-APTES as a 25. Xu J, Khor KA, Sui J, Zhang J, Chen WN. Protein expression profiles in osteoblasts carrier. After being internalized, miRNA-302a-3p overexpression in response to differentially shaped hydroxyapatite nanoparticles. Biomaterials increases human mandibular osteoblast cells differentiation 2009;30:5385–91. through the regulation of osteogenic genes and enhances bone 26. Liu YK, Lu QZ, Pei R, Ji HJ, Zhou GS, Zhao XL, et al. The effect of extracellular mineralization. The nanoparticles therefore serve as a carrier to calcium and inorganic phosphate on the growth and osteogenic differentiation of mesenchymal stem cells in vitro: implication for bone tissue engineering. deliver miRNAs as efficient bioactive molecules for bone or Biomed Mater. 2009;4:025004. periodontal tissue regeneration. BDJ Open (2023) 9:8 P. Limlawan et al. 27. Wojnilowicz M, Glab A, Bertucci A, Caruso F, Cavalieri F. Super-resolution imaging FUNDING of proton sponge-triggered rupture of endosomes and cytosolic release of small This research is funded by Royal Golden Jubilee Ph.D. scholarship from the Thailand interfering RNA. ACS Nano. 2018;13:187–202. Research Fund (PHD/0123/2559), and the research grant of the Faculty of Dentistry, 28. Ma D. Enhancing endosomal escape for nanoparticle mediated siRNA delivery. Chulalongkorn University. Nanoscale 2014;6:6415–25. 29. Cui Y, Luan J, Li H, Zhou X, Han J. Exosomes derived from mineralizing osteoblasts promote ST2 cell osteogenic differentiation by alteration of microRNA expression. COMPETING INTERESTS FEBS Lett. 2016;590:185–92. The authors declare no competing interests. 30. Mohseny AB, Machado I, Cai Y, Schaefer K-L, Serra M, Hogendoorn PC, et al. Functional characterization of osteosarcoma cell lines provides representative models to study the human disease. Lab Investig. ADDITIONAL INFORMATION 2011;91:1195–205. Supplementary information The online version contains supplementary material 31. Czekanska E, Stoddart M, Richards R, Hayes J. In search of an osteoblast cell available at https://doi.org/10.1038/s41405-023-00135-x. model for in vitro research. Eur Cell Mater. 2012;24:1–17. 32. Hamm A, Krott N, Breibach I, Blindt R, Bosserhoff AK. Efficient transfection Correspondence and requests for materials should be addressed to Stéphane Durual. method for primary cells. Tissue Eng. 2002;8:235–45. 33. Gilleron J, Querbes W, Zeigerer A, Borodovsky A, Marsico G, Schubert U, Reprints and permission information is available at http://www.nature.com/reprints et al. Image-based analysis of lipid nanoparticle–mediated siRNA delivery, intracellular trafficking and endosomal escape. Nat Biotechnol. Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims 2013;31:638–46. in published maps and institutional affiliations. 34. Liu Q, Li M, Wang S, Xiao Z, Xiong Y, Wang G. Recent advances of osterix tran- scription factor in osteoblast differentiation and bone formation. Front Cell Dev Biol. 2020;8:601224. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, ACKNOWLEDGEMENTS adaptation, distribution and reproduction in any medium or format, as long as you give The Ernest Boninchi foundation, Geneva, is gratefully acknowledged for its support. appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory AUTHOR CONTRIBUTIONS regulation or exceeds the permitted use, you will need to obtain permission directly SD and AV contributed equally to this work. PL, LM, SD, and AV conceived the original from the copyright holder. To view a copy of this license, visit http:// idea, planed the research project. AV wrote the proposal for funding, PL, SD, and AV creativecommons.org/licenses/by/4.0/. wrote the main manuscript, PL, and LM carried out the experiment, collected and analyzed with the support of AV and SD. All authors contributed to the final version of the manuscript. © The Author(s) 2023 BDJ Open (2023) 9:8
Journal
BDJ Open – Springer Journals
Published: Feb 22, 2023