Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Expression of genes for bone morphogenetic proteins BMP-2, BMP-4 and BMP-6 in various parts of the human skeleton

Expression of genes for bone morphogenetic proteins BMP-2, BMP-4 and BMP-6 in various parts of... Background: Differences in duration of bone healing in various parts of the human skeleton are common experience for orthopaedic surgeons. The reason for these differences is not obvious and not clear. Methods: In this paper we decided to measure by the use of real-time RT-PCR technique the level of expression of genes for some isoforms of bone morphogenetic proteins (BMPs), whose role is proven in bone formation, bone induction and bone turnover. Seven bone samples recovered from various parts of skeletons from six cadavers of young healthy men who died in traffic accidents were collected. Activity of genes for BMP-2, -4 and -6 was measured by the use of fluorescent SYBR Green I. Results: It was found that expression of m-RNA for BMP-2 and BMP-4 is higher in trabecular bone in epiphyses of long bones, cranial flat bones and corpus mandibulae then in the compact bone of diaphyses of long bones. In all samples examined the expression of m-RNA for BMP-4 was higher than for BMP-2. Conclusion: It was shown that m-RNA for BMP-6 is not expressed in the collected samples at all. It is postulated that differences in the level of activation of genes for BMPs is one of the important factors which determine the differences in duration of bone healing of various parts of the human skeleton. Background trol of two cell populations – osteoblasts and osteoclasts. Bone mass is a changeable parameter. Its peak is reached These cells are influenced by many factors which control in the age of 30–35 years. Bone turnover is under the con- the balance of bone formation and bone resorption. The Page 1 of 10 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 same cell populations and factors are active in bone heal- induction [32-34]. In tissue culture BMPs are needed for ing. Bone morphogenetic proteins (BMPs) are involved in formation of osteogenic cell lines [13,32,34,35]. many processes which take place in bone formation, bone induction, and bone regeneration as e.g. callus formation The aim of this paper is to show that, in spite of incom- in the course of bone healing. The full picture of bone plete knowledge of the mechanisms of bone homeostasis, turnover is not completed as yet, although many factors some important differences exist at the molecular level, and interactions are well described. The complexity of which can explain the differences in the dynamic of heal- bone turnover involves the long list of about 200 factors ing of distinct parts of human skeleton. By the use of influencing each other in various physiological and/or quantitative real-time RT-PCR we were able to show the pathological situations. PTGF (platelet derived growth differences in the level of expression of some isoforms of factor) and TGF-β (transforming growth factor – beta) BMPs in various bones or their parts. together with the BMPs are the most important factors in the process of bone healing. The new research [1] data The results were confirmed by the analysis of the electro- make the situation even more complex. phoretic bands. Differences in the dynamic of bone healing in various Methods parts of skeleton are well documented in literature. In Tissue samples and total RNA isolation and quantification population of healthy people the cortical bone heals Forty two biopsies of normal bone tissue taken post mor- within 4–8 months, and trabecular bone in 3–6 months. tem from six cadavers of young healthy men who died in The healing of cranial bones can take from several weeks traffic accidents were frozen. Biopsies were taken from to 5 years. Broken mandible heals normally during 3–4 seven different bones. The cadavers are treated as "young weeks. It takes several months for healing of broken bones healthy" after the routine serology done for all tissue bank of pelvis. Broken humeri are healed in 3–6 months. Simi- donors. Biopsies (5–7 cm long and 2–3 cm wide) were lar time is needed for healing of femurs. Complexity of taken from seven different bones. Bone marrow was orthopaedic situation has important influence on time of removed from trabecular bone by the routine technique bone repair [2-7]. used in our bone bank. There were: cranial flat bones, cor- pus mandibulae, diaphysis radii, distal epiphysis radii, ala BMPs play very important role in bone physiology influ- ossis ilii, diaphysis femoris and distal epiphysis femoris. encing bone growth, turnover, bone formation and carti- Total RNA was extracted using TRIzol Reagent (GIBCO lage induction [8]. Their influence is not restricted to bone BRL) according to manufacturer's recommendations. Fro- tissue. BMPs regulate apoptosis in various types of tissues zen in liquid nitrogen and physically powdered bone [9,10]. It seems that the study of some BMPs isoforms (200 mg) was suspended in 1 ml of TRIzol Reagent, vor- reveals unexpected and very important activities of these texed and incubated 30 min at room temperature with proteins. In one of the recent publication by the group of continuous horizontal rotation. The RNA pellet was dis- Vescovi it was shown that the BMP-4 elicits strongest solved in 20–30 µl of sterile diethylpyrocarbonate-treated effect in triggering a significant reduction in tumor-initiat- Mili-Q water and quantified spectrophotometrically at ing precursors of human glioblastoma [11]. All BMPs, 260 nm. The quality of the extracted RNAs was verified by except BMP-1, belong to the superfamily of transforming agarose gel electrophoresis. RNAs were stored as a water growth factors β, forming large group of signaling mole- solution at -70°C. The "donors" were transported after cules [10,12-15]. Their activity is related only to dimeric accidents to the Dept. of Forensic Medicine and located form. Both homodimers as well as heterodimers are active for the night in cold compartments. The samples were col- [13,16], although their biological activity differs [14]. lected in the morning after medico-legal section and fro- High activity of heterodimers BMP-4–7 and BMP-2–7 was zen in dry ice. We never attempted the investigation on established in vitro and in vivo [13]. High osteoinductive degradation of beta-actin or BMPs – mRNAs as a function potency was proved for heterodimers BMP-2–6 in com- of time. parison with respective homodimers [17,18]. In bone Reverse transcription matrix BMPs are connected with collagen and are not active unless released by the action of collagenases of oste- Single stranded complementary DNA (cDNA) was synthe- oclasts [14]. sized with oligo(dT) primers from 5 µg of total RNA 12–18 using SUPERSCRIPT First-Strand Synthesis System for RT- According to the literature [19] BMPs -2, -4, -6 exert high PCR (GIBCO BRL) accordingly to the manufacturer's osteoinductive potential, influencing odontogenesis instruction. [10,19-21], bone regeneration and healing [13,22-27], bone formation [15,17,28-31] and heterotopic bone Page 2 of 10 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 Quantitation of BMPs expression by real-time PCR Accumulation of PCR products was measured in real-time by using QuantiTect SYBR Green PCR Kit (Qiagen). The sequences of primers are listed in Table 1. Reaction was performed in DNA Engine Opticon 2 Real-Time Detec- tion System (MJ Research) three times for each probe starting with 10 – 15 min of preincubation at 94°C fol- lowed by 45 amplification cycles as follows: 94°C for 1 min, annealing temperature for 1 min and 72°C for 1 min. Beta-actin was used as housekeeping gene for arbi- trary unit calculation for every tested gen. Additionally product identity was confirmed by electrophoresis on a 1.7% agarose (GIBCO BRL) gel and visualized by ethid- ium bromide (SIGMA) staining under UV light. Statitistics: All statistical analysis was performed using the Co groups Figure 1 mparison of BMP-2 expression levels in separate bone STATISTICA 5.0 software (StatSoft, Inc., STATISTICA for Comparison of BMP-2 expression levels in separate bone Windows, Tulsa, OK). We compared the analysed groups groups. Box plot graph, Mean, SE – Standard error, SD – using the analysis of variance (ANOVA). Levels of statisti- Standard Deviation. cal significance was set as p = 0,05: S-significant difference (p < = 0,05), NS – no statistical difference was found (p > 0,05). These differences concerned expression of m-RNAs for genes BMP-2 and BMP-4. In the same bone sample the Results Real-time PCR technique was very useful for detection, level of expression of m-RNAs for BMP-2 and BMP-4 dif- determination and comparison of three BMP isoforms fer. These differences are significant when compact bone expressions. The use of β-actin gene expression as a house- and trabecular bone are compared. keeping gene allowed for calculation of arbitrary units and for comparison of BMP-2, BMP-4 and BMP-6 genes Results of descriptive statistics (Fig 1) show that expres- expression not only between them but also between dif- sion of m-RNA for BMP-2 is higher in ala ossis illi, and in ferent types of bones. Obtained results showed significant trabecular bone of epiphyses of long bones as well as of expression of two isoforms of these proteins – BMP-2 and flat bones then in corpus mandibulae and in the compact BMP-4 (Figures 1 and 2, respectively). Expression of BMP- bone of diaphyses of long bones (Fig 1). The level of 6 was not detected. Melting temperatures of amplicons expression of BMP-4 is higher in trabecular bone in epi- demonstrate their specifity (Figure 3) and electrophoretic physes of long bones, ala ossis illi and corpus mandibulae analysis proved identity of these products (Figures 4 and then in the compact bone of diaphyses of long bones and 5). This multi-analysis allowed for conclusions that there cranial flat bones (Fig 2). is no BMP-6 gene expression in all examined bone sam- ples. In all examined samples the level of expression of m-RNA for BMP-4 was higher than for BMP-2 (Fig. 1 and Fig. 2). Discussion In this paper we demonstrated the differences in expres- Several repetitions of measurements by real-time RT-PCR sion of m-RNA for isoforms BMP-2, BMP-4 in various excluded expression of mRNA for BMP-6 in analysed sam- parts of the human skeleton (Table 2). ples. Table 1: Primer sequences and sizes of amplicons generated by Real-time RT-PCR mRNA Forward primer (5'-3') Reverse primer (5'-3') Annealing [°C] Amplicon [bp] Accession number Citation BMP-2 ATGGATTCGTGGTGGAAGTG GTGGAGTTCAGATGATCAGC 58 349 NM_001200.2 [41] BMP-4 AGCATGTCAGGATTAGCCGA TGGAGATGGCACTCAGTTCA 58 399 NM_130851.1 [41] BMP-6 CAGCCTGCAGGAAGCATGAG CAAAGTAAAGAACCGAGATG 53 246 NM_001718.2 [42] β-actin GGGTCAGAAGGATTCCTATG GGTCTCAAACATGATCTGGG 58 237 NM_001101.2 [43] Page 3 of 10 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 mandibulae and ala ossis ilii, diaphysis radii and ala ossis ilii, diaphysis femoris and distal epiphysis femoris (Table 3, Figure 1) 3. Significant differences were found in expression of BMP-4 between cranial flat bones and ala ossis ilii, cranial flat bones and distal epiphysis radii, corpus mandibulae and distal epiphysis radii, diaphysis and distal epiphysis radii, diaphysis radii and ala ossis ilii, diaphysis radii and ala ossis ilii, distal epiphysis radii and ala ossis ilii, distal epiphysis radii and diaphysis femoris, ala ossis ilii and diaphysis femoris, diaphysis and distal epiphysis femoris. (Table 4, Figure 2). 4. Significant differences exist in the mean values of the levels of expression of BMP-2 when compared with the Compar g Figure 2 roups ison of BMP-4 expression levels in separate bone level of BMP-4 between the following parts of skeletons: Comparison of BMP-4 expression levels in separate bone diaphysis radii, distal epiphysis radii, ala ossis ilii, and dis- groups. Box plot graph, Mean, SE – Standard error, SD – Standard Deviation. tal epiphysis femoris (Table 5). 5. In all other measured parts of skeleton the levels of Our results differ from the ones which were published by expression of the two isoforms of BMP were similar and the Thailand group [36]. We are not fully convinced by did not differ significantly. their results. They used the semiquantitative technique of RT-PCR and the measurements were based on the inten- 6. The expression of BMP-6 isoform was not found in all sity of fluorescence of the agarose gels standardized examined samples. against cDNA for control gene for GAPDH (glyceralde- hyde-3-phosphate dehydrogenase). Their samples were The obtained results might help to understand the differ- taken from patients in the course of surgery and it is diffi- ences in the speed of healing of various parts of the skele- cult to call them "normal control samples". In the healing ton. We have started the measurements of samples of bones after fracture, activation of BMP-6 gene is expected. callus obtained in the course of surgical revisions of slow Literature data [28,37,38] allow us to assume, that the healing bone fractures. lack of m-RNA for BMP-6 in all our samples was compen- sated by activity of BMP-2 [28]. Because of the high oste- The obtained results might also have some value for the ogenic activity of homodimers BMP-2/BMP-2 and BMP-4/ bone banks where the level of expression of BMPs could BMP-4 and of high probability of formation of het- change after single steps of bone preservation as freezing, erodimers BMP-2/BMP-4, the lack of BMP-6 can be liophilisation, radiation sterilization etc. The expected explained by the substitution by homodimers BMP-2/ role of bone implants prepared in bone banks is the pro- BMP-4. The additional argument for our reasoning is the motion of bone healing by two processes – conduction high identity in sequence of proteins BMP-2 and BMP-4 and induction. reaching 92% [10,13,39,40]. Both belong to the same subclass, in contrast to BMP-6, which is the member of The process of bone induction in human orthopaedic different subfamily. practice is not well documented. Some bone banks try to promote this ability by adding Conclusion The analysis of various parts of skeleton of six healthy synthetic recombined BMPs to bone implants, sometimes men who died in traffic accidents showed several differ- with the addition of hydroxyapatite. This is why the ences in expression of some BMPs- isoforms as measured knowledge of bioinductive properties of single parts of by real-time RT-PCR spectrometry: skeleton is important. 1. Various bones forming the skeleton differ in the level of Competing interests expression of BMP-2 and BMP-4 isoforms. The author(s) declare that they have no competing inter- ests. 2. Significant differences were found in expression of BMP-2 between cranial flat bones and ala ossis ilii, corpus Page 4 of 10 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 Figure 3 Expression of BMPs in different bone biopsies derived from 6 patients quantified by real-time PCR Expression of BMPs in different bone biopsies derived from 6 patients quantified by real-time PCR. Page 5 of 10 (page number not for citation purposes) Patient No 1 Patient No 2 Patient No 3 Patient No 4 Patient No 5 Patient No 6 BMP-2 BMP-4 β-actin BMP-6 Bones: — 1; — 2; — 3; — 4; — 5; — 6; — 7 BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 Melting c Figure 4urves of real-time PCR products Melting curves of real-time PCR products. Page 6 of 10 (page number not for citation purposes) Patient No 1 Patient No 2 Patient No 3 Patient No 4 Patient No 5 Patient No 6 BMP-2 BMP-4 β-actin BMP-6 Bones: — 1; — 2; — 3; — 4; — 5; — -6; — 7 BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 E Figure 5 lectrophoretic analysis of real-time PCR products Electrophoretic analysis of real-time PCR products. Page 7 of 10 (page number not for citation purposes) Patient No 1 Patient No 2 Patient No 3 Patient No 4 Patient No 5 Patient No 6 Line 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 BMP-2 BMP-4 β-actin Lines: 1 – DNA marker; 2 – Bone 1; 3 – Bone 2; 4 – Bone 3; 5 – Bone 4; 6 – Bone 5; 7 – Bone 6; 8 – Bone 7 BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 Table 2: The number and codes of examined skeletal bone samples Group Name Group Code N BMP – 2 BMP – 4 Cranial flat bones Bone 1 18 18 Corpus mandibulae Bone 2 18 18 Diaphysis radii Bone 3 18 18 Distal epiphysis radii Bone 4 18 18 Ala ossis ilii Bone 5 18 18 Diaphysis femoris Bone 6 18 18 Distal epiphysis femoris Bone 7 18 18 Table 3: Evaluation of significant differences between mean levels of BMP-2 expression in all examined bones. S – significant difference (p < = 0,05); NS – no statistical difference was found (p > 0,05) Bone 1 Bone 2 Bone 3 Bone 4 Bone 5 Bone 6 Bone 7 Bone 1 - NS NS NS S NS NS Bone 2 NS - NS NSSNS NS Bone 3 NS NS - NSSNS NS Bone 4 NS NS NS - NS NS NS Bone 5 S S S NS - S NS Bone 6 NS NS NS NS S - NS Bone 7 NS NSNS NSNS NS - Table 4: Evaluation of significant differences between mean levels of BMP-4 expression in all examined bones. S – significant difference (p < = 0,05); NS – no statistical difference was found (p > 0,05) Bone 1 Bone 2 Bone 3 Bone 4 Bone 5 Bone 6 Bone 7 Bone 1 - NS NS S S NS NS Bone 2 NS - NS S NSNSNS Bone 3 NS NS - S S NS NS Bone 4 SSS - S S NS Bone 5 S NS S S - S NS Bone 6 NSNSNS S S - S Bone 7 NSNSNS NS NS S - Table 5: The results of the comparison by the Analysis of Variance (ANOVA) (p = 0,05) of the mean levels of expression of BMP-2 and the levels of BMP-4 in the groups of examined bones. S – significant difference (p < = 0,05); NS – no statistical difference was found (p > 0,05) Mean BMP-2 Mean BMP-4 Std. Dev. BMP-2 Std. Dev. BMP-4 Valid N BMP-2 Valid N BMP-4 F p Bone 1 NS 90,7208 94,3128 7,6504 9,4994 18 18 1,5610 0,2200 Bone 2 NS 89,7981 98,2081 10,4187 14,2636 18 18 4,0804 0,0513 Bone 3 S 89,6294 97,0668 6,2952 10,1941 18 18 6,9357 0,0126 Bone 4 S 93,3007 106,2281 10,4861 8,3981 18 18 16,6666 0,0002 Bone 5 S 95,6507 102,5552 9,4378 9,2962 18 18 4,8896 0,0338 Bone 6 NS 89,5953 91,8471 8,7169 10,1045 18 18 0,5124 0,4789 Bone 7 S 92,2981 100,2836 8,0808 12,6990 18 18 5,0663 0,0309 Page 8 of 10 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 24. Rauch F, Lauzier D, Croteau S, Travers R, Glorieux FH, Hamdy R: Authors' contributions Temporal and spatial expression of the bone morphogenetic All authors contributed equally to this work protein-2, -4, and -7 during distraction osteogenesis in rab- bits. Bone 2000, 27(3):453-459. 25. Shen H-C, Peng H, Usas A, Gearhart B, Fu FH, Huard J: Structural References and functional healing of critical-size segmental bone defects 1. Lee NK, Sowa H, Hinoi E, Ferron M, Ahn JD, Confavreux C, Dacquin by transduced muscle-derived cells expressing BMP-4. J Gene R, Mee PJ, McKee MD, Jung DY, Zhang Z, Kim JK, Mauvais-Jarvis F, Med 2004, 6:984-991. Ducy P, Karsenty G: Endocrine regulation of energy metabo- 26. Peng H, Wright V, Usas A, Gearhart B, Shen H-C, Cummins J, Huard lism by skeleton. Cell 130(3):456-69. 2007, Aug 10, J: Synergistic enhancement of bone formation and healing by 2. Smirniotopoulos JG: Radiologic-Pathologic Correlation. CNS stem cell-expressed VEGF and bone morphogenetic pro- Trauma [http://rad.usuhs.mil]. tein-4. J Clin Invest 2002, 110:751-759. 3. Peltier J, Ryan MW, Quinn FB: Mandible Fractures. UTMB Maga- 27. Sato M, Ochi T, Nakase T, Hirota S, Kitamura Y, Nomura S, Yasui N: zine [http://www.utmb.edu]. May 26, 2004 Mechanical tension-stress induces expression of bone mor- 4. Dee R, Hurst LC, Gruber MA, Kottmeier SA: Principles of Orthopaedic phogenetic protein BMP-2 and BMP-4, but not BMP-6, BMP- Practice New York: McGraw-Hill; 1997. 7, and GDF-5 mRNA, during distraction osteogenesis. J Bone 5. Brenneman FD, Katyal D, Boulanger BR, Tile M, Redelmeier DA: Miner Res 1999, 14(7):1084-1095. Long-term outcomes in open pelvic fractures. The Journal of 28. Cao X, Chen D: The BMP signaling and in vivo bone forma- Trauma 1997, 42(5):773-7. tion. Gene 2005, 357:1-8. 6. Korovessis P, Baikousis A, Stamatakis M, Katonis P: Medium- and 29. Varga AC, Wrana JL: The disparate role of BMP in stem cell long-term results of open reduction and internal fixation for biology. Oncogene 2005, 24:5713-5721. unstable pelvic ring fractures. Orthopedics 2000, 30. Ebisawa T, Tada K, Kitajima I, Tojo K, Sampath TK, Kawabata M, 23(11):1165-71. Miyazono K, Imamura T: Characterization of bone morphoge- 7. Malavaud B, Mouzin M, Tricoire JL, Gamé X, Rischmann P, Sarramon netic protein-6 signaling pathways in osteoblast differentia- JP, Puget J: Evaluation of male sexual function after pelvic tion. J Cell Sci 1999, 112:3519-3527. trauma by the International Index of Erectile Function. Urol- 31. Rickard DJ, Hofbauer LC, Bonde SK, Gori F, Spelsberg TC, Riggs BL: ogy 2000, 55(6):842-6. Bone morphogenetic protein-6 production in human oste- 8. Chen D, Zhao M, Mundy GR: Bone morphogenetic proteins. oblastic cell lines. J Clin Invest 1998, 101(2):413-422. Growth Factors 2004, 22(4):233-241. 32. Kang Q, Sun MH, Cheng H, Peng Y, Montag AG, Deyrup AT, Jiang W, 9. Reddi AH: Interplay between bone morphogenetic proteins Luu HH, Luo J, Szatkowski JP, Vanichakarn P, Park JY, Li Y, Haydon and cognate binding proteins in bone and cartilage develop- RC, He TC: Characterization of the distinct orthotopic bone- ment: noggin, chordin and DAN. Arthritis Research 2001, 3:1-5. forming activity of 14 BMPs using recombinant adenovirus- 10. Botchkarev VA: Bone morphogenetic proteins and their mediated delivery. Gene Therapy 2004, 11:1312-1320. antagonists in skin and hair follicle biology. Progress in Derma- 33. Noel D, Gazit D, Bouquet C, Apparailly F, Bony C, Plence P, Millet V, tology 2003, 120:36-47. Turgeman G, Perricaudet M, Sany J, Jorgensen C: Short-term BMP- 11. Piccirillo SG, Reynolds BA, Zanetti N, Lamorte G, Binda E, Broggi G, 2 expression is sufficient for in vivo osteochondral differenti- Brem H, Olivi A, Dimeco F, And Vescovi AL: Bone morphogenetic ation of mesenchymal stem cells. Stem Cells 2004, 22:74-85. proteions inhibit the tumorogenic potential of human brain 34. Groeneveld EHJ, Burger EH: Bone morphogenetic proteins in tumor-initiating cell. NATURE 2006, 444:761-765. human bone regeneration. European Journal of Endocrinology 2000, 12. Dimitriou R, Giannoudis PV: Discovery and development of 142:9-21. BMPs. Injury 2005, 36S:S28-S33. 35. Yamaguchi A, Komori T, Suda T: Regulation of osteoblast differ- 13. Sakou T: Bone morphogenetic proteins: from basic studies to entiation mediated by bone morphogenetic proteins, hedge- clinical approaches. Bone 1998, 22(6):591-603. hogs, and cbfa1. Endocrine Reviews 2000, 21(4):393-411. 14. Sykaras N, Opperman LA: Bone morphogenetic proteins 36. Suttapreyasri S, Koontongkaew S, Phongdara A, Leggat U: Expres- (BMPs): how do they function and what can they offer the cli- sion of bone morphogenetic proteins in normal human nician? Journal of Oral Science 2003, 45(2):57-73. intramembranous and endochondral bones. Int J Oral Maxillo- 15. Wan M, Cao X: BMP signaling in skeletal development. Bio- fac Surg 2006, 35(5):444-452. chemical and Biophysical Research Communications 2005, 328:651-657. 37. Qi X-J, Bell PR, Li G: Bone morphogenetic proteins in bone for- 16. Subach BR, Haid RW, Rodts GE, Kaiser MG: Bone morphogenetic mation and development. In Current Topics in Bone Biology World protein in spinal fusion: overview and clinical update. Neuro- Scientific Publisher, Singapore; 2005:163-177. surg Focus 2001, 10(4):Article 3. 38. Kochanowska1 IE, Wlodarski K, Wojtowicz a, Niemira1 K, 17. Kugimiya F, Kawaguchi H, Kamekura S, Chikuda H, Ohba S, Yano F, Ostrowski K: Osteogenic Properties of Various HeLa Cell- Ogata N, Katagiri T, Harada Y, Azuma Y, Nakamura K, Chung U-il: Lines and the BMP Family Genes Expression. Ann Transplant Involvement of endogenous bone morphogenetic protein 2002, 7(4):58-62. BMP2 and BMP6 in bone formation. J Biol Chem 2005, 39. Sebald W, Nickel J, Zhang J-L, Mueller TD: Molecular recognition 280(42):35704-35712. in bone morphogenetic protein (BMP)/receptor interaction. 18. Westerhuis RJ, van Bezooijen RL, Kloen P: Use of bone morpho- Biological Chemistry 2004, 385:697-710. genetic proteins in traumatology. Injury 2005, 40. Luo J, Sun MH, Kang Q, Peng Y, Jiang W, Luu HH, Luo Q, Park JY, Li 36(12):1405-1412. Y, Haydon RC, He TC: Gene therapy for bone regeneration. 19. Nakashima M, Reddi AH: The application of bone morphoge- Current Gene Therapy 2005, 5:167-179. netic proteins to dental tissue engineering. Nature Biotechnol- 41. Kusafuka K, Yamaguchi A, Kayano T, Fujiwara M, Takemura T: ogy 2003, 21(9):1025-1032. Expression of bone morphogenetic proteins in salivary pleo- 20. Iohara K, Nakashima M, Ito M, Ishikawa M, Nakasima A, Akamine A: morphic adenomas. Vichrows Arch 1998, 432:247-253. Dentin regeneration by dental pulp stem cell therapy with 42. Gilbert L, He X, Farmer P, Boden S, Kozlowski M, Rubin J, Nanes MS: recombinant human bone morphogenetic protein 2. J Dent Inhibition of osteoblast differentiation by tumor necrosis fac- Res 2004, 83(8):590-595. tor-alpha. Endocrinology 2000, 141:3956-3964. 21. Yamashiro T, Tummers M, Thesleff I: Expression of bone mor- 43. Balabanian K, Foussat A, Bouchet-Delbos L, Couderc J, Krzysiek R, phogenetic proteins and Msx genes during root formation. J Amara A, Baleux F, Portier A, Galanaud P, Emilie D: Interleukin-10 Dent Res 2003, 82(3):172-176. modulates the sensitivity of peritoneal B lymphocytes to 22. Yazawa M, Kishi K, Nakajima H, Nakajima T: Expression of bone chemokines with opposite effects on stromal cell-derived morphogenetic proteins during madibular distraction osteo- factor-1 and B-lymphocyte chemoattractant. Blood 2002, genesis in rabbits. J Oral Maxillofac Surg 2003, 61:587-592. 99:427-436. 23. Farhadieh RD, Gianoutsos MP, Yu Y, Walsh WR: The role of bone morphogenetic proteins BMP-2 and BMP-4 and their related postreceptor signaling system (Smads) in distraction osteo- genesis of the mandible. J Craniofac Surg 2004, 15(5):714-718. Page 9 of 10 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2474/8/128/pre pub Publish with Bio Med Central and every scientist can read your work free of charge "BioMed Central will be the most significant development for disseminating the results of biomedical researc h in our lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp Page 10 of 10 (page number not for citation purposes) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png BMC Musculoskeletal Disorders Springer Journals

Expression of genes for bone morphogenetic proteins BMP-2, BMP-4 and BMP-6 in various parts of the human skeleton

Download PDF
10 pages

Loading next page...
 
/lp/springer-journals/expression-of-genes-for-bone-morphogenetic-proteins-bmp-2-bmp-4-and-X9CZ4F1v0m

References (51)

Publisher
Springer Journals
Copyright
Copyright © 2007 by Kochanowska et al; licensee BioMed Central Ltd.
Subject
Medicine & Public Health; Orthopedics; Rehabilitation; Rheumatology; Sports Medicine; Internal Medicine; Epidemiology
eISSN
1471-2474
DOI
10.1186/1471-2474-8-128
pmid
18162128
Publisher site
See Article on Publisher Site

Abstract

Background: Differences in duration of bone healing in various parts of the human skeleton are common experience for orthopaedic surgeons. The reason for these differences is not obvious and not clear. Methods: In this paper we decided to measure by the use of real-time RT-PCR technique the level of expression of genes for some isoforms of bone morphogenetic proteins (BMPs), whose role is proven in bone formation, bone induction and bone turnover. Seven bone samples recovered from various parts of skeletons from six cadavers of young healthy men who died in traffic accidents were collected. Activity of genes for BMP-2, -4 and -6 was measured by the use of fluorescent SYBR Green I. Results: It was found that expression of m-RNA for BMP-2 and BMP-4 is higher in trabecular bone in epiphyses of long bones, cranial flat bones and corpus mandibulae then in the compact bone of diaphyses of long bones. In all samples examined the expression of m-RNA for BMP-4 was higher than for BMP-2. Conclusion: It was shown that m-RNA for BMP-6 is not expressed in the collected samples at all. It is postulated that differences in the level of activation of genes for BMPs is one of the important factors which determine the differences in duration of bone healing of various parts of the human skeleton. Background trol of two cell populations – osteoblasts and osteoclasts. Bone mass is a changeable parameter. Its peak is reached These cells are influenced by many factors which control in the age of 30–35 years. Bone turnover is under the con- the balance of bone formation and bone resorption. The Page 1 of 10 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 same cell populations and factors are active in bone heal- induction [32-34]. In tissue culture BMPs are needed for ing. Bone morphogenetic proteins (BMPs) are involved in formation of osteogenic cell lines [13,32,34,35]. many processes which take place in bone formation, bone induction, and bone regeneration as e.g. callus formation The aim of this paper is to show that, in spite of incom- in the course of bone healing. The full picture of bone plete knowledge of the mechanisms of bone homeostasis, turnover is not completed as yet, although many factors some important differences exist at the molecular level, and interactions are well described. The complexity of which can explain the differences in the dynamic of heal- bone turnover involves the long list of about 200 factors ing of distinct parts of human skeleton. By the use of influencing each other in various physiological and/or quantitative real-time RT-PCR we were able to show the pathological situations. PTGF (platelet derived growth differences in the level of expression of some isoforms of factor) and TGF-β (transforming growth factor – beta) BMPs in various bones or their parts. together with the BMPs are the most important factors in the process of bone healing. The new research [1] data The results were confirmed by the analysis of the electro- make the situation even more complex. phoretic bands. Differences in the dynamic of bone healing in various Methods parts of skeleton are well documented in literature. In Tissue samples and total RNA isolation and quantification population of healthy people the cortical bone heals Forty two biopsies of normal bone tissue taken post mor- within 4–8 months, and trabecular bone in 3–6 months. tem from six cadavers of young healthy men who died in The healing of cranial bones can take from several weeks traffic accidents were frozen. Biopsies were taken from to 5 years. Broken mandible heals normally during 3–4 seven different bones. The cadavers are treated as "young weeks. It takes several months for healing of broken bones healthy" after the routine serology done for all tissue bank of pelvis. Broken humeri are healed in 3–6 months. Simi- donors. Biopsies (5–7 cm long and 2–3 cm wide) were lar time is needed for healing of femurs. Complexity of taken from seven different bones. Bone marrow was orthopaedic situation has important influence on time of removed from trabecular bone by the routine technique bone repair [2-7]. used in our bone bank. There were: cranial flat bones, cor- pus mandibulae, diaphysis radii, distal epiphysis radii, ala BMPs play very important role in bone physiology influ- ossis ilii, diaphysis femoris and distal epiphysis femoris. encing bone growth, turnover, bone formation and carti- Total RNA was extracted using TRIzol Reagent (GIBCO lage induction [8]. Their influence is not restricted to bone BRL) according to manufacturer's recommendations. Fro- tissue. BMPs regulate apoptosis in various types of tissues zen in liquid nitrogen and physically powdered bone [9,10]. It seems that the study of some BMPs isoforms (200 mg) was suspended in 1 ml of TRIzol Reagent, vor- reveals unexpected and very important activities of these texed and incubated 30 min at room temperature with proteins. In one of the recent publication by the group of continuous horizontal rotation. The RNA pellet was dis- Vescovi it was shown that the BMP-4 elicits strongest solved in 20–30 µl of sterile diethylpyrocarbonate-treated effect in triggering a significant reduction in tumor-initiat- Mili-Q water and quantified spectrophotometrically at ing precursors of human glioblastoma [11]. All BMPs, 260 nm. The quality of the extracted RNAs was verified by except BMP-1, belong to the superfamily of transforming agarose gel electrophoresis. RNAs were stored as a water growth factors β, forming large group of signaling mole- solution at -70°C. The "donors" were transported after cules [10,12-15]. Their activity is related only to dimeric accidents to the Dept. of Forensic Medicine and located form. Both homodimers as well as heterodimers are active for the night in cold compartments. The samples were col- [13,16], although their biological activity differs [14]. lected in the morning after medico-legal section and fro- High activity of heterodimers BMP-4–7 and BMP-2–7 was zen in dry ice. We never attempted the investigation on established in vitro and in vivo [13]. High osteoinductive degradation of beta-actin or BMPs – mRNAs as a function potency was proved for heterodimers BMP-2–6 in com- of time. parison with respective homodimers [17,18]. In bone Reverse transcription matrix BMPs are connected with collagen and are not active unless released by the action of collagenases of oste- Single stranded complementary DNA (cDNA) was synthe- oclasts [14]. sized with oligo(dT) primers from 5 µg of total RNA 12–18 using SUPERSCRIPT First-Strand Synthesis System for RT- According to the literature [19] BMPs -2, -4, -6 exert high PCR (GIBCO BRL) accordingly to the manufacturer's osteoinductive potential, influencing odontogenesis instruction. [10,19-21], bone regeneration and healing [13,22-27], bone formation [15,17,28-31] and heterotopic bone Page 2 of 10 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 Quantitation of BMPs expression by real-time PCR Accumulation of PCR products was measured in real-time by using QuantiTect SYBR Green PCR Kit (Qiagen). The sequences of primers are listed in Table 1. Reaction was performed in DNA Engine Opticon 2 Real-Time Detec- tion System (MJ Research) three times for each probe starting with 10 – 15 min of preincubation at 94°C fol- lowed by 45 amplification cycles as follows: 94°C for 1 min, annealing temperature for 1 min and 72°C for 1 min. Beta-actin was used as housekeeping gene for arbi- trary unit calculation for every tested gen. Additionally product identity was confirmed by electrophoresis on a 1.7% agarose (GIBCO BRL) gel and visualized by ethid- ium bromide (SIGMA) staining under UV light. Statitistics: All statistical analysis was performed using the Co groups Figure 1 mparison of BMP-2 expression levels in separate bone STATISTICA 5.0 software (StatSoft, Inc., STATISTICA for Comparison of BMP-2 expression levels in separate bone Windows, Tulsa, OK). We compared the analysed groups groups. Box plot graph, Mean, SE – Standard error, SD – using the analysis of variance (ANOVA). Levels of statisti- Standard Deviation. cal significance was set as p = 0,05: S-significant difference (p < = 0,05), NS – no statistical difference was found (p > 0,05). These differences concerned expression of m-RNAs for genes BMP-2 and BMP-4. In the same bone sample the Results Real-time PCR technique was very useful for detection, level of expression of m-RNAs for BMP-2 and BMP-4 dif- determination and comparison of three BMP isoforms fer. These differences are significant when compact bone expressions. The use of β-actin gene expression as a house- and trabecular bone are compared. keeping gene allowed for calculation of arbitrary units and for comparison of BMP-2, BMP-4 and BMP-6 genes Results of descriptive statistics (Fig 1) show that expres- expression not only between them but also between dif- sion of m-RNA for BMP-2 is higher in ala ossis illi, and in ferent types of bones. Obtained results showed significant trabecular bone of epiphyses of long bones as well as of expression of two isoforms of these proteins – BMP-2 and flat bones then in corpus mandibulae and in the compact BMP-4 (Figures 1 and 2, respectively). Expression of BMP- bone of diaphyses of long bones (Fig 1). The level of 6 was not detected. Melting temperatures of amplicons expression of BMP-4 is higher in trabecular bone in epi- demonstrate their specifity (Figure 3) and electrophoretic physes of long bones, ala ossis illi and corpus mandibulae analysis proved identity of these products (Figures 4 and then in the compact bone of diaphyses of long bones and 5). This multi-analysis allowed for conclusions that there cranial flat bones (Fig 2). is no BMP-6 gene expression in all examined bone sam- ples. In all examined samples the level of expression of m-RNA for BMP-4 was higher than for BMP-2 (Fig. 1 and Fig. 2). Discussion In this paper we demonstrated the differences in expres- Several repetitions of measurements by real-time RT-PCR sion of m-RNA for isoforms BMP-2, BMP-4 in various excluded expression of mRNA for BMP-6 in analysed sam- parts of the human skeleton (Table 2). ples. Table 1: Primer sequences and sizes of amplicons generated by Real-time RT-PCR mRNA Forward primer (5'-3') Reverse primer (5'-3') Annealing [°C] Amplicon [bp] Accession number Citation BMP-2 ATGGATTCGTGGTGGAAGTG GTGGAGTTCAGATGATCAGC 58 349 NM_001200.2 [41] BMP-4 AGCATGTCAGGATTAGCCGA TGGAGATGGCACTCAGTTCA 58 399 NM_130851.1 [41] BMP-6 CAGCCTGCAGGAAGCATGAG CAAAGTAAAGAACCGAGATG 53 246 NM_001718.2 [42] β-actin GGGTCAGAAGGATTCCTATG GGTCTCAAACATGATCTGGG 58 237 NM_001101.2 [43] Page 3 of 10 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 mandibulae and ala ossis ilii, diaphysis radii and ala ossis ilii, diaphysis femoris and distal epiphysis femoris (Table 3, Figure 1) 3. Significant differences were found in expression of BMP-4 between cranial flat bones and ala ossis ilii, cranial flat bones and distal epiphysis radii, corpus mandibulae and distal epiphysis radii, diaphysis and distal epiphysis radii, diaphysis radii and ala ossis ilii, diaphysis radii and ala ossis ilii, distal epiphysis radii and ala ossis ilii, distal epiphysis radii and diaphysis femoris, ala ossis ilii and diaphysis femoris, diaphysis and distal epiphysis femoris. (Table 4, Figure 2). 4. Significant differences exist in the mean values of the levels of expression of BMP-2 when compared with the Compar g Figure 2 roups ison of BMP-4 expression levels in separate bone level of BMP-4 between the following parts of skeletons: Comparison of BMP-4 expression levels in separate bone diaphysis radii, distal epiphysis radii, ala ossis ilii, and dis- groups. Box plot graph, Mean, SE – Standard error, SD – Standard Deviation. tal epiphysis femoris (Table 5). 5. In all other measured parts of skeleton the levels of Our results differ from the ones which were published by expression of the two isoforms of BMP were similar and the Thailand group [36]. We are not fully convinced by did not differ significantly. their results. They used the semiquantitative technique of RT-PCR and the measurements were based on the inten- 6. The expression of BMP-6 isoform was not found in all sity of fluorescence of the agarose gels standardized examined samples. against cDNA for control gene for GAPDH (glyceralde- hyde-3-phosphate dehydrogenase). Their samples were The obtained results might help to understand the differ- taken from patients in the course of surgery and it is diffi- ences in the speed of healing of various parts of the skele- cult to call them "normal control samples". In the healing ton. We have started the measurements of samples of bones after fracture, activation of BMP-6 gene is expected. callus obtained in the course of surgical revisions of slow Literature data [28,37,38] allow us to assume, that the healing bone fractures. lack of m-RNA for BMP-6 in all our samples was compen- sated by activity of BMP-2 [28]. Because of the high oste- The obtained results might also have some value for the ogenic activity of homodimers BMP-2/BMP-2 and BMP-4/ bone banks where the level of expression of BMPs could BMP-4 and of high probability of formation of het- change after single steps of bone preservation as freezing, erodimers BMP-2/BMP-4, the lack of BMP-6 can be liophilisation, radiation sterilization etc. The expected explained by the substitution by homodimers BMP-2/ role of bone implants prepared in bone banks is the pro- BMP-4. The additional argument for our reasoning is the motion of bone healing by two processes – conduction high identity in sequence of proteins BMP-2 and BMP-4 and induction. reaching 92% [10,13,39,40]. Both belong to the same subclass, in contrast to BMP-6, which is the member of The process of bone induction in human orthopaedic different subfamily. practice is not well documented. Some bone banks try to promote this ability by adding Conclusion The analysis of various parts of skeleton of six healthy synthetic recombined BMPs to bone implants, sometimes men who died in traffic accidents showed several differ- with the addition of hydroxyapatite. This is why the ences in expression of some BMPs- isoforms as measured knowledge of bioinductive properties of single parts of by real-time RT-PCR spectrometry: skeleton is important. 1. Various bones forming the skeleton differ in the level of Competing interests expression of BMP-2 and BMP-4 isoforms. The author(s) declare that they have no competing inter- ests. 2. Significant differences were found in expression of BMP-2 between cranial flat bones and ala ossis ilii, corpus Page 4 of 10 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 Figure 3 Expression of BMPs in different bone biopsies derived from 6 patients quantified by real-time PCR Expression of BMPs in different bone biopsies derived from 6 patients quantified by real-time PCR. Page 5 of 10 (page number not for citation purposes) Patient No 1 Patient No 2 Patient No 3 Patient No 4 Patient No 5 Patient No 6 BMP-2 BMP-4 β-actin BMP-6 Bones: — 1; — 2; — 3; — 4; — 5; — 6; — 7 BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 Melting c Figure 4urves of real-time PCR products Melting curves of real-time PCR products. Page 6 of 10 (page number not for citation purposes) Patient No 1 Patient No 2 Patient No 3 Patient No 4 Patient No 5 Patient No 6 BMP-2 BMP-4 β-actin BMP-6 Bones: — 1; — 2; — 3; — 4; — 5; — -6; — 7 BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 E Figure 5 lectrophoretic analysis of real-time PCR products Electrophoretic analysis of real-time PCR products. Page 7 of 10 (page number not for citation purposes) Patient No 1 Patient No 2 Patient No 3 Patient No 4 Patient No 5 Patient No 6 Line 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 BMP-2 BMP-4 β-actin Lines: 1 – DNA marker; 2 – Bone 1; 3 – Bone 2; 4 – Bone 3; 5 – Bone 4; 6 – Bone 5; 7 – Bone 6; 8 – Bone 7 BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 Table 2: The number and codes of examined skeletal bone samples Group Name Group Code N BMP – 2 BMP – 4 Cranial flat bones Bone 1 18 18 Corpus mandibulae Bone 2 18 18 Diaphysis radii Bone 3 18 18 Distal epiphysis radii Bone 4 18 18 Ala ossis ilii Bone 5 18 18 Diaphysis femoris Bone 6 18 18 Distal epiphysis femoris Bone 7 18 18 Table 3: Evaluation of significant differences between mean levels of BMP-2 expression in all examined bones. S – significant difference (p < = 0,05); NS – no statistical difference was found (p > 0,05) Bone 1 Bone 2 Bone 3 Bone 4 Bone 5 Bone 6 Bone 7 Bone 1 - NS NS NS S NS NS Bone 2 NS - NS NSSNS NS Bone 3 NS NS - NSSNS NS Bone 4 NS NS NS - NS NS NS Bone 5 S S S NS - S NS Bone 6 NS NS NS NS S - NS Bone 7 NS NSNS NSNS NS - Table 4: Evaluation of significant differences between mean levels of BMP-4 expression in all examined bones. S – significant difference (p < = 0,05); NS – no statistical difference was found (p > 0,05) Bone 1 Bone 2 Bone 3 Bone 4 Bone 5 Bone 6 Bone 7 Bone 1 - NS NS S S NS NS Bone 2 NS - NS S NSNSNS Bone 3 NS NS - S S NS NS Bone 4 SSS - S S NS Bone 5 S NS S S - S NS Bone 6 NSNSNS S S - S Bone 7 NSNSNS NS NS S - Table 5: The results of the comparison by the Analysis of Variance (ANOVA) (p = 0,05) of the mean levels of expression of BMP-2 and the levels of BMP-4 in the groups of examined bones. S – significant difference (p < = 0,05); NS – no statistical difference was found (p > 0,05) Mean BMP-2 Mean BMP-4 Std. Dev. BMP-2 Std. Dev. BMP-4 Valid N BMP-2 Valid N BMP-4 F p Bone 1 NS 90,7208 94,3128 7,6504 9,4994 18 18 1,5610 0,2200 Bone 2 NS 89,7981 98,2081 10,4187 14,2636 18 18 4,0804 0,0513 Bone 3 S 89,6294 97,0668 6,2952 10,1941 18 18 6,9357 0,0126 Bone 4 S 93,3007 106,2281 10,4861 8,3981 18 18 16,6666 0,0002 Bone 5 S 95,6507 102,5552 9,4378 9,2962 18 18 4,8896 0,0338 Bone 6 NS 89,5953 91,8471 8,7169 10,1045 18 18 0,5124 0,4789 Bone 7 S 92,2981 100,2836 8,0808 12,6990 18 18 5,0663 0,0309 Page 8 of 10 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 24. Rauch F, Lauzier D, Croteau S, Travers R, Glorieux FH, Hamdy R: Authors' contributions Temporal and spatial expression of the bone morphogenetic All authors contributed equally to this work protein-2, -4, and -7 during distraction osteogenesis in rab- bits. Bone 2000, 27(3):453-459. 25. Shen H-C, Peng H, Usas A, Gearhart B, Fu FH, Huard J: Structural References and functional healing of critical-size segmental bone defects 1. Lee NK, Sowa H, Hinoi E, Ferron M, Ahn JD, Confavreux C, Dacquin by transduced muscle-derived cells expressing BMP-4. J Gene R, Mee PJ, McKee MD, Jung DY, Zhang Z, Kim JK, Mauvais-Jarvis F, Med 2004, 6:984-991. Ducy P, Karsenty G: Endocrine regulation of energy metabo- 26. Peng H, Wright V, Usas A, Gearhart B, Shen H-C, Cummins J, Huard lism by skeleton. Cell 130(3):456-69. 2007, Aug 10, J: Synergistic enhancement of bone formation and healing by 2. Smirniotopoulos JG: Radiologic-Pathologic Correlation. CNS stem cell-expressed VEGF and bone morphogenetic pro- Trauma [http://rad.usuhs.mil]. tein-4. J Clin Invest 2002, 110:751-759. 3. Peltier J, Ryan MW, Quinn FB: Mandible Fractures. UTMB Maga- 27. Sato M, Ochi T, Nakase T, Hirota S, Kitamura Y, Nomura S, Yasui N: zine [http://www.utmb.edu]. May 26, 2004 Mechanical tension-stress induces expression of bone mor- 4. Dee R, Hurst LC, Gruber MA, Kottmeier SA: Principles of Orthopaedic phogenetic protein BMP-2 and BMP-4, but not BMP-6, BMP- Practice New York: McGraw-Hill; 1997. 7, and GDF-5 mRNA, during distraction osteogenesis. J Bone 5. Brenneman FD, Katyal D, Boulanger BR, Tile M, Redelmeier DA: Miner Res 1999, 14(7):1084-1095. Long-term outcomes in open pelvic fractures. The Journal of 28. Cao X, Chen D: The BMP signaling and in vivo bone forma- Trauma 1997, 42(5):773-7. tion. Gene 2005, 357:1-8. 6. Korovessis P, Baikousis A, Stamatakis M, Katonis P: Medium- and 29. Varga AC, Wrana JL: The disparate role of BMP in stem cell long-term results of open reduction and internal fixation for biology. Oncogene 2005, 24:5713-5721. unstable pelvic ring fractures. Orthopedics 2000, 30. Ebisawa T, Tada K, Kitajima I, Tojo K, Sampath TK, Kawabata M, 23(11):1165-71. Miyazono K, Imamura T: Characterization of bone morphoge- 7. Malavaud B, Mouzin M, Tricoire JL, Gamé X, Rischmann P, Sarramon netic protein-6 signaling pathways in osteoblast differentia- JP, Puget J: Evaluation of male sexual function after pelvic tion. J Cell Sci 1999, 112:3519-3527. trauma by the International Index of Erectile Function. Urol- 31. Rickard DJ, Hofbauer LC, Bonde SK, Gori F, Spelsberg TC, Riggs BL: ogy 2000, 55(6):842-6. Bone morphogenetic protein-6 production in human oste- 8. Chen D, Zhao M, Mundy GR: Bone morphogenetic proteins. oblastic cell lines. J Clin Invest 1998, 101(2):413-422. Growth Factors 2004, 22(4):233-241. 32. Kang Q, Sun MH, Cheng H, Peng Y, Montag AG, Deyrup AT, Jiang W, 9. Reddi AH: Interplay between bone morphogenetic proteins Luu HH, Luo J, Szatkowski JP, Vanichakarn P, Park JY, Li Y, Haydon and cognate binding proteins in bone and cartilage develop- RC, He TC: Characterization of the distinct orthotopic bone- ment: noggin, chordin and DAN. Arthritis Research 2001, 3:1-5. forming activity of 14 BMPs using recombinant adenovirus- 10. Botchkarev VA: Bone morphogenetic proteins and their mediated delivery. Gene Therapy 2004, 11:1312-1320. antagonists in skin and hair follicle biology. Progress in Derma- 33. Noel D, Gazit D, Bouquet C, Apparailly F, Bony C, Plence P, Millet V, tology 2003, 120:36-47. Turgeman G, Perricaudet M, Sany J, Jorgensen C: Short-term BMP- 11. Piccirillo SG, Reynolds BA, Zanetti N, Lamorte G, Binda E, Broggi G, 2 expression is sufficient for in vivo osteochondral differenti- Brem H, Olivi A, Dimeco F, And Vescovi AL: Bone morphogenetic ation of mesenchymal stem cells. Stem Cells 2004, 22:74-85. proteions inhibit the tumorogenic potential of human brain 34. Groeneveld EHJ, Burger EH: Bone morphogenetic proteins in tumor-initiating cell. NATURE 2006, 444:761-765. human bone regeneration. European Journal of Endocrinology 2000, 12. Dimitriou R, Giannoudis PV: Discovery and development of 142:9-21. BMPs. Injury 2005, 36S:S28-S33. 35. Yamaguchi A, Komori T, Suda T: Regulation of osteoblast differ- 13. Sakou T: Bone morphogenetic proteins: from basic studies to entiation mediated by bone morphogenetic proteins, hedge- clinical approaches. Bone 1998, 22(6):591-603. hogs, and cbfa1. Endocrine Reviews 2000, 21(4):393-411. 14. Sykaras N, Opperman LA: Bone morphogenetic proteins 36. Suttapreyasri S, Koontongkaew S, Phongdara A, Leggat U: Expres- (BMPs): how do they function and what can they offer the cli- sion of bone morphogenetic proteins in normal human nician? Journal of Oral Science 2003, 45(2):57-73. intramembranous and endochondral bones. Int J Oral Maxillo- 15. Wan M, Cao X: BMP signaling in skeletal development. Bio- fac Surg 2006, 35(5):444-452. chemical and Biophysical Research Communications 2005, 328:651-657. 37. Qi X-J, Bell PR, Li G: Bone morphogenetic proteins in bone for- 16. Subach BR, Haid RW, Rodts GE, Kaiser MG: Bone morphogenetic mation and development. In Current Topics in Bone Biology World protein in spinal fusion: overview and clinical update. Neuro- Scientific Publisher, Singapore; 2005:163-177. surg Focus 2001, 10(4):Article 3. 38. Kochanowska1 IE, Wlodarski K, Wojtowicz a, Niemira1 K, 17. Kugimiya F, Kawaguchi H, Kamekura S, Chikuda H, Ohba S, Yano F, Ostrowski K: Osteogenic Properties of Various HeLa Cell- Ogata N, Katagiri T, Harada Y, Azuma Y, Nakamura K, Chung U-il: Lines and the BMP Family Genes Expression. Ann Transplant Involvement of endogenous bone morphogenetic protein 2002, 7(4):58-62. BMP2 and BMP6 in bone formation. J Biol Chem 2005, 39. Sebald W, Nickel J, Zhang J-L, Mueller TD: Molecular recognition 280(42):35704-35712. in bone morphogenetic protein (BMP)/receptor interaction. 18. Westerhuis RJ, van Bezooijen RL, Kloen P: Use of bone morpho- Biological Chemistry 2004, 385:697-710. genetic proteins in traumatology. Injury 2005, 40. Luo J, Sun MH, Kang Q, Peng Y, Jiang W, Luu HH, Luo Q, Park JY, Li 36(12):1405-1412. Y, Haydon RC, He TC: Gene therapy for bone regeneration. 19. Nakashima M, Reddi AH: The application of bone morphoge- Current Gene Therapy 2005, 5:167-179. netic proteins to dental tissue engineering. Nature Biotechnol- 41. Kusafuka K, Yamaguchi A, Kayano T, Fujiwara M, Takemura T: ogy 2003, 21(9):1025-1032. Expression of bone morphogenetic proteins in salivary pleo- 20. Iohara K, Nakashima M, Ito M, Ishikawa M, Nakasima A, Akamine A: morphic adenomas. Vichrows Arch 1998, 432:247-253. Dentin regeneration by dental pulp stem cell therapy with 42. Gilbert L, He X, Farmer P, Boden S, Kozlowski M, Rubin J, Nanes MS: recombinant human bone morphogenetic protein 2. J Dent Inhibition of osteoblast differentiation by tumor necrosis fac- Res 2004, 83(8):590-595. tor-alpha. Endocrinology 2000, 141:3956-3964. 21. Yamashiro T, Tummers M, Thesleff I: Expression of bone mor- 43. Balabanian K, Foussat A, Bouchet-Delbos L, Couderc J, Krzysiek R, phogenetic proteins and Msx genes during root formation. J Amara A, Baleux F, Portier A, Galanaud P, Emilie D: Interleukin-10 Dent Res 2003, 82(3):172-176. modulates the sensitivity of peritoneal B lymphocytes to 22. Yazawa M, Kishi K, Nakajima H, Nakajima T: Expression of bone chemokines with opposite effects on stromal cell-derived morphogenetic proteins during madibular distraction osteo- factor-1 and B-lymphocyte chemoattractant. Blood 2002, genesis in rabbits. J Oral Maxillofac Surg 2003, 61:587-592. 99:427-436. 23. Farhadieh RD, Gianoutsos MP, Yu Y, Walsh WR: The role of bone morphogenetic proteins BMP-2 and BMP-4 and their related postreceptor signaling system (Smads) in distraction osteo- genesis of the mandible. J Craniofac Surg 2004, 15(5):714-718. Page 9 of 10 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:128 http://www.biomedcentral.com/1471-2474/8/128 Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2474/8/128/pre pub Publish with Bio Med Central and every scientist can read your work free of charge "BioMed Central will be the most significant development for disseminating the results of biomedical researc h in our lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp Page 10 of 10 (page number not for citation purposes)

Journal

BMC Musculoskeletal Disorders – Springer Journals

Published: Dec 27, 2007

There are no references for this article.