Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/springer-journals/examination-of-the-molecular-control-of-ruminal-epithelial-function-in-H9F9dSrlA4
- Publisher
- Springer Journals
- Copyright
- Copyright © 2016 by The Author(s).
- Subject
- Life Sciences; Agriculture; Biotechnology; Food Science; Animal Genetics and Genomics; Animal Physiology
- eISSN
- 2049-1891
- DOI
- 10.1186/s40104-016-0114-8
- pmid
- 27651894
- Publisher site
- See Article on Publisher Site
Abstract
Background: The objective of this study was to investigate the effect of dietary restriction and subsequent compensatory growth on the relative expression of genes involved in volatile fatty acid transport, metabolism and cell proliferation in ruminal epithelial tissue of beef cattle. Sixty Holstein Friesian bulls (mean liveweight 370 ± 35 kg; mean age 479 ± 15 d) were assigned to one of two groups: (i) restricted feed allowance (RES; n = 30) for 125 d (Period 1) followed by ad libitum access to feed for 55 d (Period 2) or (ii) ad libitum access to feed throughout (ADLIB; n = 30). Target growth rate for RES was 0.6 kg/d during Period 1. At the end of each dietary period, 15 animals from each treatment group were slaughtered and ruminal epithelial tissue and liquid digesta harvested from the ventral sac of the rumen. Real-time qPCR was used to quantify mRNA transcripts of 26 genes associated with ruminal epithelial function. Volatile fatty acid analysis of rumen fluid from individual animals was conducted using gas chromatography. Results: Diet × period interactions were evident for genes involved in ketogenesis (BDH2, P = 0.017), pyruvate metabolism (LDHa, P = 0.048; PDHA1, P = 0.015) and cellular transport and structure (DSG1, P = 0.019; CACT, P =0. 027). Ruminal concentrations of propionic acid (P = 0.018) and n-valeric acid (P = 0.029) were lower in RES animals, compared with ADLIB, throughout the experiment. There was also a strong tendency (P = 0.064) toward a diet × period interaction for n-butyric with higher concentrations in RES animals, compared with ADLIB, during Period 1. Conclusions: These data suggest that following nutrient restriction, the structural integrity of the rumen wall is compromised and there is upregulation of genes involved in the production of ketone bodies and breakdown of pyruvate for cellular energy. These results provide an insight into the potential molecular mechanisms regulating ruminal epithelial absorptive metabolism and growth following nutrient restriction and subsequent compensatory growth. Keywords: Beef cattle, Compensatory growth, Feed efficiency, Nutrient restriction, Rumen epithelium * Correspondence: david.kenny@teagasc.ie School of Agriculture and Food Science, University College Dublin, Belfield, Dublin 4, Ireland Animal and Bioscience Research Department, Animal & Grassland Research and Innovation Centre, Teagasc Grange, Dunsany, Co. Meath, Ireland Full list of author information is available at the end of the article © 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. O’Shea et al. Journal of Animal Science and Biotechnology (2016) 7:53 Page 2 of 12 Background Health and Children in accordance with the European Compensatory growth is an accelerated growth rate, Community Directive 86/609/EC. upon re-alimentation, typically observed following a period of under-nutrition, to facilitate an animal in Animal model reaching its genetically pre-determined growth potential This experiment was conducted as part of a larger study [18]. The compensatory growth phenomenon has trad- designed to examine the physiological and molecular itionally been exploited by beef producers to reduce the control of compensatory growth in growing beef cattle overwintering feed costs of cattle production [2, 36]. [22]. Animals were managed on the same farm from two Additionally, during compensatory growth, animals also weeks of age prior to being transferred to Teagasc Grange exhibit enhanced feed efficiency [22], which can lead, Beef Research Centre, Dunsany, Co. Meath, Ireland. Sixty not only to improved profitability but also to a reduction purebred Holstein Friesian bulls (mean liveweight 370 ± in ruminal methane emissions [6, 13] therefore reducing 35 kg; mean age 479 ± 15 d) were blocked on the basis of the carbon footprint of beef production. However, live weight, age and sire and were subsequently assigned although the compensatory growth phenomenon is within block to one of two dietary regimens (i) restricted widely utilised throughout the world, there is a dearth of feed allowance for 125 d (RES; n = 30) followed by ad knowledge in relation to the biological control governing libitum access to feed for a further 55 d (RES; n =15) the expression of the trait. or (ii) ad libitum access to feed throughout the trial Up to 75 % of a ruminants metabolizable energy supply (ADLIB; n = 30). In order to acclimatise the animals to is provided through volatile fatty acids (VFAs), which are their environment and reduce any latent influence of pre- generated from the ruminal fermentation of ingested plant vious environments, all animals were subjected to a material. Indeed it is estimated that 65 % of overall diges- 3 mon common feeding period of ad libitum grass tion occurs in the rumen alone [53], indicating the central silage plus 2 kg of concentrate per head per day prior to importance of ruminal function to overall animal feed util- commencing the experiment. The first 125 d of the isation and efficiency. Diet composition has previously trial was denoted as Period 1 and the subsequent 55 d as been shown to affect the absorptive metabolism in ruminal Period 2. tissue of both sheep [7, 8, 52] and cattle [21, 39]. Addition- All animals were offered the same diet consisting of ally a period of feed restriction in cattle has been shown to 70:30 concentrate:forage (grass silage) throughout the increase total digestive tract digestibility [1]. Furthermore, entire trial, with RES animals receiving a restricted ration the rumen has been shown to be one of the most respon- compared to ADLIB animals. Further details of the diet sive tissues to both dietary restriction and subsequent re- employed are provided by Keogh et al. [22] RES animals alimentation [22, 41, 57]. However, potential effects of were managed to grow at 0.6 kg /d, with ADLIB animals compensatory growth following dietary restriction and expected to gain in excess of 1.5 kg/d during Period 1. subsequent re-alimentation, on ruminal epithelial function Following completion of Period 1, 15 animals from each have not been assessed, to date. We hypothesized that in treatment (RES and ADLIB) were slaughtered. Prior to the animals undergoing compensatory growth there would be commencement of Period 2 the previously restricted an up-regulation of the relative expression of genes animals (RES) were allowed a 15 d transition period in involved in VFA absorption and metabolism, as well as order to build up to an ad libitum feed intake. This transi- genes underlying growth and proliferation of the ruminal tion period was implemented to allow animals to acclima- epithelium. We were also interested in investigating the tise to a higher plane of nutrition while preventing the possibility that the structural integrity of the rumen epithe- development of intestinal disorders, such as acidosis. All lium itself is altered during nutrient restriction. As such, remaining bulls (n = 30) were then offered the control diet the aim of this study was to examine the effect of dietary ad libitum for a further 40 d before slaughter. All restriction and subsequent re-alimentation induced com- animals were slaughtered in an EU licensed abattoir (Euro pensatory growth, on the expression of 26 genes involved Farm Foods Ltd, Cooksgrove, Duleek, Co. Meath, Ireland). in VFA transport, metabolism, growth and cellular struc- Slaughter order was randomized to account for potential ture in the ruminal epithelium of Holstein Friesian bulls. confounding effects on treatment outcomes. Animals were allowed a re-alimentation period of 55 d in order to capture the greatest increment of compensatory Sample collection at slaughter growth, as previously described by Hornick et al. [18]. Tissue samples were excised post-mortem from the ventral sac of the rumen within 40 min of slaughter Methods [26]. All instruments used for tissue collection were All procedures involving animals were approved by sterilized and treated with RNaseZap (Ambion, Applera the University College Dublin Animal Research Ethics Ireland, Dublin, Ireland) prior to use. Rumen papillae Committeeand licensed by theIrish Department of were harvested directly using a scissors. Samples were O’Shea et al. Journal of Animal Science and Biotechnology (2016) 7:53 Page 3 of 12 washed thoroughly with sterile, RNase free, phosphate metabolism, cellular transport proteins, ketogenesis and buffered saline and subsequently snap frozen in liquid pyruvate metabolism. Gene specific primers (n = 26) used nitrogen before being stored at -80 °C. in this study were previously employed in studies of Penner Ruminal digesta was sampled from five different points et al. [39], Wang and Jiang [54] and Steele et al. [49] or within the rumen of each bull at slaughter, including the specifically designed for use in the current study. Primer3 dorsal and ventral sacs. Rumen digesta was strained using (http://frodo.wi.mit.edu/primer3/) and Primer BLAST cheese cloth, isolating the liquid fraction for VFA analysis. (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) software Rumen fluid samples were subsequently decanted to the was utilized to design primers [24, 51]. Primer specificity appropriate vials using a graduated Gilsen pipette in order was established using the Basic Local Alignment Search to facilitate appropriate digesta:preservative volumes. 20 mL Tool (BLAST) from the National Centre for Biotechnol- samples were preserved with 0.5 mL of 9 mol/L sulphuric ogy Information (http://www.ncbi.nlm.nih.gov/BLAST/). acid and stored at -20 °C for subsequent VFA analysis. All primers targeting reference and candidate genes were obtained from a commercial supplier (Sigma-Aldrich VFA analysis Ireland, Dublin, Ireland). Details of primer sets used in The concentration of VFAs (acetic, propionic, iso- this study are listed in Table 1. All amplified PCR products butyric, n-butyric, isovaleric and n-valeric) collected at were sequenced to verify their identity (Macrogen Europe, each slaughter time-point was measured in ruminal fluid Meibergdreef 39, 1105AZ Amsterdam, The Netherlands) using an automated gas chromatograph (Shimadzu Gas and all amplicons were confirmed 100 % homologous to Chromatography GC-8A, Shimadzu Corporation, Kyoto, their target sequence. Japan; Brotz and Schaefer, 1987). To determine relative gene expression level of target genes, five suitable reference genes were tested across all RNA extraction and purification samples using qRT-PCR viz. glyceraldehyde 3-phosphate Total RNA was isolated from approximately 100 mg of dehydrogenase (GAPDH), ribosomal protein large P0 frozen rumen papillae tissue using TRIzol reagent and (RPLP0),ATP synthase subunit β (ATP5B), hypoxanthine chloroform (Sigma-Aldrich Ireland, Dublin, Ireland). phosphoribosyltransferase 1 (HPRT1) and β2microglobulin Tissue samples were homogenised using a rotor-stator (B2M). In order to select stable reference genes, reference homogenizing tissue lyser (Qiagen, UK), following which gene expression data were analysed using GeNorm the RNA was precipitated using isopropanol. Samples (GenEx 5.2.1.3, MultiD Analyses AB, Gothenburg, were then purified using an RNeasy Plus Mini Kit (Qiagen, Sweden). GeNorm is a model-based approach software UK), according to the manufacturers instructions in order that measures the overall stability of the tested refer- to remove any contaminating genomic DNA. The quantity ence genes by calculating the intra-and intergroup vari- of the RNA isolated was determined by measuring the ation and combining both coefficients to give a stability absorbance at 260 nm using a Nanodrop spectrophotom- value (M value). A lower M value implies a higher sta- eter ND-1000 (Nanodrop Technologies, DE, USA). RNA bility in gene expression across all samples. An M value quality was assessed on the Agilent Bioanalyser 2100 using of 1.5 is specified as the default minimum coefficient by the RNA 6000 Nano Lab Chip kit (Agilent Technologies the GeNorm programme. In the current study, all refer- Ireland Ltd., Dublin, Ireland). RNA quality was also veri- ence genes tested displayed M values lower than 1.5. fied by ensuring all RNA samples had an absorbance (A260/280) of between 1.8 and 2. RNA samples with 28S/ qRT-PCR 18S ratios ranging from 1.8 – 2.0 and RNA integrity num- Following reverse transcription, cDNA quantity was ber of between 8 and 10 were deemed to be of high determined and standardised to the required concen- quality. tration for qRT-PCR. Triplicate 20 μL reactions were carried out in 96-well optical reaction plates (Applied cDNA synthesis Biosystems, Warrington, UK), containing 2 μLcDNA, Total RNA (2 μg) was reverse transcribed into cDNA 10 μL Fast SYBR Green PCR Master Mix (Applied using a High Capacity cDNA Reverse Transcription Kit Biosystems, Warrington, UK), 7 μLnuclease-free (Applied Biosystems, Foster City, CA, USA) using the H O, and 1 μL forward and reverse primers (250- Multiscribe™ reverse transcriptase according to manufac- 1,000 nmol/L per primer). Assays were performed turers instructions. Samples were stored at -20 °C for using the ABI 7500 Fast qRT-PCR System (Applied subsequent analysis. Biosystems, Warrington, UK) with the following cyc- ling parameters; 95 °C for 20 s and 40 cycles of 95 °C Primer design and reference gene selection for 3 s, 60 °C for 30s followed by amplicon dissoci- Genes involved in the following processes were investi- ation (95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s gated in the current study: growth and structure, VFA and 60 °C for 15 s). Amplification efficiencies were O’Shea et al. Journal of Animal Science and Biotechnology (2016) 7:53 Page 4 of 12 Table 1 Sequences of oligonucleotide primers used for qRT-PCR Gene name Accession number Primer sequences Amplicon size, bp Endogenous control RPLP0 NM_001012682 F: AGGGCGTCCGCAATGTT 54 R: CGACGGTTGGGTAACCAATC GAPDH NM_001034034 F: GATTGTCAGCAATGCCTCCT 135 R: CCATCCACAGTCTTCTGGGT ATP5B NM_175796 F: CCCTCAAGGAGACCATCAAA 184 R: GGACACCATGGAGGATGAGT HPRT1 NM_001034035 F: GCCGACCTGTTGGATTACAT 205 R: GCATTGTCTTCCCAGTGTCA B2M NM_173893 F: AGCGTCCTCCAAAGATTCAA 156 R: ACAGGTCTGACTGCTCCGAT Cellular structure and growth CCND1 NM_001046273 F: GCACTTCCTCTCCAAGATGC 204 R: GTCAGGCGGTGATAGGAGAG CCND2 NM_001076372 F: CCAGACCTTCATCGCTCTGT 163 R: GATCTTTGCCAGGAGATCCA CCND3 NM_001034709 F: TCCAAGCTGCGCGAGACTAC 178 R: GAGAGAGCCGGTGCAGAATC CCNE1 XM_612960 F: TTGACAGGACTGTGAGAAGC 187 R: TTCAGTACAGGCAGTGGCGA CCNE2 NM_001015665 F: CTGCATTCTGAGTTGGAACC 229 R: CTTGGAGCTTAGGAGCGTAG CDKN1A NM_001098958 F: GCAGACCAGCATGACAGATT 205 R: GTATGTACAAGAGGAGGCGT CDKN2A XM_868375 F:GTGCGCCGGTTCTTGATTAC 105 R: CCCATCATCATCACCCGCTG CDKN2B NM_001075894 F: GCGGTGGATTATCCTGGACA 210 R: CATCATCATCACCTGGATCG DSG1 NM_174045.1 F: AGACAGAGAGCAATATGGCCAGT 121 R: TTCACACTCTGCTGACATACCATCT VFA activation ACS DQ489534 F: GCTCTCACTGAGGAGCTCAAGAA 64 R: AATCCGGTGTGGCAATGG ACSS1 BC114698.1 F: CCGATCAGGTCCTGGTAGTGA 200 R: GAGCCATCACTTGGCACCTC PCCA BC123876 F: AGAATGGAAGATGCCCTGGAT 70 R: CCTCTCGAAGCAATGCGATAT Transport Proteins CACT NM_001077936.2 F: TCACGCTCATGCGAGATGTT 94 R: TTGACGCTCTTTCCCTCTGG NHE1 NM_174833.2 F: CCGTCACTGTGGTCCTGTAT 88 R: CTCAGGAAGCCGAGGATGAT NHE2 XM_604493 F: TGCTCATCATGGTGGGACTT 83 O’Shea et al. Journal of Animal Science and Biotechnology (2016) 7:53 Page 5 of 12 Table 1 Sequences of oligonucleotide primers used for qRT-PCR (Continued) R: CACATCAGTCTTCATGGCCG NHE3 AJ131764.1 F: AGGTGCAGCTGGAGATCAT 102 R: GACCTTGTTCTCGTCCAGGA Ketogenesis ACAT NM_001034319.1 F: AATAGGCAGTGTTCGTCGGG 102 R: CATGGACTCCACCCCACAAG HMGCL NM_001075132 F: TGCAGATGGGAGTGAGTGTCA 73 R: GACGCCCCCTGTGCATAG BDH1 NM_001034600 F: GACTGCCACCACTCCCTACAC 59 R: TCCGCAGCCACCAGTAGTAGT BDH2 NM_001034488 F: CTGAAGAGGCACTGAGCGAT 98 R: ATCAGAGGCCAAGTACACGC HMGCS1 AY581197 F: AGGATACTCATCACTTGGCCAACT 67 R: CATGTTCCTTCGAAGAGGGAAT HMGCS2 NM_001045883 F: TCTGGCCCATCACTCTGCC 126 R: AGTGGGGAGCCTGGAGAAGC Pyruvate Metabolism LDHa BC146210 F: GGCAAAGACTATAATGTGACAGCAA 60 R: ACGTGCCCCAGCTGTGA LDHb BC142006 F: CCAACCCAGTGGATATTCTCACA 66 R: TCACACGGTGCTTGGGTAATC PC NM_177946 F: CTCCCACCATCTGTCCTTTCC 72 R: TTTATTTGGGCAGGAGATGAATACG PDHA1 NM_001101046 F: CAGTTTGCTACTGCTGATCCTGAA 72 R: AGGTGGATCGTTGCAGTAAATGT RPLP0 ribosomal protein large P0, GAPDH glyceraldehyde 3-phosphate dehydrogenase, ATP5B ATP synthase subunit β, HPRT1 hypoxanthine phosphoribosyltransferase 1, B2M β2 microglobulin, CCND1 cyclin D1, CCND2 cyclin D2, CCND3 cyclin D3, CCNE1 cyclin E1, CCNE2 cyclin E2, CDKN1A cyclin dependant kinase inhibitor 1A, CDKN2A cyclin dependant kinase inhibitor 2A, CDKN2B cyclin dependant kinase inhibitor 2B, DSG1 desmoglein 1, ACS acetyl coA synthetase, ACSS1 acyl coA synthetase short- + + chain family member 1, PCCA propionyl coA carboxylase α polypeptide, CACT solute carrier family 25, carnitine/acylcarnitine translocase member 20, NHE1 NA /H + + + + exchanger isoform 1, NHE2 NA /H exchanger isoform 2, NHE3 NA /H exchanger isoform 3, ACAT acetyl coA acyltransferase, HMGCL 3-Hydroxymethyl-3-methylglutaryl- coA lyase, hydroxymethylglutaricaacidura, BDH1 3-Hydroxybutyrate dehydrogenase, type 1, BDH2 3-Hydroxybutyrate dehydrogenase, type 2, HMGCS1 3-Hydroxy-3- methylglutaryl-coA synthase 1, HMGCS2 3-Hydroxy-3-methylglutaryl-coA synthase 2, LDHa lactate dehydrogenase isoform a, LDHb lactate dehydrogenase isoform b, PC pyruvate carboxylase, PDHA1 pyruvate dehydrogenase lipoamide, α 1 determined for all candidate and reference genes Statistical analysis using the formula E = 10^(1/slope), with the slope of Gene expression data were checked for normality using the linear curve of cycle threshold (C ) values plotted the UNIVARIATE procedure of Statistical Analysis Soft- against the log dilution [16]. Efficiency co-efficients of ware (SAS version 9.3; SAS Institute Inc., Cary, NC). primers were estimated using serial dilutions, run as Where necessary, data were transformed using a Box-Cox separate assays. Primers with efficiencies of between transformation (PROC TRANSREG), by raising values to 90 and 110 % were deemed suitable. Interplate vari- the power of λ. Data were subsequently analysed using ation was accounted for by using an interplate cali- mixed models ANOVA (PROC MIXED) with terms for brator, i.e., a common amplification was performed diet and period as well as their interaction included as the on thesamesampleacrossall plates.The software main effects, with block included as a random effect in the package GenEx 5.2.1.3. (MultiD Analyses AB, Gothen- statistical model employed. The choice of residual covari- burg, Sweden) was used to correct for interplate ance structure was based on the magnitude of the Akaike variation, efficiency correction of the raw C values, Information Criterion (lowest is best) for models run under normalisation to the reference genes and calculation compound symmetry, unstructured, autoregressive, or of quantities relative to the maximum C value for Toeplitz variance-covariance structures. The Tukey critical each gene. difference test was performed to determine the existence O’Shea et al. Journal of Animal Science and Biotechnology (2016) 7:53 Page 6 of 12 of statistical differences between treatment LS mean values. VFA. Acetic (P = 0.024), propionic (P <0.001), (P =0.033) Statistical significance was declared at P <0.05 and trends and n-valeric acid (P < 0.001) were all higher during at P < 0.10. Period 2 compared with Period 1 while the concen- tration of iso-butyric acid (P < 0.001) and iso-valeric Results acid (P = 0.029) was lower in Period 2 than in Period 1. Animal performance Total VFA content of the rumen fluid was not affected by The animal performance data have been presented in diet (P > 0.05) but was higher in Period 2, compared with detail by Keogh et al. [22]. Briefly, average daily gain Period 1 (P = 0.001), consistent with the overall increase in (ADG) for Period 1 was 0.6 kg/d for RES animals and DMI in both treatment groups [22]. 1.9 kg/d for ADLIB animals. During re-alimentation (Period 2) an ADG of 2.5 kg/d and 1.4 kg/d was Gene expression observed for RES and ADLIB groups, respectively. This The effects of diet and period on gene expression are resulted in differences in bodyweight of 161 and 84 kg outlined in Table 3. Diet × period interactions were between RES and ADLIB treatments at the end of Period evident for DSG1 (P = 0.019); CACT (P = 0.027); 1 and 2, respectively. A treatment by period interaction BDH2 (P = 0.017); LDHa (P = 0.048) and PDHA1 (P = (P < 0.01) was detected for the weight of the reticulo- 0.015). These were manifested as follows. Expression rumen when empty [22]. The empty reticulo-rumen was of both DSG1 and CACT was lower in RES animals lighter in RES animals following a period of dietary compared to ADLIB at the end of Period 1, and sub- restriction at the end of Period 1, however, there was no sequently greater in RES at the end of Period 2. difference in empty reticulo-rumen weights between mRNA expression of BDH2, LDHa,and PDHA1 was treatment groups at the end of Period 2. greater in RES at the end of Period 1, with no differ- ence observed between treatment groups at the end VFA analysis of Period 2. Additionally, there was a tendency (P = The effects of diet and period on molar proportions of in- 0.053) towards a treatment × period interaction for dividual VFAs in the rumen fluid are outlined in Table 2. BDH1 which manifested as greater expression in An effect of diet was observed on the proportions of pro- RES, compared with ADLIB, animals during Period 1, pionic acid (P = 0.018) and n-valeric acid (P =0.029) with but no difference between groups during Period 2. reduced proportions in RES animals, compared with Lower expression levels across treatments in Period 1 ADLIB, throughout the experiment. We also observed a compared with Period 2, resulted in period effects for tendency (P = 0.064) toward a diet × period interaction for the following genes: CCND1 (P = 0.018); CCND3 (P < the proportion of n-butyric acid with greater proportions 0.001); CDKN2A (P = 0.039); PCCA (P = 0.004); NHE3 in RES animals, compared with ADLIB, during Period 1, (P < 0.001); ACAT (P = 0.006); HMGCS2 (P < 0.001); while the inverse was observed at the end of Period 2. No LDHβ (P = 0.002) and PC (P = 0.004). Whereas greater effect of diet was observed for concentrations of acetic expression across treatments at the end of Period 1 acid, iso-butyric or iso-valeric acid (P >0.05). Period ef- compared with Period 2 led to a statistically signifi- fects were witnessed for the concentration of a number of cant effect of period on transcript abundance for ACSS1 Table 2 Effect of diet (D) and period (P) on volatile fatty acid (VFA) levels in rumen fluid RES ADLIB Significance b c Period 1 Period 2 Period 1 Period 2 SEM D P D*P Molar Proportions, mmol/L VFA Acetic Acid 60.9 67.79 52.14 77.57 6.875 0.942 0.024 0.186 Propionic Acid 13.98 28.44 20.1 34.75 2.506 0.018 <0.001 0.968 N-Butyric Acid 10.5 11.09 6.02 13.84 1.895 0.653 0.033 0.064 Iso-Butyric Acid 1.84 0.15 1.1 0.54 0.202 0.351 <0.001 0.562 N-Valeric Acid 0.88 2.18 1.38 2.87 0.261 0.029 <0.001 0.708 Iso-Valeric Acid 2.31 1.55 2.31 1.97 0.244 0.386 0.029 0.388 Total, mmol/L VFA 90.42 111.18 83.04 131.55 9.831 0.513 0.001 0.167 Acetate:Propionate Ratio 4.4 2.4 2.6 2.2 Ruminal fluid samples were taken from 5 different points within the rumen of each bull at slaughter and VFA levels were measured using an automated gas chromatograph SEM, standard error of the mean D*P, diet × period interaction O’Shea et al. Journal of Animal Science and Biotechnology (2016) 7:53 Page 7 of 12 Table 3 Effect of diet (D) and period (P) on the relative expression of key genes in ruminal epithelial tissue RES ADLIB Significance b c d Gene Period 1 Period 2 Period 1 Period 2 SEM D P D*P Growth and Structure CCND1 5.804 16.219 7.981 11.04 2.701 0.586 0.018 0.182 CCND2 6.544 20.787 13.521 13.724 4.054 0.618 0.183 0.192 CCND3 6.156 50.062 9.498 37.621 9.179 0.957 <0.001 0.396 CCNE1 20.302 43.776 31.736 30.536 8.105 0.913 0.185 0.137 CCNE2 58.975 106.52 86.475 79.928 27.07 0.913 0.948 0.325 CDKN1A 11.429 21.017 13.367 13.944 4.724 0.590 0.288 0.347 CDKN2A 5.6178 14.964 12.357 17.614 3.236 0.245 0.039 0.532 CDKN2B 13.851 23.052 14.281 12.594 5.554 0.372 0.503 0.334 DSG1 7.82 50.432 40.351 27.469 13.02 0.273 0.051 0.019 VFA activation ACS 2.72 2.359 2.12 2.588 0.155 0.826 0.103 0.733 ACSS1 2.579 2.047 2.703 2.079 0.338 0.818 0.096 0.893 PCCA 1.75 1.911 1.498 1.896 0.128 0.303 0.004 0.358 Transport proteins CACT 6.597 8.145 10.829 4.969 1.61 0.745 0.189 0.027 NHE1 17.983 7.76 15.672 8.039 1.238 0.418 <0.001 0.302 NHE2 3.455 2.964 2.94 3.197 0.355 0.695 0.745 0.300 NHE3 2.609 8.503 2.759 6.313 0.79 0.212 <0.001 0.148 Ketogenesis ACAT 12.153 31.857 12.779 20.89 4.802 0.289 0.006 0.235 HMGCL 2.313 5.241 3.169 5.171 0.42 0.356 <0.001 0.278 BDH1 3.971 1.67 3.29 1.99 0.251 0.476 <0.001 0.053 BDH2 3.491 2.803 2.1 2.931 0.304 0.045 0.815 0.017 HMGCS1 6.51 3.476 6.989 2.607 0.779 0.804 <0.001 0.392 HMGCS2 2.641 3.676 2.21 4.586 0.401 0.554 <0.001 0.103 Pyruvate metabolism LDHa 1.915 1.719 1.609 1.789 0.092 0.207 0.931 0.048 LDHb 1.749 2.151 1.685 2.074 0.121 0.564 0.002 0.959 PC 2.001 2.928 2.409 2.986 0.247 0.355 0.004 0.484 PDHA1 2.074 1.248 1.619 1.265 0.093 0.024 <0.001 0.015 Gene expression values were normalized to the reference gene after adjustment for efficiencies and interplate variation and converted to values relative to the greatest cycle threshold (Ct) within each data set CCND1 cyclin D1, CCND2 cyclin D2, CCND3 cyclin D3, CCNE1 cyclin E1, CCNE2 cyclin E2, CDKN1A cyclin dependant kinase inhibitor 1A, CDKN2A cyclin dependant kinase inhibitor 2A, CDKN2B cyclin dependant kinase inhibitor 2B, DSG1 desmoglein 1, ACS acetyl coA synthetase, ACSS1 acyl coA synthetase short-chain family + + member 1, PCCA propionyl coA carboxylase α polypeptide, CACT solute carrier family 25, carnitine/acylcarnitine translocase member 20, NHE1 NA /H exchanger + + + + isoform 1, NHE2 NA /H exchanger isoform 2, NHE3 NA /H exchanger isoform 3, ACAT acetyl coA acyltransferase, HMGCL 3-Hydroxymethyl-3-methylglutaryl-coA lyase, hydroxymethylglutaricaacidura, BDH1 3-Hydroxybutyrate dehydrogenase, type 1, BDH2 3-Hydroxybutyrate dehydrogenase, type 2, HMGCS1 3-Hydroxy-3- methylglutaryl-coA synthase 1, HMGCS2 3-Hydroxy-3-methylglutaryl-coA synthase 2, LDHa lactate dehydrogenase isoform a, LDHb lactate dehydrogenase isoform b, PC pyruvate carboxylase, PDHA1 pyruvate dehydrogenase lipoamide, α 1 SEM, standard error of the mean D*P, diet × period interaction (P =0.096); NHE1 (P <0.001) and HMGCS1 (P <0.001). Discussion The following genes were not affected (P > 0.05) by either The rumen is central to digestion in ruminants, with dietary restriction or subsequent re-alimentation: CCND2, approximately 65 % of overall digestion occurring within CCNE1, CCNE2, CDKN1A, CDKN2B, ACS and NHE2. the organ [53] and characterised by the supply of O’Shea et al. Journal of Animal Science and Biotechnology (2016) 7:53 Page 8 of 12 metabolisable energy in the form of microbial derived of propionic acid with a 2-carbon unit intermediate syn- VFA. Given the central role of this organ to digestion it thesizes n-valeric acid, therefore a lower availability of n- is not surprising that the rumen is one of the most re- valeric acid may be a direct consequence of the aforemen- sponsive tissues to both dietary restriction and subse- tioned reduction in propionic acid production [40]. quent re-alimentation. Indeed, this was observed in the Similarly, Whitelaw et al. [56] also observed a decline in animals utilised in the current study [22] as well as in ruminal n-valeric acid concentrations following a period other studies investigating compensatory growth in cat- of dietary restriction. tle [41, 57]. However, despite its central importance to Recently, Minuti et al. [35] suggested that changes in animal performance, the effect of feed restriction and the expression of genes involved in immune function, subsequent compensatory growth on ruminal epithelial cellular proliferation and integrity and transport within function has not been previously examined. In the rumen epithelial tissue of dairy cows, may be due to diet- current study we hypothesised that a period of dietary ary alterations and possibly driven by nutrient induced restriction, followed by subsequent re-alimentation in- changes in microbes and microbial metabolism. Indeed duced compensatory growth, would affect VFA absorp- our own group has recently shown dramatic differences in tion and metabolism as well as cellular structure and rumen bacteria and archaea in solid and liquid fractions of growth of ruminal epithelial tissue. This was investigated rumen digesta from the same animals utilised in the through an examination of the expression of key compo- current study, using phylogenetic amplicon sequencing nent genes involved in each of these processes. We fo- technology [33]. Specifically we found a large reduction in cussed on the first two mon of re-alimentation as the the abundance of an uncharacterised Succinovibrionaceae greatest increment of compensatory growth is known to and an increase in Methanobrevibacter gottschalkii con- occur during this period [18]. sistent with the observed increase in the acetate:propio- nate ratio of RES cattle. VFA concentration and activation Intraruminal administration of acetate, propionate and In ruminants, VFAs are synthesized within the rumen butyrate have been shown to stimulate the growth and through intensive microbial degradation of ingested functional maturation of the rumen epithelium in young carbohydrates. These short chain fatty acids are of cen- ruminants, with the effect of butyrate being most promin- tral importance as an energy supply for the ruminant, ent toward rumen papillae proliferation [25, 42, 43, 47]. providing up to 75 % of energy requirements. Previous However, Wang and Jiang [54] observed that rumen reports in the literature have demonstrated that a fermentation does not directly stimulate rumen epithelial period of feed restriction can reduce VFA absorption growth in cattle through increasing proliferation of rumen across ruminal epithelium [1, 59]. In the current study papillae epithelial cells. Shen et al. [46] reported elevated the molar proportions of six individual VFAs in rumen n-butyric acid concentrations in the rumen of goats fed fluid were analysed namely: acetic, propionic, iso- energy-rich diets. Conversely, however, our data show that butyric, n-butyric, iso-valeric and n-valeric acids n-butyric acid proportions in the rumen tended to be following a 125 d period of dietary restriction and greater when animals were undergoing a period of also following a subsequent55dre-alimentation restricted growth. In addition to its proliferative effects on period. Following dietary restriction at the end of the rumen epithelium, n-butyric acid has been shown to Period 1, propionic acid concentrations were lower in be involved, in vivo, in the inhibition of ruminal apoptosis RES animals compared to ADLIB. This result sustained [34]. It is possible that greater proportions of n-butyric through to the end of Period 2, where concentrations acid in RES animals could be involved in maintaining the remained lower in RES animals. Propionic acid serves ruminal papillae during a time of nutrient restriction, in as a primary precursor of gluconeogenesis in rumi- order to maintain the efficiency of VFA absorption nants [15]. During feed restriction a lower proportion through increasing the surface area of rumen papillae. of propionic acid present in ruminal fluid could be Although outside the scope of the current study, tissue expected, due to lower feed intake and slower passage morphology studies assessing rumen papillae growth and rate. However, our data indicate that propionic acid proliferation in relation to dietary restriction and proportions remained lower than the control animals, subsequent re-alimentation are warranted. Although not when previously diet restricted animals were returned reaching concentrations of ADLIB animals during re- to an ad libitum diet. Alterations in microbial activity alimentation, butyric acid concentrations did increase in the rumen as a consequence of reduced substrate from Period 1 – Period 2 in restricted cattle, as the tissue availability most likely contributed to this observed increased in mass [22], potentially indicating the role of reductioninpropionic acid production. this acid in relation to rumen epithelial growth. Concentrations of n-valeric acid followed a similar pat- The relative gene expression of three enzymes involved tern to propionic acid across both periods. Condensation in the process of VFA production were evaluated, namely; O’Shea et al. Journal of Animal Science and Biotechnology (2016) 7:53 Page 9 of 12 acyl-CoA synthetase short-chain family member 1 (ACSS1), involved in the cell cycle, indicating that this increase in acetyl CoA synthetase (ACS) and propionyl coenzyme A organ size may be a result of other factors, such as carboxylase, α polypeptide (PCCA). Both ACSS1 and ACS cell hypertrophy or expansion of the reticulo-rumen encode enzymes involved in the conversion of acetate (a organ. This was consistent with the increased DMI of derivative of acetic acid) to acetyl coenzyme A (acetyl-coA), the animals [22]. Had earlier tissue sampling been whilst the protein encoded by PCCA converts propionic possible we may have indeed observed greater vari- acid to propionyl coenzyme A (propionyl-CoA). Following ation in ruminal epithelial gene expression profiles conversion, acetyl-CoA and propionyl-CoA can then be during re-alimentation. transported to the mitochondria through utilisation of the Structural properties of rumen papillae may be altered solute carrier family 25, carnitine/acylcarnitine translocase, due to differences in dietary intake. For example, Steele member 20 (CACT). Although no effect of dietary restric- et al. [50] identified structural adaptations in the rumen tion nor subsequent re-alimentation was observed for the epithelium of cows offered a high grain diet. Of particular expression of ACSS1, ACS or PCCA, CACT expression was interest, the authors of that study observed lower expres- affected. Lower expression of CACT was evident in RES sion of DSG1, a desmoglein in response to the high con- animals at the end of Period 1, potentially indicating re- centration diet [50]. Furthermore, Steele et al. [50] also duced transport of fatty acids into the mitochondria, and observed that expression of DSG1 subsequently increased therefore reduced fatty acid catabolism. Down-regulation of and remained elevated (compared with baseline values) CACT in RES animals may have prevented the shuttle-like following transition to a high forage diet [50]. In the action of carnitine from assisting transport of VFAs across current study, DSG1 expression was lower in RES animals the mitochondrial membrane, indicating that VFAs may in Period 1, and subsequently greater in these animals at build up within tissues. This possible reduction in the effi- the end of the re-alimentation period. DSG1 encodes an ciency of fatty acid metabolism during nutrient restriction adhesion molecule involved in maintaining the structural was partially restored during re-alimentation (Period 2). integrity of epithelial cells including rumen epithelium. However, CACT expression in restricted animals upon re- Lower expression of DSG1 following dietary restriction alimentation did not reach the same level as that of control could indicate a potential alteration of tight junctions be- animals during Period 1. Despite this, had animals been tween cells in the rumen epithelium. An alteration of the allowed a longer re-alimentation period we may have structure of the rumen wall may contribute to increased observed full recovery of CACT transcript abundance. permeability or paracellular transport which may be an ef- ficient mechanism of increased VFA absorption from the Cellular structure and growth rumen in response to nutrient restriction. Using Cr-EDTA In the animals utilised in the current study, we previ- as a paracellular marker indicating gut tract barrier func- ously observed greater reticulo-rumen weight for ADLIB tion, Zhang et al. [59] showed that the gut barrier was animals at the end of Period 1, but not Period 2 [22], impaired following short-term feed restriction (5 d). indicating full compensation of the organ during the first Additionally, the authors of that study also demonstrated two months of re-alimentation. Wang and Jiang [54] that tract barrier recovery time was affected by the severity previously observed an inhibitory effect of rumen fluid of feed restriction [58]. During re-alimentation in Period on proliferation in rumen papillae. More specifically 2, DSG1 expression was subsequently greater in RES ani- butyrate has been shown to arrest cell cycle progression mals. This enhanced DSG1 expression could indicate a [12, 27, 28, 44, 55] and induce cyclin-dependent kinase restoration in the ruminal wall barrier function, which inhibitor expression [4, 17, 32, 37, 48]. In the current plays a role in regulating the permeability of molecules via study, given the greater concentration of butyrate paracellular pathways as well as bacterial translocation recorded at the end of Period 1 in RES animals, the across the gut epithelium. This observed up-regulation of expression of cyclins and cyclin dependent kinase inhibi- DSG1 during re-alimentation indicates that the possible tors were evaluated. However, neither nutrient restric- deterioration of the rumen wall during periods of nutrient tion nor subsequent re-alimentation, had an effect on deprivation could be a reversible process, with recovery the expression of cyclin dependant kinase inhibitors (1A, following restoration of feed supply. 2A or 2B) or regulatory cyclins (D1, D2, D3, D4, E1 and The expression of three ion transporters from a family E2) involved in the inhibition, or progression, respect- of integral membrane protein transporters, known as the + + ively, of the cell cycle from the G1 phase to the S phase. Na /H exchangers (NHE1, NHE2, NHE3) was also evalu- We had hypothesized that accelerated growth typically ated in response to restricted feeding and subsequent re- observed during re-alimentation may be controlled, in alimentation. Previous in vitro studies have shown that part, by enhanced VFA absorption mediated by rumen rumen epithelium cells express high levels of NHE trans- papillae proliferation. However, the results of the current porters [10, 11]. Moreover, enhanced absorption of VFAs study showed no change in the transcription of genes is thought to be achieved through increasing the epithelial O’Shea et al. Journal of Animal Science and Biotechnology (2016) 7:53 Page 10 of 12 surface, which subsequently leads to an increase in the ac- Greater expression of LDHa was evident in RES ani- tivity of ion exchangers [9, 30]. Additionally, active trans- mals at the end of Period 1, compared to ADLIB ani- port of Na has been shown to be stimulated by the mals. LDHa is a cytoplasmic enzyme involved in the presence of VFA across isolated rumen epithelium tissue reversible catalysis of anaerobic glycolysis to produce mounted in Ussing chambers [5, 45]. However, in this lactate from pyruvate. Increased expression of LDHa study, no effect of diet was observed on the expression of during nutrient restriction suggests an increase in three NHE transporters, suggesting that previously lactate production. Lactate production occurs when reported stimulation of Na + active transport by diet, was oxygen levels are low and can be necessary in order to not the result of alterations in NHE transporter expres- regenerate NAD , which is consumed in the synthesis sion, but possibly due to greater presence of ATP for Na of pyruvate from glucose, ensuring that energy produc- + + /H exchanger function. tion is maintained [19]. In addition to greater expression of LDHa at the end of Period 1, expression of PDHA1 was Ketogenesis also greater in RES animals at the same time. The pyruvate When nutrient demand is high, fatty acid stores within dehydrogenase complex is central to pyruvate metabolism body tissues are enzymatically broken down through through its role in the irreversible conversion of pyruvate β-oxidation to form acetyl-CoA. Under normal condi- to acetyl-CoA [38]. Previous reports in the literature have tions, acetyl-CoA is further oxidized and subsequently described a reduction in the expression of PDHA1 in cattle enters the tricarboxylic (TCA) cycle. However, if activ- fed a high compared with a low concentrate diet [39]. The ity in the TCA cycle is low due to low availability of authors of that study attributed the result to an increased intermediates, such as oxaloacetate, acetyl-CoA is butyrate supply from a high concentrate diet resulting in used instead for the synthesis of ketone bodies viz. β- greater availability of acetyl-coA, thus potentially reducing hydroxybutyrate (βHBA) [14]. This results in a rise in the requirement for acetyl-CoA production by PDHA1. plasma βHBA in response to dietary restriction [23] Conversely, our results suggest an increased reliance on and during early lactation in dairy cows [3] when nu- PDHA1 to produce acetyl-coA for the production of energy trient demand is high. Plasma βHBA levels have also during nutrient restriction, possibly due to lower VFA, and previously been shown to be elevated in heifers of therefore acetyl-coA supply from the diet. Similar to our poor feed efficiency [20]. In the current study we ex- own results, Lkhagvadorj et al. [29] observed greater ex- amined the expression of six genes involved in the pression of PDHA1 in the-hepatic tissue of pigs following a pathway of ketogenesis; acetyl-coA acyltransferase 1 period of dietary restriction compared to ad libitum (ACAT), 3-Hydroxymethyl-3-methylglutaryl-CoA lyase controls. (HMGCL), 3-Hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1), 3-Hydroxy-3-methylglutaryl-CoA syn- Conclusion thase 2 (HMGCS2), 3-Hydroxybutyrate dehydrogenase, This is the first study to examine the effects of dietary type 1 (BDH1) and 3-Hydroxybutyrate dehydrogenase, restriction and subsequent re-alimentation induced type 2 (BDH2). Of the genes investigated, both BDH1 and compensatory growth on the transcript abundance of BDH2 were affected by dietary restriction and subsequent genes associated with the molecular functionality of ru- re-alimentation, with greater expression observed for each minal epithelial tissue. The results of this study suggest gene in RES animals at the end of the dietary restriction that during dietary restriction the structural capacities of period. This result suggests that during nutrient restric- the rumen wall may be altered due to down-regulation tion, there may be greater emphasis on the production of of DSG1 and the fatty acid transporter CACT. Addition- βHBA from acetyl-CoA, potentially due to lower supply of ally an up-regulation of genes involved in the production intermediate substrates for the production of cellular of ketone bodies and breakdown of pyruvate during diet- energy through the TCA cycle. Indeed greater expres- ary restriction, may have been necessary in order to sion of BDH1 has previously been associated with maintain cellular energy requirements during restricted nutrition-induced ketosis in the liver of peri-parturient nutrient availability. Our data provide an insight into the dairy cows [31]. potential molecular mechanisms regulating ruminal epithelial absorptive metabolism and growth following Pyruvate metabolism nutrient restriction and subsequent compensatory Pyruvate is an important intermediate in key pathways of growth. Identifying key genes and pathways that energy metabolism, thus the expression of four genes contribute to enhanced feed efficiency in beef cattle involved in pyruvate metabolism, namely pyruvate carb- and their implementation through genomically assisted oxylase (PC), pyruvate dehydrogenase lipoamide α 1 breeding programmes could ultimately improve the (PDHA1), lactate dehydrogenase isoform A (LDHa)and economic and environmental sustainability of beef lactate dehydrogenase isoform B (LDHb) was investigated. production. O’Shea et al. Journal of Animal Science and Biotechnology (2016) 7:53 Page 11 of 12 Abbreviations 10. Graham C, Simmons NL. Functional organization of the bovine rumen ADG: Average daily gain; ADLIB: Ad libitum-fed treatment group; epithelium. Am J Physiol Reful Integr Comp Physiol. 2005;288:R173–81. RES: Restricted-fed treatment group; SAS: Statistical analysis software; 11. Graham C, Gatherar I, Haslam I, Glanville M, Simmons NL. Expression and TCA: Tricarboxylic acid; VFA: Volatile fatty acid; βHBA: Beta-hydroxybutyrate localization of monocarboxylate transporters and sodium/proton exchangers in bovine rumen epithelium. Am J Physiol Regul Integr Comp Physiol. 2007;292:997–1007. Acknowledgements 12. Hatayama H, Iwashita J, Kuwajima A, Abe T. The short chain fatty acid, The authors of this study gratefully acknowledge skilled technical assistance butyrate, stimulates MUC2 mucin production in the human colon cancer from Dr. Matthew McCabe (Teagasc Animal Bioscience Research Centre, cell line, LS174T. Biochem Biophys Res Commun. 2007;356:599–603. Grange). Emma O’Shea received a scholarship from the Earth and Natural 13. Hegarty RS, Goopy JP, Herd RM, McCorkell B. Cattle selected for lower Sciences Doctoral Studies Programme, funded under the Programme for residual feed intake have reduced daily methane production. J Anim Sci. Research in Third Level Institutions, Cycle 5 (PRTLI-5) and co-funded under 2007;85:1479–86. the European Regional Development Fund (ERDF). The authors also wish to 14. Heitmann RN, Dawes DJ, Sensenig SC. Hepatic ketogenesis and peripheral acknowledge financial assistance from Science Foundation Ireland (SFI) ketone body utilization in the ruminant. J Nutr. 1987;117:1174–80. contract no 09/RFP/GEN2447. 15. Herbein JH, Van Maanen RW, McGilliard AD, Young JW. Rumen propionate and blood glucose kinetics in growing cattle fed isoenergetic diets. J Nutr. Funding 1978;108:994–1001. This project was funded through Science Foundation Ireland (SFI) contract 16. Higuchi R, Fockler C, Dollinger G, Watson R. Kinetic PCR analysis: real-time no 09/RFP/GEN2447. monitoring of DNA amplification reactions. Biotechnology. 1993;11:1026–30. 17. Hinnebusch BF, Meng S, Wu JT, Archer SY, Hodin RA. The effects of short- Availability of data and materials chain fatty acids on human colon cancer cell phenotype are associated Not applicable. with histone hyperacetylation. J Nutr. 2002;132:1012–17. 18. Hornick JL, Van Eenaeme C, Gerard O, Dufrasne I, Istasse L. Mechanisms of Authors’ contributions reduced and compensatory growth. Domest Anim Endocrin. 2000;19:121–32. DK conceived the study and conducted statistical analysis. EO’S conducted 19. Ivanov A, Mukhtarov M, Bregestovski P, Zilberter Y. Lactate effectively covers the laboratory analyses and prepared the manuscript. KK managed the energy demands during neuronal network activity in neonatal hippocampal animal model and assisted with manuscript preparation. SMW oversaw the slices. Front Neuroenerg. 2011;3:2. molecular analyses and assisted with manuscript preparation. AK assisted 20. Kelly AK, McGee M, Crews Jr DH, Sweeney T, Boland TM, Kenny DA. with diet formulation, tissue recovery, statistical analysis and manuscript Repeatability of feed efficiency, carcass ultrasound, feeding behaviour and preparation. All authors read and approved the final manuscript. blood metabolic variables in finishing heifers divergently selected for residual feed intake. J Anim Sci. 2010;88:3214–25. Competing interests 21. Kelly AK, Waters SM, Keogh K, O’Shea E, Kenny DA. Effect of diet type on The authors declare that they have no competing interests. the expression of genes regulating ruminal epithelium function of cattle. Tullamroe: Proceedings of the Agricultural Research Forum; 2012. p. 45. Author details 22. Keogh K, Waters SM, Kelly AK, Kenny DA. Feed restriction and subsequent School of Agriculture and Food Science, University College Dublin, Belfield, realimentaiton in Holstein Friesian bulls: I. Effect on animal performance; Dublin 4, Ireland. Animal and Bioscience Research Department, Animal & muscle, fat, and linear body measurements; and slaughter characteristics. Grassland Research and Innovation Centre, Teagasc Grange, Dunsany, Co. J Anim Sci. 2015a; 93:3578-89. Meath, Ireland. UCD Earth Institute, University College Dublin, Belfield, 23. Keogh K, Waters SM, Kelly AK, Wylie ARG, Sauerwein H, Sweeney T, et al. Dublin 4, Ireland. Feed restriction and subsequent realimentaiton in Holstein Friesian bulls: II. Effect on blood pressure and systemic concentrations of metabolites and Received: 26 January 2016 Accepted: 31 August 2016 metabolic hormones. J Anim Sci. 2015b; 93:3590-601. 24. Koressaar T, Remm M. Enhancements and modifications of primer design program Primer3. Bioinformatics. 2007;23:1289–91. 25. Lane MA, Jesse BW. Effect of volatile fatty acid infusion on development of References the rumen epithelium in neonatal sheep. J Dairy Sci. 1997;80:740–6. 1. Albornoz RI, Aschenbach JR, Barreda DR, Penner GB. Feed restriction 26. Lesmesiter KE, Tozer PR, Heinrichs AJ. Development and analysis of a rumen reduces short-chain fatty acid absorption across the reticulorumen of beef tissue sampling procedure. J Dairy Sci. 2004;87:1336–44. cattle independent of diet. J Anim Sci. 2013;91:4730–8. 27. Li CJ, Elsasser TH. Butyrate-induced apoptosis and cell cycle arrest in bovine 2. Ashfield A, Wallace M, McGee M, Crosson P. Bioeconomic modelling of kidney epithelial cells: Involvement of caspase and proteasome pathways. compensatory growth for grass-based dairy calf-to-beef production systems. J Anim Sci. 2005;83:89–97. J Agric Sci. 2014;152:805–16. 28. Li RW, Li C. Butyrate induces profound changes in gene expression related 3. Bjerre-Harpøth V, Friggens NC, Thorup VM, Larsen T, Damgaard BM, to multiple signal pathways in bovine kidney epithelial cells. BMC Ingvartsen KL, et al. Metabolic and production profiles of dairy cows in Genomics. 2006;7:234. response to decreased nutrient density to increase physiological imbalance 29. Lkhagvadorj S, Qu L, Cai W, Couture OP, Barb CR, Hausman GJ, et al. at different stages of lactation. J Dairy Sci. 2012;95:2362–80. Microarray gene expression profiles of fasting induced changes in liver and 4. Davie JR. Inhibition of histone deacetylase activity by butyrate. J Nutr. adipose tissues of pigs expression the Melanocortin-4 Receptor D298N. 2003;133:2485S–93S. Physiol Genomics. 2009;38:98–111. 5. Etschmann B, Suplie A, Martens H. Changes of ruminal sodium transport in 30. Lodemann U, Martens H. Effects of diet and osmotic pressure on Na sheep during dietary adaptation. Arch Anim Nutr. 2009;63:26–38. transport and tissue conductance of sheep isolated rumen epithelium. Exp 6. Fitzsimons C, Kenny DA, Deighton MH, Fahey AG, McGee M. Methane Physiol. 2006;91:539–50. emissions, body composition and rumen fermentation traits of beef heifers 31. Loor JJ, Everts RE, Bionaz M, Dann HM, Morin DE, Oliveira R, et al. Nutrition- differing in residual feed intake. J Anim Sci. 2013;91:5789–800. induced ketosis alters metabolic and signalling gene networks in liver of 7. Gäbel G, Bestmann M, Martens H. Influences of diet, short-chain fatty acids, periparturient dairy cows. Physiol Genomics. 2007;32:105–16. lactate and chloride on bicarbonate movement across the reticulo-rumen wall of sheep. Zentralbl Veterinarmed A. 1991a; 38:523-9 32. Mahyar-Roemer M, Roemer K. P21 waf1/cip1 can protect human colon 8. Gäbel G, Vogler S, Martens H. Short-chain fatty acids and CO as regulators carcinoma cells against p53-dependent and p53-independent apoptosis + - of Na and Cl absorption in isolated sheep rumen mucosa. J Comp Physiol induced by natural chemopreventive and therapeutic agents. Oncogene. B. 1991b;161:419-26 2001;20:3387–98. 9. Gäbel G, Aschenbach JR, Muller F. Transfer of energy substrates across the 33. McCabe MS, Cormican P, Keogh K, O’Connor A, O’Hara E, Palladino RA, et al. ruminal epithelium: Implications and limitations. Anim Health Res Rev. Illumina MiSeq phylogenetic amplicon sequencing shows a large reduction 2002;31:15–30. of an uncharacterised succinivibrionaceae and an increase of the O’Shea et al. Journal of Animal Science and Biotechnology (2016) 7:53 Page 12 of 12 Methanobrevibacter gottschalkii Clade in feed restricted cattle. PLoS One. 56. Whitelaw FG, Margaret Eadie J, Mann SO, Reid RS. Some effects of rumen 2015;10(7):e0133234. ciliate protozoa in cattle given restricted amounts of a barley diet. Br J Nutr. 34. Mentschel J, Leiser R, Mülling C, Pfarrer C, Claus R. Butyric acid stimulates 1972;27:425–37. rumen mucosa development in the calf mainly by a reduction of apoptosis. 57. Yambayamba ESK, Price MA, Jones SDM. Compensatory growth of carcass Arch Tierernahr. 2001;55:85–102. tissues and visceral organs in beef heifers. Livest Prod Sci. 1996;36:19–32. 58. Zhang S, Albornoz RI, Aschenbach JR, Barreda DR, Penner GB. Short-term 35. Minuti A, Palladino A, Khan MJ, Alqarni S, Agrawal A, Piccioli-Capelli F, et al. feed restriction impairs the absorptive function of the reticulo-rumen and Abundance of ruminal bacteria, epithelial gene expression, and systemic biomarkers of metabolism and inflammation are altered during the total tract barrier function in beef cattle. J Anim Sci. 2013a;91:1685-95 59. Zhang S, Aschenbach JR, Barreda DR, Penner GB. Recovery of absorptive peripartal period in dairy cows. J Dairy Sci. 2015;98(12):8940–51. function of the reticulo-rumen and total tract barrier function in beef cattle 36. O’Kiely P, Moloney AP, Killen L, Shannon A. A computer program to after short-term feed restriction. J Anim Sci. 2013;91:1696–706. calculate the cost of providing ruminants with home-produced feed-stuffs. Comp Electron Agric. 1997;19:23–36. 37. Orchel A, Molin I, Dzierzewicz Z, Latocha M, Weglarz L, Wilczok T. Quantification of p21 gene ecpression in caco-2 cells treated with sodium butyrate using real-time reverse transcription-PCR (RT-PCR) assay. Acta Pol Pharm. 2003;60:103–5. 38. Patel MS, Roche TE. Molecular biology and biochemistry of pyruvate dehydrogenase complexes. FASEB J. 1990;4:3224–33. 39. Penner GB, Taniguchi M, Guan LL, Beauchemin KA, Oba M. Effect of dietary forage to concentrate ratio on volatile fatty acid absorption and the expression of genes related to volatile fatty acid absorption and metabolism in ruminal tissue. J Dairy Sci. 2009;92:2767–81. 40. Pradhan K, Hemken RW. Utilization of ethanol and its effect on fatty acid patterns in ruminants. J Dairy Sci. 1970;53:1739–46. 41. Ryan WJ, Williams IH, Moir RJ. Compensatory growth in sheep and cattle II. Changes in body composition and tissue weights. Aust J Agric Res. 1993;44:1623–33. 42. Sakata T, Tamate H. Rumen epithelial cell proliferation accelerated by rapid increase in intraruminal butyrate. J Dairy Sci. 1978;61:1109–13. 43. Sakata T, Tamate H. Rumen epithelium cell proliferation accelerated by propionate and acetate. J Dairy Sci. 1979;62:49–52. 44. Sakata T, Yajima T. Influence of short chain fatty acids on the epithelial cell division of digestive tract. Q J Exp Physiol. 1984;69:639–48. 45. Sehested J, Diernaes L, Moller PD, Skadhauge E. Transport of sodium across the isolated bovine rumen epithelium: interaction with short-chain fatty acids, chloride and bicarbonate. Exp Physiol. 1996;81:79–94. 46. Shen Z, Seyfert HM, Lörhke B, Schneider F, Zitnan R, Chuddy A, et al. An energy-rich diet causes rumen papillae proliferation associated with more IGF type 1 receptors and increased plasma IGF-1 concentrations in young goats. J Nutr. 2004;134:11–7. 47. Shen Z, Kuhla S, Zitnan R, Seyfert HM, Schneider F, Hagemeister H, et al. Intraruminal infusion of n-butyric acid induces and increase of ruminal papillae size independent of IGF-1 system in castrated bulls. Arch Anim Nutr. 2005;59:213–25. 48. Shi SL, Wang Y, Liang Y, Li QF. Effects of tachyplesin and n-sodium butyrate on proliferation and gene expression of human gastric adenocarcinoma cell line bgc-823. World J Gastroenterol. 2006;12:1694–8. 49. Steele MA, Vandervoort G, AlZahal O, Hook SE, Matthews JC, McBride BW. Rumen epithelial adaptation to high-grain diets involves the coordinated regulation of genes involved in cholesterol homeostasis. Physiol Genomics 2011a;43:308-16 50. Steele MA, Croom J, Kahler M, AlZahal O, Hook SE, Plaizier K, et al. Bovine rumen epithelium undergoes rapid structural adaptations during grain- induced subacute ruminal acidosis. Am J Physiol Regul Integr Comp Physiol. 2011b;300:1515-23 51. Untergrasser A, Cutcatch I, Koressaar T, Ye J, Faircloth BC, Remm M, et al. Submit your next manuscript to BioMed Central Primer3 –new capabilities and interfaces. Nucleic Acids Res. 2012;15:e115. 52. Uppal SK, Wolf K, Khahra SS, Martens H. Modulation of Na + transport across and we will help you at every step: isolated rumen epithelium by short-chain fatty acids in hay- and • We accept pre-submission inquiries concentrate-fed sheep. J Anim Physiol Anim Nutr. 2003;87:380–8. 53. Waghorn GC, Dewhurst RJ. Feed efficiency in cattle the contribution of � Our selector tool helps you to find the most relevant journal rumen function. In: Meeting the challenges for pasture-based dairying. � We provide round the clock customer support Victoria: Proceedings of the 3rd Dairy Science Symposium; 2007. p. 111–23. � Convenient online submission 54. Wang A, Jiang H. Rumen fluid inhibits proliferation and stimulates expression of cyclin-dependent kinase inhibitors 1A and 2A in bovine � Thorough peer review rumen epithelial cells. J Anim Sci. 2010;88:3226–32. � Inclusion in PubMed and all major indexing services 55. Wang Q, Zhou Y, Wang X, Evers BM. p27 Kip1 nuclear localization and � Maximum visibility for your research cyclin-dependent kinase inhibitory activity are regulated by glycogen synthase kinase-3 in human colon cancer cells. Cell Death Differ. Submit your manuscript at 2008;15:908–19. www.biomedcentral.com/submit
Journal
Journal of Animal Science and Biotechnology – Springer Journals
Published: Sep 15, 2016