Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/springer-journals/gene-expression-of-vascular-endothelial-growth-factor-a-and-hypoxic-MvLQIlPIm5
- Publisher
- Springer Journals
- Copyright
- Copyright © 2016 by Zhang et al.
- Subject
- Life Sciences; Agriculture; Biotechnology; Food Science; Animal Genetics and Genomics; Animal Physiology
- eISSN
- 2049-1891
- DOI
- 10.1186/s40104-016-0082-z
- pmid
- 27042296
- Publisher site
- See Article on Publisher Site
Abstract
Background: Vascular endothelial growth factor A (VEGFA) can induce endothelial cell proliferation, promote cell migration, and inhibit apoptosis. These processes play key roles in physiological blood vessel formation and pathological angiogenesis. Methods: In this study, we examined VEGFA gene expression in the heart, liver, and kidney of Tibetan pigs (TP), Yorkshire pigs that migrated to high altitudes (YH), and Yorkshire pigs that lived at low altitudes (YL). We used PCR and Sanger sequencing to screen for single nucleotide polymorphisms (SNPs) in 5ʹ-flanking DNA and exons of the VEGFA gene. Quantitative real-time PCR and western blots were used to measure expression levels and PCR products were sequenced. Results: Results showed that the VEGFA mRNA and protein expression in heart, liver and kidney of TP was higher than that in YH and YL. In addition, the mRNA sequence of the pig VEGFA gene was conserved among pig breeds, and only five SNPs were found in the 5ʹ-flanking region of the VEGFA gene, the allele frequency distributions of the 5 SNPs were not significantly different between the TP, Yorkshire (YL), and Diannan small-ear (DN) pig populations. Conclusion: In conclusion, the Tibetan pig showed high levels of VEGFA gene expression in several hypoxic tissues, which suggests that the VEGFA gene may play a major functional role in hypoxic adaptation. Keywords: Gene expression, Hypoxic adaptation, Tibetan pig, VEGFA gene Background chromosome seven, comprises seven exons, and has VEGFA (also known as VEGF) is a major growth factor one transcript. for endothelial cells. It promotes vascular permeability Tibetan pig (TP) is indigenous to China and live and angiogenesis by stimulating proliferation, migration, primarily in semi-agricultural and semi-pastoral areas and survival of endothelial cells, as well as inhibiting (average elevation: 2500–4300 m) in the Qinghai-Tibet apoptosis [1–3]. VEGFA ligand binding to VEGFRs Plateau of southwest China. The TP have adapted to upregulates expression of endothelial nitric oxide syn- harsh conditions such as hypoxia [7–9], which makes thase (eNOS) and increases prostacyclin production in this species a good model for investigating molecular endothelial cells [4], and is strongly expressed in anti- mechanisms of hypoxic adaptation. proliferative lesions from patients with severe primary Hypoxia is a potent inducer of VEGFA through regula- idiopathic and secondary forms of pulmonary hyper- tion of hypoxia-inducible factors (HIFs). However, the tension [5, 6]. In pig, the VEGFA gene maps to function and mechanism for hypoxic adaptation in TP remain unclear. The objective of the present study was to detect expression of the VEGFA gene in different tissues including the heart, liver, and kidney from three * Correspondence: zhanghao827@163.com groups of pigs living at different altitudes. This study National Engineering Laboratory for Animal Breeding, China Agricultural University, Beijing 100193, People’s Republic of China Full list of author information is available at the end of the article © 2016 Zhang et al. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Zhang et al. Journal of Animal Science and Biotechnology (2016) 7:21 Page 2 of 8 should help elucidate the function of the VEGFA gene in Fisher Scientific Inc., West Palm Beach, FL, USA), hypoxic adaptation of Tibetan pig. and separated by electrophoresis in a 1 % agarose gel to verify integrity. After treatment with DNase I, 2 μg Methods of RNA in a 20 μL reaction volume was reversely The experimental processes were approved by the ani- transcribed into cDNA using a SuperRT cDNA Kit mal welfare committee of the State Key Laboratory for (CWBIO Ltd.,Beijing,China). Agro-biotechnology of China Agricultural University Total protein was isolated from the heart, liver, and (Approval number XK257), and pig farming at Linzhi of kidney using SDS Lysis Buffer (P0013B, Beyotime Tibet is permitted and the field study does not involve Ltd., China). Protein content was measured with the endangered or protected species. enhanced BCA protein assay kit (P0010, Beyotime, Ltd., China). Experimental materials Experiments were performed using pigs from three SNP screening and genotyping different populations: Tibetan pig from highlands Primers for identification of SNPs in the VEGFA gene (Linzhi, 3,000 m) (TP), Yorkshire pig that migrated to (NM_214084) were based on DNA sequence obtained high altitude (Linzhi, 3,000 m) (YH), and Yorkshire using the UCSC BLAT Search Genome tool (http://gen- pig raised atlowland (Beijing,100 m) (YL).Animals ome.ucsc.edu/). We used the amplified pig mRNA se- in the YH group were descended from a population quence and Primer Premier 5.0 software to design of Yorkshire pigs that migrated from lowland to highland primers that amplified the coding regions (exons 1 to 7) approximately 3 yr ago. Ten castrated boars from each and 5 -flanking sequences of the gene. The targeted re- population were slaughtered when they were 6 mo of age. gions, primer sequences, and amplicon sizes are shown Tissue samples were collected from the liver, heart, and in Table 1. PCR products amplified from 10 pigs in each kidney and were immediately frozen in liquid nitrogen. group were pooled and sequenced to identify SNPs. Samples were then stored at -80 °C. Chromas Pro and DNAMAN6.0 were used to analyze Ear tissue samples were collected from three pig popu- the sequencing data. Genotypes of SNPs found by lations: YL from the Beijing Shunxinlong Farm (n = 30), pooling sequencing were determined with individual TP from Linzhi, Tibet of China (n = 60), and Diannan PCR and sequencing. small-ear (DN) from Xishuang Banna, Yunnan of China (n = 40). The samples were immediately frozen and Quantitative analysis of VEGFA mRNA expression stored at -20 °C. To avoid genomic DNA contamination, we used Primer Premier 5.0 software to design VEGFA gene DNA, RNA, and protein extraction and cDNA preparation (NM_214084) primers that amplified products spanning Genomic DNA was isolated from ear tissue as previ- an intron. The primers were 5ʹ-GAGGAGTTCAAC ously described [10], dissolved in TE solution, and ATCGCCAT-3ʹ and 5ʹ-GAGGAGTTCAACATCGCCA- stored at -20 °C. 3ʹ. We used the housekeeping gene glyceraldehyde-3- Total RNA was extracted from the heart, liver, and phosphate dehydrogenase (GAPDH, NM_001206359) as kidney with TRIZOL Reagent (Invitrogen, San Diego, the internal standard and the primers were 5ʹ-GGTCA CA, USA), checked for concentration and purity CCAGGGCTGCTTTTA-3ʹ and 5ʹ-CCTTGACTGT using a NanoDrop 2000 Biophotometer (Thermo GCCGTGGAAT-3ʹ. Quantitative real-time PCR (qRT- Table 1 Target region, sequence, and amplicon size of the primers used for SNP identification Primer Target region Forward primer sequence (5ʹ to 3ʹ) Reverse primer sequence (5ʹ to 3ʹ) Amplicon size, bp 5ʹ- FR1 −1902/−2693 AGTGACTGGCTCCTGTTCTC CCTGGGTAGAAGTATTTGGC 791 5ʹ- FR2 −2193/−1902 CGTTCCTTAGTGCTGGTGAG AAAGTGAGGTTATGTGCGGC 843 5ʹ- FR3 −1546/−631 GTGTGTCTGGGTGTGTGTGG TCCCTCTCGTTTCTTGCTTGC 915 5ʹ- FR4 −654/+53 GGGCAAGCAAGAAACGAGA AGGTAGAGCAGCAAGGCAA 707 VEGFA-P1 Exon1 GAGGAGGAAGAAGAGAAGGAAG CATGTACGAGGATAGAGGGGAA 472 VEGFA-P2 Exon2 CCATTCTTCCCTCTTTGTTTTGTC TTTGTTTTCCCAGTCTGTGCTCA 367 VEGFA-P3 Exon3 GGCCGGCCCCCTCTACAG AACGGGCTTTTTAAACTCTCCACA 630 VEGFA-P4 Exon4-5 CCTGGTCTGTGGAGAGTTTA AGTGGGTAGAGAAAGAGAAA 872 VEGFA-P5 Exon6 CTGCCGCTCTCTCTTGTCTTCTGC AGCCACGCCTGCCACCTG 564 VEGFA-P6 Exon7 CGTAGGGACTCTTCTTTGGT CTCGGCTTGTCACATCTGC 313 Zhang et al. Journal of Animal Science and Biotechnology (2016) 7:21 Page 3 of 8 PCR) was conducted on the Bio-Rad CFX96 System western blots were analyzed using Image J 1.44 software (Bio-Rad, USA). Each reaction mixture contained (NIH, USA). 10.0 μL 2× SYBR Green qPCR SuperMix (Transgen, Beijing, China), 1.0 μL cDNA, 0.5 μL of each primer Cell culture (10.0 nmol/μL), and ddH O water to adjust the volume Cell culture reagents were obtained from GIBCO (Life to 20.0 μL. The real-time PCR program started with de- Technologies, Lofer, Austria). PIEC (KG302, KeyGEN naturation at 95 °C for 20 s. This was followed by 40 cy- BioTECH, China) were cultured according to the manu- cles of denaturation at 95 °C for 5 s and annealing/ facturer’s instructions. Experiments were performed elongation at 60 °C for 15 s, during which fluorescence using two incubators. For normoxia treatments, one in- was measured. Next, a melting curve was constructed by cubator (Thermo Fisher Scientific Inc., West Palm increasing the temperature from 65 °C to 95 °C in se- Beach, FL, USA) was set at 37 °C and 5 % CO ; the incu- quential steps of 0.5 °C for 5 s, during which fluores- bator oxygen sensor indicated approximately 21 % O . cence was measured. The real-time PCR efficiency of Cells were cultured under normoxic conditions for 2, 4, each pair of primers was calculated using 5 points in a 8, 12, 24, or 36 h. For hypoxia treatments, an incubator 5-fold dilution series of cDNA, which was used to con- (3 gas incubator, Changsha Hua Xi Electronics Techne- struct a standard curve. A cDNA pool of all samples was tronic Co., Ltd., China) was set at 37 °C, 5 % CO , and used as a calibration and three replications of each 94 % N ; the oxygen sensor indicated approximately 1 % sample were performed. Gene expression levels were O . Cells were cultured under hypoxic conditions for 2, -△△Ct calculated using the 2 method (△△Ct = △Ct - target gene 4, 8, 12, 24, or 36 h. Cells were collected after the indi- △Ct ) as previously described [11]. housekeeping gene cated durations in culture and total RNA extraction, cDNA synthesis and qTR-PCR were performed as de- Western blotting scribed above. Approximately 30 mg of each tissue used in quantita- tive real-time PCR was homogenized in lysis buffer Statistical analyses (10 mmol/L NaH PO , 1 mmol/L EDTA, 10 mmol/L β- 2 4 Expression levels were analyzed by one-way ANOVA mercaptoethanol, 0.25 % Triton X-100, and 0.02 % NaN , using SAS9.1 Software (SAS Inst. Inc., Cary, NC). adjusted to pH 6.8). Tissues were homogenized using a Graphs were prepared using SigmaPlot 10.0 (Systat Soft- Mixer Mill MM400 (Retsch, Germany) for 5 min and then ware, San Jose, CA) and data are presented as mean ± centrifuged at 10,000 × g for 10 min at 4 °C. Protein con- standard error. Significant and extreme differences were centrations were determined using a Protein Assay Kit set at P < 0.05 (*) and P < 0.01 (**), respectively. (Bio-Rad). Proteins (40 μg) were separated by sodium do- decyl sulfate polyacrylamide gel electrophoresis (SDS- PAGE) using a 5 % stacking gel and a 10 % separating gel. Results Following electrophoresis, proteins were transferred to SNPs and genotype frequencies Immobilon-P Transfer Membranes (IPVH00010) for 2 h The structure of the pig VEGFA gene and the positions at 300 mA using a Bio-Rad Criterion Blotter. Membranes of the primers used for SNP identification are shown in were blocked overnight in blocking buffer (P0023B, Fig. 1. Using the primers listed in Table 1, the PCR Beyotime Ltd., China) and then incubated with pri- amplicons covered 2,693 bp of the 5 -flanking and full- mary mouse monoclonal GAPDH (1:1,000 dilution, coding regions (all 7 exons). No SNPs were detected in AG019, Beyotime Ltd., China), and VEGFA (1:500 di- the coding region of the VEGFA gene among the TP, YL, lution, LS-C2929, LifeSpan BioSciences, Seattle, WA) and DN populations. Sanger sequencing revealed 5 SNPs antibodies diluted in primary antibody dilution buffer at upstream 2,435, 2,442, 2,745, 1,010, and 1,773 bp (P0023A, Beyotime Ltd., China) at 4 °C for 2 h. After from the initiation codon of the VEGFA gene that were 3 washes with PBST(phosphate buffer saline contain- named G-2745C, G-2442A, G-2435deletion, T-1010C ing 0.1 % Tween 20), membranes were incubated with and C-1773 T respectively (Fig. 2). secondary HRP-labeled goat anti-mouse IgG (H + L) Individual sequencing analysis indicated genotype and (1:1,000 dilution, A0216, Beyotime Ltd., China) anti- allele frequencies of the 5 SNPs in the 3 pig populations body diluted in secondary antibody dilution buffer (Table 2). No significant differences in genotypes distri- (P0023D, Beyotime Ltd., China) for 1 h. After the butions at loci G-2745C, G-2442A, and G-2435deletion membranes were washed 3 times in Tris-buffered saline were seen comparing TP with YL or DN (P > 0.05). Al- with Tween for 30 min, immune complexes were visual- though the TP had a different genotype distribution in ized using an eECL Western Blot Kit (CW0049A, CWBIO T-1010C with the DN, the difference between TP and Ltd., China) according to the manufacturer’s instructions. YL was not significant (P > 0.05). At locus C-1773 T, To determine expression ratios of VEGFA and GAPDH, there were significant differences in genotype frequency Zhang et al. Journal of Animal Science and Biotechnology (2016) 7:21 Page 4 of 8 Fig. 1 Structure of the pig VEGFA gene and the positions of primers used for SNP identification. The thick black lines represent flanking regions and introns; the grey blocks represent exons of the VEGFA gene; the thin black lines represent positions of amplicons. Pig total DNA was used as PCR templates for the 5ʹ-FR1, 5ʹ-FR2, 5ʹ-FR3, 5ʹ-FR4, VEGFA-P1, VEGFA-P2, VEGFA-P3, VEGFA-P4, and VEGFA-P5 primers comparing TP with YL or DN; however, the allele C fre- VEGFA protein expression quency of TP was between YL and DN. Results western blot showed that the VEGFA protein expression had same difference trends in heart, liver VEGFA mRNA expression and kidney with mRNA expression between the three PCR efficiencies of VEGFA and GAPDH genes were groups (Fig. 4). The protein expression was signifi- within 95 to 105 % that was satisfied for qRT-PCR. Ex- cantly higher in heart and liver of TP than that of pression of VEGFA mRNA is shown in Fig. 3. We found YH and YL (P< 0.05). While in kidney tissue, the TP that expression of VEGFA mRNA was relatively high in had higher VEGFA protein expression than YL (P< 0.05) the liver and kidney, but low in the heart. Moreover, and YH, although the difference between TP and YH was under hypoxic conditions, expression of VEGFA mRNA not significant (P> 0.05). in all three tissues was significantly higher in TP than in YH and YL (P < 0.01). Following migration of Yorkshire VEGFA gene expression in PIEC cells pigs from lowland to highland, expression of VEGFA Expression of VEGFA mRNA in endothelial cells is mRNA increased in the kidney (P < 0.05), but trended shown in Fig. 5. At all time points, expression of VEGFA downward in the liver. mRNA in vitro was higher under hypoxic condition than Fig. 2 Sequencing chromatograms of 5 SNPs: G-2442A, G-2435 deletion, G-2745C, T -1010C, and C-1773 T. Chromatogram of the PCR product amplified using the 5ʹ-FR1 primer set (Table 1) shows the 3 identified SNPs G-2442A, G-2435 deletion, and G-2745 C. The 5ʹ-FR2 primer set (Table 1) shows SNP C-1773 T. The 5ʹ-FR3 primer set (Table 1) shows SNP T-1010C. YL = Yorkshire pig (n = 30), DN = Diannan small-ear pig (n = 40), TP = Tibetan pig (n = 60) Zhang et al. Journal of Animal Science and Biotechnology (2016) 7:21 Page 5 of 8 Table 2 Gene and genotype frequency of the 5 SNPs in different pig breeds Loci Breed Genotype (number/percentage) Allele GG GC CC P value* (Fisher’s exact test) G C G-2745C YL 10/1 0/0 0/0 0.237 1 0 DN 10/1 0/0 0/0 0.237 1 0 TP 8/0.800 2/0.200 0/0 0.900 0.100 GG GA AA G A G-2442A YL 10/1 0/0 0/0 0.500 1 0 DN 9/0.900 1/0.1 0/0 0.763 0.950 0.050 TP 9/0.900 1/0.1 0/0 0.950 0.050 GG G-deletion Deletion G Deletion G-2435 deletion YL 8/0.889 1/0.111 0/0 0.474 0.940 0.060 DN 7/0.700 0/0 3/0.300 0.105 0.700 0.300 TP 10/1 0/0 0/0 1 0 TT TC CC T C T-1010C YL 35/0.875 5/0.125 0/0 0.342 0.938 0.062 DN 40/1 0/0 0/0 0.010 1 0 TP 16/0.8 4/0.2 0/0 0.900 0.100 CC CT TT C T C-1773 T YL 1/0.034 7/0.233 22/0.733 0.000 0.150 0.850 DN 36/1 0/0 0/0 0.001 1 0 TP 14//0.700 4/0.200 2/0.100 0.800 0.200 Note: *P value was significance of the exact test for genotype frequency distribution compared with TP. YL = Yorkshire pig (n = 30), DN = Diannan small-ear pig (n = 40), TP = Tibetan pig (n = 60) under normoxic condition (P< 0.05). Under both nor- binding to promoters of hypoxia response elements moxic and hypoxic conditions, expression of VEGFA (HREs) [13, 14]. mRNA had an increased trend after 4 h over time. We found 5 SNPs in the VEGFA gene. TP, as well as the other pig breeds, exhibited relatively large polymor- Discussion phisms at the 5 loci, although the distinction between VEGFA is a pivotal angiogenic factor that binds to spe- frequency distributions was not significant. No SNPs cialized receptors on the surface of endothelial cells were detected in the coding region of the VEGFA gene. and induces them to generate new vessels [12]. The mRNA sequence of VEGFA was highly conserved VEGFA expression was modulated by HIF-1 through among pig breeds, which is consistent with previous Fig. 3 Expression of VEGFA mRNA in the heart (a), liver (b), and kidney (c). Each bar represents mean ± S.E. * Significant difference (P < 0.05), ** Extreme significant difference (P < 0.01). TP = Tibetan pig (n = 10); YH = Yorkshire pig raised at high-altitude (n = 10); YL = Yorkshire pig raised at lowland (n = 10) Zhang et al. Journal of Animal Science and Biotechnology (2016) 7:21 Page 6 of 8 Fig. 4 Expression of VEGFA proteins in the heart (a), liver (b), and kidney (c). Each bar represents mean ± S.E. * Significant difference (P < 0.05), ** Extreme significant difference (P < 0.01). TP = Tibetan pig (n = 10); YH = Yorkshire pig raised at high-altitude (n = 10); YL = Yorkshire pig raised at lowland (n = 10) studies showing that both the mRNA sequence and pro- signaling interferes with myocardial angiogenesis. This re- tein domain of human VEGFA gene were conserved sults in local ischemia, which triggers cardiomyocyte dam- [15]. Thus, the biological function of VEGFA is primarily age and heart failure [16, 17]. In the present study,VEGFA regulated by controlling its expression. The results also expression in heart tissue was significantly higher in TP indicated that there might be other regulatory mecha- compared with Yorkshire under hypoxia at high altitudes. nisms (for example of epigenetic regulation) in the re- To adapt to a hypoxic environment, TP increased expres- gion or functional SNPs in long-distance regions. It was sion of the VEGFA gene in vivo and changed their cardio- a pending work what SNPs or what other regulatory vascular response to hypoxia. The increased VEGFA mechanisms could regulate the gene expression and expression might increase blood flow and enhance cardiac have roles on hypoxic adaptation in Tibetan pig. pumping [18, 19]. The heart plays an important role in adaptation to hyp- In the early phase of liver regeneration, proliferating oxia. It has been reported that decreased cardiac VEGFA hepatocytes showed hypoxia-induced VEGFA expression, Fig. 5 Quantitative expression of VEGFA mRNA in endothelial cells. Each bar represents mean ± S.E. * Significant difference (P < 0.05), ** Extreme significant difference (P < 0.01) (n =3) Zhang et al. Journal of Animal Science and Biotechnology (2016) 7:21 Page 7 of 8 which initiates proper blood flow through the liver [20]. and ZXW participated in collecting tissues. BZ and YZQB performed the molecular experiment. PS and YFL analysed the data and interpreted the Our results consistently showed that expressions of results. BZ drafted this manuscript. All authors critically revised the manuscript VEGFA mRNA and protein in liver were significantly for important intellectual contents and approved the final manuscript. higher in TP than in YH and YL, which indicated that the TP might improve blood flow in liver tissue to adapt Acknowledgments to hypoxia. This work was supported by the National Major Special Project on New VEGFA plays a crucial role in the kidney, where it is Varieties Cultivation for Transgenic Organisms (2016ZX08009-003-006) and the National Key Technology R&D Program (2012BAD03B03) and the produced primarily by glomerular epithelial cells (podo- Program for Changjiang Scholar and Innovation Research Team in cytes) and is also found in epithelial cells [21, 22]. In University (IRT1191). mice, specific overexpression or deletion of the Author details VEGFA gene in podocytes results in glomerular National Engineering Laboratory for Animal Breeding, China Agricultural dysfunction [23, 24]. Moreover, VEGFA acts as an University, Beijing 100193, People’s Republic of China. College of Agriculture autocrine growth factor on both proliferating and dif- and Animal Husbandry, Tibet University, Linzhi 860000, People’s Republic of China. School of life science & technology, Nanyang normal University, ferentiating glomerular visceral epithelial cells (podo- Nanyang 473061, Henan Province, People’s Republic of China. Hebei cytes) [24] and has roles in prolonged survival and Provincial Husbandry and Veterinary Research Institute, Baoding, Hebei resistance to apoptosis [25]. In the present study, TP 071001, People’s Republic of China. showed a high expression level of the VEGFA gene, Received: 12 August 2015 Accepted: 22 March 2016 suggesting that VEGFA plays a pivotal role in the maintenance of glomerular integrity under hypoxia in the kidneys of pigs. References 1. Gille H, Kowalski J, Li B, LeCouter J, Moffat B, Zioncheck TF, et al. Analysis of Conclusion biological effects and signaling properties of Flt-1 (VEGFR-1) and KDR We found that the mRNA sequence of the pig (VEGFR-2) A reassessment using novel receptor-specific vascular endothelial growth factor mutants. J Biol Chem. 2001;276:3222–30. VEGFA gene was conserved among pig breeds, which 2. Matsumoto T, Mugishima H. Signal transduction via vascular endothelial indicated the biological function of the gene was pri- growth factor (VEGF) receptors and their roles in atherogenesis. J Atheroscler marily regulated by differential expression. Only five Thromb. 2006;13:130–5. 3. Lohela M, Bry M, Tammela T, Alitalo K. VEGFs and receptors involved in SNPs (G-2745C, G-2442A, G-2435deletion, C-1773 T angiogenesis versus lymphangiogenesis. Curr Opin Cell Biol. 2009;21:154–65. and T-1010C) were found in the 5′-flanking region of 4. Carmeliet P, Moons L, Luttun A, Vincenti V, Compernolle V, De Mol M, et al. length of 2693 bp upstream from the initiation codon Synergism between vascular endothelial growth factor and placental growth factor contributes to angiogenesis and plasma extravasation in of the VEGFA gene among the TP, YL, and DN popu- pathological conditions. Nat Med. 2001;7:575–83. lations. However, further studies are required to iden- 5. Geiger R, Berger RM, Hess J, Bogers AJ, Sharma HS, Mooi WJ. Enhanced tify thesite thatcan regulate thegeneexpression in expression of vascular endothelial growth factor in pulmonary plexogenic arteriopathy due to congenital heart disease. J Pathol. 2000;191:202–7. pig. The Tibetan pig had considerably high expres- 6. Hirose S, Hosoda Y, Furuya S, Otsuki T, Ikeda E. Expression of vascular sions of the VEGFA gene in heart and liver tissues in endothelial growth factor and its receptors correlates closely with formation high-altitude environment. The increased VEGFA ex- of the plexiform lesion in human pulmonary hypertension. Pathol Int. 2000; 50:472–9. pression might be one way of genetic adaptation to 7. Cheng P. Livestock breeds of China. Food and Agriculture Organization of hypoxia in high-altitude, through promoting endothe- the United Nations. 1985. lial cells proliferation, angiogenesis and maintaining 8. Pan PW, Zhao SH, Yu M, Liu B, Xiong TA, Li K. Identification of differentially expressed genes in the Longissimus Dorsi muscle tissue between Duroc vascular permeability. Further research on molecular and Erhualian pig by mRNA differential display. Asian Aust J Anim. 2003;16: mechanisms of the VEGFA for hypoxic adaptation 1066–70. was a pending work in Tibetan pig. 9. Gong JJ, He ZP, Li ZQ, Lv XB, Ying SC, Chen XH. Investigation on fattening and carcass traits in Tibetan pig and its combinations. Southwest China J Abbreviations Agric Sci. 2007;20:1109-12. DN: Diannan small-ear pig; eNOS: endothelial nitric oxide synthase; 10. Green MR, Sambrook J. Molecular cloning: a laboratory manual. New York: HIF-1α: hypoxia-inducible factor 1α; HREs: hypoxia response elements; Cold Spring Harbor Laboratory Press; 2012. PIEC: pig iliac endothelial cells; qRT-PCR: quantitative real-time PCR; 11. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using − ΔΔCT SDS-PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis; real-time quantitative PCR and the 2 method. Methods. 2001;25:402–8. SNPs: single nucleotide polymorphisms; TP: Tibetan pig; VEGFA: vascular 12. Goodsell DS. The molecular perspective: VEGF and angiogenesis. Stem Cells. endothelial growth factor A; VEGFR-1: VEGF receptor 1; VEGFR-2: VEGF 2003;21:118–9. receptor 2; YH: Yorkshire pigs that migrated to high altitudes; 13. Semenza GL. Regulation of mammalian O2 homeostasis by hypoxia-inducible YL: Yorkshire pigs that lived at low altitudes. factor 1. Annu Rev Cell Dev Bi. 1999;15:551–78. 14. Kim HA, Lim S, Moon H, Kim SW, Hwang K, Lee M, et al. Hypoxia-inducible Competing interests vascular endothelial growth factor gene therapy using the oxygen- The authors declare that they have no competing interests. dependent degradation domain in myocardial ischemia. Pharm Res Dordr. 2010;27:2075–84. Authors’ contributions 15. Golozar A, Beaty TH, Gravitt PE, Ruczinski I, Qiao Y, Fan J, et al. Oesophageal HZ provided essential experiment conditions and instruments. HZ, YZQB squamous cell carcinoma in high-risk Chinese populations: Possible role for and BZ conceived and designed the experimental plan. BZ, PS, YFL, YZY vascular epithelial growth factor A. Eur J Cancer. 2014;50:2855–65. Zhang et al. Journal of Animal Science and Biotechnology (2016) 7:21 Page 8 of 8 16. Shiojima I, Sato K, Izumiya Y, Schiekofer S, Ito M, Liao R, et al. Disruption of coordinated cardiac hypertrophy and angiogenesis contributes to the transition to heart failure. J Clin Invest. 2005;115:2108. 17. Taimeh Z, Loughran J, Birks EJ, Bolli R. Vascular endothelial growth factor in heart failure. Nat Rev Cardiol. 2013;10:519–30. 18. Chiu CL, Morgan CT, Lupton SJ, Lind JM. Parent of origin influences the cardiac expression of vascular endothelial growth factor (VEGFA). BMC Med Genet. 2013;14:43. 19. Cor AD, Astanina E, Giraudo E, Bussolino F. Semaphorins in cardiovascular medicine. Trends Mol Med. 2014;20:589–98. 20. Kajdaniuk D, Marek B, Borgiel-Marek H, Kos-Kud LAB. Vascular endothelial growth factor (VEGF)—part 1: in physiology and pathophysiology. Endokrynol Pol. 2011;62:444–55. 21. Robert B, Zhao X, Abrahamson DR. Coexpression of neuropilin-1, Flk1, and VEGF in developing and mature mouse kidney glomeruli. Am J Physiol Renal. 2000;279:F275–82. 22. Baderca F, Lighezan R, Dema A, Alexa A, Raica M. Immunohistochemical expression of VEGF in normal human renal parenchyma. Rom J Morphol Embryol. 2006;47:315–22. 23. Eremina V, Sood M, Haigh J, Nagy AAS, Lajoie G, Ferrara N, et al. Glomerular-specific alterations of VEGF-A expression lead to distinct congenital and acquired renal diseases. J Clin Invest. 2003;111:707. 24. Eremina V, Quaggin SE. The role of VEGF-A in glomerular development and function. Curr Opin Nephrol Hypertens. 2004;13:9–15. 25. Foster RR, Hole R, Anderson K, Satchell SC, Coward RJ, Mathieson PW, et al. Functional evidence that vascular endothelial growth factor may act as an autocrine factor on human podocytes. Am J Physiol Renal. 2003;284:F1263–73. Submit your next manuscript to BioMed Central and we will help you at every step: • We accept pre-submission inquiries � Our selector tool helps you to find the most relevant journal � We provide round the clock customer support � Convenient online submission � Thorough peer review � Inclusion in PubMed and all major indexing services � Maximum visibility for your research Submit your manuscript at www.biomedcentral.com/submit
Journal
Journal of Animal Science and Biotechnology – Springer Journals
Published: Apr 2, 2016