Get 20M+ Full-Text Papers For Less Than $1.50/day. Subscribe now for You or Your Team.

Learn More →

Frequency of CHEK2*1100delC in New York breast cancer cases and controls

Frequency of CHEK2*1100delC in New York breast cancer cases and controls Background: The 1100delC CHEK2 allele has been associated with a 1.4–4.7 fold increased risk for breast cancer in women carrying this mutation. While the frequency of 1100delC was 1.1–1.4% in healthy Finnish controls, the frequency of this allele in a North American control population and in North American breast cancer kindreds remains unclear. Methods: We genotyped 1665 healthy New York volunteers and 300 cases of breast cancer for the CHEK2*1100delC. Results: The overall frequency of the 1100delC was 3/300 (1.0%) among all cases with either a family history of breast cancer (n = 192) or a personal history of breast cancer (n = 108, of which 46 were bilateral, 46 unilateral, and 16 were male breast cancer cases), compared to a frequency of 5/1665 (0.3%) in healthy controls (p = 0.1). There was no difference in allele frequency among Ashkenazi and non-Ashkenazi controls. Conclusion: The relatively low breast cancer penetrance of this allele, along with the low population frequency, will limit the clinical applicability of germline testing for CHEK2*1100delC in North American kindreds. Background tation 1100delC truncates the CHEK2 protein and was first In response to DNA damage, the cell-cycle checkpoint ki- observed in families exhibiting Li-Fraumeni syndrome nase CHEK2 can be activated by ATM kinase to phospho- [3]. To address the possibility that this allele contributes rylate p53 and BRCA1, which are involved in cell-cycle to increased susceptibility to breast cancer, two recent control, apoptosis, and DNA repair [1,2]. A germline mu- studies have investigated the frequency of Page 1 of 4 (page number not for citation purposes) BMC Medical Genetics 2003, 4 http://www.biomedcentral.com/1471-2350/4/1 CHEK2*1100delC in cancer cases and controls. Vahteristo Results et al. [4] reported that the 1100delC protein-truncating We observed CHEK2*1100delC in 5/1665 (0.3%) of mutation of CHEK2 was observed in 5.5% of 507 patients healthy New York City controls, significantly lower than with a family history of breast cancer and no detectable the frequency in controls reported by Vahteristo et al. (p = BRCA mutation compared to 1.4% of 1,885 healthy Finn- 0.0004, Fisher's Exact test) or by the CHEK2 Consortium ish controls. The CHEK2-Breast Cancer Consortium ob- (p = 0.006). Within our sample, 3/1096 (0.3%) individu- served a 5.1% frequency of this allele in 1071 individuals als of Jewish (predominantly Ashkenazi) descent carried with breast cancer derived from multiple-case families in this allele, a rate comparable to the 0.4% frequency (2/ which no mutations in BRCA1 or BRCA2 were detected, 569) observed in individuals of non-Ashkenazi descent. compared to a 1.1% of 1,620 healthy (mostly Northern We detected CHEK2*1100delC in 1/100 index cases from European) controls [5]. These two groups also reported an multiple-case breast cancer families in which mutations in increased frequency of CHEK2*1100delC in kindreds with BRCA1 or BRCA2 were not detected. As noted in Table 1, male breast cancer or bilateral breast cancer. We report the one case heterozygous for the 1100delC was an indi- here the frequency of CHEK2*1100delC in North Ameri- vidual of Ashkenazi descent seen at our Center who was can breast cancer patients and controls. previously included in the report by the CHEK2-Breast Cancer Consortium. Of these 100 families, 33 were of Ashkenazi descent and 67 were of non-Ashkenazi origin. Methods We have analyzed a North American sample of healthy CHEK2*1100delC was detected in 0/16 male individuals controls participating in the New York Cancer Project, and with breast cancer without mutations in BRCA2, and in 1/ two series of cases: those enrolled in a genetic counseling 46 (2.2%) of clinic-ascertained bilateral breast cancer cas- clinic as well as a separate series of cases unselected for es in individuals with a family history of breast cancer family history ascertained at Memorial Sloan-Kettering who were also of Ashkenazi Jewish descent compared to Cancer Center. The cases and controls self-identified 0/46 clinic-ascertained unilateral breast cancer cases themselves as Jewish or non-Jewish and reported their an- matched by age, ethnicity and family history. In a separate cestor's countries of origin. The population control sam- series of bilateral breast cancer cases unselected for family ples were derived from the New York Cancer Project, an history, 0/46 carried CHEK2*1100delC, compared to 1/46 ongoing cohort study enrolling healthy volunteers. Of the unilateral breast cancer cases matched to the bilateral cas- 569 non-Ashkenazi controls participating in this study, 62 es by age and ethnicity. Taking all of the breast cancer cas- were African-American, 37 Hispanic, 20 Asian, 18 Other/ es combined, the frequency of the 1100delC was 3/300 Unknown, and 432 Caucasian. All individuals in this (1.0%) compared to the population frequency of 5/1665 study provided informed consent for future DNA analysis. (0.3%) (p = 0.10). Genomic DNA was extracted and amplified utilizing CHEK2 external PCR primers: Discussion Our current findings do not exclude the possibility that 9Fe 5' CTGTCATCTCAAGAAGAGGACT and the CHEK2*1100delC variant increases the relative risk for breast cancer in North Americans. Because this variant oc- 10R 5' ATTTGTGACTTCATCTAATCACCTCC curs significantly less commonly in healthy New York controls compared to Northern European controls, the and internal PCR primers: low frequency of this allele in multiple-case families, bi- lateral cases, and male breast cancer cases could still be 9F 5' TGGCAAGTTCAACATTATTCCC and compatible with a relative risk in the range of 3.5–12 as re- ported by Vahteristo et al. and the CHEK2-Breast Cancer 10Re 5' GAATAACTCCTAAACTCCAGC Consortium. Genotyping was performed by dHPLC (Transgenomics, A prior attempt to analyze the entire CHEK2 gene in a USA) or Pyrosequencing (Pyrosequencing, Inc. Sweden); northern European cohort was unable to detect mutations all mutations were confirmed by both of these methodol- in exons 10–14, including the 1100delC, in 79 BRCA1/2- ogies. Non-Ashkenazi individuals were screened by DNA negative individuals from Finnish families with three or sequencing for mutations in the entire BRCA1 and BRCA2 more cases of breast cancer [7]. The relative size of the coding sequence and Ashkenazi individuals were screened population control samples in our studies was compara- for the three founder alleles that account for >95% of mu- ble to prior studies (1,620 population controls in the tations in this ethnic group [6]. CHEK2-Consortium, 1,885 in Vahteristo et al, and 1,665 in the current study). We evaluated 100 BRCA mutation- negative breast cancer families, compared to 216 in the re- port by Vahteristo et al, and 718 in the Consortium study. Page 2 of 4 (page number not for citation purposes) BMC Medical Genetics 2003, 4 http://www.biomedcentral.com/1471-2350/4/1 Table 1: CHEK2*1100delC in breast cancer cases and healthy controls Positive for CHEK2*1100delC (%) Controls Jewish (New York) 3/1096 (0.3%) Non-Jewish (New York) 2/569 (0.4%) Total 5/1665 (0.3%) BRCA1/2-negative individuals of mixed ethnicity with breast cancer from families with 3 or more cases of breast 0/67 (0.0%) cancer BRCA1/2 Ashkenazi founder mutation-negative individuals with breast cancer from families with 3 or more 1/33 (3.0%) cases of breast cancer BRCA2-negative individuals of mixed ethnicity with male breast cancer 0/16 (0.0%) Individuals with bilateral breast cancer of mixed ethnicity unselected for family history 0/46 (0.0%) Individuals with unilateral breast cancer unselected for family history matched for age, ethnicity 1/46 (2.2%) Clinic-ascertained individuals of Ashkenazi Jewish descent with bilateral breast cancer 1/46 (2.2%) Clinic-ascertained individuals of Ashkenazi Jewish descent with unilateral breast cancer matched for age, family 0/46 (0.0%) history This case previously reported in CHEK2 Breast Cancer Consortium [5]. However, our report also utilized the hypothesis proposed collection; TK, KN, and PK performed genotype analysis by Begg et al [8], of an "enrichment" of germline carriers and wre supervised by NE who also participated in study of cancer predisposition alleles in individuals with bilat- design; BR wrote the first draft of the manuscript and co- eral breast cancer. Our series analyzed 92 cases of bilateral ordinated data collection; PK and SG oversaw collection breast cancer and 92 controls, compared to 33 bilateral of control samples and participated in study design; OY breast cancer cases included in the report by Vahteristo et ascertained the familial breast cases and helped with study al. While no enrichment was noted in our bilateral cases design; HH helped with data collection and analysis, JS compared to unilateral cases, this may also reflect the low- provided biostatistical analysis; MR and LS participated in er population frequency of the allele in our population. study design and analysis. Further study of the frequency of the CHEK2*1100delC al- Acknowledgments The authors would like to acknowledge the New York Cancer Project, lele in North American breast cancer kindreds is warrant- which in connection with the publication of this study made available bio- ed, however, the relative rarity of this allele in our logical samples from and information on control individuals. The New York population, plus the relatively low breast cancer pene- Cancer Project is administered and funded by AMDeC Foundation, Inc. We trance reported for this allele, limit the clinical relevance also acknowledge support of the Koodish Fellowship, the Frankel Founda- in North American kindreds of CHEK2*1100delC as a can- tion, the Lymphoma Foundation and the Danziger Foundation. cer-predisposing allele. References Conclusions 1. Chehab NH, Malikzay A, Appel M and Halazonetis TD Chk2/hCds1 functions as a DNA damage checkpoint in G(1) by stabilizing The 0.3% frequency of the 1100delC CHEK2 allele in a p53. Genes Dev 2000, 14:278-288 New York population is significantly lower than the 1.1– 2. Lee JS, Collins KM, Brown AL, Lee CH and Chung JH hCds1-medi- 1.4% rate observed in Northern European populations. ated phosphorylation of BRCA1 regulates the DNA damage response. Nature 2000, 404:201-204 This allele was infrequent in BRCA1/2 wild-type cases 3. Bell DW, Varley JM, Szydlo TE, Kang DH, Wahrer DC and Shannon with family history of breast cancer or in cases with a per- KE Heterozygous germ line hCHK2 mutations in Li-Fraume- ni syndrome. Science 1999, 286:2528-2523 sonal history of unilateral or bilateral of breast cancer. The 4. Vahteristo P, Bartkova J, Eerola H, Syrjakoski K, Ojala S and Kilpivaara relatively low breast cancer penetrance, along with the low O CHEK2 Genetic Variant Contributing to a Substantial population frequency, limit the clinical relevance in Fraction of Familial Breast Cancer. Am J Hum Genet 2002, 71:432-438 North American kindreds of CHEK2*1100delC as a cancer 5. The CHEK2 Breast Cancer Consortium Low-penetrance suscep- predisposing allele. tibility to breast cancer due to CHEK2*1100delC in noncarri- ers of BRCA1 or BRCA2 mutations. Nature Genet 2002, 31:55-59 6. Kauff N, Perez-Segura P, Robson M, Scheuer L, Siegel B and Schluger Competing interests A Incidence of non-founder BRCA1 and BRCA2 mutations in None declared. high-risk Ashkenazi breast and ovarian cancer families. J Med- ical Genet 2002, 39:611-614 7. Allinen M, Huusko P, Mantyniemi S, Launonen V and Winqvist R Mu- Authors' contributions tation analysis of the CHK2 gene in families with hereditary KO designed the study and wrote the final draft of the pa- breast cancer. Br J Cancer 2001, 85:209-212 per; HP helped in the design and coordinated specimen Page 3 of 4 (page number not for citation purposes) BMC Medical Genetics 2003, 4 http://www.biomedcentral.com/1471-2350/4/1 8. Begg CB and Berwick M A note on the estimation of relative risks of rare genetic susceptibility markers. Cancer Epidemiol Bi- omarkers Prev 1997, 6:99-103 Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2350/4/1/prepub Publish with Bio Med Central and every scientist can read your work free of charge "BioMed Central will be the most significant development for disseminating the results of biomedical researc h in our lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp Page 4 of 4 (page number not for citation purposes) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png BMC Medical Genetics Springer Journals

Loading next page...
 
/lp/springer-journals/frequency-of-chek2-1100delc-in-new-york-breast-cancer-cases-and-kBJaX1me6a

References (9)

Publisher
Springer Journals
Copyright
Copyright © 2003 by Offit et al; licensee BioMed Central Ltd.
Subject
Biomedicine; Human Genetics; Cytogenetics; Gene Function
eISSN
1471-2350
DOI
10.1186/1471-2350-4-1
Publisher site
See Article on Publisher Site

Abstract

Background: The 1100delC CHEK2 allele has been associated with a 1.4–4.7 fold increased risk for breast cancer in women carrying this mutation. While the frequency of 1100delC was 1.1–1.4% in healthy Finnish controls, the frequency of this allele in a North American control population and in North American breast cancer kindreds remains unclear. Methods: We genotyped 1665 healthy New York volunteers and 300 cases of breast cancer for the CHEK2*1100delC. Results: The overall frequency of the 1100delC was 3/300 (1.0%) among all cases with either a family history of breast cancer (n = 192) or a personal history of breast cancer (n = 108, of which 46 were bilateral, 46 unilateral, and 16 were male breast cancer cases), compared to a frequency of 5/1665 (0.3%) in healthy controls (p = 0.1). There was no difference in allele frequency among Ashkenazi and non-Ashkenazi controls. Conclusion: The relatively low breast cancer penetrance of this allele, along with the low population frequency, will limit the clinical applicability of germline testing for CHEK2*1100delC in North American kindreds. Background tation 1100delC truncates the CHEK2 protein and was first In response to DNA damage, the cell-cycle checkpoint ki- observed in families exhibiting Li-Fraumeni syndrome nase CHEK2 can be activated by ATM kinase to phospho- [3]. To address the possibility that this allele contributes rylate p53 and BRCA1, which are involved in cell-cycle to increased susceptibility to breast cancer, two recent control, apoptosis, and DNA repair [1,2]. A germline mu- studies have investigated the frequency of Page 1 of 4 (page number not for citation purposes) BMC Medical Genetics 2003, 4 http://www.biomedcentral.com/1471-2350/4/1 CHEK2*1100delC in cancer cases and controls. Vahteristo Results et al. [4] reported that the 1100delC protein-truncating We observed CHEK2*1100delC in 5/1665 (0.3%) of mutation of CHEK2 was observed in 5.5% of 507 patients healthy New York City controls, significantly lower than with a family history of breast cancer and no detectable the frequency in controls reported by Vahteristo et al. (p = BRCA mutation compared to 1.4% of 1,885 healthy Finn- 0.0004, Fisher's Exact test) or by the CHEK2 Consortium ish controls. The CHEK2-Breast Cancer Consortium ob- (p = 0.006). Within our sample, 3/1096 (0.3%) individu- served a 5.1% frequency of this allele in 1071 individuals als of Jewish (predominantly Ashkenazi) descent carried with breast cancer derived from multiple-case families in this allele, a rate comparable to the 0.4% frequency (2/ which no mutations in BRCA1 or BRCA2 were detected, 569) observed in individuals of non-Ashkenazi descent. compared to a 1.1% of 1,620 healthy (mostly Northern We detected CHEK2*1100delC in 1/100 index cases from European) controls [5]. These two groups also reported an multiple-case breast cancer families in which mutations in increased frequency of CHEK2*1100delC in kindreds with BRCA1 or BRCA2 were not detected. As noted in Table 1, male breast cancer or bilateral breast cancer. We report the one case heterozygous for the 1100delC was an indi- here the frequency of CHEK2*1100delC in North Ameri- vidual of Ashkenazi descent seen at our Center who was can breast cancer patients and controls. previously included in the report by the CHEK2-Breast Cancer Consortium. Of these 100 families, 33 were of Ashkenazi descent and 67 were of non-Ashkenazi origin. Methods We have analyzed a North American sample of healthy CHEK2*1100delC was detected in 0/16 male individuals controls participating in the New York Cancer Project, and with breast cancer without mutations in BRCA2, and in 1/ two series of cases: those enrolled in a genetic counseling 46 (2.2%) of clinic-ascertained bilateral breast cancer cas- clinic as well as a separate series of cases unselected for es in individuals with a family history of breast cancer family history ascertained at Memorial Sloan-Kettering who were also of Ashkenazi Jewish descent compared to Cancer Center. The cases and controls self-identified 0/46 clinic-ascertained unilateral breast cancer cases themselves as Jewish or non-Jewish and reported their an- matched by age, ethnicity and family history. In a separate cestor's countries of origin. The population control sam- series of bilateral breast cancer cases unselected for family ples were derived from the New York Cancer Project, an history, 0/46 carried CHEK2*1100delC, compared to 1/46 ongoing cohort study enrolling healthy volunteers. Of the unilateral breast cancer cases matched to the bilateral cas- 569 non-Ashkenazi controls participating in this study, 62 es by age and ethnicity. Taking all of the breast cancer cas- were African-American, 37 Hispanic, 20 Asian, 18 Other/ es combined, the frequency of the 1100delC was 3/300 Unknown, and 432 Caucasian. All individuals in this (1.0%) compared to the population frequency of 5/1665 study provided informed consent for future DNA analysis. (0.3%) (p = 0.10). Genomic DNA was extracted and amplified utilizing CHEK2 external PCR primers: Discussion Our current findings do not exclude the possibility that 9Fe 5' CTGTCATCTCAAGAAGAGGACT and the CHEK2*1100delC variant increases the relative risk for breast cancer in North Americans. Because this variant oc- 10R 5' ATTTGTGACTTCATCTAATCACCTCC curs significantly less commonly in healthy New York controls compared to Northern European controls, the and internal PCR primers: low frequency of this allele in multiple-case families, bi- lateral cases, and male breast cancer cases could still be 9F 5' TGGCAAGTTCAACATTATTCCC and compatible with a relative risk in the range of 3.5–12 as re- ported by Vahteristo et al. and the CHEK2-Breast Cancer 10Re 5' GAATAACTCCTAAACTCCAGC Consortium. Genotyping was performed by dHPLC (Transgenomics, A prior attempt to analyze the entire CHEK2 gene in a USA) or Pyrosequencing (Pyrosequencing, Inc. Sweden); northern European cohort was unable to detect mutations all mutations were confirmed by both of these methodol- in exons 10–14, including the 1100delC, in 79 BRCA1/2- ogies. Non-Ashkenazi individuals were screened by DNA negative individuals from Finnish families with three or sequencing for mutations in the entire BRCA1 and BRCA2 more cases of breast cancer [7]. The relative size of the coding sequence and Ashkenazi individuals were screened population control samples in our studies was compara- for the three founder alleles that account for >95% of mu- ble to prior studies (1,620 population controls in the tations in this ethnic group [6]. CHEK2-Consortium, 1,885 in Vahteristo et al, and 1,665 in the current study). We evaluated 100 BRCA mutation- negative breast cancer families, compared to 216 in the re- port by Vahteristo et al, and 718 in the Consortium study. Page 2 of 4 (page number not for citation purposes) BMC Medical Genetics 2003, 4 http://www.biomedcentral.com/1471-2350/4/1 Table 1: CHEK2*1100delC in breast cancer cases and healthy controls Positive for CHEK2*1100delC (%) Controls Jewish (New York) 3/1096 (0.3%) Non-Jewish (New York) 2/569 (0.4%) Total 5/1665 (0.3%) BRCA1/2-negative individuals of mixed ethnicity with breast cancer from families with 3 or more cases of breast 0/67 (0.0%) cancer BRCA1/2 Ashkenazi founder mutation-negative individuals with breast cancer from families with 3 or more 1/33 (3.0%) cases of breast cancer BRCA2-negative individuals of mixed ethnicity with male breast cancer 0/16 (0.0%) Individuals with bilateral breast cancer of mixed ethnicity unselected for family history 0/46 (0.0%) Individuals with unilateral breast cancer unselected for family history matched for age, ethnicity 1/46 (2.2%) Clinic-ascertained individuals of Ashkenazi Jewish descent with bilateral breast cancer 1/46 (2.2%) Clinic-ascertained individuals of Ashkenazi Jewish descent with unilateral breast cancer matched for age, family 0/46 (0.0%) history This case previously reported in CHEK2 Breast Cancer Consortium [5]. However, our report also utilized the hypothesis proposed collection; TK, KN, and PK performed genotype analysis by Begg et al [8], of an "enrichment" of germline carriers and wre supervised by NE who also participated in study of cancer predisposition alleles in individuals with bilat- design; BR wrote the first draft of the manuscript and co- eral breast cancer. Our series analyzed 92 cases of bilateral ordinated data collection; PK and SG oversaw collection breast cancer and 92 controls, compared to 33 bilateral of control samples and participated in study design; OY breast cancer cases included in the report by Vahteristo et ascertained the familial breast cases and helped with study al. While no enrichment was noted in our bilateral cases design; HH helped with data collection and analysis, JS compared to unilateral cases, this may also reflect the low- provided biostatistical analysis; MR and LS participated in er population frequency of the allele in our population. study design and analysis. Further study of the frequency of the CHEK2*1100delC al- Acknowledgments The authors would like to acknowledge the New York Cancer Project, lele in North American breast cancer kindreds is warrant- which in connection with the publication of this study made available bio- ed, however, the relative rarity of this allele in our logical samples from and information on control individuals. The New York population, plus the relatively low breast cancer pene- Cancer Project is administered and funded by AMDeC Foundation, Inc. We trance reported for this allele, limit the clinical relevance also acknowledge support of the Koodish Fellowship, the Frankel Founda- in North American kindreds of CHEK2*1100delC as a can- tion, the Lymphoma Foundation and the Danziger Foundation. cer-predisposing allele. References Conclusions 1. Chehab NH, Malikzay A, Appel M and Halazonetis TD Chk2/hCds1 functions as a DNA damage checkpoint in G(1) by stabilizing The 0.3% frequency of the 1100delC CHEK2 allele in a p53. Genes Dev 2000, 14:278-288 New York population is significantly lower than the 1.1– 2. Lee JS, Collins KM, Brown AL, Lee CH and Chung JH hCds1-medi- 1.4% rate observed in Northern European populations. ated phosphorylation of BRCA1 regulates the DNA damage response. Nature 2000, 404:201-204 This allele was infrequent in BRCA1/2 wild-type cases 3. Bell DW, Varley JM, Szydlo TE, Kang DH, Wahrer DC and Shannon with family history of breast cancer or in cases with a per- KE Heterozygous germ line hCHK2 mutations in Li-Fraume- ni syndrome. Science 1999, 286:2528-2523 sonal history of unilateral or bilateral of breast cancer. The 4. Vahteristo P, Bartkova J, Eerola H, Syrjakoski K, Ojala S and Kilpivaara relatively low breast cancer penetrance, along with the low O CHEK2 Genetic Variant Contributing to a Substantial population frequency, limit the clinical relevance in Fraction of Familial Breast Cancer. Am J Hum Genet 2002, 71:432-438 North American kindreds of CHEK2*1100delC as a cancer 5. The CHEK2 Breast Cancer Consortium Low-penetrance suscep- predisposing allele. tibility to breast cancer due to CHEK2*1100delC in noncarri- ers of BRCA1 or BRCA2 mutations. Nature Genet 2002, 31:55-59 6. Kauff N, Perez-Segura P, Robson M, Scheuer L, Siegel B and Schluger Competing interests A Incidence of non-founder BRCA1 and BRCA2 mutations in None declared. high-risk Ashkenazi breast and ovarian cancer families. J Med- ical Genet 2002, 39:611-614 7. Allinen M, Huusko P, Mantyniemi S, Launonen V and Winqvist R Mu- Authors' contributions tation analysis of the CHK2 gene in families with hereditary KO designed the study and wrote the final draft of the pa- breast cancer. Br J Cancer 2001, 85:209-212 per; HP helped in the design and coordinated specimen Page 3 of 4 (page number not for citation purposes) BMC Medical Genetics 2003, 4 http://www.biomedcentral.com/1471-2350/4/1 8. Begg CB and Berwick M A note on the estimation of relative risks of rare genetic susceptibility markers. Cancer Epidemiol Bi- omarkers Prev 1997, 6:99-103 Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2350/4/1/prepub Publish with Bio Med Central and every scientist can read your work free of charge "BioMed Central will be the most significant development for disseminating the results of biomedical researc h in our lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp Page 4 of 4 (page number not for citation purposes)

Journal

BMC Medical GeneticsSpringer Journals

Published: Jan 15, 2003

There are no references for this article.