Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/springer-journals/effect-of-supplementation-of-allicin-on-methanogenesis-and-ruminal-qzgQ63YCNV
- Publisher
- Springer Journals
- Copyright
- Copyright © 2015 by Ma et al.
- Subject
- Life Sciences; Agriculture; Biotechnology; Food Science; Animal Genetics and Genomics; Animal Physiology
- eISSN
- 2049-1891
- DOI
- 10.1186/s40104-015-0057-5
- pmid
- 26779340
- Publisher site
- See Article on Publisher Site
Abstract
Background: Garlic extracts have been reported to be effective in reducing methanogenesis. Related mechanisms are not well illustrated, however, and most studies have been conducted in vitro. This study investigates the effects of supplementary allicin (AL) in sheep diet on in vivo digestibility, rumen fermentation, and shifts of microbial flora. Methods: Two experiments were conducted using Dorper × thin-tailed Han crossbred ewes. In experiment 1, eighteen ewes (60.0 ± 1.73 kg BW) were randomly assigned for 29 days to either of two dietary treatments: a basal diet or the basal diet supplemented with 2.0 g AL/head·day to investigate supplementary AL on nutrient digestibility and methane emissions. In experiment 2, six ewes (65.2 ± 2.0 kg BW) with ruminal canulas were assigned to the same two dietary treatments as in experiment 1 for 42 days to investigate supplementary AL on ruminal fermentation and microbial flora. The methane emissions were determined using an open-circuit respirometry system and microbial assessment was done by qPCR of 16S rRNA genes. Results: Supplementary AL increased the apparent digestibility of organic matter (P < 0.001), nitrogen (P =0.006), neutral detergent fiber (P < 0.001), and acid detergent fiber (P = 0.002). Fecal nitrogen output was reduced (P =0.001) but urinary nitrogen output was unaffected (P = 0.691), while nitrogen retention (P = 0.077) and nitrogen retention/ nitrogen intake (P = 0.077) tended to increase. Supplementary AL decreased methane emissions scaled to metabolic bodyweight by 5.95 % (P = 0.007) and to digestible organic matter intake by 8.36 % (P = 0.009). Ruminal pH was unaffected (P = 0.601) while ammonia decreased (P = 0.024) and total volatile fatty acids increased (P =0.024) in response to supplementary AL. Supplementary AL decreased the population of methanogens (P = 0.001) and tended to decrease that of protozoans (P = 0.097), but increased the populations of F. succinogenes (P <0.001), R. flavefaciens (P = 0.001), and B. fibrisolvens (P =0.001). Conclusions: Supplementation of AL at 2.0 g/head·day effectively enhanced OM, N, NDF, and ADF digestibility and 0.75 reduced daily methane emissions (L/kg BW ) in ewes, probably by decreasing the population of ruminal protozoans and methanogens. Keywords: Allicin, Digestibility, Ewe, Methane, Microbial flora * Correspondence: diaoqiyu@caas.cn Tao Ma and Dandan Chen are considered co-first authors Equal contributors Feed Research Institute, Chinese Academy of Agricultural Sciences, Key Laboratory of Feed Biotechnology of the Ministry of Agriculture, Beijing 100081, China Full list of author information is available at the end of the article © 2015 Ma et al. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Ma et al. Journal of Animal Science and Biotechnology (2016) 7:1 Page 2 of 7 Background and handling procedures were followed throughout Methane has been proven the second-most anthropo- the experiment. genic greenhouse gas [1] because of its concentration in the atmosphere and its global warming potential is 21 Animals, treatments, and experimental procedure times that of carbon dioxide [2]. Domestic ruminants Experiment 1 have been blamed for substantially contributing to me- Eighteen primiparous Dorper × Thin-tailed Han cross- thane emissions. It would be of great value to decrease bred ewes (60.0 ± 1.73 kg BW), 12 months of age, were methane emissions, as methane production in ruminants randomly assigned to either of two dietary treatments: a represents a loss of about 2–15 % of feed energy [3]. In basal diet or the basal diet supplemented with allicin addition, limiting methane emissions from ruminants is (AL) at 2.0 g/head·day (extracted from underground not only beneficial for environmental protection, but bulbs of garlic, Xi’an Feida Bio-Tech Co., Ltd., Shanxi, also has potential economic benefits that could be de- China). The basal diets included pelleted total mixed rived from the application of carbon trading markets [4]. rations (TMR) and Chinese wild rye hay (Table 1); in the Numerous chemical additives to ruminant feed have experimental diet, allicin was mixed with pelleted TMR. been used to inhibit methane emissions. These chemi- The ewes were fed 1500 g pelleted TMR at 0800 h and cals, however, are either toxic to hosts or exhibit only 200 g of Chinese wild rye hay at 1200 h daily. This transient effects on methanogenesis [5] and so-called feeding level was formulated to meet the maintenance ‘natural products’ seem to be more acceptable to con- and growth requirements of yearling ewes (60 kg BW) sumers. Plants that contain bioactive products, such as according to NRC (2007) [12]. All animals were housed essential oils, saponins, and tannins, can protect them- in individual pens and had free access to fresh water selves against microbial and insect attack [6]. over the experimental period. Allicin (AL) is one of the active components of garlic All ewes were moved into metabolism crates after a (Allium sativum); it has a variety of antimicrobial activ- 14-day adaptation to diets and after another 7-day adap- ities [7]. Studies of the effect of AL on methane emis- tation to metabolism crates; the amount of feed offered, sions are still limited and previous studies focused refused, and feces were weighed daily and homogenized. mainly on the effect of other garlic components, such as A 10 % sample was collected during an 8-day collection garlic oil [8], garlic powder [9], and diallyl disulfide period as described by Ma et al. [13]. Urine was col- (DADS) [10], on nutrient digestibility and methane lected daily in buckets containing 100 mL of 10 % (v/v) emissions by sheep and cows. Although it is generally Table 1 Ingredients and chemical compositions of experimental accepted that those supplements’ activities relate to diets (% of DM) altering microbial fermentation or flora in the rumen, Item Total mixed ration Chinese wildrye hay related mechanisms could be different. Microscopy used to be a key method in microbial quantification, and Ingredient, % of DM although this method allows one to determine the total Corn 17.0 number of microorganisms accurately, it has almost no Soybean meal 12.0 capacity to distinguish among different species of bac- Chinese wildrye hay 68.7 teria [11]. Real-time quantitative PCR (q-PCR) methods CaHPO 1.35 can help overcome this problem and allow one to quan- Limestone 0.25 tify specific bacteria or groups of microorganisms accur- ately. This study therefore investigated the effect of AL NaCl 0.50 on ruminal fermentation, digestibility, and populations Premix 0.24 of protozoans, methanogens, and four cellulolytic bac- Chemical composition (deteremined) teria in the rumen by using a q-PCR technique based on DM (% as fed) 88.6 91.4 the 16S rRNA gene. We hypothesized that supplemen- OM, 80.8 90.6 tary AL could reduce the population of protozoans and GE, MJ/kg of DM 17.2 17.6 methanogens, but might have different effects on cellu- lolytic bacteria. CP 12.2 8.50 NDF 41.4 70.7 Methods ADF 21.8 38.1 This study was conducted from March 2013 to May 2013 Manufactured by Precision Animal Nutrition Research Centre, Beijing, China. at the Experimental Station of the Chinese Academy of The premix contained (per kg): 22.1 g Fe, 2.25 g Cu, 9.82 g Mn, 27.0 g Zn, 0.19 g Se, 0.54 g I, 0.09 g Co, 3.2 g Vitamin A, 0.8 g Vitamin D , and 0.4 g Agricultural Sciences (CAAS), Beijing, China. The ex- 3 Vitamin E perimental procedures were approved by the Animal b DM dry matter, OM organic matter, GE gross energy, CP crude protein, Ethics Committee of CAAS, and humane animal care NDF neutral detergent fiber, ADF acid detergent fiber Ma et al. Journal of Animal Science and Biotechnology (2016) 7:1 Page 3 of 7 H SO . The volume was measured and a sample (10 mL/L fiber (NDF) and acid-detergent fiber (ADF) were mea- 2 4 of total volume) was collected and stored at −20 °C until sured according to Van Soest et al. [16] and Goering and analysis. Samples of feed, ort, feces, and urine were pooled Van Soest [17], respectively. NDF was measured without to form a composite sample for each ewe. a heat stable amylase and expressed inclusive of residual Ruminal methane production was measured using ash. Ruminal VFA was measured according to the pro- an open-circuit respirometry system (Sable Systems cedure described by Ma et al. [18] and ammonia N was International, Las Vegas, NV, USA) with three metab- assessed according to Broderick and Kang [19]. olism cages, each fitted with a polycarbonate head box. Total DNA from rumen fluid was extracted according Measurements of methane production were staggered to a bead-beating method as described by Zhang et al. because only three measurement units were available. On [20]. The microbial cells were resuspended in a lysis buf- days 0, 2, 4, and 6 of each 8-day collection period, the fer in tubes containing zirconium beads, which were ewes were moved in sequence from their metabolism then bead-beaten at 4600 rpm for 3 min in a mini-bead cages to metabolism cages equipped with head boxes for beater (MM400, Retsch, Hann, Germany) followed by digestibility assays and methane output assessments. After phenol-chloroform extraction [21]. After centrifugation a 24 hour adaptation period, individual methane produc- of the sample at 14,000 × g for 15 min at 4 °C, the tion was measured over a 24 hour period as described by supernatant was mixed with a glass milk kit (Gene Clean Deng et al. [14]. All ewes had been previously trained for II kit, ZZBio Co., Ltd, Shanghai, China) and washed confinement in head boxes attached to metabolism cages. before a final elution step to release the DNA from the glass milk. Experiment 2 The amplifying primer of microbial flora, including Six ruminally cannulated Dorper × Thin-tailed Han total bacteria, methanogens, protozoans, F. succinogenes, crossbred ewes (65.2 ± 2.0 kg BW) were divided into two R. albus, R. flavefaciens, and B. fibrisolvens are listed in groups of three each according to crossover design and Table 2 as described by Denman and McSweeney [22]. fed either of the following diets: basal diet or basal diet All primers were verified by sequencing and melting- supplemented with allicin (AL, 2.0 g/head·day). Com- curve analysis using a C1000™ thermal cycler and bun- position of the basal diets and the experimental regime dled software CFX96 Manager™ software version 2.1 were the same as in Experiment 1. The experiment (Bio-Rad laboratories, Inc., Hercules, CA, USA). The lasted for 42 days, which consisted of two periods lasting PCR products were purified by gel extraction and ligated 21 days, including 7 days of adaptation. On days 16 and into the pGM-T vector (Promega) and the recombinant 37, two 50mL samples of ruminal digesta were collected plasmids were extracted using a plasmid minikit from rumen cannula using a syringe attached to a plastic (Omega) according to the manufacturer’s instructions tube (20-mm internal diameter), at 0, 1, 3, 6, and 9 h and quantified by A measurements. Standard curves 1 7 after the morning feeding for the measurements of for microbes were generated with 10 –10 copies of re- ruminal fermentation parameters and microbial flora combinant plasmids per μL. The qPCR was performed populations. The pH was measured immediately using a Table 2 Primers for qPCR assay pH meter (Model PB-10, Sartorius Co., Goettingen, Target species Primer sequence (5’→3’) Amplicon Germany) and all samples were frozen in liquid nitrogen Total bacteria F: CGGTGAATACGTTCYCGG 123 within 5 min and then stored at −80 °C until needed. R: GGWTACCTTGTTACGACTT Analytical procedures Methanogens F: TTCGGTGGATCDCARAGRGC 140 Dry matter (DM) content was measured by drying sam- R: GBARGTCGWAWCCGTAGAATCC ples in an air-forced oven at 135 °C for 2 h (method Protozoans F: GCTTTCGWTGGTAGTGTATT 223 930.15; AOAC, 1990) [15]. Ash content was measured R: CTTGCCCTCYAATCGTWCT by placing samples into a muffle furnace at 550 °C for F. succinogenes F: GTTCGGAATTACTGGGCGTAAA 121 5 h (method 938.08; AOAC, 1990) [15]. Organic matter R: CGCCTGCCCCTGAACTATC (OM) was measured as the difference between DM and the ash content. Nitrogen (N) was measured according R. flavefaciens F: GATGCCGCGTGGAGGAAGAAG 286 to the methods of Kjeldahl, using Se as a catalyst. Crude R: CATTTCACCGCTACACCAGGAA protein (CP) was calculated as 6.25 × N. Gross energy R. albus F: GTTTTAGGATTGTAAACCTCTGTCTT 270 (GE) was measured using a bomb calorimeter (C200, R: CCTAATATCTACGCATTTCACCGC IKA Works Inc., Staufen, Germany). Ether extracts (EE) B. fibrisolvens F: TAACATGAGAGTTTGATCCTGGCTC 135 were measured by weight loss of the DM on extraction R: CGTTACTCACCCGTCCGC with diethyl ether in Soxhlet extraction apparatus for 8 h (method 920.85; AOAC, 1990) [15]. Neutral-detergent Primers were designed according to Denman and McSweeney [22] Ma et al. Journal of Animal Science and Biotechnology (2016) 7:1 Page 4 of 7 using SsoFast EvaGreen Supermix (Bio-Rad), a C1000™ Table 4 Effects of supplementary allicin (AL) on daily methane production and ruminal fermentation in ewes thermal cycler qPCR detection system, and genomic a b DNA as the template. All PCR amplifications used the Item Treatments SEM P value following thermal cycling: 95 °C for 10 min, followed by Basal diet AL 40 cycles of 94 °C for 20 s, 60 °C for annealing, ex- Methane production tension, and collection of fluorescent signals. All samples L 61.6 64.0 3.46 0.151 were prepared from the ewes and each sample was 0.75 L/kg BW 2.85 2.69 0.06 0.007 assayed in triplicate. L/kg DOM intake 66.1 61.0 2.02 0.009 pH 5.98 5.96 0.04 0.601 Statistical analyses The data on digestibility and nitrogen balance were Ammonia, mg/100 mL 10.9 9.37 0.30 0.024 analyzed by the independent sample t-test. Data refer- Total VFA, mmol/L 109.4 125.1 4.15 0.014 ring to ruminal fermentation parameters and microbial Molar proportions, % flora measured at each sampling time were analyzed Acetate 72.2 69.7 0.59 0.023 using repeated measures data of ANOVA. All statistical Propionate 14.8 14.9 0.42 0.906 analyses were performed by using SPSS (SPSS Inc., Isobutyrate 1.32 1.86 0.09 0.011 Chicago, IL, USA) and significant differences were accepted if P < 0.05. Butyrate 9.43 11.0 0.24 0.003 Isovalerate 1.37 1.68 0.08 0.054 Results Valerate 0.89 0.71 0.04 0.363 Supplementation of AL increased apparent digestibility Acetate:propionate 4.98 4.83 0.16 0.455 of OM (P < 0.001), N (P = 0.006), NDF (P < 0.001), and BW bodyweight, DOM digestible organic matter, VFA volatile fatty acids ADF (P = 0.002) (Table 3). Daily fecal N output de- CON ewes fed basal diet, AL ewes fed basal diet supplemented with allicin creased from 10.7 to 9.34 g/d (P < 0.001) while urinary N output was unaffected (P = 0.691). Although no signifi- treatments (P = 0.601). Ammonia decreased from 10.9 to cant effect was observed, either N retention or the ratio 9.37 mg/dL (P = 0.024) while total VFA increased from of N retention/N intake tended to increase (P = 0.071) 109.4 to 125.1 mmol/L (P = 0.014) by supplementation of when AL was added. AL. The molar proportion of acetate decreased from 72.2 Supplementation of AL had no significant effect on daily to 69.7 % (P = 0.023), while that of isobutyrate and methane output by ewes (P > 0.05), but decreased daily butyrate increased from 1.32 to 1.86 % (P =0.011) and 0.75 methane output from 2.85 to 2.69 L/kg BW (P =0.007) from 9.43 to 11.0 % (P = 0.003), respectively, by supple- (Table 4). In addition, daily methane output decreased mentation of AL. No difference was observed in molar from 66.1 to 61.0 l (P =0.009) when scaled to DOM intake proportions of propionate (P = 0.155), valerate (P =0.363), by supplementary AL. Ruminal pH was similar for both and the ratio of acetate to propionate (P = 0.455). Supple- mentary AL tended to increase the molar proportion of isovalerate (P =0.054). Table 3 Effects of supplementary allicin (AL) on the apparent Supplementary AL increased the total bacteria (P<0.001), digestibility of nutrients and nitrogen balance in ewes (Table 5), decreased the population of methanogens a b Item Treatments SEM P value (P = 0.001), and tended to decrease the population of Basal diet AL protozoans (P = 0.097). Populations of F. succinogenes DM intake, g/d 1,512.4 1,512.4 0.029 0.524 (P < 0.001), R. flavefaciens (P = 0.001), and B. fibrisolvens (P = 0.001) were significantly increased by supplementa- Apparent digestibility, % tion of AL, while no effect of AL was found on the popu- OM 60.3 67.9 1.07 <0.001 lation of R. albus (P =0.675). N 66.6 70.9 0.86 0.001 NDF 37.9 51.8 1.90 <0.001 Discussion ADF 38.8 50.5 2.14 0.001 The current study found that supplementation of AL Fecal N, g/d 10.7 9.34 0.39 0.001 increased the apparent digestibility of OM, N, NDF, and ADF. It is reported that AL is very unstable and quickly Urinary N, g/d 14.9 14.5 0.87 0.691 changes into a series of other sulfur-containing com- N retention, g/d 6.54 8.30 0.95 0.071 pounds such as DADS [23]. In a related study, it was re- N retention/N intake, % 20.3 25.8 2.10 0.071 ported that supplementation of DADS at 2 g/kg of diet DM dry matter, OM organic matter, N nitrogen, NDF neutral detergent fiber, improved the apparent digestibility of OM and NDF in ADF acid detergent fiber CON ewes fed basal diet, AL ewes fed basal diet supplemented with allicin sheep [10]. Kamruzzaman et al. [24] also reported that Ma et al. Journal of Animal Science and Biotechnology (2016) 7:1 Page 5 of 7 Table 5 Effects of supplementary allicin (AL) on ruminal interrupted in the rumen of goats by infusion garlic oil; microbial population this may be related to its antibacterial activity. All these Treatments in vitro and in vivo results suggest that garlic compo- Microbial population, SEM P value per mL of ruminal fluid nents are effective in reducing methane emissions. This CON AL effect may be due to the reduction of methanogen or Total bacteria, × 10 7.36 12.10 0.72 <0.001 protozoan populations, as observed in current study. It Protozoans, × 10 7.83 6.64 0.36 0.097 has also been reported that endo- and ecto-symbiotic Methanogens, × 10 9.23 4.53 0.79 0.001 methanogens of protozoans could contribute up to 25 % F. succinogenes,×10 4.08 9.05 0.66 <0.001 of rumen fluid methane emissions in sheep [30]. R. flavefaciens,×10 4.18 6.84 0.43 0.001 Supplementary AL decreased the ruminal concentra- R. albus,× 10 6.44 6.79 0.40 0.675 tion of ammonia, but increased that of total VFA, which is similar to results reported by Cardozo et al. [31] and B. fibrisolvens,×10 9.71 15.20 0.89 0.001 a Klevenhusen et al. [10], who supplemented various garlic CON ewes fed basal diet, AL ewes fed basal diet supplemented with allicin components in vitro and in sheep diets, respectively. Again, those results could reflect enhanced utilization of dietary fibrous components by ruminal microbes as the replacing 10 % of hay by garlic leaf, which retains the population of R. flavefaciens increased. The change in same bioactive components as the garlic bulb, could in- the molar proportion of acetate, isobutyrate, and crease N digestibility in sheep. The increase in nutrient butyrate suggested that supplementary AL might affect digestibility could be explained by the increase in the rumen fermentation patterns by changing microbial populations of cellulolytic bacteria (F. succinogenes, populations. Reports of the effect of garlic components R. flavefaciens,and B. fibrisolvens) in the rumen as ob- on ruminal VFA were inconsistent. Concentration of served in current study, which in turn improved the VFA and the molar proportion of acetate decreased, but utilization of dietary fiber and provided more carbohy- the molar proportion of propionate and butyrate in- drates to microbes. creased [26]; concentration of VFA and the molar pro- Nitrogen retention is considered an index of protein portion of propionate increased [9]; and neither the total status in ruminants. The lower N output in feces in the concentration nor the molar proportion of VFA was AL group is consistent with the higher digestibility of affected by the additives [10]. The experimental dif- dietary N, suggesting an improved utilization of dietary ferences among these results could be related to the N. Urinary N output was similar between the two groups experimental diets and dosage of the plant extract used. in current study. When scaled to metabolic bodyweight, Although not significant, the population of protozoans however, a significant decrease in the AL group was tended to decrease in response to supplementary AL. 0.75 observed (0.61 vs 0.69 g/kg BW /d, P < 0.05). A reduc- The effect of garlic by-products on protozoan numbers tion of urinary N excretion is desirable, as urinary N differed in different studies. Reuter et al. [32] reported causes more waste and pollution to the environment that garlic extracts are effective against a host of proto- than fecal N, as feces could be utilized for crop pro- zoans. Kongmun et al. [33] investigated the effect of gar- duction when used as a manure [25]. Supplementary AL lic powder on in vitro fermentation and found a reduced tended to increase both N retention and the ratio of N protozoan count. Anassori et al. [34] found that sup- retention/N intake. The insignificant N retention could plementing a basal diet with raw garlic or garlic oil be due to the dosage of AL used in the current study. As effectively reduced number of total protozoans in sheep. reported by Wanapat et al. [9], supplementation of garlic Those discrepancies could be attributed to factors such powder at 40 g/day did not affect N retention, but at as specific diet and supplementary dosage. 120 g/day did improve N retention in steers. In the current study, supplementary AL decreased the The current study found that supplementation of AL population of methanogens by about 104 %. Most stud- 0.75 decreased daily methane emissions (L/kg BW ) or me- ies of the effect of garlic components on the population thane output scaled to DOM intake. Previous studies of methanogens were conducted in vitro. Chaves et al. showed that methane production was suppressed [27] reported that supplementing garlic oil decreased in vitro by garlic oil [26, 27]. Similar to our results, methanogenic activities of mixed ruminal bacteria. More Klevenhusen et al. [10] found a decrease in methane recently, Patra and Yu [35] reported that garlic oil could output scaled to digested NDF intake when DADS was reduce the abundance of archaea. Observations of the supplemented and Patra et al. [28] found that supple- reduction of methanogens in the current study coincide mentary Allium sativum tended to reduce methane out- with those of in vitro results. The reduction of methano- put scaled to digested DM intake by sheep. Zhu et al. gens could be directly due to the inhibitive effect of gar- [29] found that the final step of biohydrogenation was lic components. In addition, the decreased population of Ma et al. Journal of Animal Science and Biotechnology (2016) 7:1 Page 6 of 7 protozoans could also be responsible for the reduction Received: 24 August 2015 Accepted: 9 December 2015 in methanogens, as the total methanogen population de- clined in absolute number as well as in proportion to References the total bacterial population in the absence of proto- 1. Goel G, Makkar HPS, Becker K. Effect of Sesbania sesban and Carduus zoans [36]. pycnocephalus leaves and fenugreek (Trigonella foenum-graecum L.) seeds and In our study, we quantified four main cellulolytic their extracts on partitioning of nutrient from roughage and concentrate based feeds to methane. Anim Feed Sci Technol. 2008;147:72–89. bacteria using a q-PCR system and observed significant in- 2. United Nations Framework Convention on Climate Change. Greenhouse creases in the populations of F. succinogenes, R. flavefaciens, Gas inventory data. Bonn: UNFCCC; 1996. https://unfccc.int/ghg_data/ and B. fibrisolvens in ewes supplemented with AL. online_help/definitions/items/3817.php. 3. Hess HD, Beuret RA, Lotscher M, Hindrichsen IK, Machmüller A, Carulla JE, Wanapat et al. [9] reported that supplementation of garlic et al. Ruminal fermentation, methanogenesis and nitrogen utilization of powder did not affect the population of amylolytic or sheep receiving tropical grass hay–concentrate diets offered with Sapindus cellulolytic bacteria. Patra and Yu [35], however, reported saponaria fruits and Cratylia argentea foliage. Anim Sci. 2004;79:177–89. 4. Alford AR, Hegarty RS, Parnell PF, Cacho OJ, Herd RM, Griffith GR. The that garlic oil effectively reduced the in vitro abundance of impact of breeding to reduce residual feed intake on enteric methane F. succinogenes, R. flavefaciens, and R. albus without emissions from the Australian beef industry. Aust J Exp Agr. 2006;46:813–20. affecting that of total bacteria. It should be noted that 5. Moss AR, Jouany JP, Newbold CJ. Methane production by ruminants: its contribution to global warming. Ann Zootechnol. 2000;49:231–5. although garlic has been proven effective against some 6. Wallace RJ, McEwan NR, McIntosh FM, Teferedegne B, Newbold CJ. Natural gram-negative or gram-positive bacteria, it is not a broad- products as manipulators of rumen fermentation. Asian-Austral J Anim Sci. spectrum microbial inhibitor [37]. In addition, rumen is 2002;15:1458–68. 7. Ankri S, Mirelman D. Antimicrobial properties of allicin from garlic. Microbes such a complicated system that in vitro studies could not Infect. 1999;1:125–9. completely reflect the situation in rumen. The increase in 8. Yang WZ, Benchaar C, Ametaj BN, Chaves AV, He ML, McAllister TA. Effects the population of those three cellulolytic bacteria could be of garlic and juniper berry essential oils on ruminal fermentation and on the site and extent of digestion in lactating cows. J Dairy Sci. 2007;90:5671–81. more probably explained by the reduced populations of 9. Wanapat M, Khejornsart P, Pakdee P, Wanapat S. Effect of supplementation the protozoans that engulf bacteria. To our knowledge, of garlic powder on rumen ecology and digestibility of nutrients in there has been no study on the effect of garlic-related ruminants. J Sci Food Agri. 2008;88:2231–7. 10. Klevenhusen F, Zeitz JO, Duval S, Kreuzer M, Soliva CR. Garlic oil and its compounds on ruminal microbial flora in sheep; further principal component diallyl disulfide fail to mitigate methane, but improve study is needed to prove the effectiveness of AL in digestibility in sheep. Anim Feed Sci Technol. 2011;166:356–63. manipulating certain microbes. 11. Rinsoz T, Duquenne P, Greff-Mirguet G, Oppliger A. Application of real-time PCR for total airborne bacterial assessment: Comparison with epifluorescence microscopy and culture-dependent methods. Atmos Environ. 2008;42:6767–74. Conclusions 12. NRC. Nutrient requirements of small ruminants. Sheep, goats, cervids and Dietary supplementation of AL at 2.0 g/head·day New world camelids. Washington, DC: National Academy Press; 2007. effectively enhanced OM, N, NDF, and ADF digestibility 13. Ma T, Chen DD, Tu Y, Zhang NF, Si BW, Deng KD, et al. Effect of dietary 0.75 supplementation with resveratrol on nutrient digestibility, methanogenesis and reduced daily methane emissions (L/kg BW )in and ruminal microbial flora in sheep. J Anim Physiol An N. 2015;99(4):676–83. ewes, probably by decreasing the population of ruminal 14. Deng KD, Jiang CG, Tu Y, Zhang NF, Liu J, Ma T, et al. Energy requirements protozoans and methanogens. of Dorper crossbred ewe lambs. J Anim Sci. 2014;92:2161–9. 15. AOAC. Official methods of analysis. 15th ed. Washington, DC: Association of Official Analytical Chemists; 1990. Competing interests 16. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral The authors declare that they have no competing interest. detergent fiber and non-starch polysaccharides in relation to animal nutrition. J Dairy Sci. 1991;74:3583–97. 17. Goering HG, Van Soest JP. Forage fiber analysis. Agricultural handbook, vol. Authors’ contributions 379. USA: UPSDA; 1970. DC carried out the whole animal experiment, including sample collection 18. Ma T, Deng KD, Tu Y, Zhang NF, Jiang CG, Liu J, et al. Effect of dietary and determination. TM participated in the statistical analysis and wrote the forage-to-concentrate ratios on urinary excretion of purine derivatives and draft. KD helped to revise the manuscript. YT, NZ, and BS participated in the microbial nitrogen yields in the rumen of Dorper crossbred sheep. Livest design and coordination of the study. QD conceived of the study. All authors Sci. 2014;160:37–44. read and approved the final manuscript. 19. Broderick GA, Kang JH. Automated simultaneous determination of ammonia and total amino acids in ruminal fluid and in vitro media. J Dairy Sci. 1980;63:64–75. Acknowledgements 20. Zhang CM, Guo YQ, Yuan ZP, Wu YM, Wang JK, Liu JX, et al. Effect of This study was funded by the Ministry of Science and Technology of the octadeca carbon fatty acids on microbial fermentation, methanogenesis People’s Republic of China (Program 2012BAD39B05) and earmarked fund for and microbial flora in vitro. Anim Feed Sci Technol. 2008;146:259–69. China Agriculture Research System (CARS-39). We thank C. Liu, C. Lou, S.-Q. 21. Zoetendal EG, Akkermans AD, De Vos WM. Temperature gradient gel Wang, X. Cui, X.-L. Chen, Y.-X. Xie, and Y. Xiao for their technical assistance. electrophoresis analysis of 16S rRNA from human fecal samples reveals All authors participated in the writing of the manuscript and agreed with the stable and host-specific communities of active bacteria. Appl Environ final format. Microb. 1998;64:3854–9. 22. Denman SE, McSweeney CS. Development of a real-time PCR assay for Author details monitoring anaerobic fungal and cellulolytic bacterial populations within Feed Research Institute, Chinese Academy of Agricultural Sciences, Key the rumen. FEMS Microbiol Ecol. 2006;58:572–82. Laboratory of Feed Biotechnology of the Ministry of Agriculture, Beijing 23. Ilić DP, Nikolić VD, Nikolić LB, Stanković MZ, Stanojević LP, Cakić MD. Allicin 100081, China. College of Animal Science, Jinling Institute of Technology, and related compounds: biosynthesis, synthesis and pharmacological Nanjing, Jiangsu 210038, China. activity. Facta Univ. 2011;9:9–20. Ma et al. Journal of Animal Science and Biotechnology (2016) 7:1 Page 7 of 7 24. Kamruzzaman M, Liang X, Sekiguchi N, Sano H. Effect of feeding garlic leaf on microbial nitrogen supply, kinetics of plasma phenylalanine, tyrosine and protein synthesis in sheep. Anim Sci J. 2014;85:542–8. 25. Vaithiyanathan S, Bhatta R, Mishra AS, Prasad R, Verma DL, Singh NP. Effect of feeding graded levels of Prosopis cineraria leaves on rumen ciliate protozoans, nitrogen balance and microbial protein supply in lambs and kids. Anim Feed Sci Technol. 2007;133:177–91. 26. Busquet M, Calsamiglia S, Ferret A, Carro MD, Kamel C. Effect of garlic oil and four of its compounds on rumen microbial fermentation. J Dairy Sci. 2005;88:4393–404. 27. Chaves AV, He ML, Yang WZ, Hristov AN, McAllister TA, Benchaar C. Effects of essential oils on proteolytic, deaminative and methanogenic activities of mixed ruminal bacteria. Can J Anim Sci. 2008;88:117–22. 28. Patra AK, Kamra DN, Bhar R, Kumar R, Agarwal N. Effect of Terminalia chebula and Allium sativum on in vivo methane emission by sheep. J Anim Physiol An N. 2011;95:187–91. 29. Zhu Z, Mao S, Zhu W. Effects of ruminal infusion of garlic oil on fermentation dynamics, fatty acid profile and abundance of bacteria involved in biohydrogenation in rumen of goats. Asian-Australas J Anim Sci. 2012;25:962–70. 30. Newbold CJ, Lassalas B, Jouany JP. The importance of methanogens associated with ciliate protozoans in ruminal methane production in vitro. Lett Appl Microbiol. 1995;21:230–4. 31. Cardozo PW, Calsamiglia S, Ferret A, Kamel C. Screening for the effects of natural plant extracts at different pH on in vitro rumen microbial fermentation of a high-concentrate diet for beef cattle. J Anim Sci. 2005;83:2572–9. 32. Reuter HD, Koch HP, Lawson LD. Therapeutic effects and applications of garlic and its preparations. In: Koch HP, Lawson LD, editors. Garlic: the science and therapeutic application of Allium sativum L. And related species. Baltimore: Williams and Wilkins; 1996. p. 135–213. 33. Kongmun P, Wanapat M, Pakdee P, Navanukraw C. Effect of coconut oil and garlic powder on in vitro fermentation using gas production technique. Livest Sci. 2010;127:38–44. 34. Anassori E, Dalir-Naghadeh B, Pirmohammadi R, Taghizadeh A, Asri-Rezaei S, Maham M, et al. Garlic: a potential alternative for monensin as a rumen modifier. Livest Sci. 2011;142:276–87. 35. Patra AK, Yu Z. Effects of essential oils on methane production and fermentation by, and abundance and diversity of, rumen microbial populations. Appl Environ Microb. 2012;78:4271–80. 36. Takenaka A, Itabashi H. Changes in the population of some functional groups of rumen bacteria including methanogenic bacteria by changing the rumen ciliates in calves. J Gen Appl Microbiol. 1995;41:377–87. 37. Rees LP, Minney SF, Plummer NT, Slater JH, Skyrme DA. A quantitative assessment of the antimicrobial activity of garlic (Allium sativum). World J Microbiol Biotechnol. 1993;9:303–7. Submit your next manuscript to BioMed Central and we will help you at every step: • We accept pre-submission inquiries � Our selector tool helps you to find the most relevant journal � We provide round the clock customer support � Convenient online submission � Thorough peer review � Inclusion in PubMed and all major indexing services � Maximum visibility for your research Submit your manuscript at www.biomedcentral.com/submit
Journal
Journal of Animal Science and Biotechnology – Springer Journals
Published: Jan 15, 2016