Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/springer-journals/fermentation-dynamics-and-diversity-of-bacterial-community-in-four-t0b1Ku71Be
- Publisher
- Springer Journals
- Copyright
- Copyright © 2019 by Springer-Verlag GmbH Germany, part of Springer Nature and the University of Milan
- Subject
- Life Sciences; Microbiology; Microbial Genetics and Genomics; Microbial Ecology; Mycology; Medical Microbiology; Applied Microbiology
- ISSN
- 1590-4261
- eISSN
- 1869-2044
- DOI
- 10.1007/s13213-018-1398-z
- Publisher site
- See Article on Publisher Site
Abstract
Woody forage is a new feeding resource used worldwide, and silage is the main long-term storage, mediated by micro-organisms present during their processing. The objectives of our work were to evaluate the fermentation dynamics and to characterize the bacterial community of our typical woody forages. We selected four typical woody forages: paper mulberry (Broussonetia papyrifera), mulberry (Morus alba L.), moringa tree (Moringa oleifera), and Anthocephalus chinensis (Neolamarckia cadamba). The materials were ensiled and sampled after ensiling 1, 3, 5, 7, 15, 30, and 60 days. Our results indicate that woody forages have good forage properties with relatively high crude protein content and low neutral detergent fiber and acid detergent fiber content. −1 However, the water soluble carbohydrate content in paper mulberry was considerably low (18.67 g kg ), which makes ensiling difficult. The lactic acid and acetic acid contents in each of the four materials were reduced after 3 days of ensiling and increased again after 30 days of ensiling, with the exception of Anthocephalus chinensis. Anthocephalus chinensis and moringa tree were well-preserved after 7 and 60 days of ensiling, respectively, with low pH and ammonia nitrogen content. Cyanobacteria was predominant in moringa tree and Anthocephalus chinensis before ensiling, and Lactobacillus became dominant after 15 days of ensiling. Enterobacter dominated the paper mulberry and mulberry during fermentation process and accelerated their poor silage quality. Therefore, the conformity of bacterial community succession with ensiling parameters guaranteed the final quality of woody forage silages, and this might aid in controlling the manufacturing process. . . . Keywords Woody forage Silage quality Dynamics Bacterial community Introduction materials, and the introduction of them was described as fol- lows. Paper mulberry (Broussonetia papyrifera) is a decidu- Developing new forage resources is a priority to answer the ous tree and is grown throughout China, including temperate, increasing demand for animal products in numerous countries, tropical, and subtropical regions. The CP content of paper including China. Woody forage has recently been proposed as mulberry leaves has been reported to range between 18 and a new type of livestock feed (Hejcman et al. 2016), as woody 24%, exhibiting great potential for development as an un- forage is characterized by high yields and high crude protein conventional resource (Xiong 2010). Mulberry (Morus (CP). In our study, four typical woody forages were chosen as alba L.) is also a deciduous tree with CP and water soluble carbohydrate (WSC) contents and annual fresh yield (60– 90 t/hm ) greater than alfalfa (Huang et al. 2006). Moringa Electronic supplementary material The online version of this article tree (Moringa oleifera) may be another successful forage (https://doi.org/10.1007/s13213-018-1398-z) contains supplementary and can be harvested at 45-day intervals, yielding a total material, which is available to authorized users. biomass of 35 tons of dry matter (DM) per hectare (Cohen et al. 2016), and Anthocephalus chinensis (Neolamarckia * Fu Yu Yang yfuyu@126.com cadamba) may also be a successful forage (Deng et al. 2011). Importantly, several seminal studies have indicated College of Animal Science and Technology, China Agricultural that woody forage mixed with grasses or crops could be fed University, Beijing 100193, China to animals and may successfully improve the livestock Beijing Sure Academy of Biosciences, Beijing 100085, China growth rate and production performance (Li 2010; College of Forestry and Landscape Architecture, South China Osmari et al. 2011; Cohen et al. 2016). Agricultural University, Guangzhou 510642, China 234 Ann Microbiol (2019) 69:233–240 The principal harvest season of woody forage is June to harvested from the experimental base of South China August—periods with high temperatures and precipitation. Agricultural University in Guangzhou (23.14 N, 113.32 E, These environmental conditions lead to high forage moisture, elevation 11 m, annual mean temperature 22.2 °C, average and each of our selected woody forages may reach nearly annual precipitation 1623–1899 mm) on August 11, 2016, 80%. Because of this high moisture, ensiling may be more and the biomass was not wilted. Each of the four woody spe- suitable for preserving woody forages, in contrast with tradi- cies was a 2-year-old plant, with a height of approximately 2– tional hay. Ensiling is a forage preservation method common- 2.5 m. We used orchard shears to collect woody twigs. The ly used for moist forage crops with satisfactory conservation materials were chopped into 2–3 cm pieces using a hand hay of nutrients (Xue et al. 2015). Silage quality depends on many cutter, and 150 g was packed into plastic bags (20 × 30 cm). factors, the most important being epiphytic microbial commu- Then, air was removed using a vacuum sealer (DZ-280/2SE, nity, water soluble carbohydrate (WSC), buffering capacity Furuide machinery Co., Ltd., Shandong, China). Between (BC), and DM content (Zhang et al. 2017). Li et al. (2017) each collection, new experimental gloves were used to prevent also reported that polyphenol played an important role in im- bacterial contamination between samples. Twenty-one ali- proving silage quality. During the ensiling process, different quots of silage were collected for each woody species. The micro-organisms populate the materials, differentially altering plastic bags were stored at room temperature until further silage quality. Using plate count methods and qPCR, Konig analysis. et al. (2017) evaluated the number of bacterial colonies pres- ent and identified bacterial communities to genera by denatur- ing gradient gel electrophoresis (Zhang et al. 2016)or16S Chemical characteristic rRNA gene sequencing and found ensiling influenced the relative abundance of many bacterial communities. Li et al. Pre-ensiled materials were sampled to determine the baseline (2015) studied the bacterial community mixed with chemical composition, and three replicate silages of the four microalgae and revealed that the similarly microalgae species were opened and sampled at 1, 3, 5, 7, 15, 30, and additions to silage influenced bacterial community structure 60 days after ensiling. Ten grams of each silage sample was of Manyflower silvergrass. Kraut et al. (2016) assessed the homogenized in a blender with 90 ml distilled water for 1 min microbiota of large-scale silages produced in a bunker silo and filtered through four layers of cheesecloth and three layers and found that the location of silage influenced microbial of filter paper as described by Zhang et al. (2015), and ammo- communities, as well. Taxonomic diversity was lower in si- nia nitrogen (NH -N), organic acid content, and pH were lage located in the center or edges, while silage in corners of assessed. pH was assessed using a FiveEasy 20K; Mettler- the bunker exhibited highly diverse microbiota, with low Toledo International Inc., Greifensee, Switzerland. The organ- abundances of lactic acid bacteria (LAB) and high levels of ic acid content included lactic acid, acetic acid, propionic acid, Enterobacteriaceae. However, limited research has been con- and butyric acid and was measured by HPLC (column, ducted assessing fermentation and microbial community char- Shodex RS Pak KC-811; Showa Denko K.K., Kawasaki, acteristics during woody forage ensiling. Therefore, we en- Japan; detector, DAD, 210 nm, SPD-20A; Shimadzu Co., −1 −1 siled four woody forage species and sampled following 1, 3, Ltd., Kyoto, Japan; eluent, 3 mmol l HClO ,10 ml min ; 5, 7, 15, 30, and 60 days to assess fermentation dynamics. To temperature, 50 °C). Dry matter (DM) of residue material was provide primordial basis for successful preservation of woody determined by oven-drying at 65 °C for 48 h, ground to pass forages, we evaluated microbial communities throughout en- through a 1-mm screen, and stored at room temperature for siling using both plate count methods and high-throughput later analysis. Neutral detergent fiber (NDF) and acid deter- sequencing technology. gent fiber (ADF) were measured according to Van Soest et al. (1991) using an ANKOM 2000 Fiber Analyzer. For NDF measurements, a heat-tolerant analyzed enzyme and sodium Materials and methods sulfite were also included. Acid detergent lignin (ADL) was determined using 72% H SO digestion ADF followed by 2 4 Silage materials and ensiling incineration: the fraction lost on incineration approximated ADL. WSC content was determined using the anthrone meth- Paper mulberry and mulberry were harvested at the experi- od. CP content was calculated by multiplying total nitrogen mental base of Luoyang Academy of Agriculture and (TN) by 6.25, while the TN was determined according to Forestry Science in Henan of China (34.39 N, 112.12 E, ele- Kjeldahl procedure. The buffering capacity (BC) of the silage vation 250 m, annual mean temperature 15 °C, average annual raw materials was measured by suspending 1 g of sample in precipitation 603 mm) on June 24, 2016, during the rainy and 100 ml of distilled water for 30 min, followed by titration to −1 hot season. Woody biomass was wilted for 14 h following pH 4.0 with lactic acid (0.1 mol l ). NH –N was analyzed harvest. Moringa tree and Anthocephalus chinensis were with the phenol-sodium hypochlorite method. Ann Microbiol (2019) 69:233–240 235 Microbial analyses with plate count method effects of woody forage species (W), ensiling days (D), and their interaction (D × W). The means were then compared for Ten grams of pre-ensiled forages and silages was sampled and significance by Duncan’s multiple range method. All statisti- immediately stored at − 80 °C. An additional 10 g was blend- cal analyses were performed using the general linear model ed with 90 ml of sterilized water and serially diluted in steril- procedure of SAS 9.0 (SAS Institute, Cary, NC, USA, 2002). −1 −5 ized distilled water from 10 to 10 . The number of LAB Significance was declared at P < 0.05 unless otherwise noted. was measured by the plate count method using de Man, The alpha-diversities of the samples included Shannon index, Rogosa, and Sharpe (MRS) agar incubated at 30 °C for 48 h Chao richness estimator, Good’s coverage, relative abundance in an anaerobic box (TE-HER Hard Anareobox, ANX-3; of bacteria at the genus level, principle component analysis Hirasawa Ltd., Tokyo, Japan). Yeast was counted on rose (PCA), and Spearman correlation heat maps. Heat maps were bengal medium agar after incubation at 28 °C for 48 h, and calculated online by the i-sanger platform (version, http:// the coliform bacteria were counted on eosin-methylene blue www.i-sanger.com/). The base output of Spearman agar after incubation at 37 °C for 48 h. All microbial data were correlation heat map is a distance matrix representing the log -transformed for fresh matter (FM) calculations. All me- correlation coefficient between each micro-organism in the dia were obtained from Beijing Aoboxing BIO-TECH Co., community and environmental factor variable. Ltd., Beijing, China. Illumina HiSeq sequencing of complex bacterial Results populations Chemical and microbial characteristics before ensiling The samples stored at − 80 °C were sent to Majorbio Bio- in four typical woody forages Pham Technology Co., Ltd. (Shanghai, China). Pre-ensiled −1 materials and silage samples were added to a 10 mmol l of The dry matter (DM) in paper mulberry and mulberry was sterilized phosphate-buffered saline (pH 7.4), and DNA ex- greater than moringa tree or Anthocephalus chinensis traction was performed. The V4-V5 region of the bacteria 16S (Table 1), because the paper mulberry and mulberry were ribosomal RNA gene was amplified by PCR (95 °C for 2 min, wilted for 14 h. The pH of Anthocephalus chinensis silage followed by 25 cycles of 95 °C for 30 s, 55 °C for 30 s, and was 5.1, lower than the pH values of the other three materials. 72 °C for 30 s and a final extension at 72 °C for 5 min) using The WSC content in paper mulberry was considerably lower the primers 338F (ACTCCTACGGGAGGCAGCAG) and than any of the other materials (Table 1). Buffering capacity 806R (GGACTACHVGGGTWTCTAAT). The PCR program (BC) strongly influences ease of ensiling, with lower BC included initial denaturation at 95 °C for 3 min, followed by values indicating ensiling is easier. In our study, the BC value 25 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C of paper mulberry (94.15) was higher than the other materials, for 30 s, and extension at 72 °C for 30 s, with a final extension while Anthocephalus chinensis was the lowest (29.25) at 72 °C for 5 min. To minimize PCR bias, PCR reactions for (Table 1). each sample were conducted in triplicate, and mixtures of three PCR products were used for DNA concentration deter- Fermentation quality of our selected woody forages mination and sequencing (Li et al. 2015). The DNA samples were paired-end sequenced (2 × 250) on an Illumina MiSeq pH, lactic acid, acetic acid, propionic acid, butyric acid, and platform. For quality-control purposes, any sequences that NH –N were all affected by both woody forage species (W) contained mismatches and ambiguous reads in primers were and ensiling days (D), and the interaction between W and D removed. was significant (P <0.001) (S. Table 1). While pH in all four Operational units (OTUs) were clustered with a 97% sim- woody forage silages decreased after 60 days of ensiling, only ilarity cutoff using UPARSE (version 7.1 http://drive5.com/ moringa tree and Anthocephalus chinensis had a pH of less uparse/), and chimeric sequences were identified and removed than 4.00. The lactic acid content did not exhibit a consistent using UCHIME. The taxonomy of each 16S rRNA gene trend across days of ensiling. Acetic acid contents in paper sequence was analyzed by RDP Classifier (http://rdp.cme. mulberry and mulberry was much greater compared to msu.edu/) against the SILVA (SSU115) 16S rRNA database moringa tree or Anthocephalus chinensis, and decreased acetic using a confidence threshold of 70%. acid is also an indicator of enhanced silage quality. During ensiling, the propionic acid and butyric acid concentrations Calculations and statistical analysis changed little for paper mulberry, mulberry, or Anthocephalus chinensis. Propionic acid was not detectable Data for silage fermentation and chemical composition were in moringa tree throughout ensiling, and butyric acid was only analyzed by two-way analysis of variance to evaluate the detectible for the first 7 days of ensiling. Generally, the NH – 3 236 Ann Microbiol (2019) 69:233–240 Table 1 Chemical and micro-organism composition of four typical woody forages prior to ensiling Items Paper mulberry Mulberry Moringa tree Anthocephalus chinensis SEM P value −1 b a c d Dry matter (g kg)340.2 347.2 248.1 276.1 13.73 < 0.0001 a a b c pH 6.74 6.59 5.80 5.10 0.10 < 0.0001 −1 c a b b Water-soluble carbohydrates (g kg DM) 18.67 73.68 56.40 50.80 2.83 < 0.0001 −1 b b a c Crude protein (g kg DM) 230.5 224.9 252.2 180.3 3.44 < 0.0001 −1 Neutral detergent fiber (g kg DM) 284.9 242.1 258.8 303.4 19.76 0.2088 −1 b b b a Acid detergent fiber (g kg DM) 183.4 148.5 150.8 226.8 10.34 0.0022 −1 b d c a Acid detergent lignin (g kg DM) 64.16 30.41 44.90 130.9 3.54 < 0.0001 −1 a a b Lactic acid bacteria (log cfu g FM) 5.47 5.73 3.65 ND 0.24 < 0.0001 −1 ab a b Coliform bacteria (log cfu g FM) 5.44 5.62 4.92 ND 0.19 < 0.0001 −1 b a c Yeasts (log cfu g FM) 5.47 7.07 4.89 ND 0.16 < 0.0001 −1 a b c d Buffering capacity (g LA kg DM) 94.15 66.87 50.67 29.25 3.23 < 0.0001 a–d DM, dry matter; LA,lactic acid; ND, not detected. Means in the same row ( ) with different superscript letters differ significantly from each other (P <0.05) N concentration increased with time for each of our four The dominant epiphytic LAB in paper mulberry, mulberry, woody forages. However, the NH –N concentration of paper moringa tree, and Anthocephalus chinensis were Lactococcus mulberry was considerably higher, compared to the other (68.00%), Enterococcus (82.67%), Lactobacillus (75%), and forages. Lactobacillus (55.08%), respectively (Fig. 2). During ensil- ing, Lactococcus was replaced by Enterococcus and Microbial community of our selected woody forages Pediococcus in paper mulberry, while Lactobacillus dominat- ed all other materials. Change in bacterial community structure was calculated at the genus level with a threshold set at 1.0% during ensiling. The number of sequences was standardized relative to the mini- Relationship between chemical characteristics mum number of 28,108 sequences obtained from a single and microbial community sample. Each of the four pre-ensiling materials had marked differences in bacterial community structure (Fig. 1). Pantoea The Spearman correlation heat maps of each material were (30.66%), Cyanobacteria (34.40%), and Enterobacter determined at the genus level (S. Fig. 1). The results (12.24%) were the predominant bacteria present in paper mul- showed a significantly negative correlation between berry material before ensiling; Sphingomonas (14.20%), Lactobacillus and Pediococcus and pH in paper mulberry Pseudomonas (21.02%), Pantoea (15.76%), and and moringa tree, which revealed that the Lactobacillus or Enterobacter (8.98%) were the predominant bacteria present Pediococcus determined the silage quality in these two in mulberry material; Cyanobactria (95.16%) predominated materials. We found a significantly positive correlation of moringa tree; Cyanobactria (36.93%) and Methylobacterium Enterobacter and Methylobacterium with pH, but also a (9.69%) were dominant in Anthocephalus chinensis (Fig. 1). positive correlation with lactic acid concentration in During ensiling, the proportion of Enterobacter, Anthocephalus chinensis. Lactococcus positively correlat- Enterococcus, Lactococcus, Pediococcus,and Lactobacillus ed with WSC in paper mulberry and mulberry; this may be increased, while the proportion of Pantoea and due to the relatively high count of Lactococcus at the be- Cyanobacteria decreased to < 0.2% in paper mulberry silage. ginning of ensiling. The Spearman correlation heat map of In mulberry, Pseudomonas, Pantoea,and Sphingomonas spe- the total material was determined at the genus level (S. Fig. cies decreased during ensiling, while Enterobacter (55.24%), 2). The pH was tightly (P < 0.001) negatively correlated Lactobacillus (28.80%), and Enterococcus (6.92%) dominat- with Lactobacillus (− 0.699), but positively correlated with ed after 60 days of ensiling. Cyanobacteria decreased from Citrobacter (0.568), Cronobacter (0.623), Enterococcus 95.16 to 0.43% after 15 days of ensiling in moringa tree, with (0.564), Lactococcus (0.574), and Pantoea (0.755). A sig- Enterobacter (22.68%) and Lactobacillus (70.33%) dominat- nificantly negative correlation was observed between WSC ing the microbiota after 60 days ensiling. In Anthocephalus content and Citrobacter, Enterobacter, Enterococcus, chinensis, Cyanobacteria and Methylobacteria decreased to Lactococcus and Pediococcus. However, positive correla- less than 2% after ensiling, while Lactobacillus increased tions occurred between lactic acid and acetic acid and these from 0.74 to 84.86%. bacterial species. Ann Microbiol (2019) 69:233–240 237 Fig. 1 Bacteria relative abundance of dominant-defined genera in the ensiling process of the paper mulberry, mulberry, moringa tree, and Anthocephalus chinensis. Silages were opened after 1, 3, 5, 7, 15, 30, and 60 days Discussion paper mulberry and mulberry silages produced lower quality silage, exhibiting high pH and harmful microbial community Our results indicate woody biomass may be a useful forage structure (mainly Enterobacter) throughout the 60 days of this and can be stored through ensiling. In our study, all four study. Based on the bacterial community and chemical analy- woody species had relatively high content of CP and low sis in our study, the natural fermentation of paper mulberry NDF and ADF content. The CP contents of each of the four and mulberry led to poor silage quality. −1 woody species (between 180.3 and 252.2 g kg DM) were Before ensiling, it is important to consider the BC value −1 higher than CP typical of alfalfa (160–230 g kg DM). and WSC concentration to predict the quality of fermentation. −1 Similarly, the NDF (242.1–303.4 g kg DM) and ADF Previous research indicates a relatively high BC value may be −1 (148.5–226.8 g kg DM) concentrations of the woody spe- difficult to ensile. For example, the BC value of maize, a cies assessed in this study were lower than the typical values forage notably easy to ensile (McGarvey et al. 2013), is 23 g −1 −1 reported for alfalfa (NDF, 374.3–400.3 g kg DM; ADF, LA kg DM (Herrmann et al. 2015). Alfalfa, one of the most −1 290.5–312.8 g kg DM) (Silva et al. 2016; Tao et al. 2017). difficult crops to ensile (McAlliser et al. 1998), has a BC value −1 Therefore, the woody species of this study may have im- ranging from 66 to 78 g LA kg DM (Tao et al. 2017; Wang proved forage properties, compared to alfalfa. et al. 2009;Wangetal. 2017). In our study, the BC value of −1 While all four woody species were considered acceptable paper mulberry (94.15 g LA kg DM) was considerably for silage quality and storage, the silage quality of greater than the other woody forages, while mulberry Anthocephalus chinensis and moringa tree were superior to (66.87) and moringa tree (50.67) exhibited moderate levels, those of paper mulberry and mulberry. For example, and Anthocephalus chinensis had a low BC content (29.25). Anthocephalus chinensis was maintained and able to be suc- The low BC content in Anthocephalus chinensis is likely due cessfully stored after 7 days, and moringa tree was well- to its low pH (5.10), which is presumably caused by elevated preserved and able to be stored after 60 days of ensiling, as concentrations of chlorogenic acid, cadambinic acid, a low pH (< 4.2) and beneficial bacterial community (mainly cadambine acid, quinovic acid, n-hexadecanoic acid, and Lactobacillus) was achieved at these times. Alternatively, octadecanoic acid in the leaf tissue (Arti and Pradeep 2016). 238 Ann Microbiol (2019) 69:233–240 Fig. 2 Lactic acid bacteria relative abundance in paper mulberry (a), mulberry (b), moringa tree (c), and Anthocephalus chinensis (d) in the different silages according to fermentation time at the genus level. Silages were opened after 1, 3, 5, 7, 15, 30, and 60 days According to these BC values, Anthocephalus chinensis may acid (Yang et al. 2016). When insufficient lactic acid is pro- be the easiest to ensile, of the four woody species assessed in duced, resulting silage is unable to inhibit the growth of acetic our study. Likewise, WSC, with a recommended level of 60 to acid-producing bacteria, allowing for acetic acid fermentation −1 70 g kg DM to achieve well-preserved conservation (Zhang to occur. et al. 2016), is much greater than that observed in paper mul- Different lactic acid content variations have been report- −1 berry (18.67 g kg DM). Therefore, a combined assessment ed in previous studies, and lactic acid content in silage may of BC value, and WSC content, indicates Anthocephalus be affected by the species of crop, lactic acid-producing chinensis will be the easiest to ensile, and paper mulberry LAB, lactic acid-utilizing yeast, or Enterobacter (Zhang maybe difficult to ensile, across all four woody species et al. 2016). In our study, lactic acid-utilizing yeasts were assessed in our study. present only during the first 3 and 5 days in mulberry and During ensiling, members of Enterobacter were discovered paper mulberry, respectively, and were not detected at any in paper mulberry and mulberry; these bacteria can adapt to a time in moringa tree and Anthocephalus chinensis (S. wide range of temperature and moisture conditions and can Table 2), while Enterobacter was detected in paper mul- convert lactic acid to acetic acid (Gan et al. 2017). This may berry, mulberry, and moringa tree during ensiling. On the explain the high concentrations of acetic acid found in paper other hand, the lactic acid concentration increased during mulberry and mulberry silage in the early days of ensiling and the first 3 days of ensiling in paper mulberry, mulberry, and correspond to the second stage of fermentation. Yang et al. Anthocephalus chinensis, while moringa tree increased (2011) reported that the fermentation process in silage can during the first 7 days. Thus, the observed decrease in be classified into four primary stages, and in the second short lactic acid may be due to the presence of Enterobacter, stage, coli-type bacteria and other fungi produce acetic acid. rather than lactic acid-utilizing yeast. Then, the subsequent increase in acetic acid concentration NH –N is produced through CP degradation, and therefore, after ensiling 15 days in paper mulberry and mulberry maybe the NH –N concentration is a reliable indicator of proteolysis because LAB failed to use WSC to produce sufficient lactic in silage, with well-preserved silage displaying less than Ann Microbiol (2019) 69:233–240 239 −1 100gkg TN (Zhang et al. 2015). Dong et al. (2017)reported by cell death (McElhiney et al. 2001). Fortunately, our that low pH could suppress Enterobacteria, Clostridia,and study indicates ensiling can decrease the abundance of other micro-organisms, thereby decreasing concentrations of Cyanobacteria, thus reducing these adverse effects. NH –N with concomitant loss in consumption of WSC. In our Pantoea can reduce NH –N concentrations (Ogunade 3 3 study, considerable levels of Enterobacter were observed in et al. 2018) and was found in paper mulberry prior to and paper mulberry, mulberry, and moringa tree, and NH –Ncon- after ensiling. However, the NH –N content was inconsis- 3 3 centrations increased linearly during ensiling in these three tent with results reported by Ogunade et al. (2018), and materials. However, the final NH –N content in more research is needed to illuminate the roles of these −1 Anthocephalus chinensis (2.01 g kg TN) was the lowest of microbes during ensiling. all four woody species, likely due to the deactivation of pro- Many parameters assessed in our study indicate moringa teases induced by the low pH (Li et al. 2017), and the inhibi- tree and Anthocephalus chinensis are superior species for tion of Enterobacter. Meanwhile, the WSC content in moringa silage, compared to paper mulberry and mulberry. While tree and Anthocephalus chinensis decreased insignificantly several parameters indicate paper mulberry and mulberry after ensiling and was greater than that of paper mulberry may produce poor silage, these were primary due to high and mulberry, throughout the 60 days of this study. pH and harmful microbial community structure (mainly Epiphytic LAB naturally present on forage are responsible Enterobacter). for fermentation during ensiling (Waroon et al. 2016), and the ratio of lactic acid-producing cocci and rods was also important. Cai et al. (1998) reported that when lactic acid- producing cocci (e.g., heterofermentative Weissella and Conclusion Leuconostocs species and homofermentative Pediococci, Lactococci,and Enterococci species) were overabundant, fer- In summary, this study revealed variations in bacterial mentation became insufficient. In contrast, lactic acid- communities in different stages of woody forage silages. producing rods (Lactobacilli) promoted sustained lactic acid Our results confirmed that Enterobacter members were the production and sufficient fermentation. In our study, LAB most dominant order in paper mulberry and mulberry, counts in paper mulberry and mulberry were greater than whereas Lactobacillus phylotypes prevailed in moringa 10 cfu/g FM, while those in moringa tree and tree and Anthocephalus chinensis after ensiling. Anthocephalus chinensis were relatively low (10 cfu/g FM). Anthocephalus chinensis was maintained and able to be These values are inconsistent with our observed silage quality. successfully stored after 7 days, and moringa tree was This may because the dominant LAB was Lactococcus and well-preserved and able to be stored after 60 days of ensil- Enterococcus in paper mulberry, Enterococcus in mulberry, ing, as a low pH (< 4.2) and beneficial bacterial community while moringatreeand Anthocephalus chinensis was (mainly Lactobacillus) was achieved at these times. Lactobacillus prior to ensiling. Therefore, the silage quality Alternatively, paper mulberry and mulberry silages pro- in paper mulberry and mulberry were characterized by greater duced lower quality silage, exhibiting high pH and harmful LAB counts, but relatively greater abundance of less benefi- microbial community structure (mainly Enterobacter) cial bacteria resulted in lower fermentation quality than throughout the 60 days of this study. The results also dem- moringa tree and Anthocephalus chinensis. onstrated that woody species (paper mulberry, mulberry, To further understand the microbial communities during moringa tree, and Anthocephalus chinensis) have a rela- the fermentation process, the relative abundance of bacterial tively high CP content and low NDF and ADF content, communities at genus level was determined. Among these indicating their successful use as high-quality forage, genera, Enterobacter, Lactobacillus,and Cyanobacteria were while more studies should be conducted to improve the the dominant bacterial communities. The presence of silage quality of paper mulberry and mulberry. Enterobacter has been reported to be responsible for increased Funding information This work was supported by National Key pH, which triggers a proliferation of other aerobic micro- Technology R & D Programme for the 13th Five-year Plan organisms (Zhang et al. 2015). Cyanobacteria are photosyn- (2017YFD0502102), China; National Key Technology R & D thetic bacteria that are common in all freshwater systems Programme for the 12th Five-year Plan (2011BAD17B02), China; and (Crush et al. 2008), and the moringa tree and Anthocephalus National Technology Leader BTen Thousand People Plan^ (201502510410040), China. chinensis were harvested in a region with high precipitation (Guangzhou, China), possibly resulting in greater abundances Compliance with ethical standards of Cyanobacteria prior to ensiling. Moreover, Cyanobacteria can produce microcystin, which is a potential inhibitor of key Conflict of interest The authors declare that they have no conflict of regulatory enzymes in both animals and plants. This can lead interest. to an overwhelming of the antioxidant capacity, followed 240 Ann Microbiol (2019) 69:233–240 Publisher’sNote Springer Nature remains neutral with regard to jurisdic- McElhiney J, Lawton LA, Leifert C (2001) Investigations into the inhib- tional claims in published maps and institutional affiliations. itory effects of microcystins on plant growth, and the toxicity of plant tissues following exposure. Toxicon 39:1411–1420 McGarvey JA, Franco RB, Palumbo JD, Hnasko R, Stanker L, Mitloehner FM (2013) Bacterial population dynamics during the References ensiling of Medicago sativa (alfalfa) and subsequent exposure to air. J Appl Microbiol 114:1661–1670 Arti P, Pradeep SN (2016) Traditional uses, phytochemistry and pharma- Ogunade M, Jiang Y, Pech Cervants AA, Kim DH, Oliveira AS, Vyas D, cological properties of Neolamarckia cadamba:areview.J Weinberg ZG, Jeong KC, Adesogan AT (2018) Bacterial diversity Ethnopharmacol 181:118–135 and composition of alfalfa silage as analyzed by Illumina Miseq Cai Y, Benno Y, Ogawa M, Ohmomo S, Kumai S, Nakase T (1998) sequencing: effect of Escherichia coli O157:H7 and silage additives. Influence of lactobacillus spp. from an inoculant and of weissella J Dairy Sci 101:2048–2059 and leuconostoc spp. from forage crops on silage fermentation. Appl Osmari EK, Cecato U, Macedo FA, Souza NE (2011) Nutritional quality Environ Microbiol 64:2982–2987 indices of milk fat from goats on diets supplemented with different Cohen ZM, Leibovich H, Vaknin Y, Sagi G, Shabtay A (2016) Effect of roughages. Small Rumin Res 98:128–132 feeding lactating cows with ensiled mixture of Moringa oleifera, Silva VP, Pereira OG, Leandro RS, Da Silva TC, Ribeiro KG, Mantovani wheat hay and molasses, on digestibility and efficiency of milk HC, Santos SA (2016) Effects of lactic acid bacteria with production. Anim Feed Sci Technol 211:75–83 bacteriocinogenic potential on the fermentation profile and chemical Crush JR, Briggs LR, Sprosen JM, Nichols SN (2008) Effect of irrigation composition of alfalfa silage in tropical conditions. J Dairy Sci 99: with lake water containing microcystins on microcystin content and 1895–1902 growth of ryegrass, clover, rape, and lettuce. Environ Toxicol 23: Tao L, Zhou H, Zhang NF, Si BW, Tu Y, Ma T, Diao QY (2017) Effects of 246–252 different source additives and wilt conditions on the pH value, aer- Deng XM, Ouyang KX, Zhang Q, Huang H, Chen XY (2011) Research obic stability, carbohydrate and protein fractions of alfalfa silage. status and development thinking of Neolamarckia cadamba.J Anim Sci J 88:99–106 Central South Univ For Technol 31:91–95 Van Soest PJ, Robertsom JB, Lewis BA (1991) Methods for dietary fiber, Dong ZH, Yuan XJ, Wen AY, Desta ST, Shao T (2017) Effects of calcium neutral detergent fiber and nonstarch polysaccharides in relation to propionate on the fermentation quality and aerobic stability of alfalfa animal nutrition. J Dairy Sci 74:3583–3597 silage. Asian-Australas J Anim Sci 30:1278–1284 Wang J, Wang JQ, Zhou H, Feng T (2009) Effects of addition of previ- Gan X, Tang HL, Ye DD, Li P, Luo LX, Lin WF (2017) Diversity and ously fermented juice prepared from alfalfa on fermentation quality dynamic stability of bacterial community in traditional solid-state and protein degradation of alfalfa silage. Anim Feed Sci Technol fermentation of Qishan vinegar. Ann Microbiol 67:703–713 151:280–290 Hejcman M, Hejcmanova P, Pavlu V, Thorhallstottir (2016) Forage qual- Wang J, Chen L, Yuan XJ, Guo G, Li JF, Bai YF, Shao T (2017) Effects of ity of leaf fodder from the main woody species in Iceland and its molasses on the fermentation characteristics of mixed silage pre- potential use for livestock in the past and present. Grass Forage Sci pared with rice straw, local vegetable by-products and alfalfa in 71:649–658 Southeast China. J Integr Agric 16:664–670 Herrmann C, Idler C, Heiermann M (2015) Improving aerobic stability Waroon K, Suradej P, David H, Cai YM (2016) Natural lactic acid bac- and biogas production of maize silage using silage additives. teria population of tropical grasses and their fermentation factor Bioresour Technol 197:393–403 analysis of silage prepared with cellulase and inoculants. J Dairy Huang ZR, Yang J, Lv XJ (2006) The utilization and development of Sci 99:9768–9781 mulberry as animal forage. Grass Forage Sci 32:377–385 Xiong LY (2010) Broussonetia papyrifera feed fermentation and nutri- Konig W, Lamminen M, Weiss K et al (2017) The effect of additives on tional value of the feed. Dissertation, Guangdong Ocean University the quality of white lupin-wheat silage assessed by fermentation Xue YL, Yin GM, Zhan HP, Bai CS, Sun JJ, Yu Z, Sun QZ (2015) pattern and qPCR quantification of clostridia. Grass Forage Sci 72: Nutritive value of desert wormwood (Artemisia desertorum 757–771 Spreng.) silage in mixture with high-moisture maize straw. Grass Kraut CJ, Tripathi V, Chen Y, Gatica J, Volchinski V, Sela S, Weinberg Z, Forage Sci 72:174–178 Cytryn E (2016) Temporal and spatial assessment of microbial com- Yang C, Cai YM, Tomomi H, Hiroyuki F, Hiroki M (2011) Fermentation munities in commercial silages from bunker silos. Appl Microbiol characteristics and microorganism composition of total mixed ration Biotechnol 100:6827–6835 silage with local food by-products in different seasons. Anim Sci J Li HX (2010) Influence of ferment Broussonetia papyrifera leaf on nu- 82:259–266 trients, growing performance, carcass characteristics and meat qual- Yang JS, Tan HS, Cai YM (2016) Characteristics of lactic acid bacteria ity. Dissertation, Guangdong Ocean University isolates and their effect on silage fermentation of fruit residues. J Li LH, Sun YM, Yuan ZH et al (2015) Effect of microalgae supplemen- Dairy Sci 99:5325–5334 tation on the silage quality and anaerobic digestion performance of Zhang Q, Li X, Zhao M, Yu Z (2015) Lactic bacteria for enhancing the Manyflower silvergrass. Bioresour Technol 189:334–340 fermentation quality and aerobic stability of Leymus chinensis si- Li P, Shen YX, You MH, Zhang Y, Yan JJ, Li DX, Bai SQ (2017) Effect lage. Grass Forage Sci 71:472–481 of grape pomace on fermentation quality and aerobic stability of Zhang Q, Wu BYL, Nishino N, Wang XG, Yu Z (2016) Fermentation and sweet sorghum silage. Anim Sci J 88:1523–1530 microbial population dynamics during the ensiling of native grass McAlliser TA, Feniuk R, Mir Z, Mir P, Selinger LB, Cheng KJ (1998) and subsequent exposure to air. Anim Sci J 87:389–397 Inoculants for alfalfa silage: effects on aerobic stability, digestibility Zhang Q, Zhao MM, Wang XG, Yu Z, Na RS (2017) Ensiling alfalfa with and the growth performance of feedlot steers. Livest Prod Sci 53: whole crop corn improves the silage quality and in vitro digestibility 171–181 of the silage mixtures. Grassl Sci 63:211–217
Journal
Annals of Microbiology – Springer Journals
Published: Jan 21, 2019