Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Dietary proline supplementation alters colonic luminal microbiota and bacterial metabolite composition between days 45 and 70 of pregnancy in Huanjiang mini-pigs

Dietary proline supplementation alters colonic luminal microbiota and bacterial metabolite... Background: Pregnancy is associated with important changes in gut microbiota composition. Dietary factors may affect the diversity, composition, and metabolic activity of the intestinal microbiota. Among amino acids, proline is known to play important roles in protein metabolism and structure, cell differentiation, conceptus growth and development, and gut microbiota re-equilibration in case of dysbiosis. Results: Dietary supplementation with 1% proline decreased (P < 0.05) the amounts of Klebsiella pneumoniae, Peptostreptococcus productus, Pseudomonas, and Veillonella spp. in distal colonic contents than that in the control group. The colonic contents of Butyrivibrio fibrisolvens, Bifidobacterium sp., Clostridium coccoides, Clostridium coccoides-Eubacterium rectale, Clostridium leptum subgroup, Escherichia coli, Faecalibacterium prausnitzii, Fusobacterium prausnitzii, and Prevotella increased (P < 0.05) on d 70 of pregnancy as compared with those on d 45 of pregnancy. The colonic concentrations of acetate, total straight-chain fatty acid, and total short-chain fatty acids (SCFA) in the proline-supplemented group were lower (P < 0.05), and butyrate level (P = 0.06) decreased as compared with the control group. Almost all of the SCFA displayed higher (P < 0.05) concentrations in proximal colonic contents on d 70 of pregnancy than those on d 45 of pregnancy. The concentrations of 1,7-heptyl diamine (P =0.09) and phenylethylamine (P < 0.05) in proximal colonic contents were higher, while those of spermidine (P =0.05) and total bioamine (P = 0.06) tended to be lower in the proline-supplemented group than those in the control group. The concentrations of spermidine, spermine, and total bioamine in colonic contents were higher (P < 0.05) on d 70 of pregnancy than those measured on d 45 of pregnancy. In contrast, the concentration of phenylethylamine was lower (P < 0.05) on d 70 than on d 45 of pregnancy. (Continued on next page) * Correspondence: nnkxf@isa.ac.cn Equal contributors National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Key Laboratory of Agro-ecological Processes in Subtropical Region, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha, Hunan 410125, China Research Center of Mini-pig, Huanjiang Observation and Research Station for Karst Ecosysterms, Huanjiang, Guangxi 547100, China Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 2 of 11 (Continued from previous page) Conclusion: These findings indicate that L-proline supplementation modifies both the colonic microbiota composition and the luminal concentrations of several bacterial metabolites. Furthermore, our data show that both the microbiota composition and the concentrations of bacterial metabolites are evolving in the course of pregnancy. These results are discussed in terms of possible implication in terms of luminal environment and consequences for gut physiology and health. Keywords: Bacterial metabolites, Colonic microbiota, L-proline, Pregnant Huanjiang mini-pigs Background survival, fetal growth, as well as maintenance of vascular The gut microbiome of pigs is a robust ecosystem inhab- tone and hemodynamics [14]. Some other amino acid ited by about 100 trillion bacteria. The importance of concentrations must be tightly regulated to avoid dele- the maintenance of host-microbiome symbiosis is under- terious effects in some fetal tissues. For instance, limited scored by the observation that dysbiotic shifts in micro- entry of dietary aspartate and glutamate into blood cir- biota are associated with inflammatory bowel disorders, culation is required to avoid brain injury in the fetuses type 2 diabetes, obesity, and pregnancy metabolic syn- [15]. Thus, several evidences indicate that AA play cru- drome in humans [1–5]. The gut microbiota metabolizes cial roles in both female and male reproduction [16, 17]. dietary compounds in both the small and large intes- Among AA, it has been shown that proline played sev- tines. The microbiota is present at low concentrations eral roles in the development of the placenta, conceptus, and the transit time is relatively rapid in the small intes- and fetus [18, 19]. Increasing proline availability in ma- tine, while the concentration of bacteria is much higher ternal plasma in pigs enhances the concentrations of and the transit time is much longer in the large intes- proline and polyamines in placentae and fetal fluids, and tine. The dietary compounds that are transferred from promotes fetal growth [19]. Faure et al. [20] found that the small intestine to the large intestine are undigested dietary proline supply could promote mucin synthesis, or not fully digested compounds, notably undigested car- re-equilibrate the gut microbiota, and favor mucosal bohydrates and proteins [6]. The metabolic activity of healing in dextran sulfate sodium-treated rats. In addition, the microbiota allows for the synthesis of various com- proline plays an important role in the metabolism and re- pounds, including short-chain fatty acids (SCFA), in- cycling of nitrogenous compounds in bacteria [10]. doles, ammonia, gaseous compounds, organic acids, Gut microbiota changes markedly from the first to the bioamines, and vitamins. Among these various metabo- third trimesters of pregnancy in human beings, with an lites, some are considered beneficial whereas others are overall increase in Proteobacteria and Actinobacteria, believed to exert deleterious effects on the intestinal mu- and reduced richness (i.e., lower species count). Interest- cosa, when present in excess [7]. For instance, among ingly, the mucosal surfaces of the gut during trimester 3 SCFA, butyrate is considered beneficial for the colonic of pregnancy present low-grade inflammation [21]. Our mucosa, because it can exert some anti-inflammatory ef- previous study found that the colonic microbiota dis- fects [8]. The SCFA can reach luminal concentrations of played spatial and temporal heterogeneity in compos- 130 mmol/L in the proximal colon [9]. The concentra- ition, diversity, and species abundance in different tion of SCFA is related to the luminal pH. As weak or- colonic segments from the first to the third trimester of ganic acids, SCFA can decrease the luminal pH and pregnancy [22]. Considering the effect of proline on sev- inhibit some pathogenic microorganisms, while increas- eral physiological functions during pregnancy, and the ing the absorption of some nutrients [10]. Bioamines are role of this amino acid as precursors of metabolites with widely produced by various kinds of bacteria. Although biological effects; the present study was conducted to limited amounts of bioamines have no detectable effect document the effects of L-proline on the colonic luminal on health [11] and participate in the physiology of the microbiota and bacterial metabolite composition (in- host, larger quantities (1.4 g/d) of bioamines can become cluding SCFA and bioamines) in Huanjiang mini-pigs, harmful to humans and livestock [12]. because pigs can be used as a relevant model for ex- Pregnancy is a biological process involving simultan- trapolation to humans [23]. eous changes in many physiological systems, including microbiome composition [13]. Many nutrients, espe- Methods cially amino acids (AA), are required to sustain a suc- Animals cessful pregnancy. For instance, arginine is a The present study was carried out in accordance with the conditionally essential AA involved by itself and/or Chinese guidelines for animal welfare and experimental through its metabolites, in spermatogenesis, embryonic protocols and was approved by the Animal Care and Use Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 3 of 11 Committee of Institute of Subtropical Agriculture, colon (10 cm at the end of the colon) were collected and Chinese Academy of Sciences [24]. A total of 32 prim- stored at − 80 °C for the extraction of total DNA of iparous Huanjiang mini-pigs [average initial body weight microbiota, as well as for determining the concentra- (BW) 28.30 ± 0.87 kg] were used in this study. tions of SCFA and bioamines. Study design Colonic microbiota composition analysis The gilts were obtained from a Huanjiang mini-pig farm The total DNA was extracted from colonic contents located in Huanjiang County, Guangxi province, China. using the QIAamp DNA Stool Mini kit (Qiagen, Hilden, The experimental design consisted of a 2 × 2 factorial Germany) after chemical and mechanical disruptions arrangement, with two dietary treatments: control [27]. The quality and quantity of DNA were measured (alanine) diet and experimental (proline) diet, and two using a NanoDrop ND-1000 spectrophotometer pregnancy stages: d 45 or 75 of pregnancy. The animals (NanoDrop Technologies Inc., Wilmington, DE, USA). were randomly assigned to one of the two dietary groups Quantitative real-time polymerase chain reaction (qPCR) on d 15 after mating, with eight pens per group and two was performed to determine the number of copies of the sows per pen. The average BW of pigs in the control 16S rRNA genes of several targeted bacteria [28]. The group and experimental group was 27.84 ± 1.32 kg and primers, which were validated previously, are listed in 28.82 ± 1.17 kg, respectively. The animals received a Table 2. The qPCR was performed using SYBR Premix same basal diet supplemented with 1% L-proline or Ex Taq™ II kit (TaKaRa Bio Inc., Shiga, Japan) on an ABI 0.77% L-alanine in the control group. The basal diet was 7900HT Fast real-time PCR system (Applied Biosystems, formulated to meet the nutrient requirements and Foster City, CA, USA). The standard curves for all deter- physiological characteristics of Chinese local pigs mined bacteria were prepared using plasmid DNA con- (Table 1). All animals were housed in 2 m × 3 m pens taining each unique 16S rRNA insert. The raw bacterial with cement flooring. Temperature in the room housing qPCR data were transformed to lg the number of target the pens was maintained at 22–28 °C. All the pigs had genomes per gram of wet digesta. access to drinking water ad libitum from a nipple drinker and were fed twice daily (at 08:30 and 16:30 h) Bacterial metabolite analysis with their diets (approximately 3.0% of BW) from a The SCFA, including straight-chain fatty acids (acetate, feeder. propionate, butyrate, and pentanoate) and branched- chain fatty acids (BCFA; isobutyrate, and isopentanoate) Sample collection were analyzed by gas chromatography as described by On d 45 or 70 of pregnancy, eight sows per group were Zhou et al. [29]. The bioamines, including 1,7-heptyl di- weighed and sacrificed using general anesthesia for sam- amine, cadaverine, phenylethylamine, putrescine, trypta- ple collection at 12 h after the last feeding [25, 26]. After mine, tyramine, spermidine, and spermine were analyzed colon recovery, luminal contents of the proximal colon by high-performance liquid chromatography as de- (10 cm at posterior to the ileocecal valve) and the distal scribed by Xu et al. [30]. Statistical analysis Table 1 Composition and nutrient levels of the basal diet The data were analyzed by a mixed-effects model using (air-dry basis, %) SAS version 8.2 (SAS Institute Inc., Cary, NC, USA). Ingredients Content Nutrient Levels ,% Diet, pregnancy stage, and their interaction were in- Corn 54.00 Digestive energy, MJ/kg 13.40 cluded in the statistical model. Effects were considered statistically significant at P < 0.05, while a tendency was Soybean meal 12.00 Crude protein 12.04 considered for 0.05 ≤ P < 0.10. Rice bran 30.00 Calcium 0.78 Premix 4.00 Phosphorus 0.62 Results Total 100.00 Arginine 0.65 Microbiota composition Lysine 0.53 Tables 3 and 4 summarized the effects of diets and preg- Proline 0.67 nancy stages on microbiota composition of proximal and One kg of premix contained the following: vitamin A, 10,200 IU; vitamin D , distal colonic contents, respectively, from pregnant 1600 IU; vitamin E, 75 IU; vitamin K , 75 mg; thiamine, 3 mg; riboflavin, 16 mg; Huanjiang mini-pigs. In proximal colonic contents, the pyridoxine, 3 mg; vitamin B , 0.8 mg; nicotinic acid, 69 mg; D-pantothenic proportion of Prevotella was lower (P < 0.05), but Firmi- acid, 42 mg; folic acid, 4 mg; biotin, 1 mg; chorine, 900 mg; Fe (FeSO ·H O), 4 2 150 mg; Cu (CuSO ·5H O), 11.2 mg; Zn (ZnSO ·H O), 63 mg; Mn (MnSO ·5H O), 4 2 4 2 4 2 cutes/Bacteroidetes (F/B) ratio was higher (P < 0.05) in 32 mg; I (KI), 1.5 mg; Co (CoCO ), 0.3 mg; Se (Na SeO ·H O), 0.25 mg; Ca 3 2 3 2 the proline-supplemented group than in the control (CaCO ), 200 mg; and P (KH PO ), 20 mg 3 2 4 Digestive energy was a calculated value, while the others were measured values group. The proportions of Butyrivibrio fibrisolvens, Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 4 of 11 Table 2 Primer pairs for 16S rRNA genes of bacteria Bacteria Phylum Primer sequences (5′ → 3′) Product size, bp References Bacteroidetes Bacteroidetes F: AGCAGCCGCGGTAAT 184 [62] R: CTAHGCATTTCACCGCTA B. fibrisolvens Firmicutes F: CGCATGATGCAGTGTGAAAAGCTC 625 [63] R: CCTCCCGACACCTATTATTCATCG Bifidobacterium sp. Actinobacteria F: CTCCTGGAAACGGGTGG 226 [64] R: GGTGTTCTTCCCGATATCTACA C. coccoides Firmicutes F: AAATGACGGTACCTGACTAA 440 [65] R: CTTTGAGTTTCATTCTTGCGAA C. coccoides-E. rectale Firmicutes F: CGGTACCTGACTAAGAAGC 429 [65] R: AGTTTYATTCTTGCGAACG C. leptum subgroup Firmicutes F: GCACAAGCAGTGGAGT 239 [66] R: CTTCCTCCGTTTTGTCAA E. coli Proteobacteria F: GACCTCGGTTTAGTTCACAGA 96 [67] R: CACACGCTGACGCTGACCA F. prausnitzii Firmicutes F: AATTCCGCCTACCTCTGCACT 248 [68] R: GGAGGAAGAAGGTCTTCGG Firmicutes Firmicutes F: GTCAGCTCGTGTCGTGA 179 [69] R: CCATTGTAKYACGTGTGT F. prausnitzii Bacteroidetes F: CCCTTCAGTGCCGCAGT 158 [70] R: GTCGCAGGATGTCAAGAC K. pneumoniae Proteobacteria F: CCTGGATCTGACCCTGCAGTA 165 [71] R: CCGTCGCCGTTCTGTTTC Lactobacillus sp. Firmicutes F: TACATCCCAACTCCAGAACG 116 [72] R: AAGCAACAGTACCACGACC M. elsdenii Firmicutes F: GACCGAAACTGCGATGCTAGA 128 [73] R: TCCAGAAAGCCGCTTTCGCCACT P. aeruginosa Proteobacteria F: TCCAAGTTTAAGGTGGTAGGCTG 117 [74] R: CTTTTCTTGGAAGCATGGCATC P. productus Firmicutes F: AACTCCGGTGGTATCAGATG 268 [67] R: GGGGCTTCTGAGTCAGGTA Pseudomonas Proteobacteria F: GAGTTTGATCCTGGCTCAG 440 [75] R: CCTTCCTCCCAACTT Prevotella Bacteroidetes F: CACRGTAAACGATGGATGCC 513 [64] R: GGTCGGGTTGCAGACC Roseburia Firmicutes F: TACTGCATTGGAAACTGTCG 230 [76] R: CGGCACCGAAGAGCAAT S. ruminantium Firmicutes F: TGCTAATACCGAATGTTG 513 [77] R: TCCTGCACTCAAGAAAGA Veillonella spp. Firmicutes F: A(C/T)CAACCTGCCCTTCAGA 335 [70] R: CGTCCCGATTAACAGAGCTT Faecalibacterium prausnitzii Fusobacterium prausnitzii Bifidobacterium sp., Clostridium coccoides, Escherichia In distal colonic contents, the proportion of Klebsiella coli, Faecalibacterium prausnitzii, Fusobacterium praus- pneumoniae (P = 0.06), P. productus (P< 0.05), Pseudo- nitzii, and Prevotella were higher (P < 0.05) on d 70 of monas (P= 0.08), and Veillonella spp. (P= 0.09) tended pregnancy than on d 45 of pregnancy. The proportion of to be lower in the proline-supplemented group than in Clostridium leptum subgroup (P = 0.09), Firmicutes the control group. The proportion of most bacteria, in- (P = 0.07), Peptostreptococcus productus (P = 0.08), and F/ cluding B. fibrisolvens, Bifidobacterium sp., C. coccoides, B ratio (P = 0.07) displayed an increasing trend with preg- C. coccoides-E. rectale, C. leptum subgroup, E. coli, nancy progress. The proportion of C. coccoides- Faecalibacterium prausnitzii,Firmicutes, Fusobacter- Eubacterium rectale and Firmicutes, and F/B ratio were ium prausnitzii, P. productus, and Prevotella increased changed (P < 0.05) owing to diet × stage interactions, and (P < 0.05), whereas that of Pseudomonas aeruginosa a trend was measured for Pseudomonas (P= 0.06). decreased (P < 0.05) with the progress of pregnancy. Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 5 of 11 Table 3 Bacteria groups or species in proximal colonic contents of pregnant Huanjiang mini-pigs (lg bacteria cells/g wet weight) Bacteria Control group Proline group SEM P-values 45 d 70 d 45 d 70 d Diet Day Diet × Day Bacteroidetes 11.18 11.21 10.96 11.06 0.23 0.18 0.63 0.78 B. fibrisolvens 8.97 9.54 8.73 9.33 0.26 0.20 0.003 0.93 Bifidobacterium sp. 8.97 9.98 8.73 9.98 0.24 0.71 0.001 0.70 C. coccoides 10.23 10.77 10.01 10.76 0.25 0.47 0.001 0.54 C. coccoides-E. rectale 9.94 10.31 9.68 10.09 0.24 0.11 0.90 0.01 C. leptum subgroup 10.56 10.67 10.29 10.66 0.23 0.30 0.09 0.33 E. coli 9.93 10.31 9.77 10.30 0.22 0.53 0.003 0.56 F. prausnitzii 10.50 10.75 10.28 10.77 0.22 0.41 0.01 0.34 Firmicutes 11.10 11.04 10.83 11.33 0.21 0.94 0.07 0.03 F. prausnitzii 8.55 10.75 8.15 10.77 0.29 0.41 0.01 0.34 K. pneumoniae 7.57 7.53 7.72 7.51 0.24 0.67 0.39 0.56 Lactobacillus sp. 10.27 10.53 10.25 10.61 0.31 0.90 0.22 0.84 M. elsdenii 8.23 7.55 7.72 7.88 0.33 0.75 0.36 0.14 P. aeruginosa 8.73 8.43 8.93 8.72 0.25 0.15 0.13 0.76 P. productus 7.87 8.07 7.81 8.04 0.22 0.68 0.08 0.87 Pseudomonas 6.80 7.24 7.03 6.99 0.22 0.92 0.12 0.06 Prevotella 9.01 9.86 8.59 9.23 0.30 0.03 0.004 0.67 Roseburia 8.31 8.47 7.95 8.37 0.28 0.27 0.16 0.54 S. ruminantium 7.26 7.53 7.03 7.17 0.28 0.16 0.34 0.74 Veillonella spp. 7.21 6.83 6.88 6.90 0.27 0.48 0.34 0.29 F/B ratio 0.99 0.99 0.99 1.02 0.05 0.02 0.07 0.01 F/B ratio Firmicutes/Bacteroidetes ratio The F/B ratio displayed an increasing trend (P = 0.09) higher (P < 0.05) on d 70 of pregnancy than on d 45 of with the progress of pregnancy. The proportion of pregnancy. Proline supplementation, however, did not Bifidobacterium sp. (P =0.09), K. pneumoniae (P < 0.09), affect the concentrations of SCFA. P. aeruginosa (P =0.06), P. productus (P =0.06), and Pseudomonas (P = 0.07) changed owing to the diet × stage Bioamine contents interactions. The bioamine concentrations in colonic contents of pregnant Huanjiang mini-pigs are summarized in Table 6. The SCFA concentrations In proximal colonic contents, the concentrations of The SCFA concentrations in colonic contents of preg- 1,7-heptyl diamine (P = 0.09) and phenylethylamine nant Huanjiang mini-pigs are summarized in Table 5. (P < 0.05) tended to and were significantly higher in the In proximal colonic contents, the concentrations of proline-supplemented group, respectively, whereas those acetate, total straight-chain fatty acids, and total SCFA of spermidine (P = 0.05) and total bioamine (P =0.06) were lower (P < 0.05) in the proline-supplemented were lower or tended to be lower than those in the control group. The concentrations of butyrate tended to be group. The concentrations of spermidine, spermine, and decreased (P = 0.06) in the proline-supplemented total bioamine were higher (P <0.05) on d 70 of group, when compared with the control group. Almost pregnancy, whereas that of phenylethylamine (P <0.05) all of the SCFA in proximal colonic contents presented was lower than those on d 45 of pregnancy. The concen- higher (P < 0.05) concentrations on d 70 of pregnancy trations of 1,7-heptyl diamine, phenylethylamine, sperm- than on d 45 of pregnancy. The concentrations of acetate ine, and tryptamine displayed differences (P <0.05) (P = 0.099), butyrate (P = 0.05), isovalerate (P = 0.09), total according to diet × stage interactions, as well as straight-chain fatty acids (P = 0.06), and total SCFA total bioamine concentration (P = 0.096). In distal co- (P = 0.05) were changed, or tended to be changed, owing lonic contents, the concentrations of 1,7-heptyl diamine to the diet × stage interactions. In distal colonic contents, (P =0.07) and tryptamine (P < 0.05) were higher in the the concentrations of isobutyrate and total BCFA were proline-supplemented group, whereas those of cadaverine Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 6 of 11 Table 4 Bacteria groups or species in distal colonic contents of pregnant Huanjiang mini-pigs (lg bacteria cells/g wet weight) Item Control group Proline group SEM P-values 45 d 70 d 45 d 70 d Diet Day Diet × Day Bacteroidetes 11.04 11.03 10.91 11.11 0.23 0.84 0.47 0.46 B. fibrisolvens 8.72 9.12 8.63 9.22 0.23 0.98 0.001 0.49 Bifidobacterium sp. 9.17 9.99 9.39 9.53 0.27 0.52 0.02 0.08 C. coccoides 10.28 10.72 10.19 10.61 0.21 0.40 0.001 0.94 C. coccoides-E. rectale 9.79 10.12 9.81 10.08 0.23 0.95 0.04 0.84 C. leptum subgroup 9.98 10.42 9.97 10.19 0.24 0.42 0.04 0.44 E. coli 9.89 10.14 9.82 10.21 0.22 0.98 0.02 0.59 F. prausnitzii 10.10 10.33 10.11 10.35 0.20 0.88 0.03 0.94 Firmicutes 10.77 11.08 10.70 10.95 0.21 0.38 0.02 0.78 F. prausnitzii 7.92 8.43 7.91 8.29 0.23 0.57 0.003 0.65 K. pneumoniae 7.66 7.39 7.15 7.43 0.22 0.06 0.98 0.03 Lactobacillus sp. 9.82 10.10 9.73 9.97 0.31 0.66 0.29 0.93 M. elsdenii 8.12 7.77 7.84 7.84 0.31 0.68 0.48 0.49 P. aeruginosa 8.70 8.68 9.13 8.52 0.24 0.37 0.04 0.06 P. productus 7.70 8.23 7.65 7.77 0.20 0.02 0.01 0.06 Pseudomonas 7.23 6.81 6.60 6.82 0.26 0.08 0.56 0.07 Prevotella 8.61 9.25 8.18 8.90 0.31 0.12 0.01 0.87 Roseburia 7.98 8.07 8.06 8.12 0.28 0.75 0.69 0.93 S. ruminantium 7.03 7.12 7.01 7.37 0.29 0.61 0.31 0.54 Veillonella spp. 7.19 6.98 6.83 6.78 0.25 0.09 0.43 0.63 F/B ratio 0.98 1.00 0.98 0.99 0.06 0.46 0.09 0.21 F/B ratio Firmicutes/Bacteroidetes ratio (P < 0.05), phenylethylamine (P < 0.05), and tyramine Pregnancy is a time of dramatic host remodeling for (P = 0.098) were lower than those in the control the mother, and may be partly viewed as the develop- group. The concentrations of spermidine (P <0.05), ment of adaptive processes in a context of major new spermine (P < 0.05), tryptamine (P < 0.05), and total physiological constraints. Our previous study showed bioamine (P = 0.08) were higher, but cadaverine and that during pregnancy, both the body weight and fat phenylethylamine were lower (P <0.05) on d 70 than over lean mass ratio increased in the Huanjiang mini- on d 45 of pregnancy. The concentrations of cadaver- pigs [32]. In agreement with the above, it has been re- ine, phenylethylamine, putrescine, and tryptamine dis- ported that pregnant female Ossabaw mini-pigs dis- played differences (P < 0.05) according to diet × stage played higher body weight, notably due to fat deposition interactions. [33], which was association with higher levels of trigly- ceride and very low-density lipoprotein [34], and lower Discussion levels of high-density lipoprotein cholesterol, and low- Several studies revealed that the indigenous microbiota density lipoprotein cholesterol [35]. in the gut play important roles in the metabolism and A previous study showed that the pregnancy stage and recycling of nitrogenous compounds, including AA [10, diet composition may affect gut microbial composition 20]. Furthermore, changes in gut microbiota of pregnant [36]. The present study confirms these results and eluci- human and animals have been documented in recent dates that the proportion of Prevotella increased with years [13, 23, 31]. The present study indicates that diet- progress of pregnancy. This is consistent with the study ary supplementation with proline affects the colonic lu- of Collado and Isolauri [3], who reported that the abun- minal microbiota and bacterial metabolite composition dances of Bacteroides-Prevotella group, Clostridium, and in Huanjiang mini-pigs. In addition, our study confirms Staphylococcus increased from first trimester to third tri- that the composition of bacteria in the colon, as well as mester of normal-weight and overweight pregnant the luminal environment, differ according to the stage of women. Moreover, Santacruz et al. [37] confirmed that pregnancy. the proportion of Firmicutes, especially Clostridium Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 7 of 11 Table 5 Short-chain fatty acid concentrations in colonic contents of pregnant Huanjiang mini-pigs (mg/g) Item Control group Proline group SEM P-values 45 d 70 d 45 d 70 d Diet Day Diet × Day Proximal colonic contents Acetate 16.72 34.24 14.70 22.76 1.07 0.02 < 0.01 0.099 Propionate 5.95 12.56 6.36 9.44 0.71 0.28 < 0.01 0.16 Isobutyrate 0.23 0.92 0.28 0.71 0.19 0.41 < 0.01 0.17 Butyrate 3.64 6.69 3.68 4.18 0.51 0.06 0.010 0.05 Isovalerate 0.19 0.70 0.21 0.50 0.16 0.15 < 0.01 0.09 Valerate 0.43 1.43 0.44 1.16 0.24 0.35 < 0.01 0.34 Total BCFA 0.42 1.61 0.49 1.21 0.25 0.28 < 0.01 0.13 Total straight-chain fatty acids 26.75 54.92 25.18 37.54 1.27 0.02 < 0.01 0.06 Total SCFA 27.17 56.53 25.67 38.74 1.29 0.03 < 0.01 0.05 Distal colonic contents Acetate 10.48 9.07 10.38 10.02 0.60 0.60 0.28 0.52 Propionate 4.01 3.81 4.00 4.60 0.38 0.24 0.54 0.24 Isobutyrate 0.36 0.49 0.34 0.48 0.13 0.78 0.01 0.92 Butyrate 2.94 2.95 2.93 2.71 0.38 0.71 0.75 0.73 Isovalerate 0.33 0.39 0.31 0.34 0.13 0.34 0.25 0.62 Valerate 0.48 0.50 0.41 0.51 0.14 0.57 0.17 0.39 Total BCFA 0.69 0.88 0.66 0.82 0.18 0.53 0.03 0.84 Total straight-chain fatty acids 17.90 16.33 17.72 17.85 0.76 0.61 0.59 0.52 Total SCFA 18.59 17.21 18.38 18.67 0.77 0.64 0.69 0.54 clusters, is associated with excessive BW and obesity in accordance with some data on the evolution of the human subjects. Similar to the obese human subjects, microbiota composition during pregnancy, SCFA pre- the sows at d 70 of pregnancy had increased proportions sented higher concentrations in proximal colonic con- of C. coccoides, C. leptum subgroup, E. coli, Faecalibac- tents. In the distal colonic contents recovered at d 70 of terium prausnitzii, P. productus, and Firmicutes, as com- pregnancy. Isobutyrate and total BCFA concentrations in pared with those at d 45 of pregnancy. The increased the distal colonic contents were higher at d 70 than at d proportion of Firmicutes is considered to affect the 45 of pregnancy. As BCFA concentrations are consid- metabolic potential of the gut microbiota and enhance ered as indicators of protein catabolism by the micro- the capacity of the body to harvest energy from the diet biota in the luminal intestinal content [43], these results [38]. In addition, colonization of germ-free mice with are suggestive of increased protein fermentation in the the butyrate-producing bacteria B. fibrisolvens rescued distal colon at d 70 of pregnancy as compared with that colonic epithelia from the energy starvation status [39]. at d 45. The present study shows that the proportion of Based on our results, it appeared that some bacteria in- saccharolytic bacteria generating SCFA [44], including C. volved in indigestible carbohydrate fermentation in- coccoides, C. coccoides-E. rectale, and C. leptum sub- creased by d 70 of pregnancy, thereby allowing the groups, increases similarly when compared with the production of more SCFA and increased energy recyc- Firmicutes phylum. Faecalibacterium prausnitzii, Fuso- ling for the pregnant sows and their fetuses. bacterium, and Clostridium are known butyrate pro- Bacterial cross-feeding has a huge impact on the final ducers [45–48]. Prevotella had been proposed to balance of the SCFA production, absorption, and effi- enhance calorie extraction from resistant starches, oligo- cient exploitation of the substrates in the gut [40]. The saccharides, and other indigested carbohydrates [49], vast majority of acetate in the body is produced by the and its concentration is associated with increased co- gut microbiota, and the total fecal propionate concentra- lonic SCFA. In addition to participating in the digestive tion is linked to the relative abundance of Bacteroidetes process, microbiota allows local synthesis of SCFA, and Firmicutes [41]. Butyrate produced by the gut which are used as energy substrates by the host [50]. microbiota is dependent on butyrate-producers, such as Parts of SCFA are absorbed and metabolized by the Faecalibacterium, Eubacterium, and Roseburia [42]. In colonocytes, while the unmetabolized portion can enter Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 8 of 11 Table 6 Bioamine concentrations in colonic contents of pregnant Huanjiang mini-pigs (μg/g) Items Control group Proline group SEM P- values 45 d 70 d 45 d 70 d Diet Day Diet × Day Proximal colonic contents 1,7-heptyl diamine 2.22 2.36 2.95 2.28 0.26 0.09 0.15 0.04 Cadaverine 13.61 12.77 12.99 16.67 0.98 0.50 0.56 0.36 Phenylethylamine 6.67 8.64 12.99 6.36 0.44 0.001 < 0.01 < 0.01 Putrescine 20.30 24.38 21.83 19.12 0.99 0.45 0.78 0.18 Spermidine 35.97 67.63 30.96 44.35 1.64 0.05 0.005 0.19 Spermine 5.71 15.79 9.15 10.67 0.83 0.64 0.006 0.03 Tryptamine 1.46 2.14 2.46 1.03 0.39 0.89 0.35 0.02 Tyramine 2.82 2.53 2.02 1.79 0.45 0.15 0.61 0.96 Total bioamine 101.90 151.18 98.32 106.42 2.15 0.06 0.03 0.096 Distal colonic contents 1,7-heptyl diamine 1.63 1.24 1.80 2.06 0.32 0.07 0.78 0.22 Cadaverine 15.81 6.23 5.71 6.81 0.80 0.01 0.02 0.005 Phenylethylamine 10.09 4.47 5.70 4.57 0.54 0.011 < 0.01 0.008 Putrescine 13.87 10.51 8.84 14.30 0.65 0.56 0.33 0.001 Spermidine 29.54 33.79 22.67 38.67 1.21 0.79 0.02 0.13 Spermine 7.31 9.92 7.86 9.95 0.66 0.79 0.046 0.81 Tryptamine 0.28 0.23 0.17 1.31 0.23 0.002 0.001 < 0.01 Tyramine 1.71 1.87 0.96 1.67 0.33 0.098 0.12 0.32 Total bioamine 64.82 73.97 68.31 79.33 1.47 0.42 0.08 0.86 diverse carbohydrates and lipid metabolic routes in the the distal colonic contents. These bacterial species can peripheral tissues. While most of the butyrate pro- metabolize carbohydrates, especially indigestible fiber duced by the microbiota is metabolized in enterocytes/ [54]. Klebsiella pneumoniae, which is the most signifi- colonocytes during its transfer from the intestinal cant member of Enterobacteriaceae and Peptostreptococ- lumen to the bloodstream, propionate mainly incorpo- cus productus, are predominant for the utilization of rates into the gluconeogenesis pathway, while acetate glutamate or tryptophan [52]. Ren et al. [55] reported is mostly metabolized into the lipid biosynthesis path- that dietary proline supplementation confers a positive way [41]. Collectively, the increased SCFA production immune effect in porcine circovirus-infected pregnant and absorption may provide additional nutrients for and non-pregnant mice. pregnant sows; however, additional work outside of the Proteins are degraded by the bacterial protease and pep- scope of the present study is necessary to test this tidase activities, and the AA released from the proteins hypothesis. can be precursors of various bioamines in the colon via The AA serve not only as protein building bricks but specific AA decarboxylation pathways by specific bacteria also act as energy substrates, signaling molecules, and/or [56]. In bacteria, the bioamines are involved in many pro- as precursors for bioactive compounds [51]. Thus, AA cesses related to transcription, translation, growth, metab- intervene in the regulation of diverse physiological olism, and other functions, including improved acid process related to the reproductive functions, ranging resistance, protection from oxidative stress and host im- from spermatogenesis to oocyte fertilization and embryo munological defenses [56–60]. For instance, E. coli synthe- implantation [52]. In the large intestine, AA are not sized cadaverine during anaerobic growth at low pH in absorbed to any significant extent by the colonic mucosa the presence of its precursor lysine [61]. Several (except in the neonatal period), and thus are mostly me- bioamine-producing taxa belong to Prevotella and Mega- tabolized by the microbiota into various intermediary sphaera [60]. This may explain why the concentrations of and end products [53]. The present study showed that spermidine, spermine, and total bioamines in colonic con- dietary proline supplementation decreased the propor- tents increased with the progress of pregnancy. tion of Prevotella in the proximal colonic contents, and The way by which supplemental proline exerts its ef- the proportions of K. pneumoniae and P. productus in fect on colonic microbiota remains elusive, considering Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 9 of 11 that the capacity of the small intestine for the absorption Competing interests The authors declare that they have no competing interests. of amino acids is high. In other words, the dietary pro- line originating from the dietary proteins and supple- Author details ment is most likely large, if not totally absorbed by the National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Key Laboratory of Agro-ecological small intestinal epithelium. Thus, we propose that the Processes in Subtropical Region, Institute of Subtropical Agriculture, Chinese effects of dietary proline on the colonic ecosystem would 2 Academy of Sciences, Changsha, Hunan 410125, China. Research Center of be dependent, at least in part, on the effect of this AA Mini-pig, Huanjiang Observation and Research Station for Karst Ecosysterms, Huanjiang, Guangxi 547100, China. UMR 914 INRA/AgroParisTech/Universite on the microbiota composition and metabolic activity in Paris-Sacaly, Nutrition Physiology and Ingestive Behavior, 75005 Paris, France. the small intestine; such effects presumably affect the large intestinal luminal environment. This hypothesis is Received: 20 April 2017 Accepted: 10 January 2018 worthy of testing in future experiments. Conclusion References 1. Turnbaugh PJ, Hamady M, Yatsunenko T, Cantarel BL, Duncan A, In conclusion, the present study indicates that L-pro- Ley RE, et al. A core gut microbiome in obese and lean twins. Nature. line supplementation modifies the colonic microbiota 2009;457(7228):480–7. composition and the luminal concentrations of several 2. Karlsson FH, Tremaroli V, Nookaew I, Bergstrom G, Behre CJ, Fagerberg B, et al. Gut metagenome in European women with normal, impaired and bacterial metabolites. Furthermore, our data show that diabetic glucose control. Nature. 2013;498(7452):99–103. both the microbiota composition and the concentra- 3. Collado MC, Isolauri E, Laitinen K, Salminen S. Distinct composition of gut tions of bacterial metabolites are evolving in the microbiota during pregnancy in overweight and normal-weight women. Am J Clin Nutr. 2008;88(4):894–9. course of pregnancy. The changes in the luminal en- 4. Feng ZM, Li TJ, Wu L, Xiao DF, Blachier F, Yin YL. Monosodium L-glutamate vironment associated with these changes in micro- and dietary fat differently modify the composition of the intestinal biota composition need to be evaluated in terms of microbiota in growing pigs. Obes Facts. 2015;8(2):87–100. 5. Weitkunat K, Schumann S, Petzke KJ, Blaut M, Loh G, Klaus S. Effects of dietary beneficial over deleterious effects for the colonic mu- inulin on bacterial growth, short-chain fatty acid production and hepatic lipid cosa and for peripheral tissues in the mother and the metabolism in gnotobiotic mice. J Nutr Biochem. 2015;26(9):929–37. fetuses. 6. Portune KJ, Beaumont M, Davila AM, Tomé D, Blachier F, Sanz Y. Gut microbiota role in dietary protein metabolism and health-related outcomes: Abbreviations the two sides of the coin. Trends Food Sci Tech. 2016;57:213–32. AA: Amino acids; BCFA: Branched-chain fatty acids; qPCR: Quantitative real- 7. Blachier F, Beaumont M, Andriamihaja M, Davila AM, Lan A, Grauso M, et al. time polymerase chain reaction; SCFA: Short-chain fatty acids Changes in the luminal environment of the colonic epithelial cells and physiopathological consequences. Am J Pathol. 2017;187(3):476–86. Acknowledgments 8. Thibault R, Blachier F, Darcy-Vrillon B, de Coppet P, Bourreille A, Segain P. We thank staffs and postgraduate students of Hunan Provincial Engineering Butyrate utilization by the colonic mucosa in inflammatory bowel diseases: Research Center of Healthy Livestock for collecting samples and technicians a transport deficiency. Inflamm Bowel Dis. 2017;16(4):684–95. from key laboratory of agro-ecological processes in subtropical region for 9. Hamer HM, Jonkers D, Venema K, Vanhoutvin S, Troost FJ, Brummer RJ. providing technical assistance. We also thank Editage [http://online.editage.cn/] Review article: the role of butyrate on colonic function. Aliment Pharmacol for English language editing. Ther. 2008;27(2):104–19. 10. Macfarlane GT, Macfarlane S. Bacteria, colonic fermentation, and Funding gastrointestinal health. J AOAC Int. 2012;95(1):50–60. The present work was jointly supported by grants from the National Nature 11. Bardocz S, Duguid TJ, Brown DS, Grant G, Pusztai A, White A, et al. The Science Foundation of China (31572421 and 31270044), National Key R & D importance of dietary polyamines in cell regeneration and growth. Br J Program (2017YFD0500503), “Western Light” key program for Talent Cultivation Nutr. 1995;73(6):819–28. from Chinese Academy of Sciences, and Chinese Academy of Sciences Visiting 12. Fusi E, Rossi L, Rebucci R, Cheli F, Di Giancamillo A, Domeneghini C, et al. Professorship for Senior International Scientists (F. Blachier, 2013T2S0014). Administration of biogenic amines to Saanen kids: effects on growth performance, meat quality and gut histology. Small Ruminant Res. Availability of data and materials 2004;53(1–2):1–7. The datasets supporting the conclusions of this article are included within 13. Nuriel-Ohayon M, Neuman H, Koren O. Microbial changes during the article. pregnancy, birth, and infancy. Front Microbiol. 2016;(1031). https://doi.org/ 10.3389/fmicb.2016.01031. eCollection 2016. Authors’ contributions 14. Bazer FW. Contributions of an animal scientist to understanding the biology XFK designed the study; YJJ, QPG, and XFK carried out the experiments and of the uterus and pregnancy. Reprod Fertil Dev. 2013;25(1):129–47. data analysis; YJJ, XFK, YLY, and FB drafted and revised the manuscript. All 15. Wu GY, Bazer FW, Davis TA, Kim SW, Li P, Rhoads JM, et al. Arginine authors have read and approved the final version of the manuscript. metabolism and nutrition in growth, health and disease. Amino Acids. 2009;37:153–68. Ethics approval and consent to participate 16. Wu GY, Bazer FW, Johnson GA, Herring C, Seo H, Dai ZL, et al. Functional This article does not contain any studies with human participants performed amino acids in the development of the pig placenta. Mol Reprod Dev. by any of the authors. The use of animals for this research was approved by 2017;84(9):870–82. the Institutional Animal Care and Use Committee of the Institute of Subtropical 17. Wu GY, Bazer FW, Satterfield MC, Li XL, Wang XQ, Johnson GA, et al. Agriculture, Chinese Academy of Sciences. All procedures performed in studies Impacts of arginine nutrition on embryonic and fetal development in involving animals were in accordance with the ethical standards of the mammals. Amino Acids. 2013;45(2):241–56. institution or practice at which the studies were conducted. 18. Kwon H, Ford SP, Bazer FW, Spencer TE, Nathanielsz PW, Nijland MJ, et al. Maternal undernutrition reduces concentrations of amino acids and Consent for publication polyamines in ovine fetal plasma and placental fluids. Biol Reprod. Not applicable. 2004;71(3):901–8. Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 10 of 11 19. Wu GY, Bazer FW, Datta S, Johnson GA, Li P, Satterfield MC, et al. Proline 40. Perry RJ, Peng L, Barry NA, Cline GW, Zhang D, Cardone RL, et al. Acetate metabolism in the conceptus: implications for fetal growth and mediates a microbiome-brain-beta-cell axis to promote metabolic development. Amino Acids. 2008;35(4):691–702. syndrome. Nature. 2016;534(7606):213–7. 20. Faure M, Mettraux C, Moennoz D, Godin JP, Vuichoud J, Rochat F, et al. 41. Ríos-Covián D, Ruas-Madiedo P, Margolles A, Gueimonde M, de Los Reyes- Specific amino acids increase mucin synthesis and microbiota in dextran Gavilán CG, Salazar N. Intestinal short chain fatty acids and their link with sulfate sodium-treated rats. J Nutr. 2006;136(6):1558–64. diet and human health. Front Microbiol. 2016;7:185. 42. Louis P, Hold GL, Flint HJ. The gut microbiota, bacterial metabolites and 21. Koren O, Goodrich JK, Cullender TC, Spor A, Laitinen K, Backhed HK, et al. colorectal cancer. Nat Rev Microbiol. 2014;12(10):661–72. Host remodeling of the gut microbiome and metabolic changes during pregnancy. Cell. 2012;150(3):470–80. 43. Blachier F, Mariotti F, Huneau JF, Tomé D. Effects of amino acid-derived 22. Chalvon-Demersay T, Blachier F, Tomé D, Blais A. Animal models for the luminal metabolites on the colonic epithelium and physiopathological study of the relationships between diet and obesity: a focus on dietary consequences. Amino Acids. 2007;33(4):547–62. protein and estrogen deficiency. Front Nutr. 2017;4(5). https://doi.org/10. 44. Wang L, Conlon MA, Christophersen CT, Sorich MJ, Angley MT. 3389/fnut.2017.00005. eCollection 2017. Gastrointestinal microbiota and metabolite biomarkers in children with 23. Kong XF, Ji YJ, Li HW, Zhu Q, Blachier F, Geng MM, et al. Colonic luminal autism spectrum disorders. Biomark Med. 2014;8(3):331–44. microbiota and bacterial metabolite composition in pregnant Huanjiang 45. Burcelin R. Regulation of metabolism: a cross talk between gut microbiota mini-pigs: effects of food composition at different times of pregnancy. Sci and its human host. Physiology. 2012;27(5):300–7. Rep. 2016;6(37224). https://doi.org/10.1038/srep37224. 46. Remely M, Hippe B, Geretschlaeger I, Stegmayer S, Hoefinger I, 24. Yin YL, Yao K, Liu ZJ, Gong M, Ruan Z, Deng D, et al. Supplementing Haslberger A. Increased gut microbiota diversity and abundance of L-leucine to a low-protein diet increases tissue protein synthesis in Faecalibacterium prausnitzii and Akkermansia after fasting: a pilot study. weanling pigs. Amino Acids. 2010;39(5):1477–86. Wien Klin Wochenschr. 2015;127(9–10):394–8. 25. Kong XF, Wu GY, Liao YP, Hou ZP, Liu HJ, Yin FG, et al. Effects of Chinese 47. Stenman LK, Burcelin R, Lahtinen S. Establishing a causal link between gut herbal ultra-fine powder as a dietary additive on growth performance, microbes, body weight gain and glucose metabolism in humans-towards serum metabolites and intestinal health in early-weaned piglets. Livest Sci. treatment with probiotics. Benef Microbes. 2015;7(1):11–22. 2007;108(1–3):272–5. 48. Yao P, Cui M, Wang H, Gao H, Wang L, Yang T, et al. Quantitative analysis of 26. Liu YY, Li FN, Kong XF, Tan BE, Li YH, Duan YH, et al. Signaling pathways intestinal flora of Uygur and Han ethnic Chinese patients with ulcerative related to protein synthesis and amino acid concentration in pig skeletal colitis. Gastroenterol Res Pract. 2016:9186232. muscles depend on the dietary protein level, genotype and developmental 49. Flint HJ, Bayer EA, Rincon MT, Lamed R, White BA. Polysaccharide utilization stages. PLoS One. 2015;10(9):e0138277. by gut bacteria: potential for new insights from genomic analysis. Nat Rev 27. Fanca-Berthon P, Hoebler C, Mouzet E, David A, Michel C. Intrauterine Microbiol. 2008;6(2):121–31. growth restriction not only modifies the cecocolonic microbiota in neonatal 50. Kelly CJ, Zheng L, Campbell EL, Saeedi B, Scholz CC, Bayless AJ, et al. Crosstalk rats but also affects its activity in young adult rats. J Pediatr Gastroenterol between microbiota-derived short-chain fatty acids and intestinal epithelial HIF Nutr. 2010;51(4):402–13. augments tissue barrier function. Cell Host Microbe. 2015;17(5):662–71. 28. Jost T, Lacroix C, Braegger C, Chassard C. Stability of the maternal gut 51. Vidal-Lletjós S, Beaumont M, Tomé D, Benamouzig R, Blachier F, Lan A. Dietary microbiota during late pregnancy and early lactation. Curr Microbiol. protein and amino acid supplementation in inflammatory bowel disease 2014;68(4):419–27. course: what impact on the colonic mucosa? Nutrients. 2017;9(3):310. 29. Zhou XL, Kong XF, Lian GQ, Blachier F, Geng MM, Yin YL. Dietary 52. Dai ZL, Wu ZL, Hang SQ, Zhu WY, Wu GY. Amino acid metabolism in supplementation with soybean oligosaccharides increases short-chain fatty intestinal bacteria and its potential implications for mammalian acids but decreases protein-derived catabolites in the intestinal luminal reproduction. Mol Hum Reprod. 2015;21(5):389–409. content of weaned Huanjiang mini-piglets. Nutr Res. 2014;34(9):780–8. 53. Davila AM, Blachier F, Gotteland M, Andriamihaja M, Benetti PH, Sanz Y, et 30. Xu LW, Geng MM, Zhang LP, Yuan HZ, Kong XF, Wang JR. Determination of al. Intestinal luminal nitrogen metabolism: role of the gut microbiota and bioamines in colonic contents of piglets by pre-column. Acta Nutrimenta consequences for the host. Pharmacol Res. 2013;68(1):95–107. Sinica. 2014;6(36):78–83. 54. Wu GD, Chen J, Hoffmann C, Bittinger K, Chen YY, Keilbaugh SA, et al. 31. Ma J, Prince AL, Bader D, Hu M, Ganu R, Baquero K, et al. High-fat maternal diet Linking long-term dietary patterns with gut microbial enterotypes. Science. during pregnancy persistently alters the offspring microbiome in a primate 2011;334(6052):105–8. model. Nat Commun. 2014;5(3889). https://doi.org/10.1038/ncomms4889. 55. Ren W, Wu M, Luo W, Huang R, Yin Y, Li Y, et al. Dietary supplementation 32. Zhang T, Zha W, Tang ZL, Kong XF. Efects of dietary proline on body with proline confers a positive effect in both porcine circovirus-infected composition in pregnant Huanjiang mini-pigs. Chin J Anim Nutr. pregnant and non-pregnant mice. Br J Nutr. 2013;110(8):1492–9. 2017;29(2):556–61. 56. Shah P, Swlatlo E. A multifaceted role for polyamines in bacterial pathogens. 33. Newell-Fugate AE, Taibl JN, Clark SG, Alloosh M, Sturek M, Krisher RL. Effects Mole Microbiol. 2008;68(1):4–16. of diet-induced obesity on metabolic parameter and reproductive function 57. Wallace HM, Fraser AV, Hughes A. A perspective of polyamine metabolism. in female Ossabaw minipigs. Comp Med. 2014;64(1):44–9. Biochem J. 2003;376:1–14. 34. Ferrazzi E, Sears B, editors. Metabolic syndrome and complications of 58. Goytia M, Shafer WM. Polyamines can increase resistance of Neisseria pregnancy: the potential preventive role of nutrition. AG, Swizerland: gonorrhoeae to mediators of the innate human host defense. Infect Springer International Publishing; 2015. Immun. 2010;78(7):3187–95. 35. Luo Y, Qu H, Wang H, Wei H, Wu J, Duan Y, et al. Plasma periostin levels are 59. Jelsbak L, Thomsen LE, Wallrodt I, Jensen PR, Olsen JE. Polyamines are increased in Chinese subjects with obesity and type 2 diabetes and are positively required for virulence in Salmonella enterica serovar typhimurium. PLoS One. correlated with glucose and lipid parameters. Mediat Inflamm. 2016:6423637. 2012;7(4):e36149. 36. Mandal S, Godfrey KM, McDonald D, Treuren WV, Bjørnholt JV, Midtvedt T, 60. Nelson TM, Borgogna JL, Brotman RM, Ravel J, Walk ST, Yeoman CJ. Vaginal et al. Fat and vitamin intakes during pregnancy have stronger relations with biogenic amines: biomarkers of bacterial vaginosis or precursors to vaginal a pro-inflammatory maternal microbiota than does carbohydrate intake. dysbiosis? Front Physiol. 2015;6(253). https://doi.org/10.3389/fphys.2015. Microbiome. 2016;4(1):55. 00253. eCollection 2015. 37. Santacruz A, Collado MC, Garcia-Valdes L, Segura MT, Martin-Lagos JA, 61. Watson N, Dunyak DS, Rosey EL, Slonczewski JL, Olson ER. Identification of Anjos T, et al. Gut microbiota composition is associated with body elements involved in transcriptional regulation of the Escherichia-Coli-cad weight, weight gain and biochemical parameters in pregnant women. operon by external pH. J Bacteriol. 1992;174(2):530–40. Brit J Nutr. 2010;104(1):83–92. 62. Armougom F, Henry M, Vialettes B, Raccah D, Raoult D. Monitoring 38. Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER, Gordon JI. An bacterial community of human gut microbiota reveals an increase in obesity-associated gut microbiome with increased capacity for energy Lactobacillus in obese patients and methanogens in anorexic patients. harvest. Nature. 2006;444(7122):1027–31. PLoS One. 2009;4(9):e7125. 39. Donohoe DR, Garge N, Zhang XX, Sun W, O'Connell TM, Bunger MK, et al. 63. Fernando SC, Purvis HT, Najar FZ, Sukharnikov LO, Krehbiel CR, Nagaraja TG, The microbiome and butyrate regulate energy metabolism and autophagy et al. Rumen microbial population dynamics during adaptation to a high- in the mammalian colon. Cell Metab. 2011;13(5):517–26. grain diet. Appl Environ Microbiol. 2010;76(22):7482–90. Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 11 of 11 64. Matsuki T, Watanabe K, Fujimoto J, Miyamoto Y, Takada T, Matsumoto K, et al. Development of 16S rRNA-gene-targeted group-specific primers for the detection and identification of predominant bacteria in human feces. Appl Environ Microbiol. 2002;68(11):5445–51. 65. Bartosch S, Fite A, Macfarlane GT, McMurdo ME. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Appl Environ Microbiol. 2004;70(6):3575–81. 66. Matsuki T, Watanabe K, Fujimoto J, Takada T, Tanaka R. Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces. Appl Environ Microbiol. 2004;70(12):7220–8. 67. Wang RF, Cao WW, Cerniglia CE. PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples. Appl Environ Microbiol. 1996;62(4):1242–7. 68. Ramirez-Farias C, Slezak K, Fuller Z, Duncan A, Holtrop G, Louis P. Effect of inulin on the human gut microbiota: stimulation of Bifidobacterium adolescentis and Faecalibacterium prausnitzii. Brit J Nutr. 2009;101(4):541–50. 69. Armougom F, Raoult D. Use of pyrosequencing and DNA barcodes to monitor variations in Firmicutes and Bacteroidetes communities in the gut microbiota of obese humans. BMC Genomics. 2008;9:576. 70. Rinttila T, Kassinen A, Malinen E, Krogius L, Palva A. Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J Appl Microbiol. 2004;97(6):1166–77. 71. Shannon KE, Lee DY, Trevors JT, Beaudette LA. Application of real-time quantitative PCR for the detection of selected bacterial pathogens during municipal wastewater treatment. Sci Total Environ. 2007;382(1):121–9. 72. Menard JP, Fenollar F, Henry M, Bretelle F, Raoult D. Molecular quantification of gardnerella vaginalis and atopobium vaginae loads to predict bacterial vaginosis. Clin Infect Dis. 2008;47(1):33–43. 73. Ouwerkerk D, Klieve AV, Forster RJ. Enumeration of Megasphaera elsdenii in rumen contents by real-time taq nuclease assay. J Appl Microb. 2002;92(4):753–8. 74. Schwartz T, Volkmann H, Kirchen S, Kohnen W, Schön-Hölz K, Jansen B, et al. Real-time PCR detection of Pseudomonas aeruginosa in clinical and municipal wastewater and genotyping of the ciprofloxacin-resistant isolates. FEMS Microbiol Ecol. 2006;57(1):158–67. 75. Yadav JS, Khan IU, Fakhari F, Soellner MB. DNA-based methodologies for rapid detection, quantification, and species- or strain-level identification of respiratory pathogens (mycobacteria and pseudomonads) in metalworking fluids. Appl Occup Environ Hyg. 2003;18(11):966–75. 76. Larsen N, Vogensen FK, van den Berg FW, Nielsen DS, Andreasen AS, Pedersen BK, et al. Gut microbiota in human adults with type 2 diabetes differs from non-diabetic adults. PLoS One. 2010;5(2):e9085. 77. Tajima K, Aminov RI, Nagamine T, Matsui H, Nakamura M, Benno Y. Diet- dependent shifts in the bacterial population of the rumen revealed with real-time PCR. Appl Environ Microbiol. 2001;67(6):2766–74. Submit your next manuscript to BioMed Central and we will help you at every step: • We accept pre-submission inquiries � Our selector tool helps you to find the most relevant journal � We provide round the clock customer support � Convenient online submission � Thorough peer review � Inclusion in PubMed and all major indexing services � Maximum visibility for your research Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Animal Science and Biotechnology Springer Journals

Dietary proline supplementation alters colonic luminal microbiota and bacterial metabolite composition between days 45 and 70 of pregnancy in Huanjiang mini-pigs

Download PDF
11 pages

Loading next page...
 
/lp/springer-journals/dietary-proline-supplementation-alters-colonic-luminal-microbiota-and-xNouFLgR9J

References (79)

Publisher
Springer Journals
Copyright
Copyright © 2018 by The Author(s).
Subject
Life Sciences; Agriculture; Biotechnology; Food Science; Animal Genetics and Genomics; Animal Physiology
eISSN
2049-1891
DOI
10.1186/s40104-018-0233-5
Publisher site
See Article on Publisher Site

Abstract

Background: Pregnancy is associated with important changes in gut microbiota composition. Dietary factors may affect the diversity, composition, and metabolic activity of the intestinal microbiota. Among amino acids, proline is known to play important roles in protein metabolism and structure, cell differentiation, conceptus growth and development, and gut microbiota re-equilibration in case of dysbiosis. Results: Dietary supplementation with 1% proline decreased (P < 0.05) the amounts of Klebsiella pneumoniae, Peptostreptococcus productus, Pseudomonas, and Veillonella spp. in distal colonic contents than that in the control group. The colonic contents of Butyrivibrio fibrisolvens, Bifidobacterium sp., Clostridium coccoides, Clostridium coccoides-Eubacterium rectale, Clostridium leptum subgroup, Escherichia coli, Faecalibacterium prausnitzii, Fusobacterium prausnitzii, and Prevotella increased (P < 0.05) on d 70 of pregnancy as compared with those on d 45 of pregnancy. The colonic concentrations of acetate, total straight-chain fatty acid, and total short-chain fatty acids (SCFA) in the proline-supplemented group were lower (P < 0.05), and butyrate level (P = 0.06) decreased as compared with the control group. Almost all of the SCFA displayed higher (P < 0.05) concentrations in proximal colonic contents on d 70 of pregnancy than those on d 45 of pregnancy. The concentrations of 1,7-heptyl diamine (P =0.09) and phenylethylamine (P < 0.05) in proximal colonic contents were higher, while those of spermidine (P =0.05) and total bioamine (P = 0.06) tended to be lower in the proline-supplemented group than those in the control group. The concentrations of spermidine, spermine, and total bioamine in colonic contents were higher (P < 0.05) on d 70 of pregnancy than those measured on d 45 of pregnancy. In contrast, the concentration of phenylethylamine was lower (P < 0.05) on d 70 than on d 45 of pregnancy. (Continued on next page) * Correspondence: nnkxf@isa.ac.cn Equal contributors National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Key Laboratory of Agro-ecological Processes in Subtropical Region, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha, Hunan 410125, China Research Center of Mini-pig, Huanjiang Observation and Research Station for Karst Ecosysterms, Huanjiang, Guangxi 547100, China Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 2 of 11 (Continued from previous page) Conclusion: These findings indicate that L-proline supplementation modifies both the colonic microbiota composition and the luminal concentrations of several bacterial metabolites. Furthermore, our data show that both the microbiota composition and the concentrations of bacterial metabolites are evolving in the course of pregnancy. These results are discussed in terms of possible implication in terms of luminal environment and consequences for gut physiology and health. Keywords: Bacterial metabolites, Colonic microbiota, L-proline, Pregnant Huanjiang mini-pigs Background survival, fetal growth, as well as maintenance of vascular The gut microbiome of pigs is a robust ecosystem inhab- tone and hemodynamics [14]. Some other amino acid ited by about 100 trillion bacteria. The importance of concentrations must be tightly regulated to avoid dele- the maintenance of host-microbiome symbiosis is under- terious effects in some fetal tissues. For instance, limited scored by the observation that dysbiotic shifts in micro- entry of dietary aspartate and glutamate into blood cir- biota are associated with inflammatory bowel disorders, culation is required to avoid brain injury in the fetuses type 2 diabetes, obesity, and pregnancy metabolic syn- [15]. Thus, several evidences indicate that AA play cru- drome in humans [1–5]. The gut microbiota metabolizes cial roles in both female and male reproduction [16, 17]. dietary compounds in both the small and large intes- Among AA, it has been shown that proline played sev- tines. The microbiota is present at low concentrations eral roles in the development of the placenta, conceptus, and the transit time is relatively rapid in the small intes- and fetus [18, 19]. Increasing proline availability in ma- tine, while the concentration of bacteria is much higher ternal plasma in pigs enhances the concentrations of and the transit time is much longer in the large intes- proline and polyamines in placentae and fetal fluids, and tine. The dietary compounds that are transferred from promotes fetal growth [19]. Faure et al. [20] found that the small intestine to the large intestine are undigested dietary proline supply could promote mucin synthesis, or not fully digested compounds, notably undigested car- re-equilibrate the gut microbiota, and favor mucosal bohydrates and proteins [6]. The metabolic activity of healing in dextran sulfate sodium-treated rats. In addition, the microbiota allows for the synthesis of various com- proline plays an important role in the metabolism and re- pounds, including short-chain fatty acids (SCFA), in- cycling of nitrogenous compounds in bacteria [10]. doles, ammonia, gaseous compounds, organic acids, Gut microbiota changes markedly from the first to the bioamines, and vitamins. Among these various metabo- third trimesters of pregnancy in human beings, with an lites, some are considered beneficial whereas others are overall increase in Proteobacteria and Actinobacteria, believed to exert deleterious effects on the intestinal mu- and reduced richness (i.e., lower species count). Interest- cosa, when present in excess [7]. For instance, among ingly, the mucosal surfaces of the gut during trimester 3 SCFA, butyrate is considered beneficial for the colonic of pregnancy present low-grade inflammation [21]. Our mucosa, because it can exert some anti-inflammatory ef- previous study found that the colonic microbiota dis- fects [8]. The SCFA can reach luminal concentrations of played spatial and temporal heterogeneity in compos- 130 mmol/L in the proximal colon [9]. The concentra- ition, diversity, and species abundance in different tion of SCFA is related to the luminal pH. As weak or- colonic segments from the first to the third trimester of ganic acids, SCFA can decrease the luminal pH and pregnancy [22]. Considering the effect of proline on sev- inhibit some pathogenic microorganisms, while increas- eral physiological functions during pregnancy, and the ing the absorption of some nutrients [10]. Bioamines are role of this amino acid as precursors of metabolites with widely produced by various kinds of bacteria. Although biological effects; the present study was conducted to limited amounts of bioamines have no detectable effect document the effects of L-proline on the colonic luminal on health [11] and participate in the physiology of the microbiota and bacterial metabolite composition (in- host, larger quantities (1.4 g/d) of bioamines can become cluding SCFA and bioamines) in Huanjiang mini-pigs, harmful to humans and livestock [12]. because pigs can be used as a relevant model for ex- Pregnancy is a biological process involving simultan- trapolation to humans [23]. eous changes in many physiological systems, including microbiome composition [13]. Many nutrients, espe- Methods cially amino acids (AA), are required to sustain a suc- Animals cessful pregnancy. For instance, arginine is a The present study was carried out in accordance with the conditionally essential AA involved by itself and/or Chinese guidelines for animal welfare and experimental through its metabolites, in spermatogenesis, embryonic protocols and was approved by the Animal Care and Use Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 3 of 11 Committee of Institute of Subtropical Agriculture, colon (10 cm at the end of the colon) were collected and Chinese Academy of Sciences [24]. A total of 32 prim- stored at − 80 °C for the extraction of total DNA of iparous Huanjiang mini-pigs [average initial body weight microbiota, as well as for determining the concentra- (BW) 28.30 ± 0.87 kg] were used in this study. tions of SCFA and bioamines. Study design Colonic microbiota composition analysis The gilts were obtained from a Huanjiang mini-pig farm The total DNA was extracted from colonic contents located in Huanjiang County, Guangxi province, China. using the QIAamp DNA Stool Mini kit (Qiagen, Hilden, The experimental design consisted of a 2 × 2 factorial Germany) after chemical and mechanical disruptions arrangement, with two dietary treatments: control [27]. The quality and quantity of DNA were measured (alanine) diet and experimental (proline) diet, and two using a NanoDrop ND-1000 spectrophotometer pregnancy stages: d 45 or 75 of pregnancy. The animals (NanoDrop Technologies Inc., Wilmington, DE, USA). were randomly assigned to one of the two dietary groups Quantitative real-time polymerase chain reaction (qPCR) on d 15 after mating, with eight pens per group and two was performed to determine the number of copies of the sows per pen. The average BW of pigs in the control 16S rRNA genes of several targeted bacteria [28]. The group and experimental group was 27.84 ± 1.32 kg and primers, which were validated previously, are listed in 28.82 ± 1.17 kg, respectively. The animals received a Table 2. The qPCR was performed using SYBR Premix same basal diet supplemented with 1% L-proline or Ex Taq™ II kit (TaKaRa Bio Inc., Shiga, Japan) on an ABI 0.77% L-alanine in the control group. The basal diet was 7900HT Fast real-time PCR system (Applied Biosystems, formulated to meet the nutrient requirements and Foster City, CA, USA). The standard curves for all deter- physiological characteristics of Chinese local pigs mined bacteria were prepared using plasmid DNA con- (Table 1). All animals were housed in 2 m × 3 m pens taining each unique 16S rRNA insert. The raw bacterial with cement flooring. Temperature in the room housing qPCR data were transformed to lg the number of target the pens was maintained at 22–28 °C. All the pigs had genomes per gram of wet digesta. access to drinking water ad libitum from a nipple drinker and were fed twice daily (at 08:30 and 16:30 h) Bacterial metabolite analysis with their diets (approximately 3.0% of BW) from a The SCFA, including straight-chain fatty acids (acetate, feeder. propionate, butyrate, and pentanoate) and branched- chain fatty acids (BCFA; isobutyrate, and isopentanoate) Sample collection were analyzed by gas chromatography as described by On d 45 or 70 of pregnancy, eight sows per group were Zhou et al. [29]. The bioamines, including 1,7-heptyl di- weighed and sacrificed using general anesthesia for sam- amine, cadaverine, phenylethylamine, putrescine, trypta- ple collection at 12 h after the last feeding [25, 26]. After mine, tyramine, spermidine, and spermine were analyzed colon recovery, luminal contents of the proximal colon by high-performance liquid chromatography as de- (10 cm at posterior to the ileocecal valve) and the distal scribed by Xu et al. [30]. Statistical analysis Table 1 Composition and nutrient levels of the basal diet The data were analyzed by a mixed-effects model using (air-dry basis, %) SAS version 8.2 (SAS Institute Inc., Cary, NC, USA). Ingredients Content Nutrient Levels ,% Diet, pregnancy stage, and their interaction were in- Corn 54.00 Digestive energy, MJ/kg 13.40 cluded in the statistical model. Effects were considered statistically significant at P < 0.05, while a tendency was Soybean meal 12.00 Crude protein 12.04 considered for 0.05 ≤ P < 0.10. Rice bran 30.00 Calcium 0.78 Premix 4.00 Phosphorus 0.62 Results Total 100.00 Arginine 0.65 Microbiota composition Lysine 0.53 Tables 3 and 4 summarized the effects of diets and preg- Proline 0.67 nancy stages on microbiota composition of proximal and One kg of premix contained the following: vitamin A, 10,200 IU; vitamin D , distal colonic contents, respectively, from pregnant 1600 IU; vitamin E, 75 IU; vitamin K , 75 mg; thiamine, 3 mg; riboflavin, 16 mg; Huanjiang mini-pigs. In proximal colonic contents, the pyridoxine, 3 mg; vitamin B , 0.8 mg; nicotinic acid, 69 mg; D-pantothenic proportion of Prevotella was lower (P < 0.05), but Firmi- acid, 42 mg; folic acid, 4 mg; biotin, 1 mg; chorine, 900 mg; Fe (FeSO ·H O), 4 2 150 mg; Cu (CuSO ·5H O), 11.2 mg; Zn (ZnSO ·H O), 63 mg; Mn (MnSO ·5H O), 4 2 4 2 4 2 cutes/Bacteroidetes (F/B) ratio was higher (P < 0.05) in 32 mg; I (KI), 1.5 mg; Co (CoCO ), 0.3 mg; Se (Na SeO ·H O), 0.25 mg; Ca 3 2 3 2 the proline-supplemented group than in the control (CaCO ), 200 mg; and P (KH PO ), 20 mg 3 2 4 Digestive energy was a calculated value, while the others were measured values group. The proportions of Butyrivibrio fibrisolvens, Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 4 of 11 Table 2 Primer pairs for 16S rRNA genes of bacteria Bacteria Phylum Primer sequences (5′ → 3′) Product size, bp References Bacteroidetes Bacteroidetes F: AGCAGCCGCGGTAAT 184 [62] R: CTAHGCATTTCACCGCTA B. fibrisolvens Firmicutes F: CGCATGATGCAGTGTGAAAAGCTC 625 [63] R: CCTCCCGACACCTATTATTCATCG Bifidobacterium sp. Actinobacteria F: CTCCTGGAAACGGGTGG 226 [64] R: GGTGTTCTTCCCGATATCTACA C. coccoides Firmicutes F: AAATGACGGTACCTGACTAA 440 [65] R: CTTTGAGTTTCATTCTTGCGAA C. coccoides-E. rectale Firmicutes F: CGGTACCTGACTAAGAAGC 429 [65] R: AGTTTYATTCTTGCGAACG C. leptum subgroup Firmicutes F: GCACAAGCAGTGGAGT 239 [66] R: CTTCCTCCGTTTTGTCAA E. coli Proteobacteria F: GACCTCGGTTTAGTTCACAGA 96 [67] R: CACACGCTGACGCTGACCA F. prausnitzii Firmicutes F: AATTCCGCCTACCTCTGCACT 248 [68] R: GGAGGAAGAAGGTCTTCGG Firmicutes Firmicutes F: GTCAGCTCGTGTCGTGA 179 [69] R: CCATTGTAKYACGTGTGT F. prausnitzii Bacteroidetes F: CCCTTCAGTGCCGCAGT 158 [70] R: GTCGCAGGATGTCAAGAC K. pneumoniae Proteobacteria F: CCTGGATCTGACCCTGCAGTA 165 [71] R: CCGTCGCCGTTCTGTTTC Lactobacillus sp. Firmicutes F: TACATCCCAACTCCAGAACG 116 [72] R: AAGCAACAGTACCACGACC M. elsdenii Firmicutes F: GACCGAAACTGCGATGCTAGA 128 [73] R: TCCAGAAAGCCGCTTTCGCCACT P. aeruginosa Proteobacteria F: TCCAAGTTTAAGGTGGTAGGCTG 117 [74] R: CTTTTCTTGGAAGCATGGCATC P. productus Firmicutes F: AACTCCGGTGGTATCAGATG 268 [67] R: GGGGCTTCTGAGTCAGGTA Pseudomonas Proteobacteria F: GAGTTTGATCCTGGCTCAG 440 [75] R: CCTTCCTCCCAACTT Prevotella Bacteroidetes F: CACRGTAAACGATGGATGCC 513 [64] R: GGTCGGGTTGCAGACC Roseburia Firmicutes F: TACTGCATTGGAAACTGTCG 230 [76] R: CGGCACCGAAGAGCAAT S. ruminantium Firmicutes F: TGCTAATACCGAATGTTG 513 [77] R: TCCTGCACTCAAGAAAGA Veillonella spp. Firmicutes F: A(C/T)CAACCTGCCCTTCAGA 335 [70] R: CGTCCCGATTAACAGAGCTT Faecalibacterium prausnitzii Fusobacterium prausnitzii Bifidobacterium sp., Clostridium coccoides, Escherichia In distal colonic contents, the proportion of Klebsiella coli, Faecalibacterium prausnitzii, Fusobacterium praus- pneumoniae (P = 0.06), P. productus (P< 0.05), Pseudo- nitzii, and Prevotella were higher (P < 0.05) on d 70 of monas (P= 0.08), and Veillonella spp. (P= 0.09) tended pregnancy than on d 45 of pregnancy. The proportion of to be lower in the proline-supplemented group than in Clostridium leptum subgroup (P = 0.09), Firmicutes the control group. The proportion of most bacteria, in- (P = 0.07), Peptostreptococcus productus (P = 0.08), and F/ cluding B. fibrisolvens, Bifidobacterium sp., C. coccoides, B ratio (P = 0.07) displayed an increasing trend with preg- C. coccoides-E. rectale, C. leptum subgroup, E. coli, nancy progress. The proportion of C. coccoides- Faecalibacterium prausnitzii,Firmicutes, Fusobacter- Eubacterium rectale and Firmicutes, and F/B ratio were ium prausnitzii, P. productus, and Prevotella increased changed (P < 0.05) owing to diet × stage interactions, and (P < 0.05), whereas that of Pseudomonas aeruginosa a trend was measured for Pseudomonas (P= 0.06). decreased (P < 0.05) with the progress of pregnancy. Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 5 of 11 Table 3 Bacteria groups or species in proximal colonic contents of pregnant Huanjiang mini-pigs (lg bacteria cells/g wet weight) Bacteria Control group Proline group SEM P-values 45 d 70 d 45 d 70 d Diet Day Diet × Day Bacteroidetes 11.18 11.21 10.96 11.06 0.23 0.18 0.63 0.78 B. fibrisolvens 8.97 9.54 8.73 9.33 0.26 0.20 0.003 0.93 Bifidobacterium sp. 8.97 9.98 8.73 9.98 0.24 0.71 0.001 0.70 C. coccoides 10.23 10.77 10.01 10.76 0.25 0.47 0.001 0.54 C. coccoides-E. rectale 9.94 10.31 9.68 10.09 0.24 0.11 0.90 0.01 C. leptum subgroup 10.56 10.67 10.29 10.66 0.23 0.30 0.09 0.33 E. coli 9.93 10.31 9.77 10.30 0.22 0.53 0.003 0.56 F. prausnitzii 10.50 10.75 10.28 10.77 0.22 0.41 0.01 0.34 Firmicutes 11.10 11.04 10.83 11.33 0.21 0.94 0.07 0.03 F. prausnitzii 8.55 10.75 8.15 10.77 0.29 0.41 0.01 0.34 K. pneumoniae 7.57 7.53 7.72 7.51 0.24 0.67 0.39 0.56 Lactobacillus sp. 10.27 10.53 10.25 10.61 0.31 0.90 0.22 0.84 M. elsdenii 8.23 7.55 7.72 7.88 0.33 0.75 0.36 0.14 P. aeruginosa 8.73 8.43 8.93 8.72 0.25 0.15 0.13 0.76 P. productus 7.87 8.07 7.81 8.04 0.22 0.68 0.08 0.87 Pseudomonas 6.80 7.24 7.03 6.99 0.22 0.92 0.12 0.06 Prevotella 9.01 9.86 8.59 9.23 0.30 0.03 0.004 0.67 Roseburia 8.31 8.47 7.95 8.37 0.28 0.27 0.16 0.54 S. ruminantium 7.26 7.53 7.03 7.17 0.28 0.16 0.34 0.74 Veillonella spp. 7.21 6.83 6.88 6.90 0.27 0.48 0.34 0.29 F/B ratio 0.99 0.99 0.99 1.02 0.05 0.02 0.07 0.01 F/B ratio Firmicutes/Bacteroidetes ratio The F/B ratio displayed an increasing trend (P = 0.09) higher (P < 0.05) on d 70 of pregnancy than on d 45 of with the progress of pregnancy. The proportion of pregnancy. Proline supplementation, however, did not Bifidobacterium sp. (P =0.09), K. pneumoniae (P < 0.09), affect the concentrations of SCFA. P. aeruginosa (P =0.06), P. productus (P =0.06), and Pseudomonas (P = 0.07) changed owing to the diet × stage Bioamine contents interactions. The bioamine concentrations in colonic contents of pregnant Huanjiang mini-pigs are summarized in Table 6. The SCFA concentrations In proximal colonic contents, the concentrations of The SCFA concentrations in colonic contents of preg- 1,7-heptyl diamine (P = 0.09) and phenylethylamine nant Huanjiang mini-pigs are summarized in Table 5. (P < 0.05) tended to and were significantly higher in the In proximal colonic contents, the concentrations of proline-supplemented group, respectively, whereas those acetate, total straight-chain fatty acids, and total SCFA of spermidine (P = 0.05) and total bioamine (P =0.06) were lower (P < 0.05) in the proline-supplemented were lower or tended to be lower than those in the control group. The concentrations of butyrate tended to be group. The concentrations of spermidine, spermine, and decreased (P = 0.06) in the proline-supplemented total bioamine were higher (P <0.05) on d 70 of group, when compared with the control group. Almost pregnancy, whereas that of phenylethylamine (P <0.05) all of the SCFA in proximal colonic contents presented was lower than those on d 45 of pregnancy. The concen- higher (P < 0.05) concentrations on d 70 of pregnancy trations of 1,7-heptyl diamine, phenylethylamine, sperm- than on d 45 of pregnancy. The concentrations of acetate ine, and tryptamine displayed differences (P <0.05) (P = 0.099), butyrate (P = 0.05), isovalerate (P = 0.09), total according to diet × stage interactions, as well as straight-chain fatty acids (P = 0.06), and total SCFA total bioamine concentration (P = 0.096). In distal co- (P = 0.05) were changed, or tended to be changed, owing lonic contents, the concentrations of 1,7-heptyl diamine to the diet × stage interactions. In distal colonic contents, (P =0.07) and tryptamine (P < 0.05) were higher in the the concentrations of isobutyrate and total BCFA were proline-supplemented group, whereas those of cadaverine Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 6 of 11 Table 4 Bacteria groups or species in distal colonic contents of pregnant Huanjiang mini-pigs (lg bacteria cells/g wet weight) Item Control group Proline group SEM P-values 45 d 70 d 45 d 70 d Diet Day Diet × Day Bacteroidetes 11.04 11.03 10.91 11.11 0.23 0.84 0.47 0.46 B. fibrisolvens 8.72 9.12 8.63 9.22 0.23 0.98 0.001 0.49 Bifidobacterium sp. 9.17 9.99 9.39 9.53 0.27 0.52 0.02 0.08 C. coccoides 10.28 10.72 10.19 10.61 0.21 0.40 0.001 0.94 C. coccoides-E. rectale 9.79 10.12 9.81 10.08 0.23 0.95 0.04 0.84 C. leptum subgroup 9.98 10.42 9.97 10.19 0.24 0.42 0.04 0.44 E. coli 9.89 10.14 9.82 10.21 0.22 0.98 0.02 0.59 F. prausnitzii 10.10 10.33 10.11 10.35 0.20 0.88 0.03 0.94 Firmicutes 10.77 11.08 10.70 10.95 0.21 0.38 0.02 0.78 F. prausnitzii 7.92 8.43 7.91 8.29 0.23 0.57 0.003 0.65 K. pneumoniae 7.66 7.39 7.15 7.43 0.22 0.06 0.98 0.03 Lactobacillus sp. 9.82 10.10 9.73 9.97 0.31 0.66 0.29 0.93 M. elsdenii 8.12 7.77 7.84 7.84 0.31 0.68 0.48 0.49 P. aeruginosa 8.70 8.68 9.13 8.52 0.24 0.37 0.04 0.06 P. productus 7.70 8.23 7.65 7.77 0.20 0.02 0.01 0.06 Pseudomonas 7.23 6.81 6.60 6.82 0.26 0.08 0.56 0.07 Prevotella 8.61 9.25 8.18 8.90 0.31 0.12 0.01 0.87 Roseburia 7.98 8.07 8.06 8.12 0.28 0.75 0.69 0.93 S. ruminantium 7.03 7.12 7.01 7.37 0.29 0.61 0.31 0.54 Veillonella spp. 7.19 6.98 6.83 6.78 0.25 0.09 0.43 0.63 F/B ratio 0.98 1.00 0.98 0.99 0.06 0.46 0.09 0.21 F/B ratio Firmicutes/Bacteroidetes ratio (P < 0.05), phenylethylamine (P < 0.05), and tyramine Pregnancy is a time of dramatic host remodeling for (P = 0.098) were lower than those in the control the mother, and may be partly viewed as the develop- group. The concentrations of spermidine (P <0.05), ment of adaptive processes in a context of major new spermine (P < 0.05), tryptamine (P < 0.05), and total physiological constraints. Our previous study showed bioamine (P = 0.08) were higher, but cadaverine and that during pregnancy, both the body weight and fat phenylethylamine were lower (P <0.05) on d 70 than over lean mass ratio increased in the Huanjiang mini- on d 45 of pregnancy. The concentrations of cadaver- pigs [32]. In agreement with the above, it has been re- ine, phenylethylamine, putrescine, and tryptamine dis- ported that pregnant female Ossabaw mini-pigs dis- played differences (P < 0.05) according to diet × stage played higher body weight, notably due to fat deposition interactions. [33], which was association with higher levels of trigly- ceride and very low-density lipoprotein [34], and lower Discussion levels of high-density lipoprotein cholesterol, and low- Several studies revealed that the indigenous microbiota density lipoprotein cholesterol [35]. in the gut play important roles in the metabolism and A previous study showed that the pregnancy stage and recycling of nitrogenous compounds, including AA [10, diet composition may affect gut microbial composition 20]. Furthermore, changes in gut microbiota of pregnant [36]. The present study confirms these results and eluci- human and animals have been documented in recent dates that the proportion of Prevotella increased with years [13, 23, 31]. The present study indicates that diet- progress of pregnancy. This is consistent with the study ary supplementation with proline affects the colonic lu- of Collado and Isolauri [3], who reported that the abun- minal microbiota and bacterial metabolite composition dances of Bacteroides-Prevotella group, Clostridium, and in Huanjiang mini-pigs. In addition, our study confirms Staphylococcus increased from first trimester to third tri- that the composition of bacteria in the colon, as well as mester of normal-weight and overweight pregnant the luminal environment, differ according to the stage of women. Moreover, Santacruz et al. [37] confirmed that pregnancy. the proportion of Firmicutes, especially Clostridium Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 7 of 11 Table 5 Short-chain fatty acid concentrations in colonic contents of pregnant Huanjiang mini-pigs (mg/g) Item Control group Proline group SEM P-values 45 d 70 d 45 d 70 d Diet Day Diet × Day Proximal colonic contents Acetate 16.72 34.24 14.70 22.76 1.07 0.02 < 0.01 0.099 Propionate 5.95 12.56 6.36 9.44 0.71 0.28 < 0.01 0.16 Isobutyrate 0.23 0.92 0.28 0.71 0.19 0.41 < 0.01 0.17 Butyrate 3.64 6.69 3.68 4.18 0.51 0.06 0.010 0.05 Isovalerate 0.19 0.70 0.21 0.50 0.16 0.15 < 0.01 0.09 Valerate 0.43 1.43 0.44 1.16 0.24 0.35 < 0.01 0.34 Total BCFA 0.42 1.61 0.49 1.21 0.25 0.28 < 0.01 0.13 Total straight-chain fatty acids 26.75 54.92 25.18 37.54 1.27 0.02 < 0.01 0.06 Total SCFA 27.17 56.53 25.67 38.74 1.29 0.03 < 0.01 0.05 Distal colonic contents Acetate 10.48 9.07 10.38 10.02 0.60 0.60 0.28 0.52 Propionate 4.01 3.81 4.00 4.60 0.38 0.24 0.54 0.24 Isobutyrate 0.36 0.49 0.34 0.48 0.13 0.78 0.01 0.92 Butyrate 2.94 2.95 2.93 2.71 0.38 0.71 0.75 0.73 Isovalerate 0.33 0.39 0.31 0.34 0.13 0.34 0.25 0.62 Valerate 0.48 0.50 0.41 0.51 0.14 0.57 0.17 0.39 Total BCFA 0.69 0.88 0.66 0.82 0.18 0.53 0.03 0.84 Total straight-chain fatty acids 17.90 16.33 17.72 17.85 0.76 0.61 0.59 0.52 Total SCFA 18.59 17.21 18.38 18.67 0.77 0.64 0.69 0.54 clusters, is associated with excessive BW and obesity in accordance with some data on the evolution of the human subjects. Similar to the obese human subjects, microbiota composition during pregnancy, SCFA pre- the sows at d 70 of pregnancy had increased proportions sented higher concentrations in proximal colonic con- of C. coccoides, C. leptum subgroup, E. coli, Faecalibac- tents. In the distal colonic contents recovered at d 70 of terium prausnitzii, P. productus, and Firmicutes, as com- pregnancy. Isobutyrate and total BCFA concentrations in pared with those at d 45 of pregnancy. The increased the distal colonic contents were higher at d 70 than at d proportion of Firmicutes is considered to affect the 45 of pregnancy. As BCFA concentrations are consid- metabolic potential of the gut microbiota and enhance ered as indicators of protein catabolism by the micro- the capacity of the body to harvest energy from the diet biota in the luminal intestinal content [43], these results [38]. In addition, colonization of germ-free mice with are suggestive of increased protein fermentation in the the butyrate-producing bacteria B. fibrisolvens rescued distal colon at d 70 of pregnancy as compared with that colonic epithelia from the energy starvation status [39]. at d 45. The present study shows that the proportion of Based on our results, it appeared that some bacteria in- saccharolytic bacteria generating SCFA [44], including C. volved in indigestible carbohydrate fermentation in- coccoides, C. coccoides-E. rectale, and C. leptum sub- creased by d 70 of pregnancy, thereby allowing the groups, increases similarly when compared with the production of more SCFA and increased energy recyc- Firmicutes phylum. Faecalibacterium prausnitzii, Fuso- ling for the pregnant sows and their fetuses. bacterium, and Clostridium are known butyrate pro- Bacterial cross-feeding has a huge impact on the final ducers [45–48]. Prevotella had been proposed to balance of the SCFA production, absorption, and effi- enhance calorie extraction from resistant starches, oligo- cient exploitation of the substrates in the gut [40]. The saccharides, and other indigested carbohydrates [49], vast majority of acetate in the body is produced by the and its concentration is associated with increased co- gut microbiota, and the total fecal propionate concentra- lonic SCFA. In addition to participating in the digestive tion is linked to the relative abundance of Bacteroidetes process, microbiota allows local synthesis of SCFA, and Firmicutes [41]. Butyrate produced by the gut which are used as energy substrates by the host [50]. microbiota is dependent on butyrate-producers, such as Parts of SCFA are absorbed and metabolized by the Faecalibacterium, Eubacterium, and Roseburia [42]. In colonocytes, while the unmetabolized portion can enter Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 8 of 11 Table 6 Bioamine concentrations in colonic contents of pregnant Huanjiang mini-pigs (μg/g) Items Control group Proline group SEM P- values 45 d 70 d 45 d 70 d Diet Day Diet × Day Proximal colonic contents 1,7-heptyl diamine 2.22 2.36 2.95 2.28 0.26 0.09 0.15 0.04 Cadaverine 13.61 12.77 12.99 16.67 0.98 0.50 0.56 0.36 Phenylethylamine 6.67 8.64 12.99 6.36 0.44 0.001 < 0.01 < 0.01 Putrescine 20.30 24.38 21.83 19.12 0.99 0.45 0.78 0.18 Spermidine 35.97 67.63 30.96 44.35 1.64 0.05 0.005 0.19 Spermine 5.71 15.79 9.15 10.67 0.83 0.64 0.006 0.03 Tryptamine 1.46 2.14 2.46 1.03 0.39 0.89 0.35 0.02 Tyramine 2.82 2.53 2.02 1.79 0.45 0.15 0.61 0.96 Total bioamine 101.90 151.18 98.32 106.42 2.15 0.06 0.03 0.096 Distal colonic contents 1,7-heptyl diamine 1.63 1.24 1.80 2.06 0.32 0.07 0.78 0.22 Cadaverine 15.81 6.23 5.71 6.81 0.80 0.01 0.02 0.005 Phenylethylamine 10.09 4.47 5.70 4.57 0.54 0.011 < 0.01 0.008 Putrescine 13.87 10.51 8.84 14.30 0.65 0.56 0.33 0.001 Spermidine 29.54 33.79 22.67 38.67 1.21 0.79 0.02 0.13 Spermine 7.31 9.92 7.86 9.95 0.66 0.79 0.046 0.81 Tryptamine 0.28 0.23 0.17 1.31 0.23 0.002 0.001 < 0.01 Tyramine 1.71 1.87 0.96 1.67 0.33 0.098 0.12 0.32 Total bioamine 64.82 73.97 68.31 79.33 1.47 0.42 0.08 0.86 diverse carbohydrates and lipid metabolic routes in the the distal colonic contents. These bacterial species can peripheral tissues. While most of the butyrate pro- metabolize carbohydrates, especially indigestible fiber duced by the microbiota is metabolized in enterocytes/ [54]. Klebsiella pneumoniae, which is the most signifi- colonocytes during its transfer from the intestinal cant member of Enterobacteriaceae and Peptostreptococ- lumen to the bloodstream, propionate mainly incorpo- cus productus, are predominant for the utilization of rates into the gluconeogenesis pathway, while acetate glutamate or tryptophan [52]. Ren et al. [55] reported is mostly metabolized into the lipid biosynthesis path- that dietary proline supplementation confers a positive way [41]. Collectively, the increased SCFA production immune effect in porcine circovirus-infected pregnant and absorption may provide additional nutrients for and non-pregnant mice. pregnant sows; however, additional work outside of the Proteins are degraded by the bacterial protease and pep- scope of the present study is necessary to test this tidase activities, and the AA released from the proteins hypothesis. can be precursors of various bioamines in the colon via The AA serve not only as protein building bricks but specific AA decarboxylation pathways by specific bacteria also act as energy substrates, signaling molecules, and/or [56]. In bacteria, the bioamines are involved in many pro- as precursors for bioactive compounds [51]. Thus, AA cesses related to transcription, translation, growth, metab- intervene in the regulation of diverse physiological olism, and other functions, including improved acid process related to the reproductive functions, ranging resistance, protection from oxidative stress and host im- from spermatogenesis to oocyte fertilization and embryo munological defenses [56–60]. For instance, E. coli synthe- implantation [52]. In the large intestine, AA are not sized cadaverine during anaerobic growth at low pH in absorbed to any significant extent by the colonic mucosa the presence of its precursor lysine [61]. Several (except in the neonatal period), and thus are mostly me- bioamine-producing taxa belong to Prevotella and Mega- tabolized by the microbiota into various intermediary sphaera [60]. This may explain why the concentrations of and end products [53]. The present study showed that spermidine, spermine, and total bioamines in colonic con- dietary proline supplementation decreased the propor- tents increased with the progress of pregnancy. tion of Prevotella in the proximal colonic contents, and The way by which supplemental proline exerts its ef- the proportions of K. pneumoniae and P. productus in fect on colonic microbiota remains elusive, considering Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 9 of 11 that the capacity of the small intestine for the absorption Competing interests The authors declare that they have no competing interests. of amino acids is high. In other words, the dietary pro- line originating from the dietary proteins and supple- Author details ment is most likely large, if not totally absorbed by the National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Key Laboratory of Agro-ecological small intestinal epithelium. Thus, we propose that the Processes in Subtropical Region, Institute of Subtropical Agriculture, Chinese effects of dietary proline on the colonic ecosystem would 2 Academy of Sciences, Changsha, Hunan 410125, China. Research Center of be dependent, at least in part, on the effect of this AA Mini-pig, Huanjiang Observation and Research Station for Karst Ecosysterms, Huanjiang, Guangxi 547100, China. UMR 914 INRA/AgroParisTech/Universite on the microbiota composition and metabolic activity in Paris-Sacaly, Nutrition Physiology and Ingestive Behavior, 75005 Paris, France. the small intestine; such effects presumably affect the large intestinal luminal environment. This hypothesis is Received: 20 April 2017 Accepted: 10 January 2018 worthy of testing in future experiments. Conclusion References 1. Turnbaugh PJ, Hamady M, Yatsunenko T, Cantarel BL, Duncan A, In conclusion, the present study indicates that L-pro- Ley RE, et al. A core gut microbiome in obese and lean twins. Nature. line supplementation modifies the colonic microbiota 2009;457(7228):480–7. composition and the luminal concentrations of several 2. Karlsson FH, Tremaroli V, Nookaew I, Bergstrom G, Behre CJ, Fagerberg B, et al. Gut metagenome in European women with normal, impaired and bacterial metabolites. Furthermore, our data show that diabetic glucose control. Nature. 2013;498(7452):99–103. both the microbiota composition and the concentra- 3. Collado MC, Isolauri E, Laitinen K, Salminen S. Distinct composition of gut tions of bacterial metabolites are evolving in the microbiota during pregnancy in overweight and normal-weight women. Am J Clin Nutr. 2008;88(4):894–9. course of pregnancy. The changes in the luminal en- 4. Feng ZM, Li TJ, Wu L, Xiao DF, Blachier F, Yin YL. Monosodium L-glutamate vironment associated with these changes in micro- and dietary fat differently modify the composition of the intestinal biota composition need to be evaluated in terms of microbiota in growing pigs. Obes Facts. 2015;8(2):87–100. 5. Weitkunat K, Schumann S, Petzke KJ, Blaut M, Loh G, Klaus S. Effects of dietary beneficial over deleterious effects for the colonic mu- inulin on bacterial growth, short-chain fatty acid production and hepatic lipid cosa and for peripheral tissues in the mother and the metabolism in gnotobiotic mice. J Nutr Biochem. 2015;26(9):929–37. fetuses. 6. Portune KJ, Beaumont M, Davila AM, Tomé D, Blachier F, Sanz Y. Gut microbiota role in dietary protein metabolism and health-related outcomes: Abbreviations the two sides of the coin. Trends Food Sci Tech. 2016;57:213–32. AA: Amino acids; BCFA: Branched-chain fatty acids; qPCR: Quantitative real- 7. Blachier F, Beaumont M, Andriamihaja M, Davila AM, Lan A, Grauso M, et al. time polymerase chain reaction; SCFA: Short-chain fatty acids Changes in the luminal environment of the colonic epithelial cells and physiopathological consequences. Am J Pathol. 2017;187(3):476–86. Acknowledgments 8. Thibault R, Blachier F, Darcy-Vrillon B, de Coppet P, Bourreille A, Segain P. We thank staffs and postgraduate students of Hunan Provincial Engineering Butyrate utilization by the colonic mucosa in inflammatory bowel diseases: Research Center of Healthy Livestock for collecting samples and technicians a transport deficiency. Inflamm Bowel Dis. 2017;16(4):684–95. from key laboratory of agro-ecological processes in subtropical region for 9. Hamer HM, Jonkers D, Venema K, Vanhoutvin S, Troost FJ, Brummer RJ. providing technical assistance. We also thank Editage [http://online.editage.cn/] Review article: the role of butyrate on colonic function. Aliment Pharmacol for English language editing. Ther. 2008;27(2):104–19. 10. Macfarlane GT, Macfarlane S. Bacteria, colonic fermentation, and Funding gastrointestinal health. J AOAC Int. 2012;95(1):50–60. The present work was jointly supported by grants from the National Nature 11. Bardocz S, Duguid TJ, Brown DS, Grant G, Pusztai A, White A, et al. The Science Foundation of China (31572421 and 31270044), National Key R & D importance of dietary polyamines in cell regeneration and growth. Br J Program (2017YFD0500503), “Western Light” key program for Talent Cultivation Nutr. 1995;73(6):819–28. from Chinese Academy of Sciences, and Chinese Academy of Sciences Visiting 12. Fusi E, Rossi L, Rebucci R, Cheli F, Di Giancamillo A, Domeneghini C, et al. Professorship for Senior International Scientists (F. Blachier, 2013T2S0014). Administration of biogenic amines to Saanen kids: effects on growth performance, meat quality and gut histology. Small Ruminant Res. Availability of data and materials 2004;53(1–2):1–7. The datasets supporting the conclusions of this article are included within 13. Nuriel-Ohayon M, Neuman H, Koren O. Microbial changes during the article. pregnancy, birth, and infancy. Front Microbiol. 2016;(1031). https://doi.org/ 10.3389/fmicb.2016.01031. eCollection 2016. Authors’ contributions 14. Bazer FW. Contributions of an animal scientist to understanding the biology XFK designed the study; YJJ, QPG, and XFK carried out the experiments and of the uterus and pregnancy. Reprod Fertil Dev. 2013;25(1):129–47. data analysis; YJJ, XFK, YLY, and FB drafted and revised the manuscript. All 15. Wu GY, Bazer FW, Davis TA, Kim SW, Li P, Rhoads JM, et al. Arginine authors have read and approved the final version of the manuscript. metabolism and nutrition in growth, health and disease. Amino Acids. 2009;37:153–68. Ethics approval and consent to participate 16. Wu GY, Bazer FW, Johnson GA, Herring C, Seo H, Dai ZL, et al. Functional This article does not contain any studies with human participants performed amino acids in the development of the pig placenta. Mol Reprod Dev. by any of the authors. The use of animals for this research was approved by 2017;84(9):870–82. the Institutional Animal Care and Use Committee of the Institute of Subtropical 17. Wu GY, Bazer FW, Satterfield MC, Li XL, Wang XQ, Johnson GA, et al. Agriculture, Chinese Academy of Sciences. All procedures performed in studies Impacts of arginine nutrition on embryonic and fetal development in involving animals were in accordance with the ethical standards of the mammals. Amino Acids. 2013;45(2):241–56. institution or practice at which the studies were conducted. 18. Kwon H, Ford SP, Bazer FW, Spencer TE, Nathanielsz PW, Nijland MJ, et al. Maternal undernutrition reduces concentrations of amino acids and Consent for publication polyamines in ovine fetal plasma and placental fluids. Biol Reprod. Not applicable. 2004;71(3):901–8. Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 10 of 11 19. Wu GY, Bazer FW, Datta S, Johnson GA, Li P, Satterfield MC, et al. Proline 40. Perry RJ, Peng L, Barry NA, Cline GW, Zhang D, Cardone RL, et al. Acetate metabolism in the conceptus: implications for fetal growth and mediates a microbiome-brain-beta-cell axis to promote metabolic development. Amino Acids. 2008;35(4):691–702. syndrome. Nature. 2016;534(7606):213–7. 20. Faure M, Mettraux C, Moennoz D, Godin JP, Vuichoud J, Rochat F, et al. 41. Ríos-Covián D, Ruas-Madiedo P, Margolles A, Gueimonde M, de Los Reyes- Specific amino acids increase mucin synthesis and microbiota in dextran Gavilán CG, Salazar N. Intestinal short chain fatty acids and their link with sulfate sodium-treated rats. J Nutr. 2006;136(6):1558–64. diet and human health. Front Microbiol. 2016;7:185. 42. Louis P, Hold GL, Flint HJ. The gut microbiota, bacterial metabolites and 21. Koren O, Goodrich JK, Cullender TC, Spor A, Laitinen K, Backhed HK, et al. colorectal cancer. Nat Rev Microbiol. 2014;12(10):661–72. Host remodeling of the gut microbiome and metabolic changes during pregnancy. Cell. 2012;150(3):470–80. 43. Blachier F, Mariotti F, Huneau JF, Tomé D. Effects of amino acid-derived 22. Chalvon-Demersay T, Blachier F, Tomé D, Blais A. Animal models for the luminal metabolites on the colonic epithelium and physiopathological study of the relationships between diet and obesity: a focus on dietary consequences. Amino Acids. 2007;33(4):547–62. protein and estrogen deficiency. Front Nutr. 2017;4(5). https://doi.org/10. 44. Wang L, Conlon MA, Christophersen CT, Sorich MJ, Angley MT. 3389/fnut.2017.00005. eCollection 2017. Gastrointestinal microbiota and metabolite biomarkers in children with 23. Kong XF, Ji YJ, Li HW, Zhu Q, Blachier F, Geng MM, et al. Colonic luminal autism spectrum disorders. Biomark Med. 2014;8(3):331–44. microbiota and bacterial metabolite composition in pregnant Huanjiang 45. Burcelin R. Regulation of metabolism: a cross talk between gut microbiota mini-pigs: effects of food composition at different times of pregnancy. Sci and its human host. Physiology. 2012;27(5):300–7. Rep. 2016;6(37224). https://doi.org/10.1038/srep37224. 46. Remely M, Hippe B, Geretschlaeger I, Stegmayer S, Hoefinger I, 24. Yin YL, Yao K, Liu ZJ, Gong M, Ruan Z, Deng D, et al. Supplementing Haslberger A. Increased gut microbiota diversity and abundance of L-leucine to a low-protein diet increases tissue protein synthesis in Faecalibacterium prausnitzii and Akkermansia after fasting: a pilot study. weanling pigs. Amino Acids. 2010;39(5):1477–86. Wien Klin Wochenschr. 2015;127(9–10):394–8. 25. Kong XF, Wu GY, Liao YP, Hou ZP, Liu HJ, Yin FG, et al. Effects of Chinese 47. Stenman LK, Burcelin R, Lahtinen S. Establishing a causal link between gut herbal ultra-fine powder as a dietary additive on growth performance, microbes, body weight gain and glucose metabolism in humans-towards serum metabolites and intestinal health in early-weaned piglets. Livest Sci. treatment with probiotics. Benef Microbes. 2015;7(1):11–22. 2007;108(1–3):272–5. 48. Yao P, Cui M, Wang H, Gao H, Wang L, Yang T, et al. Quantitative analysis of 26. Liu YY, Li FN, Kong XF, Tan BE, Li YH, Duan YH, et al. Signaling pathways intestinal flora of Uygur and Han ethnic Chinese patients with ulcerative related to protein synthesis and amino acid concentration in pig skeletal colitis. Gastroenterol Res Pract. 2016:9186232. muscles depend on the dietary protein level, genotype and developmental 49. Flint HJ, Bayer EA, Rincon MT, Lamed R, White BA. Polysaccharide utilization stages. PLoS One. 2015;10(9):e0138277. by gut bacteria: potential for new insights from genomic analysis. Nat Rev 27. Fanca-Berthon P, Hoebler C, Mouzet E, David A, Michel C. Intrauterine Microbiol. 2008;6(2):121–31. growth restriction not only modifies the cecocolonic microbiota in neonatal 50. Kelly CJ, Zheng L, Campbell EL, Saeedi B, Scholz CC, Bayless AJ, et al. Crosstalk rats but also affects its activity in young adult rats. J Pediatr Gastroenterol between microbiota-derived short-chain fatty acids and intestinal epithelial HIF Nutr. 2010;51(4):402–13. augments tissue barrier function. Cell Host Microbe. 2015;17(5):662–71. 28. Jost T, Lacroix C, Braegger C, Chassard C. Stability of the maternal gut 51. Vidal-Lletjós S, Beaumont M, Tomé D, Benamouzig R, Blachier F, Lan A. Dietary microbiota during late pregnancy and early lactation. Curr Microbiol. protein and amino acid supplementation in inflammatory bowel disease 2014;68(4):419–27. course: what impact on the colonic mucosa? Nutrients. 2017;9(3):310. 29. Zhou XL, Kong XF, Lian GQ, Blachier F, Geng MM, Yin YL. Dietary 52. Dai ZL, Wu ZL, Hang SQ, Zhu WY, Wu GY. Amino acid metabolism in supplementation with soybean oligosaccharides increases short-chain fatty intestinal bacteria and its potential implications for mammalian acids but decreases protein-derived catabolites in the intestinal luminal reproduction. Mol Hum Reprod. 2015;21(5):389–409. content of weaned Huanjiang mini-piglets. Nutr Res. 2014;34(9):780–8. 53. Davila AM, Blachier F, Gotteland M, Andriamihaja M, Benetti PH, Sanz Y, et 30. Xu LW, Geng MM, Zhang LP, Yuan HZ, Kong XF, Wang JR. Determination of al. Intestinal luminal nitrogen metabolism: role of the gut microbiota and bioamines in colonic contents of piglets by pre-column. Acta Nutrimenta consequences for the host. Pharmacol Res. 2013;68(1):95–107. Sinica. 2014;6(36):78–83. 54. Wu GD, Chen J, Hoffmann C, Bittinger K, Chen YY, Keilbaugh SA, et al. 31. Ma J, Prince AL, Bader D, Hu M, Ganu R, Baquero K, et al. High-fat maternal diet Linking long-term dietary patterns with gut microbial enterotypes. Science. during pregnancy persistently alters the offspring microbiome in a primate 2011;334(6052):105–8. model. Nat Commun. 2014;5(3889). https://doi.org/10.1038/ncomms4889. 55. Ren W, Wu M, Luo W, Huang R, Yin Y, Li Y, et al. Dietary supplementation 32. Zhang T, Zha W, Tang ZL, Kong XF. Efects of dietary proline on body with proline confers a positive effect in both porcine circovirus-infected composition in pregnant Huanjiang mini-pigs. Chin J Anim Nutr. pregnant and non-pregnant mice. Br J Nutr. 2013;110(8):1492–9. 2017;29(2):556–61. 56. Shah P, Swlatlo E. A multifaceted role for polyamines in bacterial pathogens. 33. Newell-Fugate AE, Taibl JN, Clark SG, Alloosh M, Sturek M, Krisher RL. Effects Mole Microbiol. 2008;68(1):4–16. of diet-induced obesity on metabolic parameter and reproductive function 57. Wallace HM, Fraser AV, Hughes A. A perspective of polyamine metabolism. in female Ossabaw minipigs. Comp Med. 2014;64(1):44–9. Biochem J. 2003;376:1–14. 34. Ferrazzi E, Sears B, editors. Metabolic syndrome and complications of 58. Goytia M, Shafer WM. Polyamines can increase resistance of Neisseria pregnancy: the potential preventive role of nutrition. AG, Swizerland: gonorrhoeae to mediators of the innate human host defense. Infect Springer International Publishing; 2015. Immun. 2010;78(7):3187–95. 35. Luo Y, Qu H, Wang H, Wei H, Wu J, Duan Y, et al. Plasma periostin levels are 59. Jelsbak L, Thomsen LE, Wallrodt I, Jensen PR, Olsen JE. Polyamines are increased in Chinese subjects with obesity and type 2 diabetes and are positively required for virulence in Salmonella enterica serovar typhimurium. PLoS One. correlated with glucose and lipid parameters. Mediat Inflamm. 2016:6423637. 2012;7(4):e36149. 36. Mandal S, Godfrey KM, McDonald D, Treuren WV, Bjørnholt JV, Midtvedt T, 60. Nelson TM, Borgogna JL, Brotman RM, Ravel J, Walk ST, Yeoman CJ. Vaginal et al. Fat and vitamin intakes during pregnancy have stronger relations with biogenic amines: biomarkers of bacterial vaginosis or precursors to vaginal a pro-inflammatory maternal microbiota than does carbohydrate intake. dysbiosis? Front Physiol. 2015;6(253). https://doi.org/10.3389/fphys.2015. Microbiome. 2016;4(1):55. 00253. eCollection 2015. 37. Santacruz A, Collado MC, Garcia-Valdes L, Segura MT, Martin-Lagos JA, 61. Watson N, Dunyak DS, Rosey EL, Slonczewski JL, Olson ER. Identification of Anjos T, et al. Gut microbiota composition is associated with body elements involved in transcriptional regulation of the Escherichia-Coli-cad weight, weight gain and biochemical parameters in pregnant women. operon by external pH. J Bacteriol. 1992;174(2):530–40. Brit J Nutr. 2010;104(1):83–92. 62. Armougom F, Henry M, Vialettes B, Raccah D, Raoult D. Monitoring 38. Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER, Gordon JI. An bacterial community of human gut microbiota reveals an increase in obesity-associated gut microbiome with increased capacity for energy Lactobacillus in obese patients and methanogens in anorexic patients. harvest. Nature. 2006;444(7122):1027–31. PLoS One. 2009;4(9):e7125. 39. Donohoe DR, Garge N, Zhang XX, Sun W, O'Connell TM, Bunger MK, et al. 63. Fernando SC, Purvis HT, Najar FZ, Sukharnikov LO, Krehbiel CR, Nagaraja TG, The microbiome and butyrate regulate energy metabolism and autophagy et al. Rumen microbial population dynamics during adaptation to a high- in the mammalian colon. Cell Metab. 2011;13(5):517–26. grain diet. Appl Environ Microbiol. 2010;76(22):7482–90. Ji et al. Journal of Animal Science and Biotechnology (2018) 9:18 Page 11 of 11 64. Matsuki T, Watanabe K, Fujimoto J, Miyamoto Y, Takada T, Matsumoto K, et al. Development of 16S rRNA-gene-targeted group-specific primers for the detection and identification of predominant bacteria in human feces. Appl Environ Microbiol. 2002;68(11):5445–51. 65. Bartosch S, Fite A, Macfarlane GT, McMurdo ME. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Appl Environ Microbiol. 2004;70(6):3575–81. 66. Matsuki T, Watanabe K, Fujimoto J, Takada T, Tanaka R. Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces. Appl Environ Microbiol. 2004;70(12):7220–8. 67. Wang RF, Cao WW, Cerniglia CE. PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples. Appl Environ Microbiol. 1996;62(4):1242–7. 68. Ramirez-Farias C, Slezak K, Fuller Z, Duncan A, Holtrop G, Louis P. Effect of inulin on the human gut microbiota: stimulation of Bifidobacterium adolescentis and Faecalibacterium prausnitzii. Brit J Nutr. 2009;101(4):541–50. 69. Armougom F, Raoult D. Use of pyrosequencing and DNA barcodes to monitor variations in Firmicutes and Bacteroidetes communities in the gut microbiota of obese humans. BMC Genomics. 2008;9:576. 70. Rinttila T, Kassinen A, Malinen E, Krogius L, Palva A. Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J Appl Microbiol. 2004;97(6):1166–77. 71. Shannon KE, Lee DY, Trevors JT, Beaudette LA. Application of real-time quantitative PCR for the detection of selected bacterial pathogens during municipal wastewater treatment. Sci Total Environ. 2007;382(1):121–9. 72. Menard JP, Fenollar F, Henry M, Bretelle F, Raoult D. Molecular quantification of gardnerella vaginalis and atopobium vaginae loads to predict bacterial vaginosis. Clin Infect Dis. 2008;47(1):33–43. 73. Ouwerkerk D, Klieve AV, Forster RJ. Enumeration of Megasphaera elsdenii in rumen contents by real-time taq nuclease assay. J Appl Microb. 2002;92(4):753–8. 74. Schwartz T, Volkmann H, Kirchen S, Kohnen W, Schön-Hölz K, Jansen B, et al. Real-time PCR detection of Pseudomonas aeruginosa in clinical and municipal wastewater and genotyping of the ciprofloxacin-resistant isolates. FEMS Microbiol Ecol. 2006;57(1):158–67. 75. Yadav JS, Khan IU, Fakhari F, Soellner MB. DNA-based methodologies for rapid detection, quantification, and species- or strain-level identification of respiratory pathogens (mycobacteria and pseudomonads) in metalworking fluids. Appl Occup Environ Hyg. 2003;18(11):966–75. 76. Larsen N, Vogensen FK, van den Berg FW, Nielsen DS, Andreasen AS, Pedersen BK, et al. Gut microbiota in human adults with type 2 diabetes differs from non-diabetic adults. PLoS One. 2010;5(2):e9085. 77. Tajima K, Aminov RI, Nagamine T, Matsui H, Nakamura M, Benno Y. Diet- dependent shifts in the bacterial population of the rumen revealed with real-time PCR. Appl Environ Microbiol. 2001;67(6):2766–74. Submit your next manuscript to BioMed Central and we will help you at every step: • We accept pre-submission inquiries � Our selector tool helps you to find the most relevant journal � We provide round the clock customer support � Convenient online submission � Thorough peer review � Inclusion in PubMed and all major indexing services � Maximum visibility for your research Submit your manuscript at www.biomedcentral.com/submit

Journal

Journal of Animal Science and Biotechnology – Springer Journals

Published: Jan 30, 2018

There are no references for this article.