Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Distribution of bla CTX − M , bla TEM , bla SHV and bla OXA genes in Extended-spectrum-β-lactamase-producing Clinical isolates: A three-year mul ...

Distribution of bla CTX − M , bla TEM , bla SHV and bla OXA genes in... Background: Frequency of extended-spectrum-β-lactamase-producing clinical isolates is increasing worldwide. This is a multi-center study which was aimed to check the frequency of third-generation cephalosporin resistance and distribution of the key genetic determinants of Extended-spectrum-β-lactamase-producing Clinical isolates in Pakistan. Methods: A total of 2372 samples were processed in three tertiary care hospitals and one diagnostic research center of Lahore, Pakistan during Aug-2014 to Sep-2017. Analytical profile index (API 20-E) was used for biochemical characterization of isolates. Antibiotic susceptibility testing (AST) and third generation cephalosporin resistant (3GC-R) isolates were subjected to: double disc synergism test (DDST), combination disc test (CDST) and epsilometric test (E-test) for confirmation of ESBL-production. PCR amplification of isolates with plasmid and genomic DNA was performed. Amplicon sequences were checked for gene-variants and statistical analyses were performed to check the significance of data. Results: A total of 497/995 (50%) isolates including Escherichia coli 65% (n =321), Klebsiella spp. 25% (n =124) and Pseudomonas. 5% (n =24), Enterobacter spp. 4% (n = 20) and Acinetobacter spp. 2% (n = 8) were screened as third generation cephalosporin resistant (3GC-R). Urine 56% (n = 278) followed by pus 20% (n = 99) and wound swab 6% (n = 29) were frequent sources. Incidence of ESBL-producers detected by combination disc test was 79% (n = 392). PCR revealed bla (76%) gene followed by bla (52%), bla (28%) and bla CTX − M OXA TEM SHV (21%) were most prevalent among ESBL-producers detected by CDST. bla (65%), bla (78%) and CTX − M − 1 OXA bla (57%) genes were carried on plasmids. Amplicon sequencing revealed bla (75%), bla TEM CTX − M − 15 OXA − 1 (49%) and bla (34%) and 21 (n = 28) isolates carried three genes in them. TEM − 1B Conclusion: Prevalence of ESBL-producing isolates has increased 1.13 folds during study years. Isolates had high prevalence of ESBL-encoding bla gene and narrow spectrum bla and bla were also prevalent. CTXM − 15 OXA − 1 TEM − 1B Keywords: AST, Multiplex PCR, ESBL, Phenotypic test, Molecular tests, Pakistan * Correspondence: saba.mmg@pu.edu.pk Department of Microbiology and Molecular genetics, University of the Punjab, Lahore, Pakistan Citilab and Research Center, Lahore, Pakistan Full list of author information is available at the end of the article © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 2 of 10 Background 2014 to September 2017. This study was approved by Multidrug resistant clinical isolates have important the ethical review board of the Citilab and Research clinical consequence in community and hospital Center, Lahore under reference: 28th-18 CLRC/ 28th. settings [1]. They have evolved as a global concern, ex- acerbated by under reporting in some regions of the Bacterial Isolates world [2]. The tendency of these isolates concurrently A total of 2,372 samples were processed during study resistant to other groups of antibiotics significantly period; 77 % (n=1835) cultures were positive and 54 % limits the selection of antibiotics for treatment of infec- (n=995) gram negative non-duplicate clinical isolates from tions [3]. The development of resistance for third gen- various sources were collected by standard culturing eration cephalosporin is attributed to production of methods. Antibiotic susceptibility testing (AST) was per- β-lactamases including extended-spectrum-β- lacta- formed according to the guidelines provided by clinical mases (ESBLs), AmpCs and carbapenemases [4]. The laboratory standards institute [24] by using standard anti- most significant β-lactamase genes are variants of biotic discs as mentioned in our previous study [16]. Mul- CTX-M, SHV, TEM, VEB, GES, PER, TLA and OXA tiple- antibiotics resistance (MAR) value was calculated as which have broadened the substrate specificity against reported before [25]. E. coli ATCC 25922 was used as posi- ceftazidime, cefotaxime and ceftriaxone [4, 5]. These tive control and K. pneumoniae ATCC 700603 was used as geneshavebroad host rangebut predominantlyfound negative control [26]. Analytical profile index (API 20-E) in Escherichia coli and Klebsiella spp. [6]. While, OXA was used for biochemical characterization of isolates resist- genes are found predominantly in Pseudomonas spp. ant to third generation cephalosporins. and Acinetobacter spp. [7]. Moreover, many clinical pathogens harbor more than one β-lactam genes [8]. Phenotypic confirmation of ESBL-producers Plasmid association of these genes makes them easily Third generation cephalosporin resistant (3GC-R) isolates spreadable. Due to the diversity of these enzymes, as screened by Antibiotic susceptibility test (AST) were multiplex-PCR based detection methods have become a subjected to: double disc synergism test (DDST), combin- widely used tool for epidemiological surveys [8–10]. ation disc test (CDST) and epsilometric test (E-test) for Asian countries are highly affected by extended confirmation of ESBL-production [24]. In DDST, amoxicil- spectrum-β-lactamase-producers inducing lin (AMC 20/10μg), cefuroxime (CRO 30μg), ceftazidime multidrug-resistant phenotype [11–14]. Several studies (CAZ 30μg) and cefotaxime (CTX 30μg) were applied have reported the community-association of [27]. In CDST, CAZ (30μg) and CTX (30μg) alone and in ESBL-producers [11, 14, 15]. In Pakistan, an increase combination with clavulanic acid (CTC (40μg) and CZC in the number of ESBL-associated infections has been (40μg) were used [16]. All discs used were from Oxoid, Inc observed in last few decades [16–21]. Lack of regular (Canada). For E-test, CTX / CTX+ and CAZ/CAZ+ strips surveillance programs at national or international levels, from AB BIODISK MICTM were used [24]. inadequate infection control agencies, lack of facilities and inappropriate diagnostic approaches contribute to the Molecular detection emergence of the antibiotic resistance in bacteria [2, 10, The DNA used for multiplex-PCR was extracted by 22]. Moreover, dissemination of these isolates in the com- the heat lysis method [16]. In Multiplex-PCR, 2 μl munity demands the urgent call for surveillance of resist- whole cell lysate DNA for each isolate was used sep- ance and molecular characterization for arately in 25 μl PCR-master mix and amplification extended-spectrum-β-lactamase-producers [23]. This study primers as previously mentioned [16, 28, 29]. PCR was designed to check molecular epidemiology of bla amplification conditions were: Initial step of denatur- CTX ,bla ,bla and bla genes among ation at 95°C for 5 min followed by 35 cycles of de- −M TEM SHV OXA ESBL-producers in Pakistani population to have a general- naturation at 95°C for 1 min then annealing at 56°C ized view about the situation in our region. for 1.5 min, extension at 95°C for 1 min and the final extension was done at 95°C for 10 min (Table 1). Materials and Methods Study design Amplicon sequencing and in-silico analysis This cross-sectional study was conducted at the PCR amplified products were sequenced by Advance Department of Microbiology and Molecular Genetics, Bioscience International, Pakistan in collaboration with University of the Punjab, Lahore in collaboration with 1st Base, Malaysia [30]. Nucleotide sequence similarity the Department of Pathology, Allama Iqbal Medical searches were performed using the services of National College/ Jinnah Hospital, Lahore, Punjab Institute of Centre for Biotechnology Information (NCBI) (https:// Cardiology (PIC), Lahore, Doctors hospital, Lahore blast.ncbi.nlm.nih.gov/Blast.cgi). BLAST, CLUSTALX, and Citilab and Research center, Lahore from August and MEGA 7.0 software were used for sequence Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 3 of 10 Table 1 Primer sequences and amplification conditions used in this study Target gene Primer name Sequence Annealing temp (°C) Product size (bps) References bla CTXM1-F GACGATGTCACTGGCTGAGC 55 500 [8] CTXM-1 CTXM1-R AGCCGCCGACGCTAATACA bla CTXM825F CGCTTTGCCATGTGCAGCACC 55 300 [8] CTXM-3 CTXM825R GCTCAGTACGATCGAGCC bla SHV-F AGGATTGACTGCCTTTTTG 56 392 [9] SHV SHV-R ATTTGCTGATTTCGCTCG bla TEM-C ATCAGCAATAAACCAGC 56 516 [9] TEM TEM-H CCCCGAAGAACGTTTTC bla OXA-F ATATCTCTACTGTTGCATCTCC 56 619 [9] OXA OXA-R AAACCCTTCAAACCATCC alignment of amplicon sequenced obtained with already and quinolones (74–82%) was seen except amikacin 14% submitted sequences of bla , bla , bla and (n = 70). While isolates were quite susceptible to cefo- CTX−M TEM SHV bla in GenBank. parazone/sulbactam 6% (n = 30) and piperacillin/tazo- OXA bactam 24% (n = 119). 60% (n = 303) of isolates had Statistical Analysis MAR-value in the range of 0.60 to 0.799, while 27% (n = All statistical analyses were performed using IBM-SPSS 136) were having MAR-value of 0.8–1.0. Rest of the iso- statistics 23. Bivariate analyses were performed using lates 14% (n = 57) had MAR-value of 0.2–0.59. ESBL-po- chi-square test for categorical variables. All p-values sitivity was as follows; double disc synergy test 55% (n = were two sided. The percentage values included in this 273), combination disc test 79% (n = 392) and article are the “valid percentages,” which exclude the epsilometric-test showed 58% (n=288). Year-wisedatain- missing data. dicated frequency of ESBL-producers among 3GC-R has increased from 76% (n = 102) to 88% (n =146) during study Results years (Table 2). E. coli 75% (n = 241), K. pneumoniae 80% Demographic data and distribution of clinical isolates (n =99), Pseudomonas spp. 72% (n =15) and Entero- A total of 50 % (n=497/995) third generation cephalo- bacter spp. 75% (n = 15) had ceftazidime/ceftazidime+ sporin resistant (3GC-R) clinical isolates were found MIC > 32/0.064 = 500 while 5.6% (n =28) remained among 995 gram-negative isolates. These include 65 % non-determined. Cefotaxime/cefotaxime+ > 16/0.016 = (n=321) Escherichia coli,25% (n=124) Klebsiella 1000 was most frequent MIC with E. coli 64%(n = pneumoniae, 5% (n=24) Pseudomonas aeruginosa and 4 206), K. pneumoniae 69%(n =85), Pseudomonas spp. %(n=20) were Enterobacter spp. and small number of 63% (n = 15), while 6% (n =30) remained Acinetobacter spp. 2 % (n=8) were found. These isolates non-determined by cefotaxime/cefotaxime+ (Table 3). were obtained from urine 59 % (n=278), pus 20 % Association analysis indicated among 82% (n =262) (n=99), wound swab 6 % (n=29), Foley’s tip 3 % (n=17), ESBL-positive E. coli, females were more prone to sputum 3 % (n=16), tracheal secretion 3 % (n=14), body such infection with 53% (n = 138). While, infectivity fluids 2 % (n=10), blood 8 % (n=40) and HVS 1 % (n=4) rate was high for males with ESBL-positive Klebsiella respectively with p-value <0.0001. Among study popula- pneumoniae 54% (n = 47) and Enterobacter spp. 57% tion, significantly (p-value <0.0001) higher number of (n =8) (Tables 4 and 5). High frequency of ESBL- strains were isolated from males 53 % (n=265) compared producers 36% (n = 140) came from age group of to females 47 % (n=232). Age group 41-60 years was 41–60 years. Age associated ESBL-infectivity rate was prevalent 35 % (n=174) followed by 21-40 years 29 % more confined to age group 41–60 years in E. coli (n=146) (p-value <0.0001) (Table 2). 36% (n =94), Klebsiella spp. 38% (n =35) and Pseudomonas spp. 33% (n =8) (Table 6). Urine sam- Phenotypic screening and confirmation of ESBL-producers ples were frequent source of ESBL-phenotype among Isolates had high resistance towards β-lactams including E. coli 65% (n =171), Klebsiella spp. 39% (n =35) cefotaxime and cefaclor 100% (n = 497). While 98.6% (n and Pseudomonas spp. 38% (n =9) (Table 5). = 490) and 96.4% (n = 479) isolates were resistant for cefuroxime and ceftazidime respectively. While, resist- Molecular detection ance for carbapenems was low 11% (n = 55). Moderate After screening, ESBL-producing isolates (n = 392) as de- to high resistance towards aminoglycosides (67–89%) tected by combination disc test were processed for the Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 4 of 10 Table 2 Distribution of isolates according to different parameters from 2014 to 2017 Study year 2014 2015 2016 2017 2014–2017 Chi-score p-value Parameters Initial screening Samples Processed 400 (22) 500 (27) 500 (27) 435 (24) 1835 (48) 9.33 0.0023 Strains Screened 230 (23) 230 (29) 230 (23) 250 (25) 995 (54) 1.91 0.1671 3GC-R 134 (27) 85 (23) 85 (17) 166 (33) 497 (50) 30.05 <0.0001 Third generation cephalosporin resistant isolates Klebsiella spp. 22 (18) 32 (26) 45 (36) 25 (20) 124 (25) 31.19 <0.0001 Escherichia coli 106 (33) 41 (13) 40 (12) 134 (42) 321 (65) 21.99 0.0012 Enterobacter spp. 6 (30) 12 (60) 0 (0) 2 (10) 20 (4) 15.95 0.0140 Pseudomonas spp. 0 (0) 24 (100) 0 (0) 0 (0) 24 (5) 74.48 <0.0001 Acinetobacter spp. 0 (0) 3 (38) 0 (0) 5 (63) 8 (2) 4.32 0.6335 Demographic Data Gender based distribution Male 69 (51) 47 (42) 47 (55) 102 (61) 265 (53) 11.52 0.0342 Female 65 (49) 65 (58) 38 (45) 64 (39) 232 (47) Age wise distribution <1–20 17 (25) 27 (20) 14 (21) 10 (15) 68 (14) 32.19 0.0013 21–40 33 (23) 26 (19) 40 (27) 47 (32) 146 (29) 60.29 <0.0001 41–60 45 (26) 41 (31) 27 (16) 61 (35) 174 (35) 58.53 <0.0001 61–80 39 (37) 15 (11) 4 (4) 47 (45) 105 (21) 53.13 <0.0001 > 80 0 (0) 3 (2) 0 (0) 1 (25) 4 (1) 7.98 0.7867 Sample source Urine 80 (58) 150 (66) 26 (31) 16 (33) 272 (55) 18.93 0.0003 Blood 5 (4) 11 (5) 5 (6) 12 (25) 33 (7) 27.4 <0.0001 Pus 40 (29) 33 (15) 18 (21) 7 (15) 98 (20) 9.74 0.0209 Wound 2 (1) 17 (8) 11 (13) 13 (27) 43 (9) 29.26 <0.0001 Tissue 2 (1) 0 (0) 1 (1) 0 (0) 3 (1) 3.75 0.2898 Sputum 3 (2) 1 (0) 12 (14) 0 (0) 16 (3) 38.79 <0.0001 Tips 1 (1) 0 (0) 2 (2) 0 (0) 3 (1) 6 0.1116 Secretions 0 (0) 4 (2) 8 (9) 0 (0) 12 (2) 22.12 <0.0001 Fluid 3 (2) 7 (3) 0 (0) 0 (0) 10 (2) 4.02 0.2540 High vaginal swab 2 (1) 2 (1) 2 (2) 0 (0) 6 (1) 1.77 0.6215 Washings 0 (0) 1 (0) 0 (0) 0 (0) 1 (0) 1.2 0.731 Phenotypic detection tests Phenotypic test AST 134 (27) 112 (23) 85 (17) 166 (33) 497 (50) 1.45 0.9975 CDST 102 (26) 65 (16) 85 (21) 147 (37) 399 (80) 20.8 0.0136 DDST 95 (35) 89 (33) 18 (7) 71 (26) 273 (55) 32.19 0.0002 E-test 74 (24) 84 (28) 37 (12) 108 (36) 303 (61) 5.36 0.8019 Percentages are mentioned in parenthesis Third generation cephalosporin resistant Antibiotic susceptibility testing Combination disc test Double disc synergy test Epsilometric test Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 5 of 10 Table 3 Minimum Inhibitory Concentration (MIC) of applied antibiotics along with clavulanic acid Ceftazidime/ceftazidime with clavulanic acid MIC (μg/ml) MIC ratio > 32/> 4 (ND) > 32/0.064 = 500 > 32/0.125 = 256 24/0.19 = 126 16/0.38 = 42.1 4/0.25 = 16 E. coli (n = 321) 13 (4%) 241 (75%) 39 (12%) 19 (6%) 3 (1%) 6 (2%) Klebsiella spp. (n = 124) 2 (1.8%) 99 (80%) 10 (8.3%) 6 (4.6%) 7 (5.5%) 0 (0%) Pseudomonas spp. (n = 24) 5 (21%) 17 (72%) 2 (8.3%) 0 (0%) 0 (0%) 0 (0%) Enterobacter spp. (n = 20) 2 (10%) 15 (75%) 2 (10%) 0 (0%) 1 (5%) 0 (0%) Acinetobacter spp. (n = 8) 6 (75%) 2 (25%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) Cefotaxime/cefotaxime with clavulanic acid MIC (μg/ml) MIC ratio > 16/> 1 (ND) > 16/0.016 = 1000 12/0.023 = 521 3/0.023 = 130 8/0.125 = 64 4/0.094 = 42.5 E. coli (n = 321) 17 (5.4%) 206 (64%) 58 (18%) 17 (5.4%) 12 (3.7%) 11 (3.4%) Klebsiella spp. (n = 124) 2 (1.8%) 85 (69%) 19 (15%) 9 (7.4%) 7 (5.5%) 2 (1.8%) Pseudomonas spp. (n = 24) 2 (8.3%) 15 (63%) 0 (0%) 0 (0%) 2 (8.3%) 1 (4%) Enterobacter spp. (n = 20) 1 (5%) 2 (10%) 0 (0%) 0 (0%) 0 (0%) 17 (85%) Acinetobacter spp. (n = 8) 8 (100%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) a b Minimum-inhibitory concentration and Not-determined detection of bla ,bla , bla and bla en- baumannii had variants of OXA (bla , bla CTX − M SHV TEM OXA OXA − 50 OXA coding genes by PCR. In Singleplex-PCR, bla , bla , bla , bla , bla CTX − M − 144 OXA − 23 OXA − 371 OXA − 58 OXA − 68 genes were predominant 76% (n = 303) followed by and bla ) (Table 8). OXA − 94 bla 52% (n = 203), bla 28% (n =109) and OXA TEM bla 21% (n = 82). Multiplex-PCR showed that SHV bla and bla gene combin- Discussion CTX − M//SHV/TEM/OXA OXA/TEM/SHV ation was present in 9% (n = 36) and 11% (n = 43) respect- Extensive use of antibiotics has resulted in resistance ively. bla and bla combination was present against variety of antibiotics including cephalosporins. TEM/SHV TEM/OXA in 13% (n = 51) and 27% (n = 105) respectively (Table 7, They affect countries all over the world but control and Fig. 1). prevention of ESBL-producers is severely compromised Amplicon sequencing and subsequent analysis indi- in underdeveloped countries [31–33]. cated bla 86% (n = 260) was prevalent among Here, high prevalence of third generation cephalo- CTX − M − 15 bla group. bla 49% (n = 99) were found sporin resistant isolates (50%) was observed which has CTX − M − 1 OXA − 1 among bla amplicons and bla 63% (n = 69). subsequently increased by 1.13-fold from 2014 to 2017. OXA TEM − 1B 83% (n =190) of E. coli had bla followed by This high resistance also indicates high selection pres- CTX − M − 15 bla 55% (n = 69) and bla 33% (n = 76). sure for third generation cephalosporin resistant isolates OXA − 1 TEM − 1B Klebsiella spp. contained bla 67% (n = 36) [34]. This increase of resistance is worrisome as we CTX − M − 15 followed by bla 89% (n = 47) and bla 34% are left with few treatment options including cephalo- SHV − 11 TEM − 1B (n = 19). While, Pseudomonas spp. and Acinetobacter sporins. Widespread usage of antibiotics might be the Table 4 Gender based association of infectivity among different isolates Isolates Gender Number (%) ESBL-production Chi-score Odds ratio p-value Positive (%) Negative (%) E. coli (n = 321) Male 152 (47) 124 (82) 28 (18) 1.834996 1.0317 (0.5834–1.8245) 0.9146 Female 169 (53) 138 (82) 31 (18) Klebsiella spp. (n = 124) Male 68 (55) 49 (72) 19 (28) 4.08124 0.989 (0.4502–2.1746) 0.919 Female 56 (45) 40 (71) 16 (29) Pseudomonas spp.(n = 24) Male 13 (54) 10 (77) 3 (23) 0.994083 0.3333 (0.0294–3.775) 0.375 Female 11 (46) 10 (91) 1 (9) Enterobacter spp.(n = 20) Male 12 (60) 8 (67) 4 (33) 1.123626 0.6667(0.0902–4.9281) 0.6912 Female 8 (40) 6 (75) 2 (25) Acinetobacter spp. (n = 8) Male 3 (38) 2 (67) 1 (23) 0.337912 0.4000 (0.0160–10.0173) 0.5771 Female 5 (62) 5 (100) 0 (0) Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 6 of 10 Table 5 Age-wise association of ESBL-production with different isolates Isolates Age Number ESBL-production Chi- *p- group (%) score value Positive (%) Negative (%) Escherichia coli (n = 321) 0–20 44 (14) 41 (93) 3 (7) 0.900678 21–40 100 (31) 82 (82) 18 (3) 0.767442 41–60 120 (37) 94 (78) 26 (3) 0.045746 61–80 53 (17) 45 (85) 8 (6) 1.40471 > 80 4 (1) 0 (0) 4 (75) 14.33333 <0.0001 Klebsiella spp. (n = 124) 0–20 22 (18) 18 (82) 4 (18) 0.170543 21–40 38 (31) 28 (74) 10 (26) 0.450632 41–60 46 (37) 35 (76) 11 (24) 0.118343 61–80 17 (14) 10 (59) 7 (41) 3.734724 > 81 1 (1) 1 (100) 0 (0) 0.27907 Pseudomonas spp. (n = 24) 0–20 6 (25) 5 (83) 1 (17) 0.093346 21–40 5 (21) 4 (80) 1 (20) 0.00969 41–60 10 (42) 8 (80) 2 (20) 0.01938 61–80 3 (13) 3 (100) 0 (0) 0.837209 > 81 0 (0) 0 (0) 0 (0) Enterobacter spp. (n = 20) 0–20 5 (25) 4 (80) 1 (25) 0.00969 21–40 5 (25) 3 (60) 2 (67) 0.968992 41–60 5 (25) 2 (40) 3 (150) 4.273256 0.04 61–80 5 (25) 5 (100) 0 (0) 1.395349 > 81 0 (0) 0 (0) 0 (0) Acinetobacter spp. (n =8) 0–20 1 (13) 0 (0) 1 (13) 3.583333 0.03 21–40 3 (38) 1 (13) 2 (25) 3.537468 0.03 41–60 1 (13) 1 (13) 0 (0) 0.27907 61–80 2 (25) 1 (13) 1 (13) 0.931202 > 81 1 (13) 1 (13) 0 (0) 0.27907 *only p-values <0.05 are shown factor of such increase in resistance in our hospital been reported [37]. Similar findings from different settings [16, 35]. regions of the world were observed as previously studied E. coli had high 3GC-R burden compared to Klebsiella [38, 39]. Nahid et al., reported very high prevalence of spp. and Enterobacter spp. Bari et al., reported similar ESBL-producers (87.5%) but this is because she worked findings in a study conducted in 2013 in Lady Reading on Metallo-β-lactamase producers which are highly re- Hospital Peshawar [36]. These results are comparable to sistant organisms [40]. findings in Tanzania where 45% ESBL-producers have ESBL infectivity rate in males was moderately high as compared to females. This rate is quite similar to Table 6 Association of ESBL-production with type of isolates theratereportedbyAfirdietal. [41]. In our study under investigation ESBL infections were significantly higher in the mean Isolates Total ESBL-production Chi-score p-value age group of 41-60 years whereas, high infection rates number have been reported in old age individuals who are Positive Negative (%) (%) (%) immuno-compromised and hence, more prone to in- Escherichia coli 321 (65) 262 (82) 59 (18) 6.792369985 .00951 fections [42]. We have found isolates originating from females were more frequent ESBL-producers. Accord- Klebsiella spp. 124 (25) 89 (72) 35 (28) ing to many reports males have significantly higher Pseudomonas spp. 24 (5) 20 (83) 4 (17) rates of hospital-acquired infection and community- Enterobacter spp. 20 (4) 14 (70) 6 (30) acquired infections are more prevalent in females Acinetobacter spp. 8 (2) 7 (88) 1 (13) [42–46]. These findings represent that males are more Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 7 of 10 Fig. 1 Year-wide prevalence of ESBL-encoding genes among clinical isolates. Percentages of ESBL-genes detected every year is tabulated often exposed to the hospital settings compared to susceptibility data and phenotypic test results have in- the females. creased the demand for more sensitive methods of Studies indicated prevalence of ESBL-producers is ESBL-producer detection for implementation into rou- variable in different regions of world as detected by tine susceptibility testing procedures.Despite of high re- phenotypic detection tests [47–50]. DDST determined sistance burden of ESBL-producers, the usage of only 54 % strains as ESBL-producers while CDST deter- molecular detection methods is not very common. A re- mined 79 % as ESBL-producers. Ejaz et al., reported cent meta-analysis describes only 11% studies that re- similar detection efficiency of CDST as we reported here ported PCR-based detection methods for screening of [17]. Prevalence of ESBL-producing isolates is quite ESBL-producers in Pakistan [20]. Lack of knowledge and higher than from other parts of the world including technical staff triggers the use of PCR-based methods as India (42.3 %), Bangladesh (37.8 %). Dalela et al., re- it is the rapid and reliable method of ESBL-producer de- ported 90 % sensitivity of CDST for the detection of tection [8]. It seems that bla is predominant CTX − M ESBL-producers [51]. E-test revealed that 61 % strains genotype in this region of the world. Another study from were ESBL-producers while 39 % remained Pakistan indicated 72% of isolates had bla gene CTXM − 15 non-determined by this technique. Mohanty et al. also which was lower than prevalence of bla gene CTX-M reported 61 % positivity rate for ESBL-producers by found in this study [16]. Few studies from other parts of E-test technique [52]. Such discrepancies between world have shown different prevalence of bla gene CTX-M Table 7 Association of ESBL-production with type of specimen Sample Number ESBL-production Chi-score p-value (N = 497) (%) Positive (%) Negative (%) Urine 271 (55) 221 (82) 50 (18) 19.50840541 <0.0001 Pus 97 (20) 73 (75) 24 (25) Wound 39 (8) 33 (85) 6 (15) Swab Fluids and 24 (5) 16 (67) 8 (33) secretions Catheters 17 (3) 11 (65) 6 (35) and tips Blood 18 (4) 10 (56) 8 (44) Sputum 16 (3) 16 (100) 0 (0) High 7 (2) 6 (88) 1 (12) Vaginal Swab Others 6 (1) 6 (100) 0 (0) Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 8 of 10 Table 8 Gene variants obtained by amplicon sequencing in different isolates Gene variant Total Escherichia Klebsiella Enterobacter Pseudomonas Acinetobacter Chi-score *p-value (n = 392) coli (n = 321) pneumoniae cloacae (n = 20) aeruginosa (n = 24) baumannii (n =8) (n = 124) bla 303 (76) 238 (74) 53 (43) 5 (25) 7 (29) 0 (0) 13.2333292 < CTXM-1 0.0001 bla 260 (86) 204 (98) 48 (91) 3 (50) 5 (71) 0 (0) 6.336967046 0.0118 CTX-M-15 bla 203 (52) 126 (39) 35 (28) 15 (75) 19 (79) 8 (100) 11.31364661 <0.0001 OXA bla 99 (49) 69 (55) 0 (0) 7 (50) 0 (0) 0 (0) 4.800612279 0.0284 OXA-1 bla 7 (3) 0 (0) 0 (0) 0 (0) 7 (100) 0 (0) 3.997740394 0.0456 OXA-50 bla 2 (1) 0 (0) 0 (0) 0 (0) 0 (0) 2 (25) 32.84026642 <0.0001 OXA-144 bla 4 (2) 0 (0) 0 (0) 0 (0) 0 (0) 4 (50) 65.68053525 <0.0001 OXA-23 bla 2 (1) 0 (0) 0 (0) 0 (0) 0 (0) 2 (25) 32.84026642 <0.0001 OXA-371 bla 2 (1) 0 (0) 0 (0) 0 (0) 0 (0) 2 (25) 32.84026642 <0.0001 OXA-58 bla 2 (1) 0 (0) 0 (0) 0 (0) 0 (0) 2 (25) 32.84026642 <0.0001 OXA-68 bla 2 (1) 0 (0) 0 (0) 0 (0) 0 (0) 2 (25) 32.84026642 <0.0001 OXA-94 bla 109 (28) 82 (29) 23 (19) 4 (20) 0 (0) 0 (0) 16.56736583 <0.0001 TEM bla 69 (34) 76 (33) 19 (83) 1 (25) 0 (0) 0 (0) 1.942065018 TEM-1B bla 82 (21) 10 (3) 65 (52) 7 (35) 0 (0) 0 (0) 13.56652163 <0.0001 SHV bla 5 (6) 1 (10) 4 (8) 0 (0) 0 (0) 0 (0) 5.566456898 0.0183 SHV-10 bla 47 (57) 0 (0) 47 (89) 0 (0) 0 (0) 0 (0) 22.26584202 <0.0001 SHV-11 bla 13 (16) 0 (0) 13 (25) 0 (0) 0 (0) 0 (0) 16.69937791 <0.0001 SHV-1 bla 4 (5) 0 (0) 4 (8) 0 (0) 0 (0) 0 (0) 5.566456898 0.0183 SHV-27 bla 4 (5) 0 (0) 4 (8) 0 (0) 0 (0) 0 (0) 5.566456898 0.0183 SHV-28 bla 24 (29) 0 (0) 24 (45) 0 (0) 0 (0) 0 (0) 5.566456898 0.0183 SHV-83 Gene combinations bla + bla 71 (14) 55 (60) 5 (42) 2 (10) 0 (0) 0 (0) 5.44065331 0.0197 CTX-M-15 OXA-1 bla + bla 30 (6) 22 (20) 6 (50) 1 (5) 0 (0) 1 (13) 0.485769791 OXA-1 TEM-1B bla + bla 44 (9) 33 (7) 10 (8) 0 (0) 0 (0) 1 (13) 1.009389671 CTX-M-15 TEM-1B bla + bla 4 (3) 0 (0) 4 (33) 0 (0) 0 (0) 0 (0) 19.46666667 <0.0001 CTX-M-15 SHV-11 bla + bla + 28 (4) 22 (7) 5 (4) 0 (0) 0 (0) 1 (25) 0.234071093 CTXM-15 OXA-1 bla TEM-1B *only p-values <0.05 are shown among isolates including 84.7% (Chile), 98.8% (China) encoding genes which terminate the co-existence of car- and 13.6% (Tanzania) [53–55]. We observed bla and bapenemase and ESBL-encoding genes. This is in ac- TEM bla genes were less common in our settings with cordance with already published article which states OXA 50% prevalence. Report from Hamad Medical Corpor- no significant relation between both groups [59]. ation, Qatar stated that CTX-M group has evolved Appearance of different variants might provide extra through mutations in bla and bla genes and is re- advantage for these isolates to spread them and com- TEM SHV cent endemic [56]. plicate the therapeutics. -Acinetobacter baumannii isolates had OXA variants With the passage of time increase in co-resistance of (bla and others) which are carbapenemase- different ESBL-producing genes is worrisome as OXA − 23,58 encoding genes [57]. These variants have previously co-existence of multiple genes hinders the detection of been isolated from France, Spain and Turkey which indi- ESBL-producers and complicates the treatment strategy cates the global spread [50]. bla was amplified for clinicians. Moreover, high plasmid burden was found OXA − 23 from pan-drug resistance A. baumannii only which is in these plasmids are involved in gene-transfer and they accordance with our results [58]. But these Acinetobacter also carry additional antibiotic resistance genes along baumannii isolates did not carry any of the ESBL- with β-lactam antibiotics. Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 9 of 10 Conclusions and Recommendations Enterobacteriaceae in high-risk patients in an Irish tertiary care hospital. J Hosp Infect. 2015;90(2):102–7. In conclusion, bla -type ESBL-producing genes CTX−M 2. Molton JS, Tambyah PA, Ang BS, Ling ML, Fisher DA. The global spread of and bla -type narrow spectrum-β-lactamases are OXA healthcare-associated multidrug-resistant bacteria: a perspective from Asia. prevalent among the isolates in our health care Clin Infect Dis. 2013;56(9):1310–8. 3. Rudresh S, Nagarathnamma T. Extended spectrum β-lactamase producing settings. Isolates had high resistance towards cephalo- Enterobacteriaceae & antibiotic co-resistance. Indian J Med Res. 2011;133(1):116. sporins. Resistance towards cephalosporins and carba- 4. Pfeifer Y, Cullik A, Witte W. Resistance to cephalosporins and carbapenems in penems has increased many folds during study period. Gram-negative bacterial pathogens. Int J Med Microbiol. 2010;300(6):371–9. 5. Oteo J, Navarro C, Cercenado E, Delgado-Iribarren A, Wilhelmi I, Orden B, et Co-expression of multiple genes complicates the treat- al. Spread of Escherichia coli strains with high-level cefotaxime and ment strategy. bla , a pandemic genotype is CTXM−15 ceftazidime resistance between the community, long-term care facilities, quite prevalent and their plasmid association is a big and hospital institutions. J Clin Microbiol. 2006;44(7):2359–66. 6. Bajpai T, Pandey M, Varma M, Bhatambare GS. Prevalence of TEM, SHV, and thread for the community. There is a dire need for CTX-M Beta-Lactamase genes in the urinary isolates of a tertiary care efficient molecular diagnostic tools for the detection hospital. Avicenna J Med. 2017;7(1):12. of bla genes at laboratory level. 7. Page M. Extended-spectrum β-lactamases: structure and kinetic mechanism. Clin Microbiol Infect. 2008;14(s1):63–74. Abbreviations 8. Sharma J, Sharma M, Ray P. Detection of TEM & SHV genes in Escherichia CDST: Combination disc test; DDST: Double disc synergy test; coli & Klebsiella pneumoniae isolates in a tertiary care hospital from India. ESBL: Extended-spectrum β-lactamases; ESBLs: Extended-spectrum-β- Indian J Med Res. 2010;132:332–6. lactamase-producing strains; E-Test: Epsilometric test; MAR: Multiple- 9. Sharma M, Pathak S, SrivaStava P. Prevalence and antibiogram of Extended antibiotics resistance; MIC: Minimum inhibitory concentration Spectrum β-Lactamase (ESBL) producing Gram negative bacilli and further molecular characterization of ESBL producing Escherichia coli and Klebsiella Acknowledgements spp. J Clin Diagn Res. 2013;7(10):2173. We would like to pay our gratitude towards Microbiology section of Allama 10. Dallenne C, Da Costa A, Decré D, Favier C, Arlet G. Development of a set of Iqbal Medical College/Jinnah Hospital, Lahore, Punjab Institute of cardiology multiplex PCR assays for the detection of genes encoding important β- (PIC), Doctors hospital, Lahore and Cililab and Research Center, Lahore to lactamases in Enterobacteriaceae. J Antimicrob Chemother. 2010;65(3):490–5. provide assistance in collection of bacterial isolates. 11. Song J-H, Jung S-I, Ko KS, Kim NY, Son JS, Chang H-H, et al. High prevalence of antimicrobial resistance among clinical Streptococcus pneumoniae isolates in Funding Asia (an ANSORP study). Antmicrob Agents Chemother. 2004;48(6):2101–7. No funding was provided for this study 12. Hsueh PR, Hoban DJ, Carmeli Y, Chen SY, Desikan S, Alejandria M, et al. Consensus review of the epidemiology and appropriate antimicrobial Availability of data and materials therapy of complicated urinary tract infections in Asia-Pacific region. J Inf All the data files generated during this study are with authors of this and Secur. 2011;63(2):114–23. can be provided on demand. 13. Nordmann P, Naas T, Poirel L. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis. 2011;17(10):1791. Authors’ contributions 14. Jean S-S, Hsueh PR. High burden of antimicrobial resistance in Asia. Int J Study concept and design of the study: SR; data collection: (SA and HL); FR Antimicrob Agents. 2011;37(4):291–5. (helps in managing data and strains from Allama Iqbal Medical College); 15. Kucheria R, Dasgupta P, Sacks S, Khan M, NJPmj S. Urinary tract infections: reviewing the manuscript and editing (SH, NuA and SR); Major experiment new insights into a common problem. Postgrad Med J. 2005;81(952):83–6. work (SA, HL and SH). All authors approved the final version of manuscript. 16. Abrar S, Vajeeha A, Ul-Ain N, Riaz S. Distribution of CTX-M group I and group III β-lactamases produced by Escherichia coli and Klebsiella Ethics approval and consent to participate pneumoniae in Lahore, Pakistan. Microb Pathog. 2017;103:8–12. The study was approved by local ethics committee (CitiLab and Research 17. Ejaz H. Detection of extended-spectrum β-lactamases in Klebsiella Centre Ref # 28th -18 CLRC/ 28th). pneumoniae: Comparison of phenotypic characterization methods. Pak J Med Sci. 2013;29(3):768. Consent for publication 18. Jabeen K, Zafar A, RJJoPMA H. Frequency and sensitivity pattern of Not applicable extended spectrum beta lactamase producing isolates in a tertiary care hospital laboratory of Pakistan. J Pak Med Assoc. 2005;55(10):436. Competing interests 19. Khan E, Ejaz M, Zafar A, Jabeen K, Shakoor S, Inayat R, et al. Increased This study is part of PhD thesis of Ms. Samyyia Abrar. All other authors isolation of ESBL producing Klebsiella pneumoniae with emergence of declare that the work was conducted in the absence of any commercial or carbapenem resistant isolates in Pakistan: report from a tertiary care financial relationships that could be construed as a potential conflict of hospital. J Pak Med Assoc. 2010;60(3):186. interest 20. Abrar S, Hussain S, Khan RA, Ain NU, Haider H, Riaz S. Prevalence of extended-spectrum-β-lactamase-producing Enterobacteriaceae: first systematic meta-analysis report from Pakistan. Antimicrob Resist Infect Publisher’sNote Control. 2018;7(1):26. Springer Nature remains neutral with regard to jurisdictional claims in 21. Mumtaz S, Ahmed J, Ali L, Hussain H. Prevalence of extended spectrum published maps and institutional affiliations. beta lactamases (ESBL) in clinical isolates from a teaching hospital in Peshawar, Pakistan. Afr J Microbiol Res. 2011;5(19):2880–4. Author details 22. Vernet G, Mary C, Altmann DM, Doumbo O, Morpeth S, Bhutta ZA, et al. Department of Microbiology and Molecular genetics, University of the Surveillance for antimicrobial drug resistance in under-resourced countries. Punjab, Lahore, Pakistan. Allama Iqbal Medical College, Jinnah Hospital Emerg Infect Dis. 2014;20(3):434. Lahore, Lahore, Pakistan. Citilab and Research Center, Lahore, Pakistan. 23. Bhardwaj AK, Vinothkumar K. Evolution of MDRs. Quorum Sensing vs Quorum Quenching: A Battle with No End in Sight. India: Springer; 2015. p. Received: 18 March 2019 Accepted: 9 May 2019 9–22. 24. LS CaI. Performance standards for antimicrobial disk susceptibility testing: References approved standard. Natl Comm Clin Lab Stand. 2014;6:285–9. 1. O'Connell N, Keating D, Kavanagh J, Schaffer K. Detection and 25. Christopher AF, Hora S, Ali Z. Investigation of plasmid profile, antibiotic characterization of extended-spectrum beta-lactamase-producing susceptibility pattern multiple antibiotic resistance index calculation of Escherichia Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 10 of 10 coli isolates obtained from different human clinical specimens at tertiary care 46. Bourjilat F, Bouchrif B, Dersi N, Claude JDPG, Amarouch H, Timinouni M. hospital in Bareilly-India. Ann Trop Med Public Health. 2013;6(3):285. Emergence of extended-spectrum beta-lactamases-producing Escherichia 26. Alfaresi M, Elkoush A. Real-time polymerase chain reaction for rapid coli in community-acquired urinary infections in Casablanca, Morocco. J detection of genes encoding SHV extended-spectrum β-lactamases. Indian Infect Dev Countr. 2011;5(12):850–5. J Med Microbiol. 2010;28(4):332. 47. Bonnet R. Growing group of extended-spectrum β-lactamases: the CTX-M enzymes. Antimicrob Agents Chemother. 2004;48(1):1–14. 27. Drieux L, Brossier F, Sougakoff W, Jarlier V. Phenotypic detection of 48. Falagas M, Karageorgopoulos DE. Extended-spectrum β-lactamase- extended-spectrum β-lactamase production in Enterobacteriaceae: review producing organisms. J Hosp Infect. 2009;73(4):345–54. and bench guide. Clin Microbiol Infect. 2008;14(s1):90–103. 49. Reinert RR, Low DE, Rossi F, Zhang X, Wattal C, Dowzicky MJ. Antimicrobial 28. Pitout JD, Hossain A, Hanson ND. Phenotypic and Molecular Detection of susceptibility among organisms from the Asia/Pacific Rim, Europe and Latin CTX-M-β-Lactamases Produced by Escherichia coli and Klebsiella spp. J Clin and North America collected as part of TEST and the in vitro activity of Microbiol. 2004;42(12):5715–21. tigecycline. J Antimicrob Chemother. 2007;60(5):1018–29. 29. Ain NU, Iftikhar A, Bukhari SS, Abrar S, Hussain S, Haider MH, et al. High 50. Chander A, Shrestha CD. Prevalence of extended spectrum beta lactamase frequency and molecular epidemiology of metallo-β-lactamase-producing producing Escherichia coli and Klebsiella pneumoniae urinary isolates in a gram-negative bacilli in a tertiary care hospital in Lahore, Pakistan. tertiary care hospital in Kathmandu, Nepal. BMC Res Notes. 2013;6(1):487. Antimicrob Resist Infect Control. 2018;7:128. 51. Dalela G. Prevalence of extended spectrum beta-lactamase (ESBL) producers 30. Kumar V, Sun P, Vamathevan J, Li Y, Ingraham K, Palmer L, et al. among gram-negative bacilli from various clinical isolates in a tertiary care Comparative genomics of Klebsiella pneumoniae strains with different hospital at Jhalawar, Rajasthan, India. J Clin Diagn Res. 2012;6(2):182–7. antibiotic resistance profiles. Antimicrob Agents Chemother. 2011; 52. Mohanty S, Gaind R, Ranjan R, Deb M. Use of the cefepime-clavulanate ESBL 55(9):4267–76. Etest for detection of extended-spectrum beta-lactamases in AmpC co- 31. Ayukekbong JA, Ntemgwa M, Atabe AN. The threat of antimicrobial producing bacteria. J Infect Dev Countr. 2009;4(01):024–9. resistance in developing countries: causes and control strategies. 53. Sonda T, Kumburu H, van Zwetselaar M, Alifrangis M, Mmbaga BT, Lund O, Antimicrob Resist Infect Control. 2017;6(1):47. et al. Prevalence and risk factors for CTX-M gram-negative bacteria in 32. Reardon S. Antibiotic resistance sweeping developing world: bacteria are hospitalized patients at a tertiary care hospital in Kilimanjaro, Tanzania. Eur J increasingly dodging extermination as drug availability outpaces regulation. Clin Microbiol Infect Dis. 2018;37:1–10. Nature. 2014;509(7499):141–3. 54. Zhao D, Quan J, Liu L, Du X, Chen Y, Jiang Y, et al. High prevalence of ESBL- 33. Carlet J, Jarlier V, Harbarth S, Voss A, Goossens H, Pittet D. Ready for a world producing Escherichia coli and Klebsiella pneumoniae in community-onset without antibiotics? The pensières antibiotic resistance call to action: bloodstream infections in China. J Antimicrob Chemother. 2016;72(1):273– Springer; 2012. 34. Vounba P, Arsenault J, Bada-Alambedji R, Fairbrother JM. Prevalence of 55. Pavez M, Troncoso C, Osses I, Salazar R, Illesca V, Reydet P, et al. High antimicrobial resistance and potential pathogenicity, and possible spread of third prevalence of CTX-M-1 group in ESBL-producing enterobacteriaceae generation cephalosporin resistance, in Escherichia coli isolated from healthy infection in intensive care units in southern Chile. Braz J Infect Dis. 2019. chicken farms in the region of Dakar, Senegal. PLoS One. 2019;14(3):e0214304. 56. Sid Ahmed MA, Bansal D, Acharya A, Elmi AA, Hamid JM, Sid Ahmed AM, et 35. Peymani A, Naserpour-Farivar T, Zare E, Azarhoosh K. Distribution of blaTEM, al. Antimicrobial susceptibility and molecular epidemiology of extended- blaSHV, and bla genes among ESBL-producing P. aeruginosa isolated CTX-M spectrum beta-lactamase-producing Enterobacteriaceae from intensive care from Qazvin and Tehran hospitals, Iran. J Prev Med Hyg. 2017;58(2):E155. units at Hamad Medical Corporation, Qatar. Antimicrob Resist Infect Control. 36. Bari F, Shah H, Wazir R. Frequency and Detection of Extended Spectrum 2016;5(1):4–9. Betalactamase in Escherichia coli and Klebsiella pneumoniae: A Study At Lady 57. Evans BA, Amyes SGB. OXA β-Lactamases. Clinical microbiology reviews. Reading Hospital Peshawar. J Postgrad Med Inst. 2016;29(4). 2014;27(2):241–63. 37. Moyo SJ, Aboud S, Kasubi M, Lyamuya EF, Maselle SY. Antimicrobial 58. Braun SD, Jamil B, Syed MA, Abbasi SA, Weiss D, Slickers P, et al. Prevalence resistance among producers and non-producers of extended spectrum of carbapenemase-producing organisms at the Kidney Center of Rawalpindi beta-lactamases in urinary isolates at a tertiary Hospital in Tanzania. BMC (Pakistan) and evaluation of an advanced molecular microarray-based Res Notes. 2010;3(1):348–52. carbapenemase assay. Future Microbiol. 2018;13:1225–46. 38. Bindayna K, Khanfar HS, Senok AC, Botta GA. Predominance of CTX-M 59. Safari M, Nejad ASM, Bahador A, Jafari R, Alikhani MY. Prevalence of ESBL genotype among extended spectrum beta lactamase isolates in a tertiary and MBL encoding genes in Acinetobacter baumannii strains isolated from hospital in Saudi Arabia. Saudi Med J. 2010;31(8):859–63. patients of intensive care units (ICU). Saudi J Biol Sci. 2015;22(4):424–9. 39. Maina D, Revathi G, Kariuki S, Ozwara H. Genotypes and cephalosporin susceptibility in extended-spectrum beta-lactamase producing enterobacteriaceae in the community. J Infect Dev Ctries. 2011;6(06):470–7. 40. Nahid F, Khan AA, Rehman S. Zahra RJJoi, health p. Prevalence of metallo-β-lactamase NDM-1-producing multi-drug resistant bacteria at two Pakistani hospitals and implications for public health. J Infect Public Health. 2013;6(6):487–93. 41. Afridi FI, Farooqi BJ, Hussain A. Frequency of extended spectrum beta- lactamase producing Enterobacteriaceae among urinary pathogen isolates. J Coll Physicians Surg Pak. 2011;21(12):741–4. 42. Ben-Ami R, Rodríguez-Baño J, Arslan H, Pitout JD, Quentin C, Calbo ES, et al. A multinational survey of risk factors for infection with extended-spectrum β-lactamase-producing Enterobacteriaceae in nonhospitalized patients. Clin Infect Dis. 2009;49(5):682–90. 43. Ahmad M, Hassan M, Khalid A, Tariq I, Asad MH, Samad A, et al. Prevalence of Extended Spectrum beta-Lactamase and Antimicrobial Susceptibility Pattern of Clinical Isolates of Pseudomonas from Patients of Khyber Pakhtunkhwa, Pakistan. Biomed Res Int. 2016;2016:6068429. 44. Casella T, Rodríguez MM, Takahashi JT, Ghiglione B, Dropa M, Assunção E, et al. Detection of bla CTX-M-type genes in complex class 1 integrons carried by Enterobacteriaceae isolated from retail chicken meat in Brazil. Int J Food Microbiol. 2015;197:88–91. 45. Anwar M, Chaudhry I, Ahmad I, Bhatti K, Jaffery G, Tayyab M, et al. Frequency of extended spectrum β-lactamase producing Klebsiella pnumoniae and Escherichia coli isolates. Biomedica. 2007;23:34–8. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Antimicrobial Resistance & Infection Control Springer Journals

Distribution of bla CTX − M , bla TEM , bla SHV and bla OXA genes in Extended-spectrum-β-lactamase-producing Clinical isolates: A three-year mul ...

Download PDF
10 pages

Loading next page...
 
/lp/springer-journals/distribution-of-bla-ctx-m-bla-tem-bla-shv-and-bla-oxa-genes-in-wwUYEzFxzl

References (66)

Publisher
Springer Journals
Copyright
Copyright © 2019 by The Author(s).
Subject
Biomedicine; Medical Microbiology; Drug Resistance; Infectious Diseases
eISSN
2047-2994
DOI
10.1186/s13756-019-0536-0
Publisher site
See Article on Publisher Site

Abstract

Background: Frequency of extended-spectrum-β-lactamase-producing clinical isolates is increasing worldwide. This is a multi-center study which was aimed to check the frequency of third-generation cephalosporin resistance and distribution of the key genetic determinants of Extended-spectrum-β-lactamase-producing Clinical isolates in Pakistan. Methods: A total of 2372 samples were processed in three tertiary care hospitals and one diagnostic research center of Lahore, Pakistan during Aug-2014 to Sep-2017. Analytical profile index (API 20-E) was used for biochemical characterization of isolates. Antibiotic susceptibility testing (AST) and third generation cephalosporin resistant (3GC-R) isolates were subjected to: double disc synergism test (DDST), combination disc test (CDST) and epsilometric test (E-test) for confirmation of ESBL-production. PCR amplification of isolates with plasmid and genomic DNA was performed. Amplicon sequences were checked for gene-variants and statistical analyses were performed to check the significance of data. Results: A total of 497/995 (50%) isolates including Escherichia coli 65% (n =321), Klebsiella spp. 25% (n =124) and Pseudomonas. 5% (n =24), Enterobacter spp. 4% (n = 20) and Acinetobacter spp. 2% (n = 8) were screened as third generation cephalosporin resistant (3GC-R). Urine 56% (n = 278) followed by pus 20% (n = 99) and wound swab 6% (n = 29) were frequent sources. Incidence of ESBL-producers detected by combination disc test was 79% (n = 392). PCR revealed bla (76%) gene followed by bla (52%), bla (28%) and bla CTX − M OXA TEM SHV (21%) were most prevalent among ESBL-producers detected by CDST. bla (65%), bla (78%) and CTX − M − 1 OXA bla (57%) genes were carried on plasmids. Amplicon sequencing revealed bla (75%), bla TEM CTX − M − 15 OXA − 1 (49%) and bla (34%) and 21 (n = 28) isolates carried three genes in them. TEM − 1B Conclusion: Prevalence of ESBL-producing isolates has increased 1.13 folds during study years. Isolates had high prevalence of ESBL-encoding bla gene and narrow spectrum bla and bla were also prevalent. CTXM − 15 OXA − 1 TEM − 1B Keywords: AST, Multiplex PCR, ESBL, Phenotypic test, Molecular tests, Pakistan * Correspondence: saba.mmg@pu.edu.pk Department of Microbiology and Molecular genetics, University of the Punjab, Lahore, Pakistan Citilab and Research Center, Lahore, Pakistan Full list of author information is available at the end of the article © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 2 of 10 Background 2014 to September 2017. This study was approved by Multidrug resistant clinical isolates have important the ethical review board of the Citilab and Research clinical consequence in community and hospital Center, Lahore under reference: 28th-18 CLRC/ 28th. settings [1]. They have evolved as a global concern, ex- acerbated by under reporting in some regions of the Bacterial Isolates world [2]. The tendency of these isolates concurrently A total of 2,372 samples were processed during study resistant to other groups of antibiotics significantly period; 77 % (n=1835) cultures were positive and 54 % limits the selection of antibiotics for treatment of infec- (n=995) gram negative non-duplicate clinical isolates from tions [3]. The development of resistance for third gen- various sources were collected by standard culturing eration cephalosporin is attributed to production of methods. Antibiotic susceptibility testing (AST) was per- β-lactamases including extended-spectrum-β- lacta- formed according to the guidelines provided by clinical mases (ESBLs), AmpCs and carbapenemases [4]. The laboratory standards institute [24] by using standard anti- most significant β-lactamase genes are variants of biotic discs as mentioned in our previous study [16]. Mul- CTX-M, SHV, TEM, VEB, GES, PER, TLA and OXA tiple- antibiotics resistance (MAR) value was calculated as which have broadened the substrate specificity against reported before [25]. E. coli ATCC 25922 was used as posi- ceftazidime, cefotaxime and ceftriaxone [4, 5]. These tive control and K. pneumoniae ATCC 700603 was used as geneshavebroad host rangebut predominantlyfound negative control [26]. Analytical profile index (API 20-E) in Escherichia coli and Klebsiella spp. [6]. While, OXA was used for biochemical characterization of isolates resist- genes are found predominantly in Pseudomonas spp. ant to third generation cephalosporins. and Acinetobacter spp. [7]. Moreover, many clinical pathogens harbor more than one β-lactam genes [8]. Phenotypic confirmation of ESBL-producers Plasmid association of these genes makes them easily Third generation cephalosporin resistant (3GC-R) isolates spreadable. Due to the diversity of these enzymes, as screened by Antibiotic susceptibility test (AST) were multiplex-PCR based detection methods have become a subjected to: double disc synergism test (DDST), combin- widely used tool for epidemiological surveys [8–10]. ation disc test (CDST) and epsilometric test (E-test) for Asian countries are highly affected by extended confirmation of ESBL-production [24]. In DDST, amoxicil- spectrum-β-lactamase-producers inducing lin (AMC 20/10μg), cefuroxime (CRO 30μg), ceftazidime multidrug-resistant phenotype [11–14]. Several studies (CAZ 30μg) and cefotaxime (CTX 30μg) were applied have reported the community-association of [27]. In CDST, CAZ (30μg) and CTX (30μg) alone and in ESBL-producers [11, 14, 15]. In Pakistan, an increase combination with clavulanic acid (CTC (40μg) and CZC in the number of ESBL-associated infections has been (40μg) were used [16]. All discs used were from Oxoid, Inc observed in last few decades [16–21]. Lack of regular (Canada). For E-test, CTX / CTX+ and CAZ/CAZ+ strips surveillance programs at national or international levels, from AB BIODISK MICTM were used [24]. inadequate infection control agencies, lack of facilities and inappropriate diagnostic approaches contribute to the Molecular detection emergence of the antibiotic resistance in bacteria [2, 10, The DNA used for multiplex-PCR was extracted by 22]. Moreover, dissemination of these isolates in the com- the heat lysis method [16]. In Multiplex-PCR, 2 μl munity demands the urgent call for surveillance of resist- whole cell lysate DNA for each isolate was used sep- ance and molecular characterization for arately in 25 μl PCR-master mix and amplification extended-spectrum-β-lactamase-producers [23]. This study primers as previously mentioned [16, 28, 29]. PCR was designed to check molecular epidemiology of bla amplification conditions were: Initial step of denatur- CTX ,bla ,bla and bla genes among ation at 95°C for 5 min followed by 35 cycles of de- −M TEM SHV OXA ESBL-producers in Pakistani population to have a general- naturation at 95°C for 1 min then annealing at 56°C ized view about the situation in our region. for 1.5 min, extension at 95°C for 1 min and the final extension was done at 95°C for 10 min (Table 1). Materials and Methods Study design Amplicon sequencing and in-silico analysis This cross-sectional study was conducted at the PCR amplified products were sequenced by Advance Department of Microbiology and Molecular Genetics, Bioscience International, Pakistan in collaboration with University of the Punjab, Lahore in collaboration with 1st Base, Malaysia [30]. Nucleotide sequence similarity the Department of Pathology, Allama Iqbal Medical searches were performed using the services of National College/ Jinnah Hospital, Lahore, Punjab Institute of Centre for Biotechnology Information (NCBI) (https:// Cardiology (PIC), Lahore, Doctors hospital, Lahore blast.ncbi.nlm.nih.gov/Blast.cgi). BLAST, CLUSTALX, and Citilab and Research center, Lahore from August and MEGA 7.0 software were used for sequence Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 3 of 10 Table 1 Primer sequences and amplification conditions used in this study Target gene Primer name Sequence Annealing temp (°C) Product size (bps) References bla CTXM1-F GACGATGTCACTGGCTGAGC 55 500 [8] CTXM-1 CTXM1-R AGCCGCCGACGCTAATACA bla CTXM825F CGCTTTGCCATGTGCAGCACC 55 300 [8] CTXM-3 CTXM825R GCTCAGTACGATCGAGCC bla SHV-F AGGATTGACTGCCTTTTTG 56 392 [9] SHV SHV-R ATTTGCTGATTTCGCTCG bla TEM-C ATCAGCAATAAACCAGC 56 516 [9] TEM TEM-H CCCCGAAGAACGTTTTC bla OXA-F ATATCTCTACTGTTGCATCTCC 56 619 [9] OXA OXA-R AAACCCTTCAAACCATCC alignment of amplicon sequenced obtained with already and quinolones (74–82%) was seen except amikacin 14% submitted sequences of bla , bla , bla and (n = 70). While isolates were quite susceptible to cefo- CTX−M TEM SHV bla in GenBank. parazone/sulbactam 6% (n = 30) and piperacillin/tazo- OXA bactam 24% (n = 119). 60% (n = 303) of isolates had Statistical Analysis MAR-value in the range of 0.60 to 0.799, while 27% (n = All statistical analyses were performed using IBM-SPSS 136) were having MAR-value of 0.8–1.0. Rest of the iso- statistics 23. Bivariate analyses were performed using lates 14% (n = 57) had MAR-value of 0.2–0.59. ESBL-po- chi-square test for categorical variables. All p-values sitivity was as follows; double disc synergy test 55% (n = were two sided. The percentage values included in this 273), combination disc test 79% (n = 392) and article are the “valid percentages,” which exclude the epsilometric-test showed 58% (n=288). Year-wisedatain- missing data. dicated frequency of ESBL-producers among 3GC-R has increased from 76% (n = 102) to 88% (n =146) during study Results years (Table 2). E. coli 75% (n = 241), K. pneumoniae 80% Demographic data and distribution of clinical isolates (n =99), Pseudomonas spp. 72% (n =15) and Entero- A total of 50 % (n=497/995) third generation cephalo- bacter spp. 75% (n = 15) had ceftazidime/ceftazidime+ sporin resistant (3GC-R) clinical isolates were found MIC > 32/0.064 = 500 while 5.6% (n =28) remained among 995 gram-negative isolates. These include 65 % non-determined. Cefotaxime/cefotaxime+ > 16/0.016 = (n=321) Escherichia coli,25% (n=124) Klebsiella 1000 was most frequent MIC with E. coli 64%(n = pneumoniae, 5% (n=24) Pseudomonas aeruginosa and 4 206), K. pneumoniae 69%(n =85), Pseudomonas spp. %(n=20) were Enterobacter spp. and small number of 63% (n = 15), while 6% (n =30) remained Acinetobacter spp. 2 % (n=8) were found. These isolates non-determined by cefotaxime/cefotaxime+ (Table 3). were obtained from urine 59 % (n=278), pus 20 % Association analysis indicated among 82% (n =262) (n=99), wound swab 6 % (n=29), Foley’s tip 3 % (n=17), ESBL-positive E. coli, females were more prone to sputum 3 % (n=16), tracheal secretion 3 % (n=14), body such infection with 53% (n = 138). While, infectivity fluids 2 % (n=10), blood 8 % (n=40) and HVS 1 % (n=4) rate was high for males with ESBL-positive Klebsiella respectively with p-value <0.0001. Among study popula- pneumoniae 54% (n = 47) and Enterobacter spp. 57% tion, significantly (p-value <0.0001) higher number of (n =8) (Tables 4 and 5). High frequency of ESBL- strains were isolated from males 53 % (n=265) compared producers 36% (n = 140) came from age group of to females 47 % (n=232). Age group 41-60 years was 41–60 years. Age associated ESBL-infectivity rate was prevalent 35 % (n=174) followed by 21-40 years 29 % more confined to age group 41–60 years in E. coli (n=146) (p-value <0.0001) (Table 2). 36% (n =94), Klebsiella spp. 38% (n =35) and Pseudomonas spp. 33% (n =8) (Table 6). Urine sam- Phenotypic screening and confirmation of ESBL-producers ples were frequent source of ESBL-phenotype among Isolates had high resistance towards β-lactams including E. coli 65% (n =171), Klebsiella spp. 39% (n =35) cefotaxime and cefaclor 100% (n = 497). While 98.6% (n and Pseudomonas spp. 38% (n =9) (Table 5). = 490) and 96.4% (n = 479) isolates were resistant for cefuroxime and ceftazidime respectively. While, resist- Molecular detection ance for carbapenems was low 11% (n = 55). Moderate After screening, ESBL-producing isolates (n = 392) as de- to high resistance towards aminoglycosides (67–89%) tected by combination disc test were processed for the Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 4 of 10 Table 2 Distribution of isolates according to different parameters from 2014 to 2017 Study year 2014 2015 2016 2017 2014–2017 Chi-score p-value Parameters Initial screening Samples Processed 400 (22) 500 (27) 500 (27) 435 (24) 1835 (48) 9.33 0.0023 Strains Screened 230 (23) 230 (29) 230 (23) 250 (25) 995 (54) 1.91 0.1671 3GC-R 134 (27) 85 (23) 85 (17) 166 (33) 497 (50) 30.05 <0.0001 Third generation cephalosporin resistant isolates Klebsiella spp. 22 (18) 32 (26) 45 (36) 25 (20) 124 (25) 31.19 <0.0001 Escherichia coli 106 (33) 41 (13) 40 (12) 134 (42) 321 (65) 21.99 0.0012 Enterobacter spp. 6 (30) 12 (60) 0 (0) 2 (10) 20 (4) 15.95 0.0140 Pseudomonas spp. 0 (0) 24 (100) 0 (0) 0 (0) 24 (5) 74.48 <0.0001 Acinetobacter spp. 0 (0) 3 (38) 0 (0) 5 (63) 8 (2) 4.32 0.6335 Demographic Data Gender based distribution Male 69 (51) 47 (42) 47 (55) 102 (61) 265 (53) 11.52 0.0342 Female 65 (49) 65 (58) 38 (45) 64 (39) 232 (47) Age wise distribution <1–20 17 (25) 27 (20) 14 (21) 10 (15) 68 (14) 32.19 0.0013 21–40 33 (23) 26 (19) 40 (27) 47 (32) 146 (29) 60.29 <0.0001 41–60 45 (26) 41 (31) 27 (16) 61 (35) 174 (35) 58.53 <0.0001 61–80 39 (37) 15 (11) 4 (4) 47 (45) 105 (21) 53.13 <0.0001 > 80 0 (0) 3 (2) 0 (0) 1 (25) 4 (1) 7.98 0.7867 Sample source Urine 80 (58) 150 (66) 26 (31) 16 (33) 272 (55) 18.93 0.0003 Blood 5 (4) 11 (5) 5 (6) 12 (25) 33 (7) 27.4 <0.0001 Pus 40 (29) 33 (15) 18 (21) 7 (15) 98 (20) 9.74 0.0209 Wound 2 (1) 17 (8) 11 (13) 13 (27) 43 (9) 29.26 <0.0001 Tissue 2 (1) 0 (0) 1 (1) 0 (0) 3 (1) 3.75 0.2898 Sputum 3 (2) 1 (0) 12 (14) 0 (0) 16 (3) 38.79 <0.0001 Tips 1 (1) 0 (0) 2 (2) 0 (0) 3 (1) 6 0.1116 Secretions 0 (0) 4 (2) 8 (9) 0 (0) 12 (2) 22.12 <0.0001 Fluid 3 (2) 7 (3) 0 (0) 0 (0) 10 (2) 4.02 0.2540 High vaginal swab 2 (1) 2 (1) 2 (2) 0 (0) 6 (1) 1.77 0.6215 Washings 0 (0) 1 (0) 0 (0) 0 (0) 1 (0) 1.2 0.731 Phenotypic detection tests Phenotypic test AST 134 (27) 112 (23) 85 (17) 166 (33) 497 (50) 1.45 0.9975 CDST 102 (26) 65 (16) 85 (21) 147 (37) 399 (80) 20.8 0.0136 DDST 95 (35) 89 (33) 18 (7) 71 (26) 273 (55) 32.19 0.0002 E-test 74 (24) 84 (28) 37 (12) 108 (36) 303 (61) 5.36 0.8019 Percentages are mentioned in parenthesis Third generation cephalosporin resistant Antibiotic susceptibility testing Combination disc test Double disc synergy test Epsilometric test Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 5 of 10 Table 3 Minimum Inhibitory Concentration (MIC) of applied antibiotics along with clavulanic acid Ceftazidime/ceftazidime with clavulanic acid MIC (μg/ml) MIC ratio > 32/> 4 (ND) > 32/0.064 = 500 > 32/0.125 = 256 24/0.19 = 126 16/0.38 = 42.1 4/0.25 = 16 E. coli (n = 321) 13 (4%) 241 (75%) 39 (12%) 19 (6%) 3 (1%) 6 (2%) Klebsiella spp. (n = 124) 2 (1.8%) 99 (80%) 10 (8.3%) 6 (4.6%) 7 (5.5%) 0 (0%) Pseudomonas spp. (n = 24) 5 (21%) 17 (72%) 2 (8.3%) 0 (0%) 0 (0%) 0 (0%) Enterobacter spp. (n = 20) 2 (10%) 15 (75%) 2 (10%) 0 (0%) 1 (5%) 0 (0%) Acinetobacter spp. (n = 8) 6 (75%) 2 (25%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) Cefotaxime/cefotaxime with clavulanic acid MIC (μg/ml) MIC ratio > 16/> 1 (ND) > 16/0.016 = 1000 12/0.023 = 521 3/0.023 = 130 8/0.125 = 64 4/0.094 = 42.5 E. coli (n = 321) 17 (5.4%) 206 (64%) 58 (18%) 17 (5.4%) 12 (3.7%) 11 (3.4%) Klebsiella spp. (n = 124) 2 (1.8%) 85 (69%) 19 (15%) 9 (7.4%) 7 (5.5%) 2 (1.8%) Pseudomonas spp. (n = 24) 2 (8.3%) 15 (63%) 0 (0%) 0 (0%) 2 (8.3%) 1 (4%) Enterobacter spp. (n = 20) 1 (5%) 2 (10%) 0 (0%) 0 (0%) 0 (0%) 17 (85%) Acinetobacter spp. (n = 8) 8 (100%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) a b Minimum-inhibitory concentration and Not-determined detection of bla ,bla , bla and bla en- baumannii had variants of OXA (bla , bla CTX − M SHV TEM OXA OXA − 50 OXA coding genes by PCR. In Singleplex-PCR, bla , bla , bla , bla , bla CTX − M − 144 OXA − 23 OXA − 371 OXA − 58 OXA − 68 genes were predominant 76% (n = 303) followed by and bla ) (Table 8). OXA − 94 bla 52% (n = 203), bla 28% (n =109) and OXA TEM bla 21% (n = 82). Multiplex-PCR showed that SHV bla and bla gene combin- Discussion CTX − M//SHV/TEM/OXA OXA/TEM/SHV ation was present in 9% (n = 36) and 11% (n = 43) respect- Extensive use of antibiotics has resulted in resistance ively. bla and bla combination was present against variety of antibiotics including cephalosporins. TEM/SHV TEM/OXA in 13% (n = 51) and 27% (n = 105) respectively (Table 7, They affect countries all over the world but control and Fig. 1). prevention of ESBL-producers is severely compromised Amplicon sequencing and subsequent analysis indi- in underdeveloped countries [31–33]. cated bla 86% (n = 260) was prevalent among Here, high prevalence of third generation cephalo- CTX − M − 15 bla group. bla 49% (n = 99) were found sporin resistant isolates (50%) was observed which has CTX − M − 1 OXA − 1 among bla amplicons and bla 63% (n = 69). subsequently increased by 1.13-fold from 2014 to 2017. OXA TEM − 1B 83% (n =190) of E. coli had bla followed by This high resistance also indicates high selection pres- CTX − M − 15 bla 55% (n = 69) and bla 33% (n = 76). sure for third generation cephalosporin resistant isolates OXA − 1 TEM − 1B Klebsiella spp. contained bla 67% (n = 36) [34]. This increase of resistance is worrisome as we CTX − M − 15 followed by bla 89% (n = 47) and bla 34% are left with few treatment options including cephalo- SHV − 11 TEM − 1B (n = 19). While, Pseudomonas spp. and Acinetobacter sporins. Widespread usage of antibiotics might be the Table 4 Gender based association of infectivity among different isolates Isolates Gender Number (%) ESBL-production Chi-score Odds ratio p-value Positive (%) Negative (%) E. coli (n = 321) Male 152 (47) 124 (82) 28 (18) 1.834996 1.0317 (0.5834–1.8245) 0.9146 Female 169 (53) 138 (82) 31 (18) Klebsiella spp. (n = 124) Male 68 (55) 49 (72) 19 (28) 4.08124 0.989 (0.4502–2.1746) 0.919 Female 56 (45) 40 (71) 16 (29) Pseudomonas spp.(n = 24) Male 13 (54) 10 (77) 3 (23) 0.994083 0.3333 (0.0294–3.775) 0.375 Female 11 (46) 10 (91) 1 (9) Enterobacter spp.(n = 20) Male 12 (60) 8 (67) 4 (33) 1.123626 0.6667(0.0902–4.9281) 0.6912 Female 8 (40) 6 (75) 2 (25) Acinetobacter spp. (n = 8) Male 3 (38) 2 (67) 1 (23) 0.337912 0.4000 (0.0160–10.0173) 0.5771 Female 5 (62) 5 (100) 0 (0) Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 6 of 10 Table 5 Age-wise association of ESBL-production with different isolates Isolates Age Number ESBL-production Chi- *p- group (%) score value Positive (%) Negative (%) Escherichia coli (n = 321) 0–20 44 (14) 41 (93) 3 (7) 0.900678 21–40 100 (31) 82 (82) 18 (3) 0.767442 41–60 120 (37) 94 (78) 26 (3) 0.045746 61–80 53 (17) 45 (85) 8 (6) 1.40471 > 80 4 (1) 0 (0) 4 (75) 14.33333 <0.0001 Klebsiella spp. (n = 124) 0–20 22 (18) 18 (82) 4 (18) 0.170543 21–40 38 (31) 28 (74) 10 (26) 0.450632 41–60 46 (37) 35 (76) 11 (24) 0.118343 61–80 17 (14) 10 (59) 7 (41) 3.734724 > 81 1 (1) 1 (100) 0 (0) 0.27907 Pseudomonas spp. (n = 24) 0–20 6 (25) 5 (83) 1 (17) 0.093346 21–40 5 (21) 4 (80) 1 (20) 0.00969 41–60 10 (42) 8 (80) 2 (20) 0.01938 61–80 3 (13) 3 (100) 0 (0) 0.837209 > 81 0 (0) 0 (0) 0 (0) Enterobacter spp. (n = 20) 0–20 5 (25) 4 (80) 1 (25) 0.00969 21–40 5 (25) 3 (60) 2 (67) 0.968992 41–60 5 (25) 2 (40) 3 (150) 4.273256 0.04 61–80 5 (25) 5 (100) 0 (0) 1.395349 > 81 0 (0) 0 (0) 0 (0) Acinetobacter spp. (n =8) 0–20 1 (13) 0 (0) 1 (13) 3.583333 0.03 21–40 3 (38) 1 (13) 2 (25) 3.537468 0.03 41–60 1 (13) 1 (13) 0 (0) 0.27907 61–80 2 (25) 1 (13) 1 (13) 0.931202 > 81 1 (13) 1 (13) 0 (0) 0.27907 *only p-values <0.05 are shown factor of such increase in resistance in our hospital been reported [37]. Similar findings from different settings [16, 35]. regions of the world were observed as previously studied E. coli had high 3GC-R burden compared to Klebsiella [38, 39]. Nahid et al., reported very high prevalence of spp. and Enterobacter spp. Bari et al., reported similar ESBL-producers (87.5%) but this is because she worked findings in a study conducted in 2013 in Lady Reading on Metallo-β-lactamase producers which are highly re- Hospital Peshawar [36]. These results are comparable to sistant organisms [40]. findings in Tanzania where 45% ESBL-producers have ESBL infectivity rate in males was moderately high as compared to females. This rate is quite similar to Table 6 Association of ESBL-production with type of isolates theratereportedbyAfirdietal. [41]. In our study under investigation ESBL infections were significantly higher in the mean Isolates Total ESBL-production Chi-score p-value age group of 41-60 years whereas, high infection rates number have been reported in old age individuals who are Positive Negative (%) (%) (%) immuno-compromised and hence, more prone to in- Escherichia coli 321 (65) 262 (82) 59 (18) 6.792369985 .00951 fections [42]. We have found isolates originating from females were more frequent ESBL-producers. Accord- Klebsiella spp. 124 (25) 89 (72) 35 (28) ing to many reports males have significantly higher Pseudomonas spp. 24 (5) 20 (83) 4 (17) rates of hospital-acquired infection and community- Enterobacter spp. 20 (4) 14 (70) 6 (30) acquired infections are more prevalent in females Acinetobacter spp. 8 (2) 7 (88) 1 (13) [42–46]. These findings represent that males are more Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 7 of 10 Fig. 1 Year-wide prevalence of ESBL-encoding genes among clinical isolates. Percentages of ESBL-genes detected every year is tabulated often exposed to the hospital settings compared to susceptibility data and phenotypic test results have in- the females. creased the demand for more sensitive methods of Studies indicated prevalence of ESBL-producers is ESBL-producer detection for implementation into rou- variable in different regions of world as detected by tine susceptibility testing procedures.Despite of high re- phenotypic detection tests [47–50]. DDST determined sistance burden of ESBL-producers, the usage of only 54 % strains as ESBL-producers while CDST deter- molecular detection methods is not very common. A re- mined 79 % as ESBL-producers. Ejaz et al., reported cent meta-analysis describes only 11% studies that re- similar detection efficiency of CDST as we reported here ported PCR-based detection methods for screening of [17]. Prevalence of ESBL-producing isolates is quite ESBL-producers in Pakistan [20]. Lack of knowledge and higher than from other parts of the world including technical staff triggers the use of PCR-based methods as India (42.3 %), Bangladesh (37.8 %). Dalela et al., re- it is the rapid and reliable method of ESBL-producer de- ported 90 % sensitivity of CDST for the detection of tection [8]. It seems that bla is predominant CTX − M ESBL-producers [51]. E-test revealed that 61 % strains genotype in this region of the world. Another study from were ESBL-producers while 39 % remained Pakistan indicated 72% of isolates had bla gene CTXM − 15 non-determined by this technique. Mohanty et al. also which was lower than prevalence of bla gene CTX-M reported 61 % positivity rate for ESBL-producers by found in this study [16]. Few studies from other parts of E-test technique [52]. Such discrepancies between world have shown different prevalence of bla gene CTX-M Table 7 Association of ESBL-production with type of specimen Sample Number ESBL-production Chi-score p-value (N = 497) (%) Positive (%) Negative (%) Urine 271 (55) 221 (82) 50 (18) 19.50840541 <0.0001 Pus 97 (20) 73 (75) 24 (25) Wound 39 (8) 33 (85) 6 (15) Swab Fluids and 24 (5) 16 (67) 8 (33) secretions Catheters 17 (3) 11 (65) 6 (35) and tips Blood 18 (4) 10 (56) 8 (44) Sputum 16 (3) 16 (100) 0 (0) High 7 (2) 6 (88) 1 (12) Vaginal Swab Others 6 (1) 6 (100) 0 (0) Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 8 of 10 Table 8 Gene variants obtained by amplicon sequencing in different isolates Gene variant Total Escherichia Klebsiella Enterobacter Pseudomonas Acinetobacter Chi-score *p-value (n = 392) coli (n = 321) pneumoniae cloacae (n = 20) aeruginosa (n = 24) baumannii (n =8) (n = 124) bla 303 (76) 238 (74) 53 (43) 5 (25) 7 (29) 0 (0) 13.2333292 < CTXM-1 0.0001 bla 260 (86) 204 (98) 48 (91) 3 (50) 5 (71) 0 (0) 6.336967046 0.0118 CTX-M-15 bla 203 (52) 126 (39) 35 (28) 15 (75) 19 (79) 8 (100) 11.31364661 <0.0001 OXA bla 99 (49) 69 (55) 0 (0) 7 (50) 0 (0) 0 (0) 4.800612279 0.0284 OXA-1 bla 7 (3) 0 (0) 0 (0) 0 (0) 7 (100) 0 (0) 3.997740394 0.0456 OXA-50 bla 2 (1) 0 (0) 0 (0) 0 (0) 0 (0) 2 (25) 32.84026642 <0.0001 OXA-144 bla 4 (2) 0 (0) 0 (0) 0 (0) 0 (0) 4 (50) 65.68053525 <0.0001 OXA-23 bla 2 (1) 0 (0) 0 (0) 0 (0) 0 (0) 2 (25) 32.84026642 <0.0001 OXA-371 bla 2 (1) 0 (0) 0 (0) 0 (0) 0 (0) 2 (25) 32.84026642 <0.0001 OXA-58 bla 2 (1) 0 (0) 0 (0) 0 (0) 0 (0) 2 (25) 32.84026642 <0.0001 OXA-68 bla 2 (1) 0 (0) 0 (0) 0 (0) 0 (0) 2 (25) 32.84026642 <0.0001 OXA-94 bla 109 (28) 82 (29) 23 (19) 4 (20) 0 (0) 0 (0) 16.56736583 <0.0001 TEM bla 69 (34) 76 (33) 19 (83) 1 (25) 0 (0) 0 (0) 1.942065018 TEM-1B bla 82 (21) 10 (3) 65 (52) 7 (35) 0 (0) 0 (0) 13.56652163 <0.0001 SHV bla 5 (6) 1 (10) 4 (8) 0 (0) 0 (0) 0 (0) 5.566456898 0.0183 SHV-10 bla 47 (57) 0 (0) 47 (89) 0 (0) 0 (0) 0 (0) 22.26584202 <0.0001 SHV-11 bla 13 (16) 0 (0) 13 (25) 0 (0) 0 (0) 0 (0) 16.69937791 <0.0001 SHV-1 bla 4 (5) 0 (0) 4 (8) 0 (0) 0 (0) 0 (0) 5.566456898 0.0183 SHV-27 bla 4 (5) 0 (0) 4 (8) 0 (0) 0 (0) 0 (0) 5.566456898 0.0183 SHV-28 bla 24 (29) 0 (0) 24 (45) 0 (0) 0 (0) 0 (0) 5.566456898 0.0183 SHV-83 Gene combinations bla + bla 71 (14) 55 (60) 5 (42) 2 (10) 0 (0) 0 (0) 5.44065331 0.0197 CTX-M-15 OXA-1 bla + bla 30 (6) 22 (20) 6 (50) 1 (5) 0 (0) 1 (13) 0.485769791 OXA-1 TEM-1B bla + bla 44 (9) 33 (7) 10 (8) 0 (0) 0 (0) 1 (13) 1.009389671 CTX-M-15 TEM-1B bla + bla 4 (3) 0 (0) 4 (33) 0 (0) 0 (0) 0 (0) 19.46666667 <0.0001 CTX-M-15 SHV-11 bla + bla + 28 (4) 22 (7) 5 (4) 0 (0) 0 (0) 1 (25) 0.234071093 CTXM-15 OXA-1 bla TEM-1B *only p-values <0.05 are shown among isolates including 84.7% (Chile), 98.8% (China) encoding genes which terminate the co-existence of car- and 13.6% (Tanzania) [53–55]. We observed bla and bapenemase and ESBL-encoding genes. This is in ac- TEM bla genes were less common in our settings with cordance with already published article which states OXA 50% prevalence. Report from Hamad Medical Corpor- no significant relation between both groups [59]. ation, Qatar stated that CTX-M group has evolved Appearance of different variants might provide extra through mutations in bla and bla genes and is re- advantage for these isolates to spread them and com- TEM SHV cent endemic [56]. plicate the therapeutics. -Acinetobacter baumannii isolates had OXA variants With the passage of time increase in co-resistance of (bla and others) which are carbapenemase- different ESBL-producing genes is worrisome as OXA − 23,58 encoding genes [57]. These variants have previously co-existence of multiple genes hinders the detection of been isolated from France, Spain and Turkey which indi- ESBL-producers and complicates the treatment strategy cates the global spread [50]. bla was amplified for clinicians. Moreover, high plasmid burden was found OXA − 23 from pan-drug resistance A. baumannii only which is in these plasmids are involved in gene-transfer and they accordance with our results [58]. But these Acinetobacter also carry additional antibiotic resistance genes along baumannii isolates did not carry any of the ESBL- with β-lactam antibiotics. Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 9 of 10 Conclusions and Recommendations Enterobacteriaceae in high-risk patients in an Irish tertiary care hospital. J Hosp Infect. 2015;90(2):102–7. In conclusion, bla -type ESBL-producing genes CTX−M 2. Molton JS, Tambyah PA, Ang BS, Ling ML, Fisher DA. The global spread of and bla -type narrow spectrum-β-lactamases are OXA healthcare-associated multidrug-resistant bacteria: a perspective from Asia. prevalent among the isolates in our health care Clin Infect Dis. 2013;56(9):1310–8. 3. Rudresh S, Nagarathnamma T. Extended spectrum β-lactamase producing settings. Isolates had high resistance towards cephalo- Enterobacteriaceae & antibiotic co-resistance. Indian J Med Res. 2011;133(1):116. sporins. Resistance towards cephalosporins and carba- 4. Pfeifer Y, Cullik A, Witte W. Resistance to cephalosporins and carbapenems in penems has increased many folds during study period. Gram-negative bacterial pathogens. Int J Med Microbiol. 2010;300(6):371–9. 5. Oteo J, Navarro C, Cercenado E, Delgado-Iribarren A, Wilhelmi I, Orden B, et Co-expression of multiple genes complicates the treat- al. Spread of Escherichia coli strains with high-level cefotaxime and ment strategy. bla , a pandemic genotype is CTXM−15 ceftazidime resistance between the community, long-term care facilities, quite prevalent and their plasmid association is a big and hospital institutions. J Clin Microbiol. 2006;44(7):2359–66. 6. Bajpai T, Pandey M, Varma M, Bhatambare GS. Prevalence of TEM, SHV, and thread for the community. There is a dire need for CTX-M Beta-Lactamase genes in the urinary isolates of a tertiary care efficient molecular diagnostic tools for the detection hospital. Avicenna J Med. 2017;7(1):12. of bla genes at laboratory level. 7. Page M. Extended-spectrum β-lactamases: structure and kinetic mechanism. Clin Microbiol Infect. 2008;14(s1):63–74. Abbreviations 8. Sharma J, Sharma M, Ray P. Detection of TEM & SHV genes in Escherichia CDST: Combination disc test; DDST: Double disc synergy test; coli & Klebsiella pneumoniae isolates in a tertiary care hospital from India. ESBL: Extended-spectrum β-lactamases; ESBLs: Extended-spectrum-β- Indian J Med Res. 2010;132:332–6. lactamase-producing strains; E-Test: Epsilometric test; MAR: Multiple- 9. Sharma M, Pathak S, SrivaStava P. Prevalence and antibiogram of Extended antibiotics resistance; MIC: Minimum inhibitory concentration Spectrum β-Lactamase (ESBL) producing Gram negative bacilli and further molecular characterization of ESBL producing Escherichia coli and Klebsiella Acknowledgements spp. J Clin Diagn Res. 2013;7(10):2173. We would like to pay our gratitude towards Microbiology section of Allama 10. Dallenne C, Da Costa A, Decré D, Favier C, Arlet G. Development of a set of Iqbal Medical College/Jinnah Hospital, Lahore, Punjab Institute of cardiology multiplex PCR assays for the detection of genes encoding important β- (PIC), Doctors hospital, Lahore and Cililab and Research Center, Lahore to lactamases in Enterobacteriaceae. J Antimicrob Chemother. 2010;65(3):490–5. provide assistance in collection of bacterial isolates. 11. Song J-H, Jung S-I, Ko KS, Kim NY, Son JS, Chang H-H, et al. High prevalence of antimicrobial resistance among clinical Streptococcus pneumoniae isolates in Funding Asia (an ANSORP study). Antmicrob Agents Chemother. 2004;48(6):2101–7. No funding was provided for this study 12. Hsueh PR, Hoban DJ, Carmeli Y, Chen SY, Desikan S, Alejandria M, et al. Consensus review of the epidemiology and appropriate antimicrobial Availability of data and materials therapy of complicated urinary tract infections in Asia-Pacific region. J Inf All the data files generated during this study are with authors of this and Secur. 2011;63(2):114–23. can be provided on demand. 13. Nordmann P, Naas T, Poirel L. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis. 2011;17(10):1791. Authors’ contributions 14. Jean S-S, Hsueh PR. High burden of antimicrobial resistance in Asia. Int J Study concept and design of the study: SR; data collection: (SA and HL); FR Antimicrob Agents. 2011;37(4):291–5. (helps in managing data and strains from Allama Iqbal Medical College); 15. Kucheria R, Dasgupta P, Sacks S, Khan M, NJPmj S. Urinary tract infections: reviewing the manuscript and editing (SH, NuA and SR); Major experiment new insights into a common problem. Postgrad Med J. 2005;81(952):83–6. work (SA, HL and SH). All authors approved the final version of manuscript. 16. Abrar S, Vajeeha A, Ul-Ain N, Riaz S. Distribution of CTX-M group I and group III β-lactamases produced by Escherichia coli and Klebsiella Ethics approval and consent to participate pneumoniae in Lahore, Pakistan. Microb Pathog. 2017;103:8–12. The study was approved by local ethics committee (CitiLab and Research 17. Ejaz H. Detection of extended-spectrum β-lactamases in Klebsiella Centre Ref # 28th -18 CLRC/ 28th). pneumoniae: Comparison of phenotypic characterization methods. Pak J Med Sci. 2013;29(3):768. Consent for publication 18. Jabeen K, Zafar A, RJJoPMA H. Frequency and sensitivity pattern of Not applicable extended spectrum beta lactamase producing isolates in a tertiary care hospital laboratory of Pakistan. J Pak Med Assoc. 2005;55(10):436. Competing interests 19. Khan E, Ejaz M, Zafar A, Jabeen K, Shakoor S, Inayat R, et al. Increased This study is part of PhD thesis of Ms. Samyyia Abrar. All other authors isolation of ESBL producing Klebsiella pneumoniae with emergence of declare that the work was conducted in the absence of any commercial or carbapenem resistant isolates in Pakistan: report from a tertiary care financial relationships that could be construed as a potential conflict of hospital. J Pak Med Assoc. 2010;60(3):186. interest 20. Abrar S, Hussain S, Khan RA, Ain NU, Haider H, Riaz S. Prevalence of extended-spectrum-β-lactamase-producing Enterobacteriaceae: first systematic meta-analysis report from Pakistan. Antimicrob Resist Infect Publisher’sNote Control. 2018;7(1):26. Springer Nature remains neutral with regard to jurisdictional claims in 21. Mumtaz S, Ahmed J, Ali L, Hussain H. Prevalence of extended spectrum published maps and institutional affiliations. beta lactamases (ESBL) in clinical isolates from a teaching hospital in Peshawar, Pakistan. Afr J Microbiol Res. 2011;5(19):2880–4. Author details 22. Vernet G, Mary C, Altmann DM, Doumbo O, Morpeth S, Bhutta ZA, et al. Department of Microbiology and Molecular genetics, University of the Surveillance for antimicrobial drug resistance in under-resourced countries. Punjab, Lahore, Pakistan. Allama Iqbal Medical College, Jinnah Hospital Emerg Infect Dis. 2014;20(3):434. Lahore, Lahore, Pakistan. Citilab and Research Center, Lahore, Pakistan. 23. Bhardwaj AK, Vinothkumar K. Evolution of MDRs. Quorum Sensing vs Quorum Quenching: A Battle with No End in Sight. India: Springer; 2015. p. Received: 18 March 2019 Accepted: 9 May 2019 9–22. 24. LS CaI. Performance standards for antimicrobial disk susceptibility testing: References approved standard. Natl Comm Clin Lab Stand. 2014;6:285–9. 1. O'Connell N, Keating D, Kavanagh J, Schaffer K. Detection and 25. Christopher AF, Hora S, Ali Z. Investigation of plasmid profile, antibiotic characterization of extended-spectrum beta-lactamase-producing susceptibility pattern multiple antibiotic resistance index calculation of Escherichia Abrar et al. Antimicrobial Resistance and Infection Control (2019) 8:80 Page 10 of 10 coli isolates obtained from different human clinical specimens at tertiary care 46. Bourjilat F, Bouchrif B, Dersi N, Claude JDPG, Amarouch H, Timinouni M. hospital in Bareilly-India. Ann Trop Med Public Health. 2013;6(3):285. Emergence of extended-spectrum beta-lactamases-producing Escherichia 26. Alfaresi M, Elkoush A. Real-time polymerase chain reaction for rapid coli in community-acquired urinary infections in Casablanca, Morocco. J detection of genes encoding SHV extended-spectrum β-lactamases. Indian Infect Dev Countr. 2011;5(12):850–5. J Med Microbiol. 2010;28(4):332. 47. Bonnet R. Growing group of extended-spectrum β-lactamases: the CTX-M enzymes. Antimicrob Agents Chemother. 2004;48(1):1–14. 27. Drieux L, Brossier F, Sougakoff W, Jarlier V. Phenotypic detection of 48. Falagas M, Karageorgopoulos DE. Extended-spectrum β-lactamase- extended-spectrum β-lactamase production in Enterobacteriaceae: review producing organisms. J Hosp Infect. 2009;73(4):345–54. and bench guide. Clin Microbiol Infect. 2008;14(s1):90–103. 49. Reinert RR, Low DE, Rossi F, Zhang X, Wattal C, Dowzicky MJ. Antimicrobial 28. Pitout JD, Hossain A, Hanson ND. Phenotypic and Molecular Detection of susceptibility among organisms from the Asia/Pacific Rim, Europe and Latin CTX-M-β-Lactamases Produced by Escherichia coli and Klebsiella spp. J Clin and North America collected as part of TEST and the in vitro activity of Microbiol. 2004;42(12):5715–21. tigecycline. J Antimicrob Chemother. 2007;60(5):1018–29. 29. Ain NU, Iftikhar A, Bukhari SS, Abrar S, Hussain S, Haider MH, et al. High 50. Chander A, Shrestha CD. Prevalence of extended spectrum beta lactamase frequency and molecular epidemiology of metallo-β-lactamase-producing producing Escherichia coli and Klebsiella pneumoniae urinary isolates in a gram-negative bacilli in a tertiary care hospital in Lahore, Pakistan. tertiary care hospital in Kathmandu, Nepal. BMC Res Notes. 2013;6(1):487. Antimicrob Resist Infect Control. 2018;7:128. 51. Dalela G. Prevalence of extended spectrum beta-lactamase (ESBL) producers 30. Kumar V, Sun P, Vamathevan J, Li Y, Ingraham K, Palmer L, et al. among gram-negative bacilli from various clinical isolates in a tertiary care Comparative genomics of Klebsiella pneumoniae strains with different hospital at Jhalawar, Rajasthan, India. J Clin Diagn Res. 2012;6(2):182–7. antibiotic resistance profiles. Antimicrob Agents Chemother. 2011; 52. Mohanty S, Gaind R, Ranjan R, Deb M. Use of the cefepime-clavulanate ESBL 55(9):4267–76. Etest for detection of extended-spectrum beta-lactamases in AmpC co- 31. Ayukekbong JA, Ntemgwa M, Atabe AN. The threat of antimicrobial producing bacteria. J Infect Dev Countr. 2009;4(01):024–9. resistance in developing countries: causes and control strategies. 53. Sonda T, Kumburu H, van Zwetselaar M, Alifrangis M, Mmbaga BT, Lund O, Antimicrob Resist Infect Control. 2017;6(1):47. et al. Prevalence and risk factors for CTX-M gram-negative bacteria in 32. Reardon S. Antibiotic resistance sweeping developing world: bacteria are hospitalized patients at a tertiary care hospital in Kilimanjaro, Tanzania. Eur J increasingly dodging extermination as drug availability outpaces regulation. Clin Microbiol Infect Dis. 2018;37:1–10. Nature. 2014;509(7499):141–3. 54. Zhao D, Quan J, Liu L, Du X, Chen Y, Jiang Y, et al. High prevalence of ESBL- 33. Carlet J, Jarlier V, Harbarth S, Voss A, Goossens H, Pittet D. Ready for a world producing Escherichia coli and Klebsiella pneumoniae in community-onset without antibiotics? The pensières antibiotic resistance call to action: bloodstream infections in China. J Antimicrob Chemother. 2016;72(1):273– Springer; 2012. 34. Vounba P, Arsenault J, Bada-Alambedji R, Fairbrother JM. Prevalence of 55. Pavez M, Troncoso C, Osses I, Salazar R, Illesca V, Reydet P, et al. High antimicrobial resistance and potential pathogenicity, and possible spread of third prevalence of CTX-M-1 group in ESBL-producing enterobacteriaceae generation cephalosporin resistance, in Escherichia coli isolated from healthy infection in intensive care units in southern Chile. Braz J Infect Dis. 2019. chicken farms in the region of Dakar, Senegal. PLoS One. 2019;14(3):e0214304. 56. Sid Ahmed MA, Bansal D, Acharya A, Elmi AA, Hamid JM, Sid Ahmed AM, et 35. Peymani A, Naserpour-Farivar T, Zare E, Azarhoosh K. Distribution of blaTEM, al. Antimicrobial susceptibility and molecular epidemiology of extended- blaSHV, and bla genes among ESBL-producing P. aeruginosa isolated CTX-M spectrum beta-lactamase-producing Enterobacteriaceae from intensive care from Qazvin and Tehran hospitals, Iran. J Prev Med Hyg. 2017;58(2):E155. units at Hamad Medical Corporation, Qatar. Antimicrob Resist Infect Control. 36. Bari F, Shah H, Wazir R. Frequency and Detection of Extended Spectrum 2016;5(1):4–9. Betalactamase in Escherichia coli and Klebsiella pneumoniae: A Study At Lady 57. Evans BA, Amyes SGB. OXA β-Lactamases. Clinical microbiology reviews. Reading Hospital Peshawar. J Postgrad Med Inst. 2016;29(4). 2014;27(2):241–63. 37. Moyo SJ, Aboud S, Kasubi M, Lyamuya EF, Maselle SY. Antimicrobial 58. Braun SD, Jamil B, Syed MA, Abbasi SA, Weiss D, Slickers P, et al. Prevalence resistance among producers and non-producers of extended spectrum of carbapenemase-producing organisms at the Kidney Center of Rawalpindi beta-lactamases in urinary isolates at a tertiary Hospital in Tanzania. BMC (Pakistan) and evaluation of an advanced molecular microarray-based Res Notes. 2010;3(1):348–52. carbapenemase assay. Future Microbiol. 2018;13:1225–46. 38. Bindayna K, Khanfar HS, Senok AC, Botta GA. Predominance of CTX-M 59. Safari M, Nejad ASM, Bahador A, Jafari R, Alikhani MY. Prevalence of ESBL genotype among extended spectrum beta lactamase isolates in a tertiary and MBL encoding genes in Acinetobacter baumannii strains isolated from hospital in Saudi Arabia. Saudi Med J. 2010;31(8):859–63. patients of intensive care units (ICU). Saudi J Biol Sci. 2015;22(4):424–9. 39. Maina D, Revathi G, Kariuki S, Ozwara H. Genotypes and cephalosporin susceptibility in extended-spectrum beta-lactamase producing enterobacteriaceae in the community. J Infect Dev Ctries. 2011;6(06):470–7. 40. Nahid F, Khan AA, Rehman S. Zahra RJJoi, health p. Prevalence of metallo-β-lactamase NDM-1-producing multi-drug resistant bacteria at two Pakistani hospitals and implications for public health. J Infect Public Health. 2013;6(6):487–93. 41. Afridi FI, Farooqi BJ, Hussain A. Frequency of extended spectrum beta- lactamase producing Enterobacteriaceae among urinary pathogen isolates. J Coll Physicians Surg Pak. 2011;21(12):741–4. 42. Ben-Ami R, Rodríguez-Baño J, Arslan H, Pitout JD, Quentin C, Calbo ES, et al. A multinational survey of risk factors for infection with extended-spectrum β-lactamase-producing Enterobacteriaceae in nonhospitalized patients. Clin Infect Dis. 2009;49(5):682–90. 43. Ahmad M, Hassan M, Khalid A, Tariq I, Asad MH, Samad A, et al. Prevalence of Extended Spectrum beta-Lactamase and Antimicrobial Susceptibility Pattern of Clinical Isolates of Pseudomonas from Patients of Khyber Pakhtunkhwa, Pakistan. Biomed Res Int. 2016;2016:6068429. 44. Casella T, Rodríguez MM, Takahashi JT, Ghiglione B, Dropa M, Assunção E, et al. Detection of bla CTX-M-type genes in complex class 1 integrons carried by Enterobacteriaceae isolated from retail chicken meat in Brazil. Int J Food Microbiol. 2015;197:88–91. 45. Anwar M, Chaudhry I, Ahmad I, Bhatti K, Jaffery G, Tayyab M, et al. Frequency of extended spectrum β-lactamase producing Klebsiella pnumoniae and Escherichia coli isolates. Biomedica. 2007;23:34–8.

Journal

Antimicrobial Resistance & Infection Control – Springer Journals

Published: May 22, 2019

There are no references for this article.