Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Effects of benzoic acid (VevoVitall®) on the performance and jejunal digestive physiology in young pigs

Effects of benzoic acid (VevoVitall®) on the performance and jejunal digestive physiology in... Background: As a organic acid, benzoic acid has become one of the most important alternatives for antibiotics, and its beneficial effect on performance in animals has been proven for a decade. However, knowledge of the effects of benzoic acid on jejunal digestive physiology, especially the antioxidant capacity and mucosal glucagon-like peptide 2 (GLP-2) concentrations is lacking. Methods: A total of 20 barrows [Duroc × (Yorkshire × Landrace)] with an average body weight (BW) of 18.75 ± 0.2 kg were used in a 14-d trial to determine the potential mechanisms of benzoic acid supplementation on the performance, nutrient digestibility and jejunal digestive physiology in young pigs. All pigs were randomly allotted to 1 of 2 diets supplemented with 0 or 5000 mg/kg benzoic acid. Results: Relative to the control, benzoic acid supplementation increased the average daily feed intake (ADFI), and average daily gain (ADG) in young pigs (P < 0.05), improved the apparent total tract digestibility of dry matter (DM), crude protein (CP), ether extract (EE), gross energy (GE) and crude ash (P < 0.05), and enhanced the activities of trypsin, lipase and amylase in the jejunum (P < 0.05). Similarly, relative to the control, supplementing benzoic acid in the diet resulted in a trend to reduce the pH values of the digesta (P = 0.06), decreased crypt depth and increased the villus height to crypt depth ratio (P < 0.05) in the jejunum of pigs. Finally, benzoic acid supplementation increased the mRNA expression and concentration of glucagon-like peptide 2 and the activities of glutathione peroxidase and superoxide dismutase in the jejunal mucosa of young pigs (P <0.05). Conclusions: In conclusion, supplementation with 5000 mg/kg benzoic acid improved the performance of young pigs through promoting nutrient digestion, improving jejunal antioxidant capacity, and maintaining the jejunal morphology in young pigs. Keywords: Benzoic acid, Glucagon-like peptide 2, Nutrient digestibility, Performance, Young pigs Background antimicrobial properties and forms colourless to white To overcome the negative effect on pig production brought crystals, and was authorized to be used for the preservation by the ban of antibiotics in Europe, using different alterna- of various foodstuffs and feed of growing pigs at the dose tives, such as organic acids and essential oils, has been of 0.5 to 1.0 % by the European Union in 2003 [2]. recommended as one of the effective methods to help Previous studies have shown that benzoic acid can improve the performance and decrease the incidence of improve the performance and nutrient digestibility, diarrhea in pigs [1]. As the simplest of the aromatic inhibit pathogenic microorganisms, and maintain the carboxylic acids, benzoic acid has broad-spectrum balance of microflora [3–7]. However, there is little avail- able information on the systematic mechanisms through which benzoic acid promotes pig performance, especially * Correspondence: dwchen@sicau.edu.cn; acatmxb2003@163.com the effect of benzoic acid on the antioxidant capacity and Equal contributors Animal Nutrition Institute, Sichuan Agricultural University, Xinkang Road 46#, mucosal glucagon-like peptide 2 (GLP-2) concentrations Ya’an, Sichuan Province 625014, People’s Republic of China © 2016 Diao et al. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Diao et al. Journal of Animal Science and Biotechnology (2016) 7:32 Page 2 of 7 in the jejunum of pigs. Thus, the objective of this study On d 15, following weighing, all the pigs were killed was to evaluate the effects of benzoic acid on the per- with an intravenous injection of chlorpromazine hydro- formance, nutrient digestibility, pH values, activities of chloride (Shanghai Harvest Pharmaceutical Co. Ltd. digestive enzymes, mucosal morphology, GLP-2 con- China, 150 mg/kg body weight) and jugular exsanguina- centration and antioxidant capacity in the jejunal tions. Then, the mid-jejunum (2 cm) was immediately mucosa of young pigs, which could help us further isolated, washed and preserved in 10 % formalin solution understand the mechanism through which benzoic acid for histological analysis. This was followed by measuring improves pig performance, and provide the scientific the pH of the jejunal digesta with a pH meter (PHS-3C basis for using benzoic acid in practice. pH, Shanghai, China). The jejunal mucosa were collected by scraping the intestinal wall with a glass microscope Methods slide, immediately frozen in liquid nitrogen, and stored The experimental protocol used in this study was approved at -80 °C until the analysis of the antioxidant capacity, by the Animal Care and Use Committee of Sichuan GLP-2 concentration and quantitative real-time PCR. Agricultural University (Ya’an, China). Benzoic acid Additionally, the jejunal digesta was collected, and (VevoVitall) was provided by DSM (China) Limited stored at -80 °C for measuring the activities of the (Shanghai, China). digestive enzymes. Experimental design, animals and diet Apparent total tract digestibility A total of 20 healthy DLY [Duroc × (Yorkshire × The ATTD was measured using AIA as a digestibility indi- Landrace)] young pigs with an initial average BW of 18.75 ± cator. AIA in diets and fecal samples were determined by 0.20 kg were randomly allotted to 1 of 2 diets including a a method described by the Chinese National Standard control and a diet supplemented with 5000 mg/kg benzoic (GB/T 23742) [9]. All diets and fecal samples were ana- acid for 14 days During d 11-14, the apparent total tract lyzed for DM (method 930.15, AOAC, 1995), ash (method digestibility (ATTD) of nutrients was measured using the 942.05, AOAC, 1995), EE (method 945.16, AOAC, 1995), acid insoluble ash (AIA) as an endogenous indicator. All Ca (method 927.02, AOAC, 1995), P (method 995.11, pigs were placed individually in metabolism cages (1.5 m × AOAC, 1995), CP (method 990.03, AOAC, 1995) [10] and 0.7 m × 1.0 m) with a self-feeder and a nipple watering de- GE. The GE concentration was determined using bomb vice, which were located in a temperature (25 ± 1 °C) and calorimetry (Parr Instrument 1563, Moline IL). The relative humidity (60 ± 5 %)-controlled room. The pigs content of benzoic acid in the diets was measured by had free access to feed and drinking water. The lighting DSM (China) Limited (Shanghai, China) using high- was natural. Individual BW was recorded after all pigs performance liquid chromatography. The digestibility of were food-deprived for 12 h on d 1 and 15, and feed con- chemical constituents was calculated as (100 – A1/A2 x sumption was recorded as the amount of feed offered F2/F1 x 100), where A1 represents the AIA content of the daily minus the remaining quantity in the next morning diet; A2 represents the AIA content of the feces; F1 repre- during the experiment, which were used to determine the sents the nutrient content of the diet; F2 represents the average weight gain (ADG), average daily feed intake nutrient content of the feces [11]. (ADFI) and ratio of feed to gain (F/G). The diets were formulated to meet or exceed the Histological measurements National Research Council recommended nutrient re- The measurements of the villous height and crypt depth quirements for pigs weighing 10-20 kg (NRC, 2012) [8]. were conducted as described by Pluske et al [12]. Briefly, Ingredients and composition of the diets is presented in the ring-shaped histological sections of the jejunum were Table 1. The experimental diet was formulated using excised, dehydrated, and embedded in paraffin wax benzoic acid to substitute for maize in the basal diet. No before 4 transverse sections (5 μm) were cut, and then antibiotics were used in any diet. installed on glass slides and stained with haematoxylin and eosin. The height of 10 well orientated villi and their Sampling and measurements adjoined crypts were measured at 40 × magnification Experimental diets were sampled and stored at -20 °C with an Olympus CK 40 Microscope (Olympus Optical until analyzed for dry matter (DM), crude protein (CP), Company, Guangzhou, China). ether extract (EE), gross energy (GE) and crude ash. After each collection of feces, 10 % hydrochloric acid Digestive enzymes activities, antioxidant capacity and was added to fix excreta nitrogen. Feces collected on d GLP-2 concentration 11-14 of each replicate were dried in a forced air oven The activities of digestive enzymes (trypsin, lipase and (60 °C) for 72 h, and ground through a 1-mm screen amylase) in frozen jejunal digesta, the activities of super- before chemical analysis. oxide dismutase (SOD) and glutathione peroxidase Diao et al. Journal of Animal Science and Biotechnology (2016) 7:32 Page 3 of 7 Table 1 Ingredients and nutrient compositions of basal diet, air dry basis,% Ingredients,% Calculated Composition,% Analyzed Composition,% Maize 57.88 DE,MJ/kg 14.37 Control diet Dehulled soybean meal 22.00 Available phosphorus 0.41 Crude protein 18.32 Fish meal 5.00 Arg 1.20 Calcium 0.86 Soybean oil 1.50 Cys 0.32 Total phosphorus 0.62 Whey powder 6.00 His 0.49 Ether extract 0.73 Sugar 2.00 Ile 0.80 Gross energy,kcal/g 4.17 Glucose 3.00 Leu 1.65 Benzoic acid,mg/kg 0 L-Lys-HCl,78 % 0.24 Lys 1.31 Benzoic acid diet DL-Met,99 % 0.10 Met 0.45 Crude protein 18.36 Trp,98 % 0.02 Met + Cys 0.77 Calcium 0.83 Thr,98.5 % 0.07 Phe 0.91 Total phosphorus 0.59 Choline Chloride 0.10 Thr 0.84 Ether extract 0.72 Calcium carbonat 0.90 Trp 0.25 Gross energy,kcal/g 4.19 Dicalcium phosphate 0.40 Na 0.24 Benzoic acid,mg/kg 5036 Nacl 0.15 Vitamin Complex 0.04 Mineral Complex 0.30 Phytase 0.10 The premix provides following per kg diet: Vitamin A 6000 IU; Vitamin D 400 IUg; Vitamin E 10 IU; Vitamin K 3 mg; Vitamin B 3 mg; Vitamin B 6 mg; Vitamin 3 3 1 2 B 3 mg; Vitamin B 24 μg; folic acid 1.2 mg; nicotinic acid 14 mg; biotin 150 mg; D-pantothenic acid 15 mg 6 12 The premix provides following per kg diet: Fe (as ferrous sulfate) 100 mg, Cu (as copper sulfate) 6 mg, Mn 40 mg, Zn (as zinc sulfate) 80 mg, I 0.3 mg, Se 0.3 mg (GSH-px) and the methane dicarboxylic aldehyde (MDA) Company, Dalian, China) according to the manufac- concentration in the jejunal mucosa were determined turer’s instructions. using commercial kits obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) combined with Real-time quantitative PCR a UV-VIS Spectrophotometer (UV1100, MAPADA, Real-time quantitative PCR was carried out using the Shanghai, China) according to the manufacturer’s CFX96 Real-Time PCR Detection System (Bio-Rad instructions. Laboratories, Richmond, CA), as described by Mao et al. The GLP-2 concentration of the jejunal mucosa was (2014) [13]. Briefly, the gene-specific primers used in the determined using a commercially available pig Enzyme- present study were synthesised commercially by Invitro- linked Immunosorbent Assay Kit from R&D system gen (Shanghai, China), which are listed in Table 2. The (Minneapolis, MN) according to the manufacturer’s PCR system was composed of 5 μL 2 × SYBR Premix Ex instructions. The GLP-2 concentration was quantified Taq (Biotechnology Company, Dalian, China), 0.5 μLof using a BioTek Synergy HT microplate reader (BioTek forward and 0.5 μL of reverse primers (100 nmol/L), Instruments, Winooski, VT), and absorbance was mea- 3 μL diethylpyrocarbonate-treated water and 1 μL sured at 450 nm. cDNA. Cycling conditions were as follows: 95 °C for 10 s, followed by forty cycles of 95 °C for 5 s, annealing Total RNA extraction and reverse transcription reaction at 62 °C for 10 s and 72 °C for 15 s. The melting curve Total RNA was isolated from the frozen jejuna mucosa conditions were 95 °C for 30 s, 55 °C for 1 min and 95 ° (one sample per replicate) using the TRIzol reagent (Bio- C for 1 min, which was carried out after each real-time technology Company, Dalian, China) according to the quantitative PCR to check and verify the specificity and manufacturer’s protocol. The concentration and purity purity of all PCR products. Each sample was run simul- of total RNA were analysed on a spectrophotometer taneously in triplicate on the same PCR plate, and the (Beckman Colter DU 800, Beckman Coulter Inc, Brea, average of each triplicate value expressed as the number USA), and the optical density 260:280 (OD260:OD280) of copies was used for the statistical analysis. A standard ranged from 1.8 to 2.0 for all the samples. The synthesis curve was established using serial dilutions of one of the of the first strand of cDNA of each sample was obtained complementary DNA samples, which could be used for by reverse transcription by RT Reagents (Biotechnology obtaining reliable amplification efficiency values (ranged Diao et al. Journal of Animal Science and Biotechnology (2016) 7:32 Page 4 of 7 Table 2 Primes for real time PCR Target gene Forward primer 5’-3’ Reverse primer 5’-3’ Accession number GLP-2 TGTAATGCTGGTACAAGGCAG CTTGTCTTCAGTCATCTGATC NM_214324.1 β-actin TCTGGCACCACACCTTCT TGATCTGGGTCATCTTCTCAC DQ178122 from 90 to 110 %). β-actin was chosen as the reference villous height to crypt depth ratio, and decreased crypt gene to normalize the mRNA concentration of the tar- depth in the jejunum of pigs (P < 0.05, Table 6). No get gene, which was calculated with the previous differences were observed for the villous height in the method [14]. jejunum between the two goups. Statistical analysis GLP-2 concentration and mRNA expression in jejunal Data were analyzed by T-test using the statistical pro- mucosa gram of SAS version 9.0 (SAS Inst. Inc., NC) where each As shown in Table 7, 5000 mg/kg benzoic acid supple- pig was the statistical unit. All differences were consid- mentation significantly increased the concentration and ered significant at P < 0.05 and P values between 0.05 mRNA expression of GLP-2 in the jejunal mucosa of and 0.10 were considered a trend. pigs (P < 0.05). Results Enzymes activities of SOD, GSH-PX and MDA Performance concentration When compared with the control group, 5000 mg/kg When compared with the control group, 5000 mg/kg benzoic acid supplementation significantly increased benzoic acid supplementation significantly increased the ADFI, ADG and final BW of pigs (Table 3, P < 0.05). activities of SOD and GSH-PX in the jejunal mucosa of However, no differences were observed among dietary pigs (P < 0.05, Table 8). There were no difference or the treatments in G/F. MDA concentration in the jejunal mucosa between the two groups. Apparent total tract digestibility As shown in Table 4, the ATTD of CP, DM, EE, GE and Discussion ash in pigs fed the benzoic acid diet was greater than Many studies have recently focused on alternatives to that in pigs fed the control diet (P < 0.05). antibiotics, and benzoic acid has been proposed as a feed additive for benefiting animal health. An in vitro study Digestive enzymes activities and pH values in jejunal has shown that benzoic acid had the strong antibacterial digesta action, which provided the basis to its application in ani- When compared with the control group, 5000 mg/kg mals [15]. Recent studies have shown that, 5000 mg/kg benzoic acid supplementation tended to decrease the pH benzoic acid supplementation improved the perform- value of the jejunal digesta of pigs (P < 0.10, Table 5), ance in weaned or nursery pigs [3, 4, 16–18], which is and significantly increased the activities of trypsin, lipase similar with this study (Table 3). The effect of benzoic and amylase in the jejunal digesta of pigs (P < 0.05). acid on the performance of pigs may be at least partly associated with an improvement of dietary pH and diet- Histological measurements ary buffering capacity [19], which can enhance the diet- When compared with the control group, 5000 mg/kg ary digestibility, increase the microbial diversity of the benzoic acid supplementation significantly increased the intestine [3], control the growth of pathogenic bacteria, Table 3 Effect of benzoic acid on growth performance in Table 4 Effect of benzoic acid on nutrient digestibility in young young pigs pigs Items Control Benzoic acid SEM P-value Items Control Benzoic acid SEM P-value b a Initial weight,kg 18.74 18.75 0.07 0.974 Crude protein 0.901 0.925 0.003 0.006 b a b a 14 d weight,kg 27.02 28.79 0.12 0.004 Dry matter 0.916 0.942 0.002 <0.001 b a b a Average daily gain,g 595 718 8.01 0.012 Ether extract 0.851 0.900 0.008 0.011 b a b a Average daily feed intake,g 1035 1190 12.22 0.005 Gross energy 0.918 0.945 0.002 <0.001 b a Feed: gain ratio 1.76 1.66 0.02 0.204 Ash 0.732 0.808 0.005 <0.001 Mean values with their standard errors, n =10 Mean values with their standard errors, n =10 a-b a-b Within a row, means with different superscripts differ (P < 0.05) Within a row, means with different superscripts differ (P < 0.05) Diao et al. Journal of Animal Science and Biotechnology (2016) 7:32 Page 5 of 7 Table 5 Effect of benzoic acid on pH values and digestive Table 7 Effect of benzoic acid on Glucagon-like peptide 2 con- enzyme activities in jejunum of young pigs centration and gene relative expression in the jejunal mucosa of young pigs Items Control Benzoic acid SEM P-value Items Control Benzoic SEM P-value pH 6.2 5.7 0.11 0.064 acid 3 b a Trypsin,U� 10 /mg protein 45.3 48.2 0.64 0.039 b a Glucagon-like peptide 2 4.12 6.66 0.17 <0.001 3 b a Lipase,U� 10 /g protein 2.7 2.9 0.32 0.028 concentration,pmol/L b a b a Amylase,U/mg protein 309.1 401.9 15.81 0.030 Glucagon-like peptide 2 1.00 1.63 0.04 0.011 gene relative expression Mean values with their standard errors, n =10 a-b Within a row, means with different superscripts differ (P < 0.05) Mean values with their standard errors, n =10 a-b Within a row, means with different superscripts differ (P < 0.05) and establish a proper balance between beneficial and pathogenic microbes in the gastrointestinal tract [16]. The jejunum is the key tissue for nutrient digestion, However, Kluge et al. reported that 5000 mg/kg benzoic absorption and transportation, and the function of diges- acid supplementation in the diet had no effect on the tion and transportation mainly depends on the villous in performance in weaned pigs, while 10,000 mg/kg ben- the jejunum [27]. Therefore, whether the mucosa struc- zoic acid supplementation significantly improved the ture state is adequate or not is related to nutrient diges- performance [5]. These different results of benzoic acid tion, absorption and growth of the animal. Halas et al. affecting the growth of pigs may be derived from the [17] demonstrated diet supplementation with 5000 mg/ benzoic acid purity in the different sources and manu- kg benzoic acid improved intestinal morphology (higher facturers, as well as the differences in the age and breed villous height and the villous height to crypt depth of pigs, the nutrient composition of the diet or the envir- ratio), and thus improved nutrient absorption and per- onmental conditions. formance of piglets, which was consistent with this Previous studies have shown that diet supplementation study. The reduction of crypt depth represents greater with a single acid or compound acidifiers could decrease mature epithelial cells, which results in stronger secre- pH values, and increase the activities of digestive en- tion function, and the higher villous height and villous zymes in the gastrointestinal tract [20–23]. In addition, height to crypt depth ratio indicates more favorable our previous studies have also shown that 5000 mg/kg mucosa structure and larger absorptive area of total benzoic acid supplementation could decrease pH value, luminal villous, which could result in adequate digestive and increased the activities of trypsin, lipase, amylase, enzyme development and better digestibility [12]. Our maltase, sucrase and lactase in the jejunal digesta of study showed benzoic acid improved mucosa structure weaned pig [7, 24], which was consistent with this study. state, along with bringing about superior nutrient diges- Therefore, it is possible that benzoic acid supplementa- tion and growth in pigs. Previous studies reported that tion increased the digestive ability of pigs. This study the improved morphology in digestive tract was related also showed that diet supplementation with 5000 mg/kg to a more acidic environment [28] and higher concentra- benzoic acid could enhance the ATTD of nutrients, tion of volatile fatty acids [16] and larger sucrase and which is consistent with the previous studies [16, 25]. lactase activities in the striated border [29], which could However, Galassi et al. [26] reported that 5000 mg/kg give rise to promoting cell growth and division through benzoic acid supplementation had no effect on the nutri- stabilizing DNA and repair damage [30], and these fac- ent ATTD in growing pigs (the last phase of growth). tors may contribute to the better morphology in the The different results could be due to the different jejunum brought about by benzoic acid. physiological stages of experimental pigs. Thus, it could GLP-2, a intestinal nutrition factor, could promote the be proposed that benzoic acid supplementation improv- protein synthesis, weight and villous height of the small ing the digestive ability of pigs would be weakened as intestine, increase nutrient digestion and absorption, and the pigs age. improve the barrier function and development of the Table 8 Effect of benzoic acid on enzyme activities of SOD, Table 6 Effect of benzoic acid on jejunal morphology in young GSH-px and concentration of MDA in jejunal mucosa of young pigs pigs Items Control Benzoic acid SEM P-value Items Control Benzoic acid SEM P-value b a Villus height,μm 178 198 4.15 0.394 Superoxide Dismutase,U/mL 29.07 70.43 5.73 0.011 b a b a Crypt depth,μm 162 129 3.16 0.046 Glutathione peroxidase,U/mg 83.08 345.97 22.88 0.049 b a Villus height:crypt depth 0.94 1.40 0.03 0.019 Malondialdehyde,μmol/L 1.71 1.52 0.09 0.322 Mean values with their standard errors, n =10 Mean values with their standard errors, n =10 a-b a-b Within a row, means with different superscripts differ (P < 0.05) Within a row, means with different superscripts differ (P < 0.05) Diao et al. Journal of Animal Science and Biotechnology (2016) 7:32 Page 6 of 7 intestine [31–33]. Its beneficial effect on the intestine design and helped to revise the manuscript. All of the authors read and approved the final version of this manuscript. could be due to the fact that GLP-2 may decrease the apoptosis of epithelial cells, increase cell proliferation in Competing interests intestinal mucosa, and promote the growth and regen- The authors declare that they have no competing interests. erative repair after injury of intestinal mucosa [31, 34]. However, in our study, 5000 mg/kg benzoic acid supple- Received: 12 December 2015 Accepted: 11 May 2016 mentation increased the GLP-2 concentration and relative gene expression in the jejunal mucosa, which verified that benzoic acid could improve the morphology of the References 1. Vondruskova H, Slamova R, Trckova M, Zraly Z, Pavlik I. Alternatives to jejunum via upregulating the GLP-2 concentration in the antibiotics as growth promoters for use in swine production: A review. intestine of pigs. Moreover, in our previous in vitro study J Anim Sci Biotechnol. 2013;4:35–47. doi:10.1186/2049-1891-4-35. on intestinal porcine epithelial cells (IPEC-1) we revealed 2. European Food Safety Authority EFSA. Opinion of the scientific panel on additives and products or substances used in animal feed on the safety a consistent result, which showed 10 μg/mL benzoic acid and efficacy of VevoVitall® (benzoic acid) as feed additive for pigs for promoted growth of the jejunum epithelial cells IPEC-1 fattening. EFSA J. 2007;457:1–14. and up-regulated the relative expression of GLP-2 3. Torrallardona D, Badiola I, Broz J. Effects of benzoic acid on performance and ecology of gastrointestinal microbiota in weanling piglets. Livest Sci. (unpublished). 2007;108:210–3. doi:10.1016/j.livsci.2007.01.062. In the normal physiological condition, the digestive 4. Guggenbuhl P, Séon A, Quintana AP, Nunes CS. Effects of dietary tract can produce reactive oxygen species (ROS) [35]. In supplementation with benzoic acid (VevoVitall®) on the zootechnical performance, the gastrointestinal microflora and the ileal digestibility of response to the injury of free radicals, there are two anti- the young pig. Livest Sci. 2007;108:218–21. doi:10.1016/j.livsci.2007.01.068. oxidant systems which existe in the body, namely, the 5. Kluge H, Broz J, Eder K. Effect of benzoic acid on growth performance, enzymatic and non-enzymatic antioxidant system, and nutrient digestibility, nitrogen balance, gastrointestinal microflora and parameters of microbial metabolism in piglets. J Anim Physiol Anim Nutr. enzymatic antioxidant system mainly consists of SOD 2006;90:316–24. doi:10.1111/j.1439-0396.2005.00604.x. 2− and GSH-px [36]. SOD can disproportionate O into 6. Graber T, Kluge H, Hirche F, Broz J, Stangl GI. Effects of dietary benzoic acid H O , and GSH-px can transform lipid hydroperoxide and sodium-benzoate on performance, nitrogen and mineral balance and 2 2 hippuric acid excretion of piglets. Arch Anim Nutr. 2012;66:227–36. doi:10. into alcohol and block lipid peroxidation reaction, which 1080/1745039X.2012.676812. could prevent ROS from reacting with protein, lipid, 7. Diao H, ZhengP,YuB,HeJ,Mao XB,YuJ,Chen DW. Effectsofdietary nucleic acid, carbohydrates or other molecules, and supplementation with benzoic acid on intestinal morphological structure and microflor in weaned piglets. Livest Sci. 2014;167:249–56. doi:10.1016/j. resist the denaturation of these molecules, and thus livsci.2014.05.029. decrease inflammation, apoptosis and maintain mucosal 8. Holmes E, Li JV, Marchesi JR, Nicholson JK. Gut microbiota composition integrity [36]. In this study, 5000 mg/kg benzoic acid and activity in relation to host metabolic phenotype and disease risk. Cell Metab. 2012;16:559–64. doi:10.1016/j.cmet.2012.10.007. supplementation increased the activities of SOD and 9. GB/T 23742. Measurement of the acid insoluble ash in feed. Beijing: GSH-PX in the jejunal mucosa of pigs, which could Standards Press of China; 2009. increase the antioxidant capacity, and then improve the 10. AOAC. Official Methods of Analysis. 16th ed. Washington, DC: Association of Official Analytical Chemists; 1995. morphology of the jejunum. However, there have been 11. Van Leeuwen P, Veldman A, Boisen S, Deuring K, Van Kempen GJM, no other reports relating to the effects of benzoic acid on Derksen GB, Verstegen MWA, Schaafsma G. Apparent ileal dry matter and antioxidant capacity in animals, and the mechanism re- crude protein digestibility of rations fed to pigs and determined with the use of chromic oxide (Cr O ) and acid-insoluble ash as digestive markers. 2 3 mains unclear, thus, further research is clearly warranted. Br J Nutr. 1996;76:551–62. doi:10.1079/BJN19960062. 12. Pluske J, Williams I, Aherne F. Maintenance of villous height and crypt depth in piglets by providing continuous nutrition after weaning. Anim Conclusion Sci. 1996;62:131–44. doi:10.1017/S1357729800014417. In conclusion, diet supplementation with 5000 mg/kg 13. Mao XB, Lai X, Yu B, He J, Yu J, Zheng P, Tian G, Zhang KY, Chen DW. benzoic acid improved the performance of young pigs at Effects of dietary threonine supplementation on immune challenge induced by swine Pseudorabies least partly through improving the nutrient digestion and live vaccine in weaned pigs. Arch Anim Nutr. 2014;68:1–15. doi:10.1080/ the jejunal morphology. Moreover, benzoic acid supple- 1745039X.2013.869988. mentation improved the intestinal function possibly via 14. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time − ΔΔCT quantitative PCR and the 2 method. Methods. 2001;25:402–8. doi:10.1006/ increasing the GLP-2 production and the antioxidant cap- meth.2001.1262. acity in the intestine of young pigs. 15. Knarreborg A, Miquel N, Granli T, Jensen B. Establishment and application of an in vitro methodology to study the effects of organic acids on coliform and Acknowledgements lactic acid bacteria in the proximal part of the gastrointestinal tract of piglets. This study was financially supported by a China Pig Modern Industrial Anim Feed Sci Technol. 2002;99:131–40. doi:10.1016/S0377-8401(02)00069-X. Technology System Grant (CARS-36). 16. Karlsson FH, Tremaroli V, Nookaew I, Bergstrom G, Behre CJ, Fagerberg B, Nielsen J, Bäckhed F. Gut metagenome in European women with normal, Authors’ contributions impaired and diabetic glucose control. Nature. 2013;498:99–103. doi:10. DWC and XBM conceived the study and designed the experiment. HD and 1038/nature12198. ZBG performed the experiments, including chemical analysis, analyzed the 17. Halas D, Hansen CF, Hampson D, Mullan B, Kim J, Wilson R, Pluske JR. experimental data, and wrote the manuscript. JY and BY verified the validity Dietary supplementation with benzoic acid improves apparent ileal of the experiment and checked the results. JH, ZQH, PZ participated in its digestibility of total nitrogen and increases villous height and caecal Diao et al. Journal of Animal Science and Biotechnology (2016) 7:32 Page 7 of 7 microbial diversity in weaner pigs. Anim Feed Sci Technol. 2010;160:137–47. doi:10.1016/j.anifeedsci.2010.07.001. 18. Papatsiros VG, Tassis PD, Tzika ED, Papaioannou DS, Petridou E, Alexopoulos C, Kyriakis SC. Effect of benzoic acid and combination of benzoic acid with a probiotic containing Bacillus cereus var. Toyoi in weaned pig nutrition. Pol J Vet Sci. 2011;14:117–25. doi:10.2478/v10181-011-0017-8. 19. Kirchgessner M, Roth F. Nutritive effects of organic acids in piglet rearing and pig fattening. Übersichten zur Tierernährung. 1988;16:93–108. 20. Kasprowicz-Potocka M, Frankiewicz A, Selwet M, Chilomer K. Effect of salts and organic acids on metabolite production and microbial parameters of piglets' digestive tract. Livest Sci. 2009;126:310–3. doi:10.1016/j.livsci.2009.06.011. 21. Partanen K, Jalava T, Valaja J. Effects of a dietary organic acid mixture and of dietary fibre levels on ileal and faecal nutrient apparent digestibility, bacterial nitrogen flow, microbial metabolite concentrations and rate of passage in the digestive tract of pigs. Animal. 2007;1:389–401. doi:10.1017/ S1751731107657838. 22. Risley C, Kornegay E, Lindemann M, Weakland S. Effects of organic acids with and without a microbial culture on performance and gastrointestinal tract measurements of weanling pigs. Anim Feed Sci Technol. 1991;35:259–70. doi:10.1016/0377-8401(91)90132-C. 23. JY Y. Effects of slow-release compound acidifiers on gastrointestinal pH and intestinal morphology and function in weaned piglets. Master Diss. Sichuan Agricultural University.,Ya'an Sichuan, P. R. China. 2009. 24. Diao H, Zheng P, Yu B, He J, Mao XB, Yu J, Chen DW. Effects of benzoic Acid and thymol on growth performance and gut characteristics of weaned piglets. Asian-Australas J Anim Sci. 2015;28:827–39. doi:10.5713/ajas.14.0704. 25. Bühler K, Bucher B, Wenk C, Broz J. Influence of benzoic acid in high fibre diets on nutrient digestibility and VFA production in growing/finishing pigs. Arch Anim Nutr. 2009;63:127–36. doi:10.1080/17450390902723927. 26. Galassi G, Malagutti L, Colombini S, Rapetti L, Crovetto GM. Effects of benzoic acid on nitrogen, phosphorus and energy balance and on ammonia emission from slurries in the heavy pig. Ital J Anim Sci. 2011;10:201–4. doi:10.4081/ijas.2011;10:e38. 27. Low A. Studies on digestion and absorption in the intestines of growing pigs. Brit J Nutr. 1979;41:147–56. doi:10.1079/BJN19790021. 28. Lupton J, Jacobs L. Fiber supplementation results in expanded proliferative zones in rat gastric mucosa. Am J Clin Nutr. 1987;46:980–4. 29. Hampson D, Kidder D. Influence of creep feeding and weaning on brush border enzyme activities in the piglet small intestine. Res Vet Sci. 1986;40:24–31. 30. Burns CP, Rozengurt E. Extracellular Na and initiation of DNA synthesis: Role of intracellular pH and K . J Cell Biol. 1984;98:1082–9. doi:10.1083/jcb. 98.3.1082. 31. Burrin D, Stoll B, Jiang R, Petersen Y, Elnif J, Buddington RK, Schmidt M, Holst JJ, Hartmann B, Sangild PT. GLP-2 stimulates intestinal growth in premature TPN-fed pigs by suppressing proteolysis and apoptosis. Am J Physiol Gastrointest Liver Physiol. 2000;279:1249–56. 32. Yu C, Jia G, Jiang Y, Deng Q, Chen Z, Xu Z, Chen X, Wang K. Effect of glucagon-like peptide 2 on tight junction in jejunal epithelium of weaned pigs though MAPK signaling pathway. Asian-Australas J Anim Sci. 2014;27:733–42. doi:10.5713/ajas.2013.13540. 33. Pedersen NB, Hjollund KR, Johnsen AH, Ørskov C, Rosenkilde MM, Hartmann B, Holst JJ. Porcine glucagon-like peptide-2: Structure, signaling, metabolism and effects. Regul Pept. 2008;146:310–20. doi:10.1016/j.regpep.2007.11.003. 34. Burrin D, Stoll B, Guan X. Glucagon-like peptide 2 function in domestic animals. Domest Anim Endocrinol. 2003;24:103–22. doi:10.1016/S0739-7240(02)00210-2. 35. Aruoma OI, Grootveld M, Bahorun T. Free radicals in biology and medicine: From inflammation to biotechnology. Biofactors. 2006;27:1–3. doi:10.1002/ biof.5520270101. Submit your next manuscript to BioMed Central 36. Jacob RA. The integrated antioxidant system. Nutr Res. 1995;15:755–66. and we will help you at every step: doi:10.1016/0271-5317(95)00041-G. • We accept pre-submission inquiries � Our selector tool helps you to find the most relevant journal � We provide round the clock customer support � Convenient online submission � Thorough peer review � Inclusion in PubMed and all major indexing services � Maximum visibility for your research Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Animal Science and Biotechnology Springer Journals

Effects of benzoic acid (VevoVitall®) on the performance and jejunal digestive physiology in young pigs

Download PDF
7 pages

Loading next page...
 
/lp/springer-journals/effects-of-benzoic-acid-vevovitall-on-the-performance-and-jejunal-AoFKzpYSKQ

References (43)

Publisher
Springer Journals
Copyright
Copyright © 2016 by Diao et al.
Subject
Life Sciences; Agriculture; Biotechnology; Food Science; Animal Genetics and Genomics; Animal Physiology
eISSN
2049-1891
DOI
10.1186/s40104-016-0091-y
pmid
27239300
Publisher site
See Article on Publisher Site

Abstract

Background: As a organic acid, benzoic acid has become one of the most important alternatives for antibiotics, and its beneficial effect on performance in animals has been proven for a decade. However, knowledge of the effects of benzoic acid on jejunal digestive physiology, especially the antioxidant capacity and mucosal glucagon-like peptide 2 (GLP-2) concentrations is lacking. Methods: A total of 20 barrows [Duroc × (Yorkshire × Landrace)] with an average body weight (BW) of 18.75 ± 0.2 kg were used in a 14-d trial to determine the potential mechanisms of benzoic acid supplementation on the performance, nutrient digestibility and jejunal digestive physiology in young pigs. All pigs were randomly allotted to 1 of 2 diets supplemented with 0 or 5000 mg/kg benzoic acid. Results: Relative to the control, benzoic acid supplementation increased the average daily feed intake (ADFI), and average daily gain (ADG) in young pigs (P < 0.05), improved the apparent total tract digestibility of dry matter (DM), crude protein (CP), ether extract (EE), gross energy (GE) and crude ash (P < 0.05), and enhanced the activities of trypsin, lipase and amylase in the jejunum (P < 0.05). Similarly, relative to the control, supplementing benzoic acid in the diet resulted in a trend to reduce the pH values of the digesta (P = 0.06), decreased crypt depth and increased the villus height to crypt depth ratio (P < 0.05) in the jejunum of pigs. Finally, benzoic acid supplementation increased the mRNA expression and concentration of glucagon-like peptide 2 and the activities of glutathione peroxidase and superoxide dismutase in the jejunal mucosa of young pigs (P <0.05). Conclusions: In conclusion, supplementation with 5000 mg/kg benzoic acid improved the performance of young pigs through promoting nutrient digestion, improving jejunal antioxidant capacity, and maintaining the jejunal morphology in young pigs. Keywords: Benzoic acid, Glucagon-like peptide 2, Nutrient digestibility, Performance, Young pigs Background antimicrobial properties and forms colourless to white To overcome the negative effect on pig production brought crystals, and was authorized to be used for the preservation by the ban of antibiotics in Europe, using different alterna- of various foodstuffs and feed of growing pigs at the dose tives, such as organic acids and essential oils, has been of 0.5 to 1.0 % by the European Union in 2003 [2]. recommended as one of the effective methods to help Previous studies have shown that benzoic acid can improve the performance and decrease the incidence of improve the performance and nutrient digestibility, diarrhea in pigs [1]. As the simplest of the aromatic inhibit pathogenic microorganisms, and maintain the carboxylic acids, benzoic acid has broad-spectrum balance of microflora [3–7]. However, there is little avail- able information on the systematic mechanisms through which benzoic acid promotes pig performance, especially * Correspondence: dwchen@sicau.edu.cn; acatmxb2003@163.com the effect of benzoic acid on the antioxidant capacity and Equal contributors Animal Nutrition Institute, Sichuan Agricultural University, Xinkang Road 46#, mucosal glucagon-like peptide 2 (GLP-2) concentrations Ya’an, Sichuan Province 625014, People’s Republic of China © 2016 Diao et al. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Diao et al. Journal of Animal Science and Biotechnology (2016) 7:32 Page 2 of 7 in the jejunum of pigs. Thus, the objective of this study On d 15, following weighing, all the pigs were killed was to evaluate the effects of benzoic acid on the per- with an intravenous injection of chlorpromazine hydro- formance, nutrient digestibility, pH values, activities of chloride (Shanghai Harvest Pharmaceutical Co. Ltd. digestive enzymes, mucosal morphology, GLP-2 con- China, 150 mg/kg body weight) and jugular exsanguina- centration and antioxidant capacity in the jejunal tions. Then, the mid-jejunum (2 cm) was immediately mucosa of young pigs, which could help us further isolated, washed and preserved in 10 % formalin solution understand the mechanism through which benzoic acid for histological analysis. This was followed by measuring improves pig performance, and provide the scientific the pH of the jejunal digesta with a pH meter (PHS-3C basis for using benzoic acid in practice. pH, Shanghai, China). The jejunal mucosa were collected by scraping the intestinal wall with a glass microscope Methods slide, immediately frozen in liquid nitrogen, and stored The experimental protocol used in this study was approved at -80 °C until the analysis of the antioxidant capacity, by the Animal Care and Use Committee of Sichuan GLP-2 concentration and quantitative real-time PCR. Agricultural University (Ya’an, China). Benzoic acid Additionally, the jejunal digesta was collected, and (VevoVitall) was provided by DSM (China) Limited stored at -80 °C for measuring the activities of the (Shanghai, China). digestive enzymes. Experimental design, animals and diet Apparent total tract digestibility A total of 20 healthy DLY [Duroc × (Yorkshire × The ATTD was measured using AIA as a digestibility indi- Landrace)] young pigs with an initial average BW of 18.75 ± cator. AIA in diets and fecal samples were determined by 0.20 kg were randomly allotted to 1 of 2 diets including a a method described by the Chinese National Standard control and a diet supplemented with 5000 mg/kg benzoic (GB/T 23742) [9]. All diets and fecal samples were ana- acid for 14 days During d 11-14, the apparent total tract lyzed for DM (method 930.15, AOAC, 1995), ash (method digestibility (ATTD) of nutrients was measured using the 942.05, AOAC, 1995), EE (method 945.16, AOAC, 1995), acid insoluble ash (AIA) as an endogenous indicator. All Ca (method 927.02, AOAC, 1995), P (method 995.11, pigs were placed individually in metabolism cages (1.5 m × AOAC, 1995), CP (method 990.03, AOAC, 1995) [10] and 0.7 m × 1.0 m) with a self-feeder and a nipple watering de- GE. The GE concentration was determined using bomb vice, which were located in a temperature (25 ± 1 °C) and calorimetry (Parr Instrument 1563, Moline IL). The relative humidity (60 ± 5 %)-controlled room. The pigs content of benzoic acid in the diets was measured by had free access to feed and drinking water. The lighting DSM (China) Limited (Shanghai, China) using high- was natural. Individual BW was recorded after all pigs performance liquid chromatography. The digestibility of were food-deprived for 12 h on d 1 and 15, and feed con- chemical constituents was calculated as (100 – A1/A2 x sumption was recorded as the amount of feed offered F2/F1 x 100), where A1 represents the AIA content of the daily minus the remaining quantity in the next morning diet; A2 represents the AIA content of the feces; F1 repre- during the experiment, which were used to determine the sents the nutrient content of the diet; F2 represents the average weight gain (ADG), average daily feed intake nutrient content of the feces [11]. (ADFI) and ratio of feed to gain (F/G). The diets were formulated to meet or exceed the Histological measurements National Research Council recommended nutrient re- The measurements of the villous height and crypt depth quirements for pigs weighing 10-20 kg (NRC, 2012) [8]. were conducted as described by Pluske et al [12]. Briefly, Ingredients and composition of the diets is presented in the ring-shaped histological sections of the jejunum were Table 1. The experimental diet was formulated using excised, dehydrated, and embedded in paraffin wax benzoic acid to substitute for maize in the basal diet. No before 4 transverse sections (5 μm) were cut, and then antibiotics were used in any diet. installed on glass slides and stained with haematoxylin and eosin. The height of 10 well orientated villi and their Sampling and measurements adjoined crypts were measured at 40 × magnification Experimental diets were sampled and stored at -20 °C with an Olympus CK 40 Microscope (Olympus Optical until analyzed for dry matter (DM), crude protein (CP), Company, Guangzhou, China). ether extract (EE), gross energy (GE) and crude ash. After each collection of feces, 10 % hydrochloric acid Digestive enzymes activities, antioxidant capacity and was added to fix excreta nitrogen. Feces collected on d GLP-2 concentration 11-14 of each replicate were dried in a forced air oven The activities of digestive enzymes (trypsin, lipase and (60 °C) for 72 h, and ground through a 1-mm screen amylase) in frozen jejunal digesta, the activities of super- before chemical analysis. oxide dismutase (SOD) and glutathione peroxidase Diao et al. Journal of Animal Science and Biotechnology (2016) 7:32 Page 3 of 7 Table 1 Ingredients and nutrient compositions of basal diet, air dry basis,% Ingredients,% Calculated Composition,% Analyzed Composition,% Maize 57.88 DE,MJ/kg 14.37 Control diet Dehulled soybean meal 22.00 Available phosphorus 0.41 Crude protein 18.32 Fish meal 5.00 Arg 1.20 Calcium 0.86 Soybean oil 1.50 Cys 0.32 Total phosphorus 0.62 Whey powder 6.00 His 0.49 Ether extract 0.73 Sugar 2.00 Ile 0.80 Gross energy,kcal/g 4.17 Glucose 3.00 Leu 1.65 Benzoic acid,mg/kg 0 L-Lys-HCl,78 % 0.24 Lys 1.31 Benzoic acid diet DL-Met,99 % 0.10 Met 0.45 Crude protein 18.36 Trp,98 % 0.02 Met + Cys 0.77 Calcium 0.83 Thr,98.5 % 0.07 Phe 0.91 Total phosphorus 0.59 Choline Chloride 0.10 Thr 0.84 Ether extract 0.72 Calcium carbonat 0.90 Trp 0.25 Gross energy,kcal/g 4.19 Dicalcium phosphate 0.40 Na 0.24 Benzoic acid,mg/kg 5036 Nacl 0.15 Vitamin Complex 0.04 Mineral Complex 0.30 Phytase 0.10 The premix provides following per kg diet: Vitamin A 6000 IU; Vitamin D 400 IUg; Vitamin E 10 IU; Vitamin K 3 mg; Vitamin B 3 mg; Vitamin B 6 mg; Vitamin 3 3 1 2 B 3 mg; Vitamin B 24 μg; folic acid 1.2 mg; nicotinic acid 14 mg; biotin 150 mg; D-pantothenic acid 15 mg 6 12 The premix provides following per kg diet: Fe (as ferrous sulfate) 100 mg, Cu (as copper sulfate) 6 mg, Mn 40 mg, Zn (as zinc sulfate) 80 mg, I 0.3 mg, Se 0.3 mg (GSH-px) and the methane dicarboxylic aldehyde (MDA) Company, Dalian, China) according to the manufac- concentration in the jejunal mucosa were determined turer’s instructions. using commercial kits obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) combined with Real-time quantitative PCR a UV-VIS Spectrophotometer (UV1100, MAPADA, Real-time quantitative PCR was carried out using the Shanghai, China) according to the manufacturer’s CFX96 Real-Time PCR Detection System (Bio-Rad instructions. Laboratories, Richmond, CA), as described by Mao et al. The GLP-2 concentration of the jejunal mucosa was (2014) [13]. Briefly, the gene-specific primers used in the determined using a commercially available pig Enzyme- present study were synthesised commercially by Invitro- linked Immunosorbent Assay Kit from R&D system gen (Shanghai, China), which are listed in Table 2. The (Minneapolis, MN) according to the manufacturer’s PCR system was composed of 5 μL 2 × SYBR Premix Ex instructions. The GLP-2 concentration was quantified Taq (Biotechnology Company, Dalian, China), 0.5 μLof using a BioTek Synergy HT microplate reader (BioTek forward and 0.5 μL of reverse primers (100 nmol/L), Instruments, Winooski, VT), and absorbance was mea- 3 μL diethylpyrocarbonate-treated water and 1 μL sured at 450 nm. cDNA. Cycling conditions were as follows: 95 °C for 10 s, followed by forty cycles of 95 °C for 5 s, annealing Total RNA extraction and reverse transcription reaction at 62 °C for 10 s and 72 °C for 15 s. The melting curve Total RNA was isolated from the frozen jejuna mucosa conditions were 95 °C for 30 s, 55 °C for 1 min and 95 ° (one sample per replicate) using the TRIzol reagent (Bio- C for 1 min, which was carried out after each real-time technology Company, Dalian, China) according to the quantitative PCR to check and verify the specificity and manufacturer’s protocol. The concentration and purity purity of all PCR products. Each sample was run simul- of total RNA were analysed on a spectrophotometer taneously in triplicate on the same PCR plate, and the (Beckman Colter DU 800, Beckman Coulter Inc, Brea, average of each triplicate value expressed as the number USA), and the optical density 260:280 (OD260:OD280) of copies was used for the statistical analysis. A standard ranged from 1.8 to 2.0 for all the samples. The synthesis curve was established using serial dilutions of one of the of the first strand of cDNA of each sample was obtained complementary DNA samples, which could be used for by reverse transcription by RT Reagents (Biotechnology obtaining reliable amplification efficiency values (ranged Diao et al. Journal of Animal Science and Biotechnology (2016) 7:32 Page 4 of 7 Table 2 Primes for real time PCR Target gene Forward primer 5’-3’ Reverse primer 5’-3’ Accession number GLP-2 TGTAATGCTGGTACAAGGCAG CTTGTCTTCAGTCATCTGATC NM_214324.1 β-actin TCTGGCACCACACCTTCT TGATCTGGGTCATCTTCTCAC DQ178122 from 90 to 110 %). β-actin was chosen as the reference villous height to crypt depth ratio, and decreased crypt gene to normalize the mRNA concentration of the tar- depth in the jejunum of pigs (P < 0.05, Table 6). No get gene, which was calculated with the previous differences were observed for the villous height in the method [14]. jejunum between the two goups. Statistical analysis GLP-2 concentration and mRNA expression in jejunal Data were analyzed by T-test using the statistical pro- mucosa gram of SAS version 9.0 (SAS Inst. Inc., NC) where each As shown in Table 7, 5000 mg/kg benzoic acid supple- pig was the statistical unit. All differences were consid- mentation significantly increased the concentration and ered significant at P < 0.05 and P values between 0.05 mRNA expression of GLP-2 in the jejunal mucosa of and 0.10 were considered a trend. pigs (P < 0.05). Results Enzymes activities of SOD, GSH-PX and MDA Performance concentration When compared with the control group, 5000 mg/kg When compared with the control group, 5000 mg/kg benzoic acid supplementation significantly increased benzoic acid supplementation significantly increased the ADFI, ADG and final BW of pigs (Table 3, P < 0.05). activities of SOD and GSH-PX in the jejunal mucosa of However, no differences were observed among dietary pigs (P < 0.05, Table 8). There were no difference or the treatments in G/F. MDA concentration in the jejunal mucosa between the two groups. Apparent total tract digestibility As shown in Table 4, the ATTD of CP, DM, EE, GE and Discussion ash in pigs fed the benzoic acid diet was greater than Many studies have recently focused on alternatives to that in pigs fed the control diet (P < 0.05). antibiotics, and benzoic acid has been proposed as a feed additive for benefiting animal health. An in vitro study Digestive enzymes activities and pH values in jejunal has shown that benzoic acid had the strong antibacterial digesta action, which provided the basis to its application in ani- When compared with the control group, 5000 mg/kg mals [15]. Recent studies have shown that, 5000 mg/kg benzoic acid supplementation tended to decrease the pH benzoic acid supplementation improved the perform- value of the jejunal digesta of pigs (P < 0.10, Table 5), ance in weaned or nursery pigs [3, 4, 16–18], which is and significantly increased the activities of trypsin, lipase similar with this study (Table 3). The effect of benzoic and amylase in the jejunal digesta of pigs (P < 0.05). acid on the performance of pigs may be at least partly associated with an improvement of dietary pH and diet- Histological measurements ary buffering capacity [19], which can enhance the diet- When compared with the control group, 5000 mg/kg ary digestibility, increase the microbial diversity of the benzoic acid supplementation significantly increased the intestine [3], control the growth of pathogenic bacteria, Table 3 Effect of benzoic acid on growth performance in Table 4 Effect of benzoic acid on nutrient digestibility in young young pigs pigs Items Control Benzoic acid SEM P-value Items Control Benzoic acid SEM P-value b a Initial weight,kg 18.74 18.75 0.07 0.974 Crude protein 0.901 0.925 0.003 0.006 b a b a 14 d weight,kg 27.02 28.79 0.12 0.004 Dry matter 0.916 0.942 0.002 <0.001 b a b a Average daily gain,g 595 718 8.01 0.012 Ether extract 0.851 0.900 0.008 0.011 b a b a Average daily feed intake,g 1035 1190 12.22 0.005 Gross energy 0.918 0.945 0.002 <0.001 b a Feed: gain ratio 1.76 1.66 0.02 0.204 Ash 0.732 0.808 0.005 <0.001 Mean values with their standard errors, n =10 Mean values with their standard errors, n =10 a-b a-b Within a row, means with different superscripts differ (P < 0.05) Within a row, means with different superscripts differ (P < 0.05) Diao et al. Journal of Animal Science and Biotechnology (2016) 7:32 Page 5 of 7 Table 5 Effect of benzoic acid on pH values and digestive Table 7 Effect of benzoic acid on Glucagon-like peptide 2 con- enzyme activities in jejunum of young pigs centration and gene relative expression in the jejunal mucosa of young pigs Items Control Benzoic acid SEM P-value Items Control Benzoic SEM P-value pH 6.2 5.7 0.11 0.064 acid 3 b a Trypsin,U� 10 /mg protein 45.3 48.2 0.64 0.039 b a Glucagon-like peptide 2 4.12 6.66 0.17 <0.001 3 b a Lipase,U� 10 /g protein 2.7 2.9 0.32 0.028 concentration,pmol/L b a b a Amylase,U/mg protein 309.1 401.9 15.81 0.030 Glucagon-like peptide 2 1.00 1.63 0.04 0.011 gene relative expression Mean values with their standard errors, n =10 a-b Within a row, means with different superscripts differ (P < 0.05) Mean values with their standard errors, n =10 a-b Within a row, means with different superscripts differ (P < 0.05) and establish a proper balance between beneficial and pathogenic microbes in the gastrointestinal tract [16]. The jejunum is the key tissue for nutrient digestion, However, Kluge et al. reported that 5000 mg/kg benzoic absorption and transportation, and the function of diges- acid supplementation in the diet had no effect on the tion and transportation mainly depends on the villous in performance in weaned pigs, while 10,000 mg/kg ben- the jejunum [27]. Therefore, whether the mucosa struc- zoic acid supplementation significantly improved the ture state is adequate or not is related to nutrient diges- performance [5]. These different results of benzoic acid tion, absorption and growth of the animal. Halas et al. affecting the growth of pigs may be derived from the [17] demonstrated diet supplementation with 5000 mg/ benzoic acid purity in the different sources and manu- kg benzoic acid improved intestinal morphology (higher facturers, as well as the differences in the age and breed villous height and the villous height to crypt depth of pigs, the nutrient composition of the diet or the envir- ratio), and thus improved nutrient absorption and per- onmental conditions. formance of piglets, which was consistent with this Previous studies have shown that diet supplementation study. The reduction of crypt depth represents greater with a single acid or compound acidifiers could decrease mature epithelial cells, which results in stronger secre- pH values, and increase the activities of digestive en- tion function, and the higher villous height and villous zymes in the gastrointestinal tract [20–23]. In addition, height to crypt depth ratio indicates more favorable our previous studies have also shown that 5000 mg/kg mucosa structure and larger absorptive area of total benzoic acid supplementation could decrease pH value, luminal villous, which could result in adequate digestive and increased the activities of trypsin, lipase, amylase, enzyme development and better digestibility [12]. Our maltase, sucrase and lactase in the jejunal digesta of study showed benzoic acid improved mucosa structure weaned pig [7, 24], which was consistent with this study. state, along with bringing about superior nutrient diges- Therefore, it is possible that benzoic acid supplementa- tion and growth in pigs. Previous studies reported that tion increased the digestive ability of pigs. This study the improved morphology in digestive tract was related also showed that diet supplementation with 5000 mg/kg to a more acidic environment [28] and higher concentra- benzoic acid could enhance the ATTD of nutrients, tion of volatile fatty acids [16] and larger sucrase and which is consistent with the previous studies [16, 25]. lactase activities in the striated border [29], which could However, Galassi et al. [26] reported that 5000 mg/kg give rise to promoting cell growth and division through benzoic acid supplementation had no effect on the nutri- stabilizing DNA and repair damage [30], and these fac- ent ATTD in growing pigs (the last phase of growth). tors may contribute to the better morphology in the The different results could be due to the different jejunum brought about by benzoic acid. physiological stages of experimental pigs. Thus, it could GLP-2, a intestinal nutrition factor, could promote the be proposed that benzoic acid supplementation improv- protein synthesis, weight and villous height of the small ing the digestive ability of pigs would be weakened as intestine, increase nutrient digestion and absorption, and the pigs age. improve the barrier function and development of the Table 8 Effect of benzoic acid on enzyme activities of SOD, Table 6 Effect of benzoic acid on jejunal morphology in young GSH-px and concentration of MDA in jejunal mucosa of young pigs pigs Items Control Benzoic acid SEM P-value Items Control Benzoic acid SEM P-value b a Villus height,μm 178 198 4.15 0.394 Superoxide Dismutase,U/mL 29.07 70.43 5.73 0.011 b a b a Crypt depth,μm 162 129 3.16 0.046 Glutathione peroxidase,U/mg 83.08 345.97 22.88 0.049 b a Villus height:crypt depth 0.94 1.40 0.03 0.019 Malondialdehyde,μmol/L 1.71 1.52 0.09 0.322 Mean values with their standard errors, n =10 Mean values with their standard errors, n =10 a-b a-b Within a row, means with different superscripts differ (P < 0.05) Within a row, means with different superscripts differ (P < 0.05) Diao et al. Journal of Animal Science and Biotechnology (2016) 7:32 Page 6 of 7 intestine [31–33]. Its beneficial effect on the intestine design and helped to revise the manuscript. All of the authors read and approved the final version of this manuscript. could be due to the fact that GLP-2 may decrease the apoptosis of epithelial cells, increase cell proliferation in Competing interests intestinal mucosa, and promote the growth and regen- The authors declare that they have no competing interests. erative repair after injury of intestinal mucosa [31, 34]. However, in our study, 5000 mg/kg benzoic acid supple- Received: 12 December 2015 Accepted: 11 May 2016 mentation increased the GLP-2 concentration and relative gene expression in the jejunal mucosa, which verified that benzoic acid could improve the morphology of the References 1. Vondruskova H, Slamova R, Trckova M, Zraly Z, Pavlik I. Alternatives to jejunum via upregulating the GLP-2 concentration in the antibiotics as growth promoters for use in swine production: A review. intestine of pigs. Moreover, in our previous in vitro study J Anim Sci Biotechnol. 2013;4:35–47. doi:10.1186/2049-1891-4-35. on intestinal porcine epithelial cells (IPEC-1) we revealed 2. European Food Safety Authority EFSA. Opinion of the scientific panel on additives and products or substances used in animal feed on the safety a consistent result, which showed 10 μg/mL benzoic acid and efficacy of VevoVitall® (benzoic acid) as feed additive for pigs for promoted growth of the jejunum epithelial cells IPEC-1 fattening. EFSA J. 2007;457:1–14. and up-regulated the relative expression of GLP-2 3. Torrallardona D, Badiola I, Broz J. Effects of benzoic acid on performance and ecology of gastrointestinal microbiota in weanling piglets. Livest Sci. (unpublished). 2007;108:210–3. doi:10.1016/j.livsci.2007.01.062. In the normal physiological condition, the digestive 4. Guggenbuhl P, Séon A, Quintana AP, Nunes CS. Effects of dietary tract can produce reactive oxygen species (ROS) [35]. In supplementation with benzoic acid (VevoVitall®) on the zootechnical performance, the gastrointestinal microflora and the ileal digestibility of response to the injury of free radicals, there are two anti- the young pig. Livest Sci. 2007;108:218–21. doi:10.1016/j.livsci.2007.01.068. oxidant systems which existe in the body, namely, the 5. Kluge H, Broz J, Eder K. Effect of benzoic acid on growth performance, enzymatic and non-enzymatic antioxidant system, and nutrient digestibility, nitrogen balance, gastrointestinal microflora and parameters of microbial metabolism in piglets. J Anim Physiol Anim Nutr. enzymatic antioxidant system mainly consists of SOD 2006;90:316–24. doi:10.1111/j.1439-0396.2005.00604.x. 2− and GSH-px [36]. SOD can disproportionate O into 6. Graber T, Kluge H, Hirche F, Broz J, Stangl GI. Effects of dietary benzoic acid H O , and GSH-px can transform lipid hydroperoxide and sodium-benzoate on performance, nitrogen and mineral balance and 2 2 hippuric acid excretion of piglets. Arch Anim Nutr. 2012;66:227–36. doi:10. into alcohol and block lipid peroxidation reaction, which 1080/1745039X.2012.676812. could prevent ROS from reacting with protein, lipid, 7. Diao H, ZhengP,YuB,HeJ,Mao XB,YuJ,Chen DW. Effectsofdietary nucleic acid, carbohydrates or other molecules, and supplementation with benzoic acid on intestinal morphological structure and microflor in weaned piglets. Livest Sci. 2014;167:249–56. doi:10.1016/j. resist the denaturation of these molecules, and thus livsci.2014.05.029. decrease inflammation, apoptosis and maintain mucosal 8. Holmes E, Li JV, Marchesi JR, Nicholson JK. Gut microbiota composition integrity [36]. In this study, 5000 mg/kg benzoic acid and activity in relation to host metabolic phenotype and disease risk. Cell Metab. 2012;16:559–64. doi:10.1016/j.cmet.2012.10.007. supplementation increased the activities of SOD and 9. GB/T 23742. Measurement of the acid insoluble ash in feed. Beijing: GSH-PX in the jejunal mucosa of pigs, which could Standards Press of China; 2009. increase the antioxidant capacity, and then improve the 10. AOAC. Official Methods of Analysis. 16th ed. Washington, DC: Association of Official Analytical Chemists; 1995. morphology of the jejunum. However, there have been 11. Van Leeuwen P, Veldman A, Boisen S, Deuring K, Van Kempen GJM, no other reports relating to the effects of benzoic acid on Derksen GB, Verstegen MWA, Schaafsma G. Apparent ileal dry matter and antioxidant capacity in animals, and the mechanism re- crude protein digestibility of rations fed to pigs and determined with the use of chromic oxide (Cr O ) and acid-insoluble ash as digestive markers. 2 3 mains unclear, thus, further research is clearly warranted. Br J Nutr. 1996;76:551–62. doi:10.1079/BJN19960062. 12. Pluske J, Williams I, Aherne F. Maintenance of villous height and crypt depth in piglets by providing continuous nutrition after weaning. Anim Conclusion Sci. 1996;62:131–44. doi:10.1017/S1357729800014417. In conclusion, diet supplementation with 5000 mg/kg 13. Mao XB, Lai X, Yu B, He J, Yu J, Zheng P, Tian G, Zhang KY, Chen DW. benzoic acid improved the performance of young pigs at Effects of dietary threonine supplementation on immune challenge induced by swine Pseudorabies least partly through improving the nutrient digestion and live vaccine in weaned pigs. Arch Anim Nutr. 2014;68:1–15. doi:10.1080/ the jejunal morphology. Moreover, benzoic acid supple- 1745039X.2013.869988. mentation improved the intestinal function possibly via 14. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time − ΔΔCT quantitative PCR and the 2 method. Methods. 2001;25:402–8. doi:10.1006/ increasing the GLP-2 production and the antioxidant cap- meth.2001.1262. acity in the intestine of young pigs. 15. Knarreborg A, Miquel N, Granli T, Jensen B. Establishment and application of an in vitro methodology to study the effects of organic acids on coliform and Acknowledgements lactic acid bacteria in the proximal part of the gastrointestinal tract of piglets. This study was financially supported by a China Pig Modern Industrial Anim Feed Sci Technol. 2002;99:131–40. doi:10.1016/S0377-8401(02)00069-X. Technology System Grant (CARS-36). 16. Karlsson FH, Tremaroli V, Nookaew I, Bergstrom G, Behre CJ, Fagerberg B, Nielsen J, Bäckhed F. Gut metagenome in European women with normal, Authors’ contributions impaired and diabetic glucose control. Nature. 2013;498:99–103. doi:10. DWC and XBM conceived the study and designed the experiment. HD and 1038/nature12198. ZBG performed the experiments, including chemical analysis, analyzed the 17. Halas D, Hansen CF, Hampson D, Mullan B, Kim J, Wilson R, Pluske JR. experimental data, and wrote the manuscript. JY and BY verified the validity Dietary supplementation with benzoic acid improves apparent ileal of the experiment and checked the results. JH, ZQH, PZ participated in its digestibility of total nitrogen and increases villous height and caecal Diao et al. Journal of Animal Science and Biotechnology (2016) 7:32 Page 7 of 7 microbial diversity in weaner pigs. Anim Feed Sci Technol. 2010;160:137–47. doi:10.1016/j.anifeedsci.2010.07.001. 18. Papatsiros VG, Tassis PD, Tzika ED, Papaioannou DS, Petridou E, Alexopoulos C, Kyriakis SC. Effect of benzoic acid and combination of benzoic acid with a probiotic containing Bacillus cereus var. Toyoi in weaned pig nutrition. Pol J Vet Sci. 2011;14:117–25. doi:10.2478/v10181-011-0017-8. 19. Kirchgessner M, Roth F. Nutritive effects of organic acids in piglet rearing and pig fattening. Übersichten zur Tierernährung. 1988;16:93–108. 20. Kasprowicz-Potocka M, Frankiewicz A, Selwet M, Chilomer K. Effect of salts and organic acids on metabolite production and microbial parameters of piglets' digestive tract. Livest Sci. 2009;126:310–3. doi:10.1016/j.livsci.2009.06.011. 21. Partanen K, Jalava T, Valaja J. Effects of a dietary organic acid mixture and of dietary fibre levels on ileal and faecal nutrient apparent digestibility, bacterial nitrogen flow, microbial metabolite concentrations and rate of passage in the digestive tract of pigs. Animal. 2007;1:389–401. doi:10.1017/ S1751731107657838. 22. Risley C, Kornegay E, Lindemann M, Weakland S. Effects of organic acids with and without a microbial culture on performance and gastrointestinal tract measurements of weanling pigs. Anim Feed Sci Technol. 1991;35:259–70. doi:10.1016/0377-8401(91)90132-C. 23. JY Y. Effects of slow-release compound acidifiers on gastrointestinal pH and intestinal morphology and function in weaned piglets. Master Diss. Sichuan Agricultural University.,Ya'an Sichuan, P. R. China. 2009. 24. Diao H, Zheng P, Yu B, He J, Mao XB, Yu J, Chen DW. Effects of benzoic Acid and thymol on growth performance and gut characteristics of weaned piglets. Asian-Australas J Anim Sci. 2015;28:827–39. doi:10.5713/ajas.14.0704. 25. Bühler K, Bucher B, Wenk C, Broz J. Influence of benzoic acid in high fibre diets on nutrient digestibility and VFA production in growing/finishing pigs. Arch Anim Nutr. 2009;63:127–36. doi:10.1080/17450390902723927. 26. Galassi G, Malagutti L, Colombini S, Rapetti L, Crovetto GM. Effects of benzoic acid on nitrogen, phosphorus and energy balance and on ammonia emission from slurries in the heavy pig. Ital J Anim Sci. 2011;10:201–4. doi:10.4081/ijas.2011;10:e38. 27. Low A. Studies on digestion and absorption in the intestines of growing pigs. Brit J Nutr. 1979;41:147–56. doi:10.1079/BJN19790021. 28. Lupton J, Jacobs L. Fiber supplementation results in expanded proliferative zones in rat gastric mucosa. Am J Clin Nutr. 1987;46:980–4. 29. Hampson D, Kidder D. Influence of creep feeding and weaning on brush border enzyme activities in the piglet small intestine. Res Vet Sci. 1986;40:24–31. 30. Burns CP, Rozengurt E. Extracellular Na and initiation of DNA synthesis: Role of intracellular pH and K . J Cell Biol. 1984;98:1082–9. doi:10.1083/jcb. 98.3.1082. 31. Burrin D, Stoll B, Jiang R, Petersen Y, Elnif J, Buddington RK, Schmidt M, Holst JJ, Hartmann B, Sangild PT. GLP-2 stimulates intestinal growth in premature TPN-fed pigs by suppressing proteolysis and apoptosis. Am J Physiol Gastrointest Liver Physiol. 2000;279:1249–56. 32. Yu C, Jia G, Jiang Y, Deng Q, Chen Z, Xu Z, Chen X, Wang K. Effect of glucagon-like peptide 2 on tight junction in jejunal epithelium of weaned pigs though MAPK signaling pathway. Asian-Australas J Anim Sci. 2014;27:733–42. doi:10.5713/ajas.2013.13540. 33. Pedersen NB, Hjollund KR, Johnsen AH, Ørskov C, Rosenkilde MM, Hartmann B, Holst JJ. Porcine glucagon-like peptide-2: Structure, signaling, metabolism and effects. Regul Pept. 2008;146:310–20. doi:10.1016/j.regpep.2007.11.003. 34. Burrin D, Stoll B, Guan X. Glucagon-like peptide 2 function in domestic animals. Domest Anim Endocrinol. 2003;24:103–22. doi:10.1016/S0739-7240(02)00210-2. 35. Aruoma OI, Grootveld M, Bahorun T. Free radicals in biology and medicine: From inflammation to biotechnology. Biofactors. 2006;27:1–3. doi:10.1002/ biof.5520270101. Submit your next manuscript to BioMed Central 36. Jacob RA. The integrated antioxidant system. Nutr Res. 1995;15:755–66. and we will help you at every step: doi:10.1016/0271-5317(95)00041-G. • We accept pre-submission inquiries � Our selector tool helps you to find the most relevant journal � We provide round the clock customer support � Convenient online submission � Thorough peer review � Inclusion in PubMed and all major indexing services � Maximum visibility for your research Submit your manuscript at www.biomedcentral.com/submit

Journal

Journal of Animal Science and Biotechnology – Springer Journals

Published: May 28, 2016

There are no references for this article.