Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Evidence for association between Disrupted-in-schizophrenia 1 (DISC1) gene polymorphisms and autism in Chinese Han population: a family-based association study

Evidence for association between Disrupted-in-schizophrenia 1 (DISC1) gene polymorphisms and... Background: Disrupted-in-Schizophrenia 1 (DISC1) gene is one of the most promising candidate genes for major mental disorders. In a previous study, a Finnish group demonstrated that DISC1 polymorphisms were associated with autism and Asperger syndrome. However, the results were not replicated in Korean population. To determine whether DISC1 is associated with autism in Chinese Han population, we performed a family-based association study between DISC1 polymorphisms and autism. Methods: We genotyped seven tag single nucleotide polymorphisms (SNPs) in DISC1, spanning 338 kb, in 367 autism trios (singleton and their biological parents) including 1,101 individuals. Single SNP association and haplotype association analysis were performed using the family-based association test (FBAT) and Haploview software. Results: We found three SNPs showed significant associations with autism (rs4366301: G > C, Z = 2.872, p = 0.004; rs11585959: T > C, Z = 2.199, p = 0.028; rs6668845: A > G, Z = 2.326, p = 0.02). After the Bonferroni correction, SNP rs4366301, which located in the first intron of DISC1, remained significant. When haplotype were constructed with two-markers, three haplotypes displayed significant association with autism. These results were still significant after using the permutation method to obtain empirical p values. Conclusions: Our study provided evidence that the DISC1 may be the susceptibility gene of autism. It suggested DISC1 might play a role in the pathogenesis of autism. Keywords: DISC1 autism, SNP, FBAT, association study Background of autism and the estimated heritability is over 90% [3-7]. Autism is a severe neurodevelopmental disorder mainly However, the genetic etiology remains elusive. characterized by impairment in social interaction, com- Several lines of evidence from postmortem [8-10] and municative deficits, and repetitive and stereotyped pat- structural magnetic resonance imaging (MRI) [11-16] terns of behaviors or interests [1]. Since autism was first supported the existence of brain abnormality in autism. described as a disorder by Dr. Leo Kanner in 1943 [2], It indicated that brain abnormalities in autism are not the speculation about its etiology has become an intri- limited to a single brain area but involve different struc- guing field which attracts a large number of scientists. To tures within a globally affected neuronal network. date, compelling evidence from twin and family studies Furthermore, functional MRI studies in autism patients has indicated a strong genetic involvement in the etiology have indicated that alterations in task related connectiv- ity, including enhanced activation and connectivity in posterior areas, enhanced reliance on visuospatial abilities * Correspondence: daizhang@bjmu.edu.cn for verbal and visual reasoning and reduced frontal sys- Key Laboratory for Mental Health, Ministry of Health, Beijing, P.R. China tems connectivity [17-21]. All together, these previous Full list of author information is available at the end of the article © 2011 Zheng et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Zheng et al. Behavioral and Brain Functions 2011, 7:14 Page 2 of 8 http://www.behavioralandbrainfunctions.com/content/7/1/14 studies suggested that abnormalities of neurodevelop- family-based association study to identify the association ment might be the etiology of autism. Considering the between DISC1 polymorphisms and autism. heritability of autism is relatively high, genes which play important roles in neurodevelopment might be candidate Materials and methods genes for autism. Subjects Disrupted-in-Schizophrenia 1 (DISC1) is a candidate Three hundred and sixty seven Chinese Han family trios gene of autism, which has been demonstrated to involve (singleton autistic disorder patients and their unaffected in neuronal migration [22-24], neurite outgrowth [25,26] biological parents) were recruited for the present study at and axon targeting [27] during brain development. The the Institute of Mental Health, Peking University, China. DISC1, on chromosome 1q42, was originally identified Of the 367 autistic child probands, 336 were male and 31 from the breakpoint of a hereditary chromosomal trans- were female. The mean age of the children at the time of location in a large Scottish pedigree [28-30]. It has 13 testing was 7.5 years (ranged from 3 to 17 years). Diag- exons spanning over 410 kb and encodes a cytosolic scaf- noses of autism were established by two senior psychia- fold protein with coiled-coil-rich C-terminus which inter- trists. All patients fulfilled the DSM-IV (Diagnostic and acts with multiple proteins involved in various functions. Statistical Manual of Mental Disorders, Fourth Edition) As one of the most interesting candidate genes for major criteria for autistic disorder. To assess the cases, child- mental illness, DISC1 have been demonstrated to associ- hood autism rating scale (CARS) [53] and autism beha- ate with schizophrenia, depression, bipolar disorder and vior checklist (ABC) [54] were used. Children with fragile schizoaffective disorder in several independent popula- X syndrome, tuberous sclerosis, a previously identified tions by multiple association studies [31-37]. Meanwhile, chromosomal abnormality, or any other neurological investigations into function of DISC1 have revealed that condition suspected to be associated with autism were it may contribute to risk for psychiatric disorders through excluded. All subjects provided written informed consent its effects on the processes of neurodevelopment signed by their legal guardians (i.e., their parents) for par- [25,38-43]. Recently, Niwa et al. reported that transient ticipation in this study. This study was approved by the knockdown of Disc1 during embryo development of mice Ethics Committee of the Institute of Mental Health, Pek- resulted in selective abnormalities in postnatal mesocorti- ing University. cal dopaminergic maturation and adult behavioral deficits [44]. Genotyping Autism and schizophrenia share neurocognitive defects Genomic DNA was extracted from the blood using a such as impaired executive function and social function- Qiagen QIAamp DNA Mini Kit. We selected seven single ing [45,46]. Thus, the impairment of neurodevelopment nucleotide polymorphisms (SNPs) in the DISC1 gene may be the common underlying mechanism of these two according to the dbSNP http://www.ncbi.nlm.nih.gov/ disorders. Recent studies have showed a genetic overlap SNP/ and the HapMap phase Ⅱ Chinese Han in Beijing between these two disorders [47,48]. Therefore, DISC1 (CHB) genotype dataset http://hapmap.ncbi.nlm.nih.gov/, was selected as a candidate gene for autism. Two reports including rs4366301, rs11585959, rs1322784, rs6668845, have revealed some abnormalities of DISC1 in three indi- rs10864698, rs872624 in introns and rs821616 in exon viduals with autism spectrum disorders (ASD) [49,50]. (Figure 1). SNPs with minor allele frequency (MAF) Moreover, a Finnish group has represented a significant >0.05wereselectedand pair-wisetagging in theTagger association of DISC1 with ASD. They established associa- module implemented in Haploview v4.1 program was tion between autism and a DISC1 intragenic microsatel- used to select SNPs that could capture >80% of the mar- lite D1S2709 and found that one intragenic SNP, kers with r >0.8. Meanwhile, the physical position of rs1322784, was associated with Asperger syndrome [51]. SNPs and the previous positive results were considered Their study indicated that DISC1 might also play a role too. in the etiology of autism. However, the results of associa- Direct DNA sequencing was used for analyzing tion studies were not consistent. In another association rs11585959. The other six SNPs (rs4366301, rs1322784, study, no significant association of DISC1 polymorphism rs6668845, rs10864698, rs872624 and rs821616) were ana- with ASD was found in Korean population [52]. lyzed by polymerase chain reaction-restriction fragment Considering the biological functions of DISC1 protein length polymorphism (PCR-RFLP) analysis. The informa- and the positive results of previous association studies tion of primers and PCR-RFLP analysis is given in Table 1. between DISC1 and mental disorders, we hypothesized The PCR amplification was performed in a 25 μl volume that DISC1 might be involved in the etiology of autism. containing GC Buffer (TaKaRa), 200 μMofeach dNTPs, To explore whether DISC1 is the susceptibility gene of 0.3 μM of each primer, 1 U of Taq DNA polymerase, and autism in Chinese Han population, we performed this 40 ng of the genomic DNA. The conditions used for PCR Zheng et al. Behavioral and Brain Functions 2011, 7:14 Page 3 of 8 http://www.behavioralandbrainfunctions.com/content/7/1/14 Figure 1 DISC1 gene locus and linkage disequilibrium (LD) structure. (A) A diagram showing the exonic structure of DISC1 gene (black). The single nucleotide polymorphisms (SNPs) used in this study are shown in relation to the exons. (B)The linkage disequilibrium (LD) structure of the DISC1 region in the total autism samples according to Haploview (solid spine of LD, D’> 0.7). Markers with LD (D’ < 1 and LOD > 2) are shown in red through pink (color intensity decreases with decreasing D’ value). Regions of low LD (D’ < 1 and LOD < 2) are shown in white. Two blocks were generated by Haploview. Table 1 Information of the primers and PCR-RFLP Analysis of seven SNPs in DISC1 gene SNP Position Primer sequence (5’-3’) Product (bp) RFLP Allele (bp) rs4366301 Intron 1 F: AGAAGACTAGGAAAAATAACT 406 ScrFⅠ C: (43/265/98) G: (43/363) R: ATAAACACTGAACAGAATGTC rs11585959 Intron 2 F: TGACATTCTACCTTCTCTCTC 556 - - - R: ACTACCTTTATTACCATCTTC rs1322784 Intron 6 F: CCTCCTCTGTTGAAAGTAGGT 645 Van91Ⅰ A: (201/444) G: (645) R:GGAAGAAAGTCTGAATGTGAC rs6668845 Intron 9 F:AAAAAAAAAAAATCAACTGAG 572 TaiⅠ G: (442/130) A: (572) R:CCCAAATCTTTCATAGTGACT rs10864698 Intron 9 F: TCCAGAGCCAGTGAAATGTTC 630 MunⅠ A: (381/249) G: (630) R: TTGTGCCTGAATGAATGAGAC rs872624 Intron 9 F: ACAAAACCAGAAACCTTGAGT 757 NdeⅠ G: (506/251) A: (757) R: ACATATTAGGGAAACTGAATG rs821616 Exon 11 F: GTATTGGGCTGCTGAGTCTG 540 BsrⅠ T: (204/336) A: (540) R: GACCTCTTTCTGTTCACCTCC PCR-RFLP, polymerase chain reaction-restriction fragment length polymorphism; SNP, single nucleotide polymorphism; F, forward; R, reverse. direct sequencing was applied for rs11585959. Zheng et al. Behavioral and Brain Functions 2011, 7:14 Page 4 of 8 http://www.behavioralandbrainfunctions.com/content/7/1/14 amplification were an initial denaturation phase at 94°C Table 2 Results of FBAT for the seven SNPs in DISC1 gene for 5min, followed by 38 cycles at 94°C for 30 sec, anneal- ing at 53-65°C for 30-45 sec, and extension at 72°C for Markers Afreq Families S E(s) Z p-values 30 sec, followed by a final extension phase at 72°C for rs4366301 C:0.831 169 213.00 233.00 -2.872 0.004 G:0.169 169 125.00 105.00 2.872 0.004 7min.A15 μL aliquot of the PCR product mixtures was rs11585959 C:0.243 216 123.00 141.00 -2.199 0.028 completely digested with 4 units of restriction enzyme T:0.757 216 309.00 291.00 2.199 0.028 overnight. Digestion products were visualized through rs1322784 G:0.369 242 206.00 202.50 -0.392 0.695 ethidium bromide staining after electrophoresis in 1.5%- A:0.631 242 278.00 281.50 0.392 0.695 2% agarose gels. The DNA sequencing was performed rs6668845 G:0.332 244 172.00 193.00 -2.326 0.020 after cleaning the PCR product using a BigDye Terminator A:0.668 244 316.00 295.00 2.326 0.020 Cycle Sequencing Ready Reaction Kit with Ampli Taq rs10864698 A:0.330 242 175.00 191.50 -1.831 0.067 G:0.670 242 309.00 292.50 1.831 0.067 DNA polymerase (PE Biosystem). The inner primers rs872624 G:0.345 232 168.00 180.00 -1.372 0.170 were used for the cycle-sequencing reaction, and the A:0.655 232 296.00 284.00 1.372 0.170 fragments were separated by electrophoresis on an ABI rs821616 A:0.881 130 186.00 181.50 0.728 0.467 PRISM 377-96 DNA Sequencer (Applied Biosystem, Fos- T:0.119 130 74.00 78.50 -0.728 0.467 ter City, U.S.A). FBAT, family-based association test; Afreq, allelic frequency; Families, number of informative families; Statistical Analyses S, test statistics for the observed number of transmitted alleles; E(S), expected value of S under the null hypothesis (i.e., no linkage or association). Prior to analysis, Mendelian inconsistencies were Significant p values (p < 0.05) are in boldface. checked using the PEDCHECK program, version 1.1 [55]. Deviations in the genotype counts from the Hardy- Weinberg equilibrium were tested using a chi-square the genotype distributions of these SNPs in patients signifi- goodness-of-fit test. The pairwise linkage disequilibrium cantly deviated from Hardy-Weinberg equilibrium (p > (LD) analysis was applied to detect the inter-marker 0.05, data not shown). Allele frequencies and the results of relationship with Haploview http://www.broad.mit.edu/ FBAT for single SNP analysis are shown in Table 2. Uni- mpg/haploview/, using D’ values. The family-based asso- variate (single-marker) FBAT demonstrated that variant ciation test (FBAT) was performed with FBAT program alleles at three SNPs showed a preferential transmission v1.5.1 [56]. The FBAT program uses generalized score (rs4366301 G: Z = 2.872, p = 0.004; rs11585959 T: Z = statistics to perform a variety of transmission disequili- 2.199, p = 0.028; rs6668845 A: Z = 2.326, p = 0.020) (Table brium tests (TDT), including haplotype analyses. More- 2). Moreover, rs4366301 remained significant with autism over, the FBAT program provides estimates of haplotype after the Bonferroni correction (significantly corrected p < frequencies and pairwise linkage disequilibrium (LD) 0.007, i.e. a = 0.05/n) which was considered as a conserva- between the specified markers http://www.biostat.har- tive correction method. The LD patterns of the SNPs were vard.edu/~fbat/default.html. The global haplotype tests measured with the solid spine of LD option of Haploview of association were performed under “multiallelic” mode (D’>0.7). Two LD blocks were identified (Figure 1). To in haplotype FBAT. Meanwhile, the individual haplotype determine whether any specific haplotype would confer a tests were conducted under “biallelic” mode in haplo- higher risk for autism, the specific and global-haplotype type FBAT. Family-based association tests were per- FBAT tests of association were performed (Table 3). Three formed under an additive model in the present study. haplotypes displayed significant association. The haplotype The significance level for all statistical tests was two- G-T (rs4366301-rs11585959) revealed significant excess tailed (p < 0.05). We also performed the association ana- transmission from parents to affected offspring both in the lysis by Haploview version 4.1 http://www.broad.mit. specific and global haplotype FBAT (p = 0.0015 and 0.0062, edu/mpg/haploview[57]. respectively). In addition, haplotype constructed from the A allele of rs6668845 and the G allele of rs10864698 demon- Results strated an excess transmission (p = 0.024 and 0.0064, We tested a total of seven SNPs over the 338 kb region of respectively) and haplotype constructed from the G allele 1q42 with DISC1 in 367 Chinese Han autism trios. All of rs6668845 and the A allele of rs10864698 displayed an seven SNPs were polymorphic with minor allele frequency undertransmission (p = 0.0499 and 0.0064, respectively). (MAF) >5% and were then used as genetic markers for the These results were still significant, after using the permuta- association study. A number of sample genotypes could not tion method to obtain empirical p values. be assigned due to repeated PCR failure or unclear geno- We also performed the single SNP association and type results, including 10 genotypes for rs4366301 and haplotype analysis with Haploview, the results were rs11585959; 5 for rs1322784; 9 for rs6668845; 7 for similar to those using FBAT method. (Additional file 1, rs10864698; 30 for rs872624 and 3 for rs821616. None of Table S1, Table S2). Zheng et al. Behavioral and Brain Functions 2011, 7:14 Page 5 of 8 http://www.behavioralandbrainfunctions.com/content/7/1/14 Table 3 Results of Haplotype association analysis for the SNPs with linkage disequilibrium Markers Haplotype Freq Z p Global Haplotype test p c p rs4366301-rs11585959 G-T 0.160 3.166 0.0015 12.362 0.0062 0.004 rs6668845-rs10864698 A-G 0.665 2.257 0.0240 10.095 0.0064 0.026 rs6668845-rs10864698 G-A 0.327 -1.960 0.0499 10.095 0.0064 0.026 Freq, frequency of the haplotype. p values using permutation test. Global haplotype represents the haplotype using all possible variants. the authors mentioned in their paper, the sample size of Discussion the Finnish study was relatively small [51]. The result DISC1 is one of the most promising susceptibility genes should be replicated in an expanded sample. Ethnic for major mental disorders. Genetic studies had indicated genetic heterogeneity might be another reason for these that DISC1 was a susceptibility gene for schizophrenia, discordant findings. In our study, major allele frequency depression, bipolar disorder and schizoaffective disorder for rs1322784 in autism cases was 0.617 compare to 0.83 [31-37]. Many investigators have considered the possibi- in Finnish population (Additional file 1, Table S3) lity that adult brain function and behavior are influenced [51,52]. The allele frequency for rs1322784 varies in dif- by neuronal network formation during early development ferent population as shown in the data from the Interna- [58-61]. Considering the established biological functions tional HapMap project. In CEU (Utah residents with of the DISC1 protein and the structural and functional Northern and Western European ancestry from the abnormalities in brains of autism patients, DISC1 was a CEPH collection) population the major allele frequency candidate gene for autism. Up to know, besides two case (MAF) of rs1322784 is 0.786, as well as 0.589 in Chinese reports, only one published research detected DISC1 was Han population in Beijing (CHB). Though our study did associated with autism and Asperger syndrome using not replicate the association between rs1322784 and aut- family-based association analysis. However, the results ism in Chinese Han population, we observed strong asso- did not replicated in a Korean population. To investigate ciation of rs4366301 in DISC1 with autism. DISC1 as potential autism susceptibility gene, we per- In the Finnish study, Kilpinen et al. detected suggestive formed a family-based association study in Chinese Han association with haplotype HEP3 (rs751229 and population. In the present study, we analyzed seven tag rs3738401) [62] in the Asperger syndrome study sample SNPs in DISC1 for association with autism in 367 Chi- using TRANSMIT software. However, this haplotype was nese Han family trios. The results of our study demon- not associated with Asperger syndrome and autism when strated that three SNPs, rs4366301, rs11585959, and analysis was performed by FBAT software. Moreover, sin- rs6668845 were associated with autism (Table 2). Among gle SNP association analysis of rs751229 and rs3738401 these three SNPs, rs4366301 had the most significance obtained no significant association with Asperger syn- (p = 0.004). Even after Bonferroni correction, rs4366301 drome and autism [51]. We constructed the LD patterns was still significant. When haplotypes were constructed between rs751229 and rs3738401 in the Haploview by with two markers, three haplotypes displayed positive using the genotyping date (only SNPs with MAF > 0.05) association. The results remained significant when the from the HapMap project http://www.hapmap.org. In Chi- global haplotype FBAT was performed (Table 3). Our nese Han population, genotyping date of rs751229 was not research established the association between autism and available in HapMap project. However, SNP rs2082552 the DISC1 gene. and rs823165 were genotyped. The positions of these two In a previous study, a Finnish group reported a positive SNPs were very close to rs751229 (the distance is 649 bp association of rs1322784 with Asperger syndrome besides and 907 bp, respectively). LD analysis demonstrated that a significant association of a DISC1 intragenic microsatel- rs3728401, rs2082552, and rs823165 were not located lite with autism [51]. However, we didn’t replicate this within one linkage disequilibrium block (Additional file 1, positive finding in 367 autism trios in Chinese Han popu- Figure S1). Pairwise D’ between rs3728401 and rs2082552 lation. No significant association was obtained for is 0.64, while D’ between rs3728401 and rs823165 is 0.66. rs1322784 in our study (p = 0.695). One reason is that These results suggested linkage disequilibrim of rs3738401 our research mainly focused on the genetic research of and rs751229 might not exist in Chinese Han population. autism, while the Finnish study founded that rs1322784 Therefore, we did not perform the association study was associated with Asperger syndrome. Although autism of these two SNPs with autism in Chinese Han population. and Asperger syndrome are included in autism spectrum In our study, we detected two other haplotypes which disorder (ASD), these two disorders have different clini- were associated with autism. The haplotype G-T cal features. Therefore, the genetic etiology of autism and (rs4366301-rs11585959) and A-G (rs6668845-rs10864698) Asperger syndrome may be not consistent. Second, as Zheng et al. Behavioral and Brain Functions 2011, 7:14 Page 6 of 8 http://www.behavioralandbrainfunctions.com/content/7/1/14 Acknowledgements and Funding demonstrate significant excess transmission from parents We thank all the patients and their families for their support and participation. to affected offspring. This work was supported by grants from the National High Technology Many association studies have replicated a positive Research and Development Program of China (2010CB833905), the National Natural Science Foundation of China (30870897, 81071110), and the Beijing association of rs821616 which is a missense polymorph- Natural Science Foundation (7081005). ism leading to a serine-to-cysteine substitution at amino acid 704 (Ser704Cys)in DISC1 with schizophrenia Author details Key Laboratory for Mental Health, Ministry of Health, Beijing, P.R. China. [32,36,37]. Our group have also demonstrated the asso- Institute of Mental Health, Peking University, Beijing, P. R. China. ciation between rs821616 and schizophrenia in Chinese Han population[32]. Function studies have reported that Authors’ contributions the substitution induced by rs821616 polymorphism may FZ and LW contributed equally to this work. FZ and LW designed the study and drafted the manuscript. FZ performed affect cognition [37,63] and the underlying mechanism the experiment, analyzed the data and interpreted the results. MJ, WY, YR, may be an altered interaction of DISC1 with its binding TL, JL and JL participated in data collection. WY and DZ supervised the partners or disruption of its signaling pathways [64,65]. study. All authors read and approved the final manuscript. Therefore, we genotyped this SNP in our study However, Competing interests we obtained no significant support for the association of The authors declare that they have no competing interests. rs821616 with autism (p = 0.467). This result is consis- Received: 17 December 2010 Accepted: 15 May 2011 tent with the results of the previous studies in Korean Published: 15 May 2011 population [52] and Finnish population [51]. It indicated that rs821616 may not involve in the etiology of autism. References However, we found that other SNPs were significantly 1. American Psychiatric Association: The Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV). Washington, DC: American associated with autism in Chinese Han population. Psychiatric Publishing Inc; 1994. DISC1 is a pleiotropic protein with many purported 2. Kanner L: autistic disturbances of affective contact. Nervous Child 1943, 2:217-250. functions, subcellular locations, binding partners and 3. Ronald A, Happe F, Bolton P, Butcher LM, Price TS, Wheelwright S, Baron- plays roles in many aspects of neurodevelopment Cohen S, Plomin R: Genetic heterogeneity between the three [22,39,66-69]. The middle part of DISC1 had been iden- components of the autism spectrum: a twin study. J Am Acad Child Adolesc Psychiatry 2006, 45:691-699. tified as a DISC1 self-association domain [23]. In con- 4. Bailey A, Le Couteur A, Gottesman I, Bolton P, Simonoff E, Yuzda E, trast, the C-termianl part of DISC1 binds to important Rutter M: Autism as a strongly genetic disorder: evidence from a British interacting molecules.. Interactions with LIS1, NDEL, twin study. Psychol Med 1995, 25:63-77. 5. Steffenburg S, Gillberg C, Hellgren L, Andersson L, Gillberg IC, Jakobsson G, FEZ1, integrin and other proteins indicated that many Bohman M: A twin study of autism in Denmark, Finland, Iceland, Norway of the proteins of the “DISC1 network” are involved in and Sweden. J Child Psychol Psychiatry 1989, 30:405-416. pathways critical for neuronal polarization and migra- 6. Folstein S, Rutter M: Infantile autism: a genetic study of 21 twin pairs. J tion, formation of synapses, and dendritic growth and Child Psychol Psychiatry 1977, 18:297-321. 7. Folstein SE, Rosen-Sheidley B: Genetics of autism: complex aetiology for a branching. Up to now, researches have demonstrated heterogeneous disorder. Nat Rev Genet 2001, 2:943-955. that DISC1 is a susceptibility gene for mental disorders 8. Ritvo ER, Freeman BJ, Scheibel AB, Duong T, Robinson H, Guthrie D, Ritvo A: such as autism, schizophrenia and bipolar disorder. Lower Purkinje cell counts in the cerebella of four autistic subjects: initial findings of the UCLA-NSAC Autopsy Research Report. Am J However, it is possible that the underlying pathogeneses Psychiatry 1986, 143:862-866. of DISC1 for different psychiatric disorders might be 9. Fatemi SH, Halt AR, Realmuto G, Earle J, Kist DA, Thuras P, Merz A: Purkinje different. cell size is reduced in cerebellum of patients with autism. Cell Mol Neurobiol 2002, 22:171-175. In conclusion, the present study demonstrated a positive 10. Bailey AJ: Postmortem studies of autism. Autism Res 2008, 1:265. association of DISC1 with autism in Chinese Han popula- 11. Paya Gonzalez B, Fuentes Menchaca N: Neurobiology of autism: tion. Our results provided evidence that DISC1 might neuropathology and neuroimaging studies. Actas Esp Psiquiatr 2007, 35:271-276. involve in the etiology of autism. Further researches of 12. Courchesne E, Carper R, Akshoomoff N: Evidence of brain overgrowth in association analysis across populations are needed. the first year of life in autism. JAMA 2003, 290:337-344. 13. Saitoh O, Karns CM, Courchesne E: Development of the hippocampal formation from 2 to 42 years: MRI evidence of smaller area dentata in Additional material autism. Brain 2001, 124:1317-1324. 14. Verhoeven JS, De Cock P, Lagae L, Sunaert S: Neuroimaging of autism. Neuroradiology 2010, 52:3-14. Additional file 1: 1-DISC1 and autism. Table S1. Results of single 15. Paakki JJ, Rahko J, Long X, Moilanen I, Tervonen O, Nikkinen J, Starck T, marker association for seven SNPs in DISC1 gene in 367 trios by Remes J, Hurtig T, Haapsamo H, et al: Alterations in regional homogeneity Haploview. Table S2. Results of Haplotype association analysis for the of resting-state brain activity in autism spectrum disorders. Brain Res SNPs with linkage disequilibrium in 367 trios by Haploview. Table S3. 2010, 1321:169-179. Frequencies of different alleles and genotypes in different association 16. Griebling J, Minshew NJ, Bodner K, Libove R, Bansal R, Konasale P, studies Figure S1. DISC1 gene linkage disequilibrium (LD) structure in Keshavan MS, Hardan A: Dorsolateral prefrontal cortex magnetic Chinese Han in Beijing (CHB) using HapMap date by Haploview. Tables resonance imaging measurements and cognitive performance in autism. and figures J Child Neurol 2010, 25:856-863. Zheng et al. Behavioral and Brain Functions 2011, 7:14 Page 7 of 8 http://www.behavioralandbrainfunctions.com/content/7/1/14 17. Koshino H, Kana RK, Keller TA, Cherkassky VL, Minshew NJ, Just MA: fMRI 36. Song W, Li W, Feng J, Heston LL, Scaringe WA, Sommer SS: Identification investigation of working memory for faces in autism: visual coding and of high risk DISC1 structural variants with a 2% attributable risk for underconnectivity with frontal areas. Cereb Cortex 2008, 18:289-300. schizophrenia. Biochem Biophys Res Commun 2008, 367:700-706. 18. Allen G, Muller RA, Courchesne E: Cerebellar function in autism: functional 37. Callicott JH, Straub RE, Pezawas L, Egan MF, Mattay VS, Hariri AR, magnetic resonance image activation during a simple motor task. Biol Verchinski BA, Meyer-Lindenberg A, Balkissoon R, Kolachana B, et al: Psychiatry 2004, 56:269-278. Variation in DISC1 affects hippocampal structure and function and 19. Allen G, Courchesne E: Differential effects of developmental cerebellar increases risk for schizophrenia. Proc Natl Acad Sci USA 2005, abnormality on cognitive and motor functions in the cerebellum: an 102:8627-8632. fMRI study of autism. Am J Psychiatry 2003, 160:262-273. 38. Millar JK, Pickard BS, Mackie S, James R, Christie S, Buchanan SR, Malloy MP, 20. Sahyoun CP, Belliveau JW, Soulieres I, Schwartz S, Mody M: Neuroimaging Chubb JE, Huston E, Baillie GS, et al: DISC1 and PDE4B are interacting of the functional and structural networks underlying visuospatial vs. genetic factors in schizophrenia that regulate cAMP signaling. Science linguistic reasoning in high-functioning autism. Neuropsychologia 2010, 2005, 310:1187-1191. 48:86-95. 39. Kim JY, Duan X, Liu CY, Jang MH, Guo JU, Pow-anpongkul N, Kang E, 21. Mostofsky SH, Powell SK, Simmonds DJ, Goldberg MC, Caffo B, Pekar JJ: Song H, Ming GL: DISC1 regulates new neuron development in the adult Decreased connectivity and cerebellar activity in autism during motor brain via modulation of AKT-mTOR signaling through KIAA1212. Neuron task performance. Brain 2009, 132:2413-2425. 2009, 63:761-773. 22. Meyer KD, Morris JA: Disc1 regulates granule cell migration in the 40. Morris JA, Kandpal G, Ma L, Austin CP: DISC1 (Disrupted-In-Schizophrenia developing hippocampus. Hum Mol Genet 2009, 18:3286-3297. 1) is a centrosome-associated protein that interacts with MAP1A, MIPT3, 23. Kamiya A, Kubo K, Tomoda T, Takaki M, Youn R, Ozeki Y, Sawamura N, ATF4/5 and NUDEL: regulation and loss of interaction with mutation. Park U, Kudo C, Okawa M, et al: A schizophrenia-associated mutation of Hum Mol Genet 2003, 12:1591-1608. DISC1 perturbs cerebral cortex development. Nat Cell Biol 2005, 41. Millar JK, Christie S, Porteous DJ: Yeast two-hybrid screens implicate DISC1 7:1167-1178. in brain development and function. Biochem Biophys Res Commun 2003, 24. Duan X, Chang JH, Ge S, Faulkner RL, Kim JY, Kitabatake Y, Liu XB, Yang CH, 311:1019-1025. Jordan JD, Ma DK, et al: Disrupted-In-Schizophrenia 1 regulates 42. Brandon NJ, Handford EJ, Schurov I, Rain JC, Pelling M, Duran-Jimeniz B, integration of newly generated neurons in the adult brain. Cell 2007, Camargo LM, Oliver KR, Beher D, Shearman MS, Whiting PJ: Disrupted in 130:1146-1158. Schizophrenia 1 and Nudel form a neurodevelopmentally regulated 25. Miyoshi K, Honda A, Baba K, Taniguchi M, Oono K, Fujita T, Kuroda S, protein complex: implications for schizophrenia and other major Katayama T, Tohyama M: Disrupted-In-Schizophrenia 1, a candidate gene neurological disorders. Mol Cell Neurosci 2004, 25:42-55. for schizophrenia, participates in neurite outgrowth. Mol Psychiatry 2003, 43. Kamiya A, Tomoda T, Chang J, Takaki M, Zhan C, Morita M, Cascio MB, 8:685-694. Elashvili S, Koizumi H, Takanezawa Y, et al: DISC1-NDEL1/NUDEL protein 26. Hattori T, Shimizu S, Koyama Y, Yamada K, Kuwahara R, Kumamoto N, interaction, an essential component for neurite outgrowth, is modulated Matsuzaki S, Ito A, Katayama T, Tohyama M: DISC1 regulates cell-cell by genetic variations of DISC1. Hum Mol Genet 2006, 15:3313-3323. adhesion, cell-matrix adhesion and neurite outgrowth. Mol Psychiatry 44. Niwa M, Kamiya A, Murai R, Kubo K, Gruber AJ, Tomita K, Lu L, Tomisato S, 2010. Jaaro-Peled H, Seshadri S, et al: Knockdown of DISC1 by in utero gene 27. Faulkner RL, Jang MH, Liu XB, Duan X, Sailor KA, Kim JY, Ge S, Jones EG, transfer disturbs postnatal dopaminergic maturation in the frontal Ming GL, Song H, Cheng HJ: Development of hippocampal mossy fiber cortex and leads to adult behavioral deficits. Neuron 2010, 65:480-489. synaptic outputs by new neurons in the adult brain. Proc Natl Acad Sci 45. Baron-Cohen S, Belmonte MK: Autism: a window onto the development USA 2008, 105:14157-14162. of the social and the analytic brain. Annu Rev Neurosci 2005, 28:109-126. 28. Millar JK, Wilson-Annan JC, Anderson S, Christie S, Taylor MS, Semple CA, 46. Happe F, Booth R, Charlton R, Hughes C: Executive function deficits in Devon RS, St Clair DM, Muir WJ, Blackwood DH, Porteous DJ: Disruption of autism spectrum disorders and attention-deficit/hyperactivity disorder: two novel genes by a translocation co-segregating with schizophrenia. examining profiles across domains and ages. Brain Cogn 2006, 61:25-39. Hum Mol Genet 2000, 9:1415-1423. 47. Carroll LS, Owen MJ: Genetic overlap between autism, schizophrenia and 29. St Clair D, Blackwood D, Muir W, Carothers A, Walker M, Spowart G, bipolar disorder. Genome Med 2009, 1:102. Gosden C, Evans HJ: Association within a family of a balanced autosomal 48. Burbach JP, van der Zwaag B: Contact in the genetics of autism and translocation with major mental illness. Lancet 1990, 336:13-16. schizophrenia. Trends Neurosci 2009, 32:69-72. 30. Blackwood DH, Fordyce A, Walker MT, St Clair DM, Porteous DJ, Muir WJ: 49. Crepel A, Breckpot J, Fryns JP, De la Marche W, Steyaert J, Devriendt K, Schizophrenia and affective disorders–cosegregation with a Peeters H: DISC1 duplication in two brothers with autism and mild translocation at chromosome 1q42 that directly disrupts brain-expressed mental retardation. Clin Genet 2010, 77:389-394. genes: clinical and P300 findings in a family. Am J Hum Genet 2001, 50. Williams JM, Beck TF, Pearson DM, Proud MB, Cheung SW, Scott DA: A 69:428-433. 1q42 deletion involving DISC1, DISC2, and TSNAX in an autism 31. Saetre P, Agartz I, De Franciscis A, Lundmark P, Djurovic S, Kahler A, spectrum disorder. Am J Med Genet A 2009, 149A:1758-1762. Andreassen OA, Jakobsen KD, Rasmussen HB, Werge T, et al: Association 51. Kilpinen H, Ylisaukko-Oja T, Hennah W, Palo OM, Varilo T, Vanhala R, between a disrupted-in-schizophrenia 1 (DISC1) single nucleotide Nieminen-von Wendt T, von Wendt L, Paunio T, Peltonen L: Association of polymorphism and schizophrenia in a combined Scandinavian case- DISC1 with autism and Asperger syndrome. Mol Psychiatry 2008, control sample. Schizophr Res 2008, 106:237-241. 13:187-196. 32. Qu M, Tang F, Yue W, Ruan Y, Lu T, Liu Z, Zhang H, Han Y, Zhang D, 52. Lim SM, Kim HJ, Nam M, Chung JH, Park YH: Association study of DISC1 in Wang F: Positive association of the Disrupted-in-Schizophrenia-1 gene Korean population with autism spectrum disorders. Psychiatr Genet 2009, (DISC1) with schizophrenia in the Chinese Han population. Am J Med 19:160. Genet B Neuropsychiatr Genet 2007, 144B:266-270. 53. Schopler E, Reichler RJ, DeVellis RF, Daly K: Toward objective classification 33. Zhang F, Sarginson J, Crombie C, Walker N, St Clair D, Shaw D: Genetic of childhood autism: Childhood Autism Rating Scale (CARS). J Autism Dev association between schizophrenia and the DISC1 gene in the Scottish Disord 1980, 10:91-103. population. Am J Med Genet B Neuropsychiatr Genet 2006, 141B:155-159. 54. Krug DA, Arick J, Almond P: Behavior checklist for identifying severely 34. Hodgkinson CA, Goldman D, Jaeger J, Persaud S, Kane JM, Lipsky RH, handicapped individuals with high levels of autistic behavior. J Child Malhotra AK: Disrupted in schizophrenia 1 (DISC1): association with Psychol Psychiatry 1980, 21:221-229. schizophrenia, schizoaffective disorder, and bipolar disorder. Am J Hum 55. O’Connell JR, Weeks DE: PedCheck: a program for identification of Genet 2004, 75:862-872. genotype incompatibilities in linkage analysis. Am J Hum Genet 1998, 35. Zhang X, Tochigi M, Ohashi J, Maeda K, Kato T, Okazaki Y, Kato N, 63:259-266. Tokunaga K, Sawa A, Sasaki T: Association study of the DISC1/TRAX locus 56. Rabinowitz D, Laird N: A unified approach to adjusting association tests with schizophrenia in a Japanese population. Schizophr Res 2005, for population admixture with arbitrary pedigree structure and arbitrary 79:175-180. missing marker information. Hum Hered 2000, 50:211-223. Zheng et al. Behavioral and Brain Functions 2011, 7:14 Page 8 of 8 http://www.behavioralandbrainfunctions.com/content/7/1/14 57. Barrett JC, Fry B, Maller J, Daly MJ: Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 2005, 21:263-265. 58. Cannon TD, van Erp TG, Bearden CE, Loewy R, Thompson P, Toga AW, Huttunen MO, Keshavan MS, Seidman LJ, Tsuang MT: Early and late neurodevelopmental influences in the prodrome to schizophrenia: contributions of genes, environment, and their interactions. Schizophr Bull 2003, 29:653-669. 59. Harrison PJ, Weinberger DR: Schizophrenia genes, gene expression, and neuropathology: on the matter of their convergence. Mol Psychiatry 2005, 10:40-685, image 4. 60. Lisman JE, Coyle JT, Green RW, Javitt DC, Benes FM, Heckers S, Grace AA: Circuit-based framework for understanding neurotransmitter and risk gene interactions in schizophrenia. Trends Neurosci 2008, 31:234-242. 61. Jaaro-Peled H, Hayashi-Takagi A, Seshadri S, Kamiya A, Brandon NJ, Sawa A: Neurodevelopmental mechanisms of schizophrenia: understanding disturbed postnatal brain maturation through neuregulin-1-ErbB4 and DISC1. Trends Neurosci 2009, 32:485-495. 62. Hennah W, Varilo T, Kestila M, Paunio T, Arajarvi R, Haukka J, Parker A, Martin R, Levitzky S, Partonen T, et al: Haplotype transmission analysis provides evidence of association for DISC1 to schizophrenia and suggests sex-dependent effects. Hum Mol Genet 2003, 12:3151-3159. 63. Prata DP, Mechelli A, Fu CH, Picchioni M, Kane F, Kalidindi S, McDonald C, Kravariti E, Toulopoulou T, Miorelli A, et al: Effect of disrupted-in- schizophrenia-1 on pre-frontal cortical function. Mol Psychiatry 2008, 13:915-917, 909. 64. Eastwood SL, Walker M, Hyde TM, Kleinman JE, Harrison PJ: The DISC1 Ser704Cys substitution affects centrosomal localization of its binding partner PCM1 in glia in human brain. Hum Mol Genet 2010, 19:2487-2496. 65. Hashimoto R, Numakawa T, Ohnishi T, Kumamaru E, Yagasaki Y, Ishimoto T, Mori T, Nemoto K, Adachi N, Izumi A, et al: Impact of the DISC1 Ser704Cys polymorphism on risk for major depression, brain morphology and ERK signaling. Hum Mol Genet 2006, 15:3024-3033. 66. Camargo LM, Collura V, Rain JC, Mizuguchi K, Hermjakob H, Kerrien S, Bonnert TP, Whiting PJ, Brandon NJ: Disrupted in Schizophrenia 1 Interactome: evidence for the close connectivity of risk genes and a potential synaptic basis for schizophrenia. Mol Psychiatry 2007, 12:74-86. 67. Hayashi-Takagi A, Takaki M, Graziane N, Seshadri S, Murdoch H, Dunlop AJ, Makino Y, Seshadri AJ, Ishizuka K, Srivastava DP, et al: Disrupted-in- Schizophrenia 1 (DISC1) regulates spines of the glutamate synapse via Rac1. Nat Neurosci 2010, 13:327-332. 68. Ming GL, Song H: DISC1 partners with GSK3beta in neurogenesis. Cell 2009, 136:990-992. 69. Shinoda T, Taya S, Tsuboi D, Hikita T, Matsuzawa R, Kuroda S, Iwamatsu A, Kaibuchi K: DISC1 regulates neurotrophin-induced axon elongation via interaction with Grb2. J Neurosci 2007, 27:4-14. doi:10.1186/1744-9081-7-14 Cite this article as: Zheng et al.: Evidence for association between Disrupted-in-schizophrenia 1 (DISC1) gene polymorphisms and autism in Chinese Han population: a family-based association study. Behavioral and Brain Functions 2011 7:14. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Behavioral and Brain Functions Springer Journals

Evidence for association between Disrupted-in-schizophrenia 1 (DISC1) gene polymorphisms and autism in Chinese Han population: a family-based association study

Download PDF
8 pages

Loading next page...
 
/lp/springer-journals/evidence-for-association-between-disrupted-in-schizophrenia-1-disc1-Xjy3luZcBz

References (148)

Publisher
Springer Journals
Copyright
Copyright © 2011 by Zheng et al; licensee BioMed Central Ltd.
Subject
Biomedicine; Neurosciences; Neurology; Behavioral Therapy; Psychiatry
eISSN
1744-9081
DOI
10.1186/1744-9081-7-14
pmid
21569632
Publisher site
See Article on Publisher Site

Abstract

Background: Disrupted-in-Schizophrenia 1 (DISC1) gene is one of the most promising candidate genes for major mental disorders. In a previous study, a Finnish group demonstrated that DISC1 polymorphisms were associated with autism and Asperger syndrome. However, the results were not replicated in Korean population. To determine whether DISC1 is associated with autism in Chinese Han population, we performed a family-based association study between DISC1 polymorphisms and autism. Methods: We genotyped seven tag single nucleotide polymorphisms (SNPs) in DISC1, spanning 338 kb, in 367 autism trios (singleton and their biological parents) including 1,101 individuals. Single SNP association and haplotype association analysis were performed using the family-based association test (FBAT) and Haploview software. Results: We found three SNPs showed significant associations with autism (rs4366301: G > C, Z = 2.872, p = 0.004; rs11585959: T > C, Z = 2.199, p = 0.028; rs6668845: A > G, Z = 2.326, p = 0.02). After the Bonferroni correction, SNP rs4366301, which located in the first intron of DISC1, remained significant. When haplotype were constructed with two-markers, three haplotypes displayed significant association with autism. These results were still significant after using the permutation method to obtain empirical p values. Conclusions: Our study provided evidence that the DISC1 may be the susceptibility gene of autism. It suggested DISC1 might play a role in the pathogenesis of autism. Keywords: DISC1 autism, SNP, FBAT, association study Background of autism and the estimated heritability is over 90% [3-7]. Autism is a severe neurodevelopmental disorder mainly However, the genetic etiology remains elusive. characterized by impairment in social interaction, com- Several lines of evidence from postmortem [8-10] and municative deficits, and repetitive and stereotyped pat- structural magnetic resonance imaging (MRI) [11-16] terns of behaviors or interests [1]. Since autism was first supported the existence of brain abnormality in autism. described as a disorder by Dr. Leo Kanner in 1943 [2], It indicated that brain abnormalities in autism are not the speculation about its etiology has become an intri- limited to a single brain area but involve different struc- guing field which attracts a large number of scientists. To tures within a globally affected neuronal network. date, compelling evidence from twin and family studies Furthermore, functional MRI studies in autism patients has indicated a strong genetic involvement in the etiology have indicated that alterations in task related connectiv- ity, including enhanced activation and connectivity in posterior areas, enhanced reliance on visuospatial abilities * Correspondence: daizhang@bjmu.edu.cn for verbal and visual reasoning and reduced frontal sys- Key Laboratory for Mental Health, Ministry of Health, Beijing, P.R. China tems connectivity [17-21]. All together, these previous Full list of author information is available at the end of the article © 2011 Zheng et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Zheng et al. Behavioral and Brain Functions 2011, 7:14 Page 2 of 8 http://www.behavioralandbrainfunctions.com/content/7/1/14 studies suggested that abnormalities of neurodevelop- family-based association study to identify the association ment might be the etiology of autism. Considering the between DISC1 polymorphisms and autism. heritability of autism is relatively high, genes which play important roles in neurodevelopment might be candidate Materials and methods genes for autism. Subjects Disrupted-in-Schizophrenia 1 (DISC1) is a candidate Three hundred and sixty seven Chinese Han family trios gene of autism, which has been demonstrated to involve (singleton autistic disorder patients and their unaffected in neuronal migration [22-24], neurite outgrowth [25,26] biological parents) were recruited for the present study at and axon targeting [27] during brain development. The the Institute of Mental Health, Peking University, China. DISC1, on chromosome 1q42, was originally identified Of the 367 autistic child probands, 336 were male and 31 from the breakpoint of a hereditary chromosomal trans- were female. The mean age of the children at the time of location in a large Scottish pedigree [28-30]. It has 13 testing was 7.5 years (ranged from 3 to 17 years). Diag- exons spanning over 410 kb and encodes a cytosolic scaf- noses of autism were established by two senior psychia- fold protein with coiled-coil-rich C-terminus which inter- trists. All patients fulfilled the DSM-IV (Diagnostic and acts with multiple proteins involved in various functions. Statistical Manual of Mental Disorders, Fourth Edition) As one of the most interesting candidate genes for major criteria for autistic disorder. To assess the cases, child- mental illness, DISC1 have been demonstrated to associ- hood autism rating scale (CARS) [53] and autism beha- ate with schizophrenia, depression, bipolar disorder and vior checklist (ABC) [54] were used. Children with fragile schizoaffective disorder in several independent popula- X syndrome, tuberous sclerosis, a previously identified tions by multiple association studies [31-37]. Meanwhile, chromosomal abnormality, or any other neurological investigations into function of DISC1 have revealed that condition suspected to be associated with autism were it may contribute to risk for psychiatric disorders through excluded. All subjects provided written informed consent its effects on the processes of neurodevelopment signed by their legal guardians (i.e., their parents) for par- [25,38-43]. Recently, Niwa et al. reported that transient ticipation in this study. This study was approved by the knockdown of Disc1 during embryo development of mice Ethics Committee of the Institute of Mental Health, Pek- resulted in selective abnormalities in postnatal mesocorti- ing University. cal dopaminergic maturation and adult behavioral deficits [44]. Genotyping Autism and schizophrenia share neurocognitive defects Genomic DNA was extracted from the blood using a such as impaired executive function and social function- Qiagen QIAamp DNA Mini Kit. We selected seven single ing [45,46]. Thus, the impairment of neurodevelopment nucleotide polymorphisms (SNPs) in the DISC1 gene may be the common underlying mechanism of these two according to the dbSNP http://www.ncbi.nlm.nih.gov/ disorders. Recent studies have showed a genetic overlap SNP/ and the HapMap phase Ⅱ Chinese Han in Beijing between these two disorders [47,48]. Therefore, DISC1 (CHB) genotype dataset http://hapmap.ncbi.nlm.nih.gov/, was selected as a candidate gene for autism. Two reports including rs4366301, rs11585959, rs1322784, rs6668845, have revealed some abnormalities of DISC1 in three indi- rs10864698, rs872624 in introns and rs821616 in exon viduals with autism spectrum disorders (ASD) [49,50]. (Figure 1). SNPs with minor allele frequency (MAF) Moreover, a Finnish group has represented a significant >0.05wereselectedand pair-wisetagging in theTagger association of DISC1 with ASD. They established associa- module implemented in Haploview v4.1 program was tion between autism and a DISC1 intragenic microsatel- used to select SNPs that could capture >80% of the mar- lite D1S2709 and found that one intragenic SNP, kers with r >0.8. Meanwhile, the physical position of rs1322784, was associated with Asperger syndrome [51]. SNPs and the previous positive results were considered Their study indicated that DISC1 might also play a role too. in the etiology of autism. However, the results of associa- Direct DNA sequencing was used for analyzing tion studies were not consistent. In another association rs11585959. The other six SNPs (rs4366301, rs1322784, study, no significant association of DISC1 polymorphism rs6668845, rs10864698, rs872624 and rs821616) were ana- with ASD was found in Korean population [52]. lyzed by polymerase chain reaction-restriction fragment Considering the biological functions of DISC1 protein length polymorphism (PCR-RFLP) analysis. The informa- and the positive results of previous association studies tion of primers and PCR-RFLP analysis is given in Table 1. between DISC1 and mental disorders, we hypothesized The PCR amplification was performed in a 25 μl volume that DISC1 might be involved in the etiology of autism. containing GC Buffer (TaKaRa), 200 μMofeach dNTPs, To explore whether DISC1 is the susceptibility gene of 0.3 μM of each primer, 1 U of Taq DNA polymerase, and autism in Chinese Han population, we performed this 40 ng of the genomic DNA. The conditions used for PCR Zheng et al. Behavioral and Brain Functions 2011, 7:14 Page 3 of 8 http://www.behavioralandbrainfunctions.com/content/7/1/14 Figure 1 DISC1 gene locus and linkage disequilibrium (LD) structure. (A) A diagram showing the exonic structure of DISC1 gene (black). The single nucleotide polymorphisms (SNPs) used in this study are shown in relation to the exons. (B)The linkage disequilibrium (LD) structure of the DISC1 region in the total autism samples according to Haploview (solid spine of LD, D’> 0.7). Markers with LD (D’ < 1 and LOD > 2) are shown in red through pink (color intensity decreases with decreasing D’ value). Regions of low LD (D’ < 1 and LOD < 2) are shown in white. Two blocks were generated by Haploview. Table 1 Information of the primers and PCR-RFLP Analysis of seven SNPs in DISC1 gene SNP Position Primer sequence (5’-3’) Product (bp) RFLP Allele (bp) rs4366301 Intron 1 F: AGAAGACTAGGAAAAATAACT 406 ScrFⅠ C: (43/265/98) G: (43/363) R: ATAAACACTGAACAGAATGTC rs11585959 Intron 2 F: TGACATTCTACCTTCTCTCTC 556 - - - R: ACTACCTTTATTACCATCTTC rs1322784 Intron 6 F: CCTCCTCTGTTGAAAGTAGGT 645 Van91Ⅰ A: (201/444) G: (645) R:GGAAGAAAGTCTGAATGTGAC rs6668845 Intron 9 F:AAAAAAAAAAAATCAACTGAG 572 TaiⅠ G: (442/130) A: (572) R:CCCAAATCTTTCATAGTGACT rs10864698 Intron 9 F: TCCAGAGCCAGTGAAATGTTC 630 MunⅠ A: (381/249) G: (630) R: TTGTGCCTGAATGAATGAGAC rs872624 Intron 9 F: ACAAAACCAGAAACCTTGAGT 757 NdeⅠ G: (506/251) A: (757) R: ACATATTAGGGAAACTGAATG rs821616 Exon 11 F: GTATTGGGCTGCTGAGTCTG 540 BsrⅠ T: (204/336) A: (540) R: GACCTCTTTCTGTTCACCTCC PCR-RFLP, polymerase chain reaction-restriction fragment length polymorphism; SNP, single nucleotide polymorphism; F, forward; R, reverse. direct sequencing was applied for rs11585959. Zheng et al. Behavioral and Brain Functions 2011, 7:14 Page 4 of 8 http://www.behavioralandbrainfunctions.com/content/7/1/14 amplification were an initial denaturation phase at 94°C Table 2 Results of FBAT for the seven SNPs in DISC1 gene for 5min, followed by 38 cycles at 94°C for 30 sec, anneal- ing at 53-65°C for 30-45 sec, and extension at 72°C for Markers Afreq Families S E(s) Z p-values 30 sec, followed by a final extension phase at 72°C for rs4366301 C:0.831 169 213.00 233.00 -2.872 0.004 G:0.169 169 125.00 105.00 2.872 0.004 7min.A15 μL aliquot of the PCR product mixtures was rs11585959 C:0.243 216 123.00 141.00 -2.199 0.028 completely digested with 4 units of restriction enzyme T:0.757 216 309.00 291.00 2.199 0.028 overnight. Digestion products were visualized through rs1322784 G:0.369 242 206.00 202.50 -0.392 0.695 ethidium bromide staining after electrophoresis in 1.5%- A:0.631 242 278.00 281.50 0.392 0.695 2% agarose gels. The DNA sequencing was performed rs6668845 G:0.332 244 172.00 193.00 -2.326 0.020 after cleaning the PCR product using a BigDye Terminator A:0.668 244 316.00 295.00 2.326 0.020 Cycle Sequencing Ready Reaction Kit with Ampli Taq rs10864698 A:0.330 242 175.00 191.50 -1.831 0.067 G:0.670 242 309.00 292.50 1.831 0.067 DNA polymerase (PE Biosystem). The inner primers rs872624 G:0.345 232 168.00 180.00 -1.372 0.170 were used for the cycle-sequencing reaction, and the A:0.655 232 296.00 284.00 1.372 0.170 fragments were separated by electrophoresis on an ABI rs821616 A:0.881 130 186.00 181.50 0.728 0.467 PRISM 377-96 DNA Sequencer (Applied Biosystem, Fos- T:0.119 130 74.00 78.50 -0.728 0.467 ter City, U.S.A). FBAT, family-based association test; Afreq, allelic frequency; Families, number of informative families; Statistical Analyses S, test statistics for the observed number of transmitted alleles; E(S), expected value of S under the null hypothesis (i.e., no linkage or association). Prior to analysis, Mendelian inconsistencies were Significant p values (p < 0.05) are in boldface. checked using the PEDCHECK program, version 1.1 [55]. Deviations in the genotype counts from the Hardy- Weinberg equilibrium were tested using a chi-square the genotype distributions of these SNPs in patients signifi- goodness-of-fit test. The pairwise linkage disequilibrium cantly deviated from Hardy-Weinberg equilibrium (p > (LD) analysis was applied to detect the inter-marker 0.05, data not shown). Allele frequencies and the results of relationship with Haploview http://www.broad.mit.edu/ FBAT for single SNP analysis are shown in Table 2. Uni- mpg/haploview/, using D’ values. The family-based asso- variate (single-marker) FBAT demonstrated that variant ciation test (FBAT) was performed with FBAT program alleles at three SNPs showed a preferential transmission v1.5.1 [56]. The FBAT program uses generalized score (rs4366301 G: Z = 2.872, p = 0.004; rs11585959 T: Z = statistics to perform a variety of transmission disequili- 2.199, p = 0.028; rs6668845 A: Z = 2.326, p = 0.020) (Table brium tests (TDT), including haplotype analyses. More- 2). Moreover, rs4366301 remained significant with autism over, the FBAT program provides estimates of haplotype after the Bonferroni correction (significantly corrected p < frequencies and pairwise linkage disequilibrium (LD) 0.007, i.e. a = 0.05/n) which was considered as a conserva- between the specified markers http://www.biostat.har- tive correction method. The LD patterns of the SNPs were vard.edu/~fbat/default.html. The global haplotype tests measured with the solid spine of LD option of Haploview of association were performed under “multiallelic” mode (D’>0.7). Two LD blocks were identified (Figure 1). To in haplotype FBAT. Meanwhile, the individual haplotype determine whether any specific haplotype would confer a tests were conducted under “biallelic” mode in haplo- higher risk for autism, the specific and global-haplotype type FBAT. Family-based association tests were per- FBAT tests of association were performed (Table 3). Three formed under an additive model in the present study. haplotypes displayed significant association. The haplotype The significance level for all statistical tests was two- G-T (rs4366301-rs11585959) revealed significant excess tailed (p < 0.05). We also performed the association ana- transmission from parents to affected offspring both in the lysis by Haploview version 4.1 http://www.broad.mit. specific and global haplotype FBAT (p = 0.0015 and 0.0062, edu/mpg/haploview[57]. respectively). In addition, haplotype constructed from the A allele of rs6668845 and the G allele of rs10864698 demon- Results strated an excess transmission (p = 0.024 and 0.0064, We tested a total of seven SNPs over the 338 kb region of respectively) and haplotype constructed from the G allele 1q42 with DISC1 in 367 Chinese Han autism trios. All of rs6668845 and the A allele of rs10864698 displayed an seven SNPs were polymorphic with minor allele frequency undertransmission (p = 0.0499 and 0.0064, respectively). (MAF) >5% and were then used as genetic markers for the These results were still significant, after using the permuta- association study. A number of sample genotypes could not tion method to obtain empirical p values. be assigned due to repeated PCR failure or unclear geno- We also performed the single SNP association and type results, including 10 genotypes for rs4366301 and haplotype analysis with Haploview, the results were rs11585959; 5 for rs1322784; 9 for rs6668845; 7 for similar to those using FBAT method. (Additional file 1, rs10864698; 30 for rs872624 and 3 for rs821616. None of Table S1, Table S2). Zheng et al. Behavioral and Brain Functions 2011, 7:14 Page 5 of 8 http://www.behavioralandbrainfunctions.com/content/7/1/14 Table 3 Results of Haplotype association analysis for the SNPs with linkage disequilibrium Markers Haplotype Freq Z p Global Haplotype test p c p rs4366301-rs11585959 G-T 0.160 3.166 0.0015 12.362 0.0062 0.004 rs6668845-rs10864698 A-G 0.665 2.257 0.0240 10.095 0.0064 0.026 rs6668845-rs10864698 G-A 0.327 -1.960 0.0499 10.095 0.0064 0.026 Freq, frequency of the haplotype. p values using permutation test. Global haplotype represents the haplotype using all possible variants. the authors mentioned in their paper, the sample size of Discussion the Finnish study was relatively small [51]. The result DISC1 is one of the most promising susceptibility genes should be replicated in an expanded sample. Ethnic for major mental disorders. Genetic studies had indicated genetic heterogeneity might be another reason for these that DISC1 was a susceptibility gene for schizophrenia, discordant findings. In our study, major allele frequency depression, bipolar disorder and schizoaffective disorder for rs1322784 in autism cases was 0.617 compare to 0.83 [31-37]. Many investigators have considered the possibi- in Finnish population (Additional file 1, Table S3) lity that adult brain function and behavior are influenced [51,52]. The allele frequency for rs1322784 varies in dif- by neuronal network formation during early development ferent population as shown in the data from the Interna- [58-61]. Considering the established biological functions tional HapMap project. In CEU (Utah residents with of the DISC1 protein and the structural and functional Northern and Western European ancestry from the abnormalities in brains of autism patients, DISC1 was a CEPH collection) population the major allele frequency candidate gene for autism. Up to know, besides two case (MAF) of rs1322784 is 0.786, as well as 0.589 in Chinese reports, only one published research detected DISC1 was Han population in Beijing (CHB). Though our study did associated with autism and Asperger syndrome using not replicate the association between rs1322784 and aut- family-based association analysis. However, the results ism in Chinese Han population, we observed strong asso- did not replicated in a Korean population. To investigate ciation of rs4366301 in DISC1 with autism. DISC1 as potential autism susceptibility gene, we per- In the Finnish study, Kilpinen et al. detected suggestive formed a family-based association study in Chinese Han association with haplotype HEP3 (rs751229 and population. In the present study, we analyzed seven tag rs3738401) [62] in the Asperger syndrome study sample SNPs in DISC1 for association with autism in 367 Chi- using TRANSMIT software. However, this haplotype was nese Han family trios. The results of our study demon- not associated with Asperger syndrome and autism when strated that three SNPs, rs4366301, rs11585959, and analysis was performed by FBAT software. Moreover, sin- rs6668845 were associated with autism (Table 2). Among gle SNP association analysis of rs751229 and rs3738401 these three SNPs, rs4366301 had the most significance obtained no significant association with Asperger syn- (p = 0.004). Even after Bonferroni correction, rs4366301 drome and autism [51]. We constructed the LD patterns was still significant. When haplotypes were constructed between rs751229 and rs3738401 in the Haploview by with two markers, three haplotypes displayed positive using the genotyping date (only SNPs with MAF > 0.05) association. The results remained significant when the from the HapMap project http://www.hapmap.org. In Chi- global haplotype FBAT was performed (Table 3). Our nese Han population, genotyping date of rs751229 was not research established the association between autism and available in HapMap project. However, SNP rs2082552 the DISC1 gene. and rs823165 were genotyped. The positions of these two In a previous study, a Finnish group reported a positive SNPs were very close to rs751229 (the distance is 649 bp association of rs1322784 with Asperger syndrome besides and 907 bp, respectively). LD analysis demonstrated that a significant association of a DISC1 intragenic microsatel- rs3728401, rs2082552, and rs823165 were not located lite with autism [51]. However, we didn’t replicate this within one linkage disequilibrium block (Additional file 1, positive finding in 367 autism trios in Chinese Han popu- Figure S1). Pairwise D’ between rs3728401 and rs2082552 lation. No significant association was obtained for is 0.64, while D’ between rs3728401 and rs823165 is 0.66. rs1322784 in our study (p = 0.695). One reason is that These results suggested linkage disequilibrim of rs3738401 our research mainly focused on the genetic research of and rs751229 might not exist in Chinese Han population. autism, while the Finnish study founded that rs1322784 Therefore, we did not perform the association study was associated with Asperger syndrome. Although autism of these two SNPs with autism in Chinese Han population. and Asperger syndrome are included in autism spectrum In our study, we detected two other haplotypes which disorder (ASD), these two disorders have different clini- were associated with autism. The haplotype G-T cal features. Therefore, the genetic etiology of autism and (rs4366301-rs11585959) and A-G (rs6668845-rs10864698) Asperger syndrome may be not consistent. Second, as Zheng et al. Behavioral and Brain Functions 2011, 7:14 Page 6 of 8 http://www.behavioralandbrainfunctions.com/content/7/1/14 Acknowledgements and Funding demonstrate significant excess transmission from parents We thank all the patients and their families for their support and participation. to affected offspring. This work was supported by grants from the National High Technology Many association studies have replicated a positive Research and Development Program of China (2010CB833905), the National Natural Science Foundation of China (30870897, 81071110), and the Beijing association of rs821616 which is a missense polymorph- Natural Science Foundation (7081005). ism leading to a serine-to-cysteine substitution at amino acid 704 (Ser704Cys)in DISC1 with schizophrenia Author details Key Laboratory for Mental Health, Ministry of Health, Beijing, P.R. China. [32,36,37]. Our group have also demonstrated the asso- Institute of Mental Health, Peking University, Beijing, P. R. China. ciation between rs821616 and schizophrenia in Chinese Han population[32]. Function studies have reported that Authors’ contributions the substitution induced by rs821616 polymorphism may FZ and LW contributed equally to this work. FZ and LW designed the study and drafted the manuscript. FZ performed affect cognition [37,63] and the underlying mechanism the experiment, analyzed the data and interpreted the results. MJ, WY, YR, may be an altered interaction of DISC1 with its binding TL, JL and JL participated in data collection. WY and DZ supervised the partners or disruption of its signaling pathways [64,65]. study. All authors read and approved the final manuscript. Therefore, we genotyped this SNP in our study However, Competing interests we obtained no significant support for the association of The authors declare that they have no competing interests. rs821616 with autism (p = 0.467). This result is consis- Received: 17 December 2010 Accepted: 15 May 2011 tent with the results of the previous studies in Korean Published: 15 May 2011 population [52] and Finnish population [51]. It indicated that rs821616 may not involve in the etiology of autism. References However, we found that other SNPs were significantly 1. American Psychiatric Association: The Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV). Washington, DC: American associated with autism in Chinese Han population. Psychiatric Publishing Inc; 1994. DISC1 is a pleiotropic protein with many purported 2. Kanner L: autistic disturbances of affective contact. Nervous Child 1943, 2:217-250. functions, subcellular locations, binding partners and 3. Ronald A, Happe F, Bolton P, Butcher LM, Price TS, Wheelwright S, Baron- plays roles in many aspects of neurodevelopment Cohen S, Plomin R: Genetic heterogeneity between the three [22,39,66-69]. The middle part of DISC1 had been iden- components of the autism spectrum: a twin study. J Am Acad Child Adolesc Psychiatry 2006, 45:691-699. tified as a DISC1 self-association domain [23]. In con- 4. Bailey A, Le Couteur A, Gottesman I, Bolton P, Simonoff E, Yuzda E, trast, the C-termianl part of DISC1 binds to important Rutter M: Autism as a strongly genetic disorder: evidence from a British interacting molecules.. Interactions with LIS1, NDEL, twin study. Psychol Med 1995, 25:63-77. 5. Steffenburg S, Gillberg C, Hellgren L, Andersson L, Gillberg IC, Jakobsson G, FEZ1, integrin and other proteins indicated that many Bohman M: A twin study of autism in Denmark, Finland, Iceland, Norway of the proteins of the “DISC1 network” are involved in and Sweden. J Child Psychol Psychiatry 1989, 30:405-416. pathways critical for neuronal polarization and migra- 6. Folstein S, Rutter M: Infantile autism: a genetic study of 21 twin pairs. J tion, formation of synapses, and dendritic growth and Child Psychol Psychiatry 1977, 18:297-321. 7. Folstein SE, Rosen-Sheidley B: Genetics of autism: complex aetiology for a branching. Up to now, researches have demonstrated heterogeneous disorder. Nat Rev Genet 2001, 2:943-955. that DISC1 is a susceptibility gene for mental disorders 8. Ritvo ER, Freeman BJ, Scheibel AB, Duong T, Robinson H, Guthrie D, Ritvo A: such as autism, schizophrenia and bipolar disorder. Lower Purkinje cell counts in the cerebella of four autistic subjects: initial findings of the UCLA-NSAC Autopsy Research Report. Am J However, it is possible that the underlying pathogeneses Psychiatry 1986, 143:862-866. of DISC1 for different psychiatric disorders might be 9. Fatemi SH, Halt AR, Realmuto G, Earle J, Kist DA, Thuras P, Merz A: Purkinje different. cell size is reduced in cerebellum of patients with autism. Cell Mol Neurobiol 2002, 22:171-175. In conclusion, the present study demonstrated a positive 10. Bailey AJ: Postmortem studies of autism. Autism Res 2008, 1:265. association of DISC1 with autism in Chinese Han popula- 11. Paya Gonzalez B, Fuentes Menchaca N: Neurobiology of autism: tion. Our results provided evidence that DISC1 might neuropathology and neuroimaging studies. Actas Esp Psiquiatr 2007, 35:271-276. involve in the etiology of autism. Further researches of 12. Courchesne E, Carper R, Akshoomoff N: Evidence of brain overgrowth in association analysis across populations are needed. the first year of life in autism. JAMA 2003, 290:337-344. 13. Saitoh O, Karns CM, Courchesne E: Development of the hippocampal formation from 2 to 42 years: MRI evidence of smaller area dentata in Additional material autism. Brain 2001, 124:1317-1324. 14. Verhoeven JS, De Cock P, Lagae L, Sunaert S: Neuroimaging of autism. Neuroradiology 2010, 52:3-14. Additional file 1: 1-DISC1 and autism. Table S1. Results of single 15. Paakki JJ, Rahko J, Long X, Moilanen I, Tervonen O, Nikkinen J, Starck T, marker association for seven SNPs in DISC1 gene in 367 trios by Remes J, Hurtig T, Haapsamo H, et al: Alterations in regional homogeneity Haploview. Table S2. Results of Haplotype association analysis for the of resting-state brain activity in autism spectrum disorders. Brain Res SNPs with linkage disequilibrium in 367 trios by Haploview. Table S3. 2010, 1321:169-179. Frequencies of different alleles and genotypes in different association 16. Griebling J, Minshew NJ, Bodner K, Libove R, Bansal R, Konasale P, studies Figure S1. DISC1 gene linkage disequilibrium (LD) structure in Keshavan MS, Hardan A: Dorsolateral prefrontal cortex magnetic Chinese Han in Beijing (CHB) using HapMap date by Haploview. Tables resonance imaging measurements and cognitive performance in autism. and figures J Child Neurol 2010, 25:856-863. Zheng et al. Behavioral and Brain Functions 2011, 7:14 Page 7 of 8 http://www.behavioralandbrainfunctions.com/content/7/1/14 17. Koshino H, Kana RK, Keller TA, Cherkassky VL, Minshew NJ, Just MA: fMRI 36. Song W, Li W, Feng J, Heston LL, Scaringe WA, Sommer SS: Identification investigation of working memory for faces in autism: visual coding and of high risk DISC1 structural variants with a 2% attributable risk for underconnectivity with frontal areas. Cereb Cortex 2008, 18:289-300. schizophrenia. Biochem Biophys Res Commun 2008, 367:700-706. 18. Allen G, Muller RA, Courchesne E: Cerebellar function in autism: functional 37. Callicott JH, Straub RE, Pezawas L, Egan MF, Mattay VS, Hariri AR, magnetic resonance image activation during a simple motor task. Biol Verchinski BA, Meyer-Lindenberg A, Balkissoon R, Kolachana B, et al: Psychiatry 2004, 56:269-278. Variation in DISC1 affects hippocampal structure and function and 19. Allen G, Courchesne E: Differential effects of developmental cerebellar increases risk for schizophrenia. Proc Natl Acad Sci USA 2005, abnormality on cognitive and motor functions in the cerebellum: an 102:8627-8632. fMRI study of autism. Am J Psychiatry 2003, 160:262-273. 38. Millar JK, Pickard BS, Mackie S, James R, Christie S, Buchanan SR, Malloy MP, 20. Sahyoun CP, Belliveau JW, Soulieres I, Schwartz S, Mody M: Neuroimaging Chubb JE, Huston E, Baillie GS, et al: DISC1 and PDE4B are interacting of the functional and structural networks underlying visuospatial vs. genetic factors in schizophrenia that regulate cAMP signaling. Science linguistic reasoning in high-functioning autism. Neuropsychologia 2010, 2005, 310:1187-1191. 48:86-95. 39. Kim JY, Duan X, Liu CY, Jang MH, Guo JU, Pow-anpongkul N, Kang E, 21. Mostofsky SH, Powell SK, Simmonds DJ, Goldberg MC, Caffo B, Pekar JJ: Song H, Ming GL: DISC1 regulates new neuron development in the adult Decreased connectivity and cerebellar activity in autism during motor brain via modulation of AKT-mTOR signaling through KIAA1212. Neuron task performance. Brain 2009, 132:2413-2425. 2009, 63:761-773. 22. Meyer KD, Morris JA: Disc1 regulates granule cell migration in the 40. Morris JA, Kandpal G, Ma L, Austin CP: DISC1 (Disrupted-In-Schizophrenia developing hippocampus. Hum Mol Genet 2009, 18:3286-3297. 1) is a centrosome-associated protein that interacts with MAP1A, MIPT3, 23. Kamiya A, Kubo K, Tomoda T, Takaki M, Youn R, Ozeki Y, Sawamura N, ATF4/5 and NUDEL: regulation and loss of interaction with mutation. Park U, Kudo C, Okawa M, et al: A schizophrenia-associated mutation of Hum Mol Genet 2003, 12:1591-1608. DISC1 perturbs cerebral cortex development. Nat Cell Biol 2005, 41. Millar JK, Christie S, Porteous DJ: Yeast two-hybrid screens implicate DISC1 7:1167-1178. in brain development and function. Biochem Biophys Res Commun 2003, 24. Duan X, Chang JH, Ge S, Faulkner RL, Kim JY, Kitabatake Y, Liu XB, Yang CH, 311:1019-1025. Jordan JD, Ma DK, et al: Disrupted-In-Schizophrenia 1 regulates 42. Brandon NJ, Handford EJ, Schurov I, Rain JC, Pelling M, Duran-Jimeniz B, integration of newly generated neurons in the adult brain. Cell 2007, Camargo LM, Oliver KR, Beher D, Shearman MS, Whiting PJ: Disrupted in 130:1146-1158. Schizophrenia 1 and Nudel form a neurodevelopmentally regulated 25. Miyoshi K, Honda A, Baba K, Taniguchi M, Oono K, Fujita T, Kuroda S, protein complex: implications for schizophrenia and other major Katayama T, Tohyama M: Disrupted-In-Schizophrenia 1, a candidate gene neurological disorders. Mol Cell Neurosci 2004, 25:42-55. for schizophrenia, participates in neurite outgrowth. Mol Psychiatry 2003, 43. Kamiya A, Tomoda T, Chang J, Takaki M, Zhan C, Morita M, Cascio MB, 8:685-694. Elashvili S, Koizumi H, Takanezawa Y, et al: DISC1-NDEL1/NUDEL protein 26. Hattori T, Shimizu S, Koyama Y, Yamada K, Kuwahara R, Kumamoto N, interaction, an essential component for neurite outgrowth, is modulated Matsuzaki S, Ito A, Katayama T, Tohyama M: DISC1 regulates cell-cell by genetic variations of DISC1. Hum Mol Genet 2006, 15:3313-3323. adhesion, cell-matrix adhesion and neurite outgrowth. Mol Psychiatry 44. Niwa M, Kamiya A, Murai R, Kubo K, Gruber AJ, Tomita K, Lu L, Tomisato S, 2010. Jaaro-Peled H, Seshadri S, et al: Knockdown of DISC1 by in utero gene 27. Faulkner RL, Jang MH, Liu XB, Duan X, Sailor KA, Kim JY, Ge S, Jones EG, transfer disturbs postnatal dopaminergic maturation in the frontal Ming GL, Song H, Cheng HJ: Development of hippocampal mossy fiber cortex and leads to adult behavioral deficits. Neuron 2010, 65:480-489. synaptic outputs by new neurons in the adult brain. Proc Natl Acad Sci 45. Baron-Cohen S, Belmonte MK: Autism: a window onto the development USA 2008, 105:14157-14162. of the social and the analytic brain. Annu Rev Neurosci 2005, 28:109-126. 28. Millar JK, Wilson-Annan JC, Anderson S, Christie S, Taylor MS, Semple CA, 46. Happe F, Booth R, Charlton R, Hughes C: Executive function deficits in Devon RS, St Clair DM, Muir WJ, Blackwood DH, Porteous DJ: Disruption of autism spectrum disorders and attention-deficit/hyperactivity disorder: two novel genes by a translocation co-segregating with schizophrenia. examining profiles across domains and ages. Brain Cogn 2006, 61:25-39. Hum Mol Genet 2000, 9:1415-1423. 47. Carroll LS, Owen MJ: Genetic overlap between autism, schizophrenia and 29. St Clair D, Blackwood D, Muir W, Carothers A, Walker M, Spowart G, bipolar disorder. Genome Med 2009, 1:102. Gosden C, Evans HJ: Association within a family of a balanced autosomal 48. Burbach JP, van der Zwaag B: Contact in the genetics of autism and translocation with major mental illness. Lancet 1990, 336:13-16. schizophrenia. Trends Neurosci 2009, 32:69-72. 30. Blackwood DH, Fordyce A, Walker MT, St Clair DM, Porteous DJ, Muir WJ: 49. Crepel A, Breckpot J, Fryns JP, De la Marche W, Steyaert J, Devriendt K, Schizophrenia and affective disorders–cosegregation with a Peeters H: DISC1 duplication in two brothers with autism and mild translocation at chromosome 1q42 that directly disrupts brain-expressed mental retardation. Clin Genet 2010, 77:389-394. genes: clinical and P300 findings in a family. Am J Hum Genet 2001, 50. Williams JM, Beck TF, Pearson DM, Proud MB, Cheung SW, Scott DA: A 69:428-433. 1q42 deletion involving DISC1, DISC2, and TSNAX in an autism 31. Saetre P, Agartz I, De Franciscis A, Lundmark P, Djurovic S, Kahler A, spectrum disorder. Am J Med Genet A 2009, 149A:1758-1762. Andreassen OA, Jakobsen KD, Rasmussen HB, Werge T, et al: Association 51. Kilpinen H, Ylisaukko-Oja T, Hennah W, Palo OM, Varilo T, Vanhala R, between a disrupted-in-schizophrenia 1 (DISC1) single nucleotide Nieminen-von Wendt T, von Wendt L, Paunio T, Peltonen L: Association of polymorphism and schizophrenia in a combined Scandinavian case- DISC1 with autism and Asperger syndrome. Mol Psychiatry 2008, control sample. Schizophr Res 2008, 106:237-241. 13:187-196. 32. Qu M, Tang F, Yue W, Ruan Y, Lu T, Liu Z, Zhang H, Han Y, Zhang D, 52. Lim SM, Kim HJ, Nam M, Chung JH, Park YH: Association study of DISC1 in Wang F: Positive association of the Disrupted-in-Schizophrenia-1 gene Korean population with autism spectrum disorders. Psychiatr Genet 2009, (DISC1) with schizophrenia in the Chinese Han population. Am J Med 19:160. Genet B Neuropsychiatr Genet 2007, 144B:266-270. 53. Schopler E, Reichler RJ, DeVellis RF, Daly K: Toward objective classification 33. Zhang F, Sarginson J, Crombie C, Walker N, St Clair D, Shaw D: Genetic of childhood autism: Childhood Autism Rating Scale (CARS). J Autism Dev association between schizophrenia and the DISC1 gene in the Scottish Disord 1980, 10:91-103. population. Am J Med Genet B Neuropsychiatr Genet 2006, 141B:155-159. 54. Krug DA, Arick J, Almond P: Behavior checklist for identifying severely 34. Hodgkinson CA, Goldman D, Jaeger J, Persaud S, Kane JM, Lipsky RH, handicapped individuals with high levels of autistic behavior. J Child Malhotra AK: Disrupted in schizophrenia 1 (DISC1): association with Psychol Psychiatry 1980, 21:221-229. schizophrenia, schizoaffective disorder, and bipolar disorder. Am J Hum 55. O’Connell JR, Weeks DE: PedCheck: a program for identification of Genet 2004, 75:862-872. genotype incompatibilities in linkage analysis. Am J Hum Genet 1998, 35. Zhang X, Tochigi M, Ohashi J, Maeda K, Kato T, Okazaki Y, Kato N, 63:259-266. Tokunaga K, Sawa A, Sasaki T: Association study of the DISC1/TRAX locus 56. Rabinowitz D, Laird N: A unified approach to adjusting association tests with schizophrenia in a Japanese population. Schizophr Res 2005, for population admixture with arbitrary pedigree structure and arbitrary 79:175-180. missing marker information. Hum Hered 2000, 50:211-223. Zheng et al. Behavioral and Brain Functions 2011, 7:14 Page 8 of 8 http://www.behavioralandbrainfunctions.com/content/7/1/14 57. Barrett JC, Fry B, Maller J, Daly MJ: Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 2005, 21:263-265. 58. Cannon TD, van Erp TG, Bearden CE, Loewy R, Thompson P, Toga AW, Huttunen MO, Keshavan MS, Seidman LJ, Tsuang MT: Early and late neurodevelopmental influences in the prodrome to schizophrenia: contributions of genes, environment, and their interactions. Schizophr Bull 2003, 29:653-669. 59. Harrison PJ, Weinberger DR: Schizophrenia genes, gene expression, and neuropathology: on the matter of their convergence. Mol Psychiatry 2005, 10:40-685, image 4. 60. Lisman JE, Coyle JT, Green RW, Javitt DC, Benes FM, Heckers S, Grace AA: Circuit-based framework for understanding neurotransmitter and risk gene interactions in schizophrenia. Trends Neurosci 2008, 31:234-242. 61. Jaaro-Peled H, Hayashi-Takagi A, Seshadri S, Kamiya A, Brandon NJ, Sawa A: Neurodevelopmental mechanisms of schizophrenia: understanding disturbed postnatal brain maturation through neuregulin-1-ErbB4 and DISC1. Trends Neurosci 2009, 32:485-495. 62. Hennah W, Varilo T, Kestila M, Paunio T, Arajarvi R, Haukka J, Parker A, Martin R, Levitzky S, Partonen T, et al: Haplotype transmission analysis provides evidence of association for DISC1 to schizophrenia and suggests sex-dependent effects. Hum Mol Genet 2003, 12:3151-3159. 63. Prata DP, Mechelli A, Fu CH, Picchioni M, Kane F, Kalidindi S, McDonald C, Kravariti E, Toulopoulou T, Miorelli A, et al: Effect of disrupted-in- schizophrenia-1 on pre-frontal cortical function. Mol Psychiatry 2008, 13:915-917, 909. 64. Eastwood SL, Walker M, Hyde TM, Kleinman JE, Harrison PJ: The DISC1 Ser704Cys substitution affects centrosomal localization of its binding partner PCM1 in glia in human brain. Hum Mol Genet 2010, 19:2487-2496. 65. Hashimoto R, Numakawa T, Ohnishi T, Kumamaru E, Yagasaki Y, Ishimoto T, Mori T, Nemoto K, Adachi N, Izumi A, et al: Impact of the DISC1 Ser704Cys polymorphism on risk for major depression, brain morphology and ERK signaling. Hum Mol Genet 2006, 15:3024-3033. 66. Camargo LM, Collura V, Rain JC, Mizuguchi K, Hermjakob H, Kerrien S, Bonnert TP, Whiting PJ, Brandon NJ: Disrupted in Schizophrenia 1 Interactome: evidence for the close connectivity of risk genes and a potential synaptic basis for schizophrenia. Mol Psychiatry 2007, 12:74-86. 67. Hayashi-Takagi A, Takaki M, Graziane N, Seshadri S, Murdoch H, Dunlop AJ, Makino Y, Seshadri AJ, Ishizuka K, Srivastava DP, et al: Disrupted-in- Schizophrenia 1 (DISC1) regulates spines of the glutamate synapse via Rac1. Nat Neurosci 2010, 13:327-332. 68. Ming GL, Song H: DISC1 partners with GSK3beta in neurogenesis. Cell 2009, 136:990-992. 69. Shinoda T, Taya S, Tsuboi D, Hikita T, Matsuzawa R, Kuroda S, Iwamatsu A, Kaibuchi K: DISC1 regulates neurotrophin-induced axon elongation via interaction with Grb2. J Neurosci 2007, 27:4-14. doi:10.1186/1744-9081-7-14 Cite this article as: Zheng et al.: Evidence for association between Disrupted-in-schizophrenia 1 (DISC1) gene polymorphisms and autism in Chinese Han population: a family-based association study. Behavioral and Brain Functions 2011 7:14. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit

Journal

Behavioral and Brain Functions – Springer Journals

Published: May 15, 2011

There are no references for this article.