Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

GLP1 and GIP are involved in the action of synbiotics in broiler chickens

GLP1 and GIP are involved in the action of synbiotics in broiler chickens Background: In order to discover new strategies to replace antibiotics in the post-antibiotic era in meat-type chicken production, two new synbiotics were tested: (Lactobacillus salivarius IBB3154 plus galactooligosaccharide (Syn1) and Lactobacillus plantarum IBB3036 plus raffinose family oligosaccharides (Syn2). Methods: The synbiotics were administered via syringe, using a special automatic system, into the egg air chamber th 5 of Cobb 500 broiler chicks on the 12 day of egg incubation (2 mg of prebiotics + 10 cfu bacteria per egg). Hatched roosters (total 2,400) were reared on an experimental farm, kept in pens (75 animals per pen), with free access to feed and water. After 42 d animals were slaughtered. Blood serum, pancreas, duodenum and duodenum content were collected. Results: Syn2 increased trypsin activity by 2.5-fold in the pancreas and 1.5-fold in the duodenal content. In the duodenum content, Syn2 resulted in ca 30% elevation in lipase activity and 70% reduction in amylase activity. Syn1 and Syn2 strongly decreased expression of mRNA for GLP-1 and GIP in the duodenum and for GLP-1 receptors in the pancreas. Simultaneously, concentrations of the incretins significantly diminished in the blood serum (P < 0.05). The decreased expression of incretins coincides with changed activity of digestive enzymes in the pancreas and in the duodenal content. The results indicate that incretins are involved in the action of Syn1 and Syn2 or that they may even be their target. No changes were observed in key hormones regulating metabolism (insulin, glucagon, corticosterone, thyroid hormones, and leptin) or in metabolic indices (glucose, NEFA, triglycerides, cholesterol). Additionally, synbiotics did not cause significant changes in the activities of alanine and aspartate aminotransferases in broiler chickens. Simultaneously, the activity of alkaline phosphatase and gamma glutamyl transferase diminished after Syn2 and Syn1, respectively. Conclusion: The selected synbiotics may be used as in ovo additives for broiler chickens, and Syn2 seems to improve their potential digestive proteolytic and lipolytic ability. Our results suggest that synbiotics can be directly or indirectly involved in incretin secretion and reception. Keywords: GIP, GLP-1, Incretins, In ovo, Synbiotics Background poultry breeding to replace the usage of antibiotics as In recent years the administration of natural non-anti- growth promoters banned in some parts of the world, biotic and non-hormonal growth stimulators supporting strengthen health, improve production parameters and di- chicken health has been most intensively studied. Prebi- minish environmental pollution. Both the manner and otics and probiotics, either alone or in combination (syn- moment of addition of biologically active compounds biotics), are considered to be a helpful alternative in seem to be important to achieve the best effects. The in ovo technique applied in the present paper is a relatively new method of supplementation, which allows for the ap- * Correspondence: ewaprusz@up.poznan.pl; ewaprusz27@gmail.com plication of prebiotics or synbiotics in early developmental Department of Animal Physiology and Biochemistry, Poznan University of Life Sciences, Wolynska 35, 60-637 Poznan, Poland stages and enables the modulation of gastrointestinal tract Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 2 of 9 activity [1, 2]. Besides being an important location for bac- present paper studied the expression of mRNA for GIP terial settlement and enzymatic digestion of feed, the in- and GLP-1 in the duodenum, for their receptors in the testine is also a source of incretins which play a significant pancreas, and the levels of both incretins in the blood role, among others, in the regulation of pancreatic serum. Previously, we have demonstrated the effect on function. the enzymatic activity of the pancreas of in ovo adminis- Synbiotics may contribute to the modification of the tered synbiotics composed of inulin plus Lactococcus gut activity. Some results indicate that synbiotics can lactis subsp. lactis, and of Bi tos plus Lactococcus lactis affect incretins in humans and rodents [3–5]. Moreover, subsp. cremoris [1]. In the present study, two synbiotics previous research has shown that synbiotics are able to were chosen (Syn1 – Lactobacillus salivarius IBB3154 modify the entire spectrum of phenotypic features, e.g. plus galactooligosaccharide [Bi tos]; Syn2 – Lactobacillus growth, intestinal tissue structure, pancreas potency, mo- plantarum IBB3036 plus raffinose family oligosaccharides lecular changes in liver, and also spleen, tonsils and caecal [RFO]) and, besides the enzymatic activity of the pancreas, bacterial populations and caecal fermentation [6, 7]. There analyses also focused on enzymatic activity in the duo- are no reports related to the impact of synbiotics on incre- denum content. Moreover, a wide panel of hormones tins in poultry. Therefore, in birds treated with synbiotics, regulating metabolism (insulin, glucagon, corticosterone, we decided to study simultaneously the activity of di- leptin, and thyroid hormones), as well as a broad gestive enzymes in the pancreas and duodenum, and spectrum of biochemical indices (glucose, non-esterified the synthesis, secretion and reception of two important fatty acids, triglycerides, total and free cholesterol, total incretins –– gastric inhibitory polypeptide or glucose- proteins and albumins) and diagnostic enzymes (alanine dependent insulinotropic peptide (GIP) and glucagon- aminotransferase, aspartate aminotransferase, alkaline like peptide 1 (GLP-1) –– exerting stimulatory action phosphatase, and gamma glutamyl transferase) were an- on insulin secretion. GIP, described by Brown et al. [8], alyzed. All the analyses allowed us to answer the question is a 42-amino acid compound synthesized and secreted of whether the chosen in ovo implemented synbiotics act by K cells in the entire small intestine. The biological long-term and whether they modulate the hormonal and activity of GIP is regulated via gastric inhibitory peptide enzymatic activities of the digestive tract. receptors (GIP-R). GIP-R in humans and rodents are expressed in various tissues and organs, such as the Methods brain, pancreas, small intestine, stomach, adipose tis- This study was undertaken with the approval of the sue, pituitary, heart, spleen, thymus, lung, kidney, and Polish Local Ethical Commission (Bydgoszcz, Poland, thyroid [9–11]. Among the various functions of GIP the No. 36/2012). following can be mentioned: reduction of gastric acid secretion [9]; stimulation of insulin secretion [9, 12]; Experimental design control of food intake as a negative regulator of NPY Selection of synbiotics was performed based on the in [9]; stimulation of lipogenesis in fat tissue [13]; and a vitro and in vivo experiments described by Dunislawska et positive effect on bone formation and downregulation al. [25]. Also, detailed procedures for the experimental of bone resorption [14]. Unfortunately, the biological setup and rearing conditions were presented previously by functions of GIP in chicken are still insufficiently Dunislawska et al. [25]. In brief, 5,850 eggs (approx. 65 g understood. Equally important for the regulation of the each) from Cobb500FF hens (42-week-old) were incu- body’s metabolism is another incretin – glucagon-like bated at a commercial hatchery. On d 12, eggs were ran- peptide 1 (GLP-1). GLP-1 is secreted by L-cells located domly allotted to 3 groups and injected with 0.2 mL of mainly in the duodenum, ileum, and colon [15]. There either saline or synbiotics. The control group received are two biologically active forms of GLP-1: GLP-1-(7–37) pure saline (0.9%), whereas experimental groups received and GLP-1-(7–36)NH , and both derive from the proglu- synbiotics: Syn1 – Lactobacillus salivarius IBB3154 plus cagon molecule by post-translational processing [16–18]. galactooligosaccharide [Bi tos, Clasado Biosciences, Ltd., GLP-1 inhibits gastric emptying [9], glucose production in Jersey, UK]; Syn2 – Lactobacillus plantarum IBB3036 plus the liver [19], peristaltic movements, and pancreas raffinose family oligosaccharides [RFO – combination of functions [18, 20], and decreases appetite [21]. GLP-1R 6.1% of sucrose, 9.4% of raffinose, 65.2% of stachyose, 18.0% (glucagon-like peptide 1 receptor) belongs to the group of verbascose, and 1.3%.of other saccharides] [26, 27]. The of G-protein coupled receptors and is expressed in vari- prebiotic component was given at a dose of 2 mg and ous tissues, such as the central nervous system, pancre- bacteria at a quantity of 10 cfu per egg. atic islets, pancreas, stomach, intestine, liver, and fat For further investigations only those roosters were tissue [22–24]. qualified which had hatched from eggs previously in ovo Considering that the final action of hormones is the injected into air chamber eggs (total 2400). The roosters result of their synthesis, secretion and reception, the were reared on a commercial farm registered also as an Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 3 of 9 experimental farm (Piast, Olszowa, Poland). Birds from kit, RIA – Cis International), total triiodothyronine control and experimental groups were kept on the floor (Triiodothyronine (T3) kit, RIA – Cis International), in pens (75 animals per pen) and had free access to feed free triiodothyronine (Free Triiodothyronine (fT3) kit, and water. Body weight, feed consumption, feed conver- RIA – Cis International), corticosterone (Corticosterone sion efficiency and mortality were measured. The rearing ELISA kit – Enzo Life Sci., Warsaw, Poland), leptin data from the experiment are described by Dunislawska (Multi-Species Leptin RIA, Millipore, USA), incretins GIP et al. [25]. For the investigations described in the paper, (Gastric Inhibitory Polypeptide) (SunRed, Jufengyuan 42-day-old birds randomly chosen from the pens were Road, Baoshan, District, Shanghai), and GLP-1 (Glucagon- used. like Polypeptide-1) (Phoenix Pharmaceuticals Inc., USA). In order to verify the specificity of binding of kits, serum Blood collection dilution curve was performed. For this purpose serum On d 42 birds were slaughtered, the blood was collected from five randomly chickens was diluted 2×, 4× and 10 and then the blood serum obtained. Immediately after times in Elisa/RIA buffer, and next concentrations of in- the blood collection, pancreases and duodenum were ex- vestigated hormones were determined in all dilutions. cised. Also, the duodenum content was taken for ana- lyses. Next, the whole material was frozen and kept for Enzyme activity in the blood serum further investigations at −80 °C. The activity of diagnostic enzymes and concentration of main blood biochemical parameters were analyzed in the Pancreatic enzyme activity blood serum. The activities of alanine (ALT; GPT) and The activity of pancreatic enzymes was measured as aspartate (AST; GOT) aminotransferases as well as alka- described previously [1]. line phosphatase (ALP) and gamma glutamyl transpepti- In brief, after being weighed pancreases were dase (GGT) were estimated using commercial kits (Pointe homogenized in TBS buffer on ice and 20% homoge- Scientific, USA). nates were centrifuged (10,000×g for 16 min.). Activ- ities of amylase, lipase, and trypsin were measured Biochemical parameters in the blood serum using appropriate commercial colorimetric tests The parameters of carbohydrate (glucose), protein (total (Biovision, USA). For measurement of lipase activity, proteins and albumins), and lipid (triglycerides, free fatty homogenates were diluted 100× using TBS buffer, acids, cholesterol) metabolism were estimated: glucose while for measurement of amylase activity these were was measured using a Glucose Assay Kit – Pointe Scien- diluted 1,000X with commercially supplied buffer. In tific (USA), total protein and albumins were estimated the case of trypsin measurement, diluted supernatants using a Total Proteins Kit (Alpha Diagnostics, Poland) (100× with TBS) were incubated with 1% enterokinase and Total Albumins Kit (Alpha Diagnostics, Poland), tri- (prepared in 0.1 mol/L Tris-HCl with 0.1 mol/L CaCl ; glycerides were measured using a kit from Pointe Scien- pH 7.2). The temperatures for measurement of enzyme tific (USA) (Alpha Diagnostics, Poland), free fatty acids activities were as follows: for amylase and trypsin 25 °C, were estimated with a kit from Wako Chemicals (USA), and for lipase 37 °C. Activities were measured as the and cholesterol was measured with a Cholesterol/ amount of product formed during reactions (glycerol, Cholesteryl Ester Quantitation Kit – BioVision (USA). nitrophenol, p-nitroaniline) and these are expressed in the manuscript as % of control. Real-Time PCR To determine the activity of the lipase, amylase and Determination of incretins (GIP; GLP-1) and their recep- trypsin in the duodenal content, 250 μL of PBS was tors (GIP-R; GLP-1R) mRNA and incretins serum con- added to 100 mg of content, the mixture was homoge- centration is described below. Isolation of total RNA nized on ice and centrifuged (10,000×g for 16 min.). The was performed using Tripure reagent (Roche, Germany) activity of enzymes was measured using the commercial according to the manufacturer’s instructions. The effi- kits mentioned above. ciency of isolation and the quality of isolated RNA were determined using NanoDrop 1000. Additionally, the in- Hormonal profile tegrity of RNA was determined by electrophoresis in 1% The concentrations of blood serum hormones involved agarose gel. cDNA was synthesized from 1 μg of total in the regulation of feed intake and catabolic/anabolic RNA using a high-capacity cDNA reverse transcription pathways and carbohydrate/lipid/protein turnover were kit (Thermo Fisher Scientific). Moreover, to exclude con- investigated in the blood serum as follows using commer- tamination of genomic DNA, we performed all RT-PCRs cial RIA and EIA kits: insulin (Insulin RIA kit, Millipore, in parallel without added RT and detected no signals. USA), total thyroxine (Thyroxine (T4) kit, RIA – Cis Primers for reactions were designed using Primer- International), free thyroxine (Free Thyroxine (fT4) BLAST (Primers sequences are presented in Table 1). Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 4 of 9 Real-Time PCR was performed using QuantStudio 12 K Flex™ Real-Time PCR and Fast SYBR Green Master Mix (Life Technologies, Grand Island, NY, USA). Amplification involved one cycle at 95 °C for 1 min for initial denatur- ation and then 45 cycles consisting of denaturation (95 °C for 3 s) and annealing (62 °C for 30 s). Detection of the fluorescent product was set at the last step of each cycle. To determine the specificity of amplification, analyses of product melting were performed after each amplification (0.1 °C/s increment from 65 °C to 95 °C, with fluorescence collection at 0.1 °C intervals). Relative gene expression was evaluated by Delta Delta CT (ΔΔCT) with GAPDH as a reference. Statistical analysis Statistical analyses were performed as previously de- scribed [1]. In brief, all data were analyzed using one- way ANOVA followed by the Duncan’s multiple range test. Data are presented as means ±SEM, (n = 8 per group) and P < 0.05 was considered statistically signifi- cant. Statistical significance compared to controls was marked * P <0.05, ** P <0.01. Results Synbiotics modulate GLP-1/GLP-1R and GIP/GIP-R mRNA expression levels and decrease concentrations of GLP-1 Fig. 1 GLP-1 and GLP-1R mRNA expression in chicken duodenum and GIP in the blood serum and pancreas. Results are means ± SEM (n = 8). *P < 0.05, **P < 0.01 In the experiment, the effect of synbiotics on the expres- compared with control sion of mRNA for GLP-1, GIP and their receptors mRNA in chicken duodenum and pancreas was stated. In the duodenum, downregulation of GLP-1 mRNA level trypsin activity in birds which had been administered (Fig. 1a) was observed after Syn1 (P < 0.05) and Syn2 Syn2. On the other hand, in the duodenal content activ- (P < 0.05). Similar results were obtained for GIP.Syn1 ity of trypsin and lipase were noticeably heightened after (P < 0.01) and Syn2 (P < 0.01) decreased its mRNA ex- synbiotics with significant changes observed after Syn2. pression (Fig. 2a). Also, we investigated the effects of In turn, amylase activity in the duodenum was less than synbiotics on GIP-R and GLP-1R mRNA in the chicken half that of the control value and again a statistically pancreas. In synbiotic groups, we found lower mRNA significant change was observed only for Syn2. All levels of GLP-1R compared to the control group (Fig. 1b; alterations are included in Table 2. P < 0.05). Statistically significant differences were not ob- served for GIP-R mRNA in the pancreas (Fig. 2b). Simul- Effect of synbiotics on biochemical parameters and taneously, the effect of the synbiotics on serum levels of enzyme activity in blood serum GIP and GLP-1 was examined and, using immunoenzy- The concentrations of other blood parameters including matic assays, lower concentrations of the both incretins hormones are presented in Table 3. Besides the changes were found. The effect of synbiotics on GLP-1 concentra- noticed for incretins and their receptors and for the ac- tion (P < 0.01) was more pronounced; however, statistically tivity of digestive enzymes, no significant changes were significant changes were also observed in GIP levels stated for the measured hormones or biochemical com- (P < 0.05) (Fig. 3). pounds. The levels of insulin, glucagon, corticosterone, thyroid hormones, and leptin were similar in both con- Synbiotics modulate pancreatic enzyme activity trol and experimental groups. Moreover, the insulin/ The decreased expression of incretins coincided with glucagon molar ratio was not evidently changed and no changed activity of digestive enzymes in the pancreas significant alterations in metabolic parameters were and in the duodenal content. The activity of all investi- shown. The levels of serum glucose, non-esterified fatty gated enzymes in the pancreas was elevated; however, a acids, triglycerides, cholesterol, total protein and albu- statistically significant difference was observed only for mins did not change. The synbiotics used did not cause Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 5 of 9 Discussion The heightened activity of all enzymes in the pancreases may be ascribed to their greater stored amount in exo- crine cells. Thus, by elevating trypsin activity the synbio- tics prepared organisms especially well to digest proteins. The most effective was Syn2, which increased 2.5-fold the “potential” activity of pancreases and 1.5-fold trypsin ac- tivity in the content of duodenum. Also, none of the in ovo injected synbiotics decreased the amylolytic or lipo- lytic potential of pancreases. The changes observed after in ovo administration of synbiotics are not unusual, be- cause alterations in the total activity of digestive enzymes in the pancreas had been observed previously by Pruszynska-Oszmalek et al. [1]. In that paper, in ovo injected synbiotics (inulin + Lactococcus lactis spp. lactis; Bi tos + Lactococcus lactis subsp. cremoris) elevated the amylolytic and lipolytic activity of the pancreas at the end of the rearing period, and synbiotics based on Bi tos also elevated trypsin activity. In the present paper, we con- firmed that synbiotics injected early during development may exert long-lasting effects on pancreatic enzymes. Additionally, the present study also covers the activity of the main pancreatic enzymes in the duodenal content, which reflects their ability to digest three main groups of nutrients: proteins, lipids and carbohydrates. Elevated ac- tivities of trypsin and lipase indicate that Syn2 may im- prove the process of protein and lipid digestion. However, Fig. 2 GIP and GIP-R mRNA expression in chicken duodenum and the amylolytic activity in the intestine was strongly de- pancreas. Results are means ± SEM (n = 8). *P < 0.05, **P <0.01 creased after synbiotic treatment. This phenomenon was compared with control probably the result of a lower level of secretion of amylase to the duodenum. It is possible that, as a result, the con- bigger changes in the activities of two diagnostic en- centration of glucose in the duodenum content was low- zymes: alanine and aspartate aminotransferases. How- ered. In comparison to control birds, appropriate averages ever, the activity of ALP and GGT markers was were 88.7% and 90.4% after treatment with Syn1 and modified. Alkaline phosphatase was lower after synbio- Syn2, respectively; both changes were statistically signifi- tics; however, a statistically significant difference was cant at P < 0.05. This, in turn, was reflected in a lower se- observed only for Syn2. The activity of gamma glutamyl cretion of incretins to the blood. This could offer an transferase was also lower after synbiotics but, in turn, explanation for the parallel decrease in amylase activity in a statistically significant change was observed after the gastrointestinal tract, diminished expression of mRNA Syn1 administration (Table 4). for incretins and their lowered concentration in the blood ab Fig. 3 GLP-1 and GIP concentrations in blood serum. Results are means ± SEM (n = 8). *P < 0.05, **P < 0.01 compared with control Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 6 of 9 Table 1 Polymerase chain reaction primer sequences and product size Genes Forward primer (5′→3′) Reverse primer (5′→3′) Product Size, bp GLP-1 CCAAGCGTCATTCTGAATTTG TGACCTTCCAAATAAGAGGTGATA 76 GIP CGCAGTGAGTGACCAAAGC TAGGAGCCATGCAAGGAAGT 67 GLP-1R GTGTACCGGTTCTGCACCTC GGGCAGAGTCGAGTTCTCCT 60 GIP-R GCGTTACCTCTACGAGAACGA GCGGATGATCCACCACAC 70 GAPDH GTGAAAGTCGGAGTCAACGG ACAGTGCCCTTGAAGTGTCC 170 serum. Additionally, the increase in trypsin and lipase ac- highly diminished concentration of GLP-1 and a signifi- tivity could be connected with the lower levels of GLP-1 cantly reduced level of GIP in the blood serum. Simul- after synbiotic application. Intravenous infusion of GLP-1 taneously, expression of mRNA for both receptors in reduced trypsin and lipase activity in men [28]. Simultan- the pancreases was lower and for GLP-1R this was sta- eously, none of the effects of synbiotics on amylase con- tistically significant. This situation should not promote tent in pancreas could be explained by the fact that GLP-1 insulin secretion by meal via incretins. However, no sig- does not mediate amylase release from a model of pancre- nificant changes were observed either for insulin level, atic cells (AR42J), as observed previously [29]. Similarly, which was not lower in the blood serum after synbio- no effect of GIP on amylase release from dispersed pan- tics, or for other investigated hormones: glucagon, cor- creatic acinar cells was noted by Sjodin and Conlon [30]. ticosterone, leptin. Also, metabolic parameters, glucose, On the other hand, it is difficult to explain the strongly di- non-esterified acids, triglycerides, cholesterol, total pro- minished amylolytic activity in the duodenum content teins and albumins in the blood serum were unchanged from the above observations. It seems to be the case that following in ovo treatment with synbiotics. Thus, the secretion of amylase to the duodenum is also controlled alterations in the activity of pancreatic enzymes and in by other mechanisms. Nevertheless, incretins appear to be incretins did not translate into changes in additional an important element in the duodeno-pancreatic and parameters, such as other hormones and biochemical duodeno-brain loops. Besides the continuously explored indices. Also, in parallel studies within this experiment new functions of incretins, they are important for such a lack of synbiotic-induced changes on breeding parame- key processes as insulin secretion and appetite regulation. ters was observed, as calculated for the whole period from Honda reviewed and discussed a role of some incretins in days 1 to 41 [25]. Neither body weight gain nor feed in- food intake regulation [31]. Turton et al. described the take, feed conversion efficiency or mortality differed presence of GLP-1 and its receptors in the hypothalamus significantly between control and experimental groups and the suppressive effect of GLP-1 given ICV on food in- treated with synbiotics. take in rats [32]. Also, the same effect has been noted in In the present study, a multilateral network of connec- chicken [33]. The two incretins, GLP-1 and GIP, are se- tions was observed, involving the synbiotic – incretins – creted by L and K cells of the intestine, respectively. These pancreatic digestive potential – activity of enzymes in cells are believed to be sensors of the nutrient ingredients duodenum. Synbiotics given in ovo initiate changes and passing through the intestine [15]. Of these, glucose are the first link in the chain of events finally exerting strongly stimulates both GLP-1 release [15] and GIP long-lasting effects. The succession of subsequent secretion. changes can be differently interpreted. On the one side, In the present paper, the mRNA transcripts of both the altered microbiome could in no way reduce the amy- investigated incretins were strongly reduced in the duo- lolytic activity in duodenum by restriction of amylase se- denum and these changes were accompanied by a very cretion. In turn, the slowed down digestion of complex Table 2 Changes in amylase, lipase and trypsin activities in pancreas and duodenum content after in ovo synbiotic treatment Enzymes Determination location Control Synbiotic 1 Synbiotic 2 Trypsin Pancreas 100.0 ± 38.52 191.49 ± 25.45 246.49* ± 25.13 Duodenum content 100.0 ± 18.39 93.99 ± 27.35 150.69* ± 14.55 Lipase Pancreas 100.0 ± 27.43 158.43 ± 30.94 128.96 ± 32.98 Duodenum content 100.0 ± 6.41 110.58 ± 17.86 127.43* ± 10.66 Amylase Pancreas 100.0 ± 27.03 117.94 ± 18.46 116.64 ± 12.79 Duodenum content 100.0 ± 26.21 48.07 ± 20.78 30.05* ± 7.63 Differences are expressed as % of control. Results are the mean ± SEM (n = 8). *P < 0.05 Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 7 of 9 Table 3 Hormone and metabolic profiles in blood serum 1 inhibits food intake in neonatal chicks [33, 35]. Add- itionally, administration of GLP-1 increased cortico- Items Control Synbiotic 1 Synbiotic 2 sterone in blood serum [35]. In contrast, in our studies Insulin, nmol/L 0.184 ± 0.027 0.167 ± 0.032 0.251 ± 0.058 no corticosterone changes were stated. Furthermore, the Glucagon, nmol/L 0.088 ± 0.010 0.091 ± 0.019 0.087 ± 0.020 observed alterations in the pancreatic duodenal axis and Insulin/Glucagon, 2.592 ± 0.812 2.372 ± 0.699 3.459 ± 0.770 expression of incretins did not transpose onto breeding mol/mol parameters. The organisms of the birds probably Corticosterone, ng/mL 96.21 ± 3.10 101.7 ± 11.34 97.62 ± 6.01 adapted themselves to a new physiological situation by Leptin, ng/mL 0.170 ± 0.047 0.139 ± 0.012 0.161 ± 0.019 switching on/off other mechanisms. On the other hand, Total T4, ng/mL 19.35 ± 1.59 16.75 ± 0.75 16.99 ± 1.08 it is significant that the synbiotics did not lead to a de- Free T4, pg/mL 8.827 ± 1.703 10.350 ± 1.071 8.575 ± 1.110 terioration in rearing parameters. Together with analyzing enzymatic, hormonal, and Total T3, ng/mL 0.774 ± 0.150 0.971 ± 0.227 0.761 ± 0.164 biochemical indices linked directly to body growth and Free T3, pg/mL 1.847 ± 0.126 2.270 ± 0.272 1.684 ± 0.132 metabolism, diagnostic enzyme activity in the blood Glucose, mg/dL 206.40 ± 1.51 201.91 ± 2.53 198.48 ± 5.34 serum was also measured to estimate the overall health NEFA, mmol/L 0.56 ± 0.02 0.68 ± 0.03 0.56 ± 0.02 of broilers. ALP and GGT were used as markers of bone Triglycerides, mg/dL 115.61 ± 11.19 124.20 ± 8.71 106.62 ± 8.36 diseases (ALP) and liver and bile duct diseases (GGT Total cholesterol, mg/dL 121.53 ± 2.28 117.95 ± 9.46 119.28 ± 6.57 and ALP). While not statistically heightened, in two cases lower values of ALP (Syn2) and GGT (Syn1) indi- Free cholesterol, mg/dL 10.06 ± 0.97 10.57 ± 3.32 9.53 ± 1.66 cated a good or even improved health status for Results are means ± SEM (n =8) synbiotic-treated birds. Other health markers are ami- carbohydrates and smaller amount of glucose might notransferases. Their activity increases in disorders lower expression of incretins in the duodenum and their such as liver damage. The activity of aminotransferases level in the blood. On the other hand, alterations within in the blood serum was not significantly changed, incretins could precede changes in enzyme activity in which indicates no negative action from the used syn- the pancreas and in the duodenum. Whatever the se- biotics on the health status of birds. Also, Pruszynska- quence of events, it is undeniable that the activities of Oszmalek et al. [1] stated that in ovo administered syn- digestive enzymes in the pancreas and in the duodenum biotics (inulin plus Lactococcus lactis subsp. lactis; are associated with synbiotic in ovo delivery, incretin ex- Bi tos plus Lactococcus lactis subsp. cremoris)had no pression and their concentration in the blood. It is an negative effect on the activity of alanine and aspartate open question as to whether the noticed effect on both aminotransferases. However, on the contrary, the activity incretin and enzyme activity is a general property of of both aminotransferases was diminished. Also, after various synbiotics or is just characteristic for those treatment with prebiotic Bi tos alanine aminotransferase chosen. These results showed that synbiotics are able to activity was significantly lower. The activity of alanine and change trypsin, amylase and lipase activity in the chicken aspartate aminotransferases has also been measured by duodenum. Previous studies performed on humans and other authors. Salarmoini and Fooladi [36] investigated an rodents have suggested that modulation of gut micro- addition of probiotic L. acidophilus and did not note any biota by synbiotics or probiotics can affect incretin ex- elevation of the activities of aminotransferases and so no pression [4, 34]. However, our results are the first to link negative consequences of the use of these bacteria. Also, a few elements: in ovo technique, synbiotics, incretins Saccharomyces cerevisiae used as probiotics which had a and digestive enzymes in broiler chickens. A search of beneficial effect on body weight and feed consumption the literature provides limited information about the role efficiency in chickens did not elevate the activities of of incretins in chicken physiology. It had been shown aminotransferases [37]. Analyzing and summarizing previously that intracerebroventricular injection of GLP- data obtained on the influence of the two investigated Table 4 Activity of transferases and alkaline phosphatase in the blood serum Target, IU/L Control Synbiotic 1 Synbiotic 2 Alanine aminotransferase (ALT) 7.04 ± 1.49 6.63 ± 0.90 5.53 ± 0.75 Aspartate aminotransferase (AST) 68.78 ± 6.89 76.73 ± 3.86 67.98 ± 5.54 Alkaline 519.6 ± 34.96 394.9 ± 72.07 355.5* ± 50.26 Phosphatase (ALP) Gamma glutamyl transferase (GGT) 4.423 ± 0.807 2.371* ± 0.507 2.844 ± 0.408 Results are means ± SEM (n = 8). *P < 0.05, compared with control Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 8 of 9 synbiotics (Lb. salivarius IBB3154 plus galacto- (Lb. salivarius IBB3154 plus galactooligosaccharide – Bi tos); Syn2: synbiotic 2 (Lb. plantarum IBB3036 plus RFO) oligosaccharide [Bi tos] and Lb. plantarum IBB3036 plus raffinose family oligosaccharides [RFO]), it seems Acknowledgments to be obvious that they may be used as in ovo additives The authors would like to thank Jacek Bardowski and Roman Krzysztof th Górecki from IBB PAS in Warsaw for providing bacterial strains. in chickens without negative, up to the 6 week, effects on health and basic production parameters. Simultan- Funding eously, they must affect the pancreas, evoking significant This study was supported by the European Union Seventh Framework Programme for research, technological development and demonstration as alterations in the activity of gastrointestinal tract digestive part of the ECO-FCE project under grant agreement No. 311794. Additionally, enzymes and in the expression of incretins. So, they influ- this scientific work was partly funded by the Ministry of Science and Higher ence an important function of the organism, which is Education from funds for science in the years 2015–2016 allocated to an international co-financed project (no W171.PR/2015). proper food digestion, and they downregulate (control) expression of incretins. As mentioned above, synbiotics Availability of data and materials and prebiotics can modulate intestinal microflora. Based All data generated or analyzed during this study are included in this article. on these findings, literature data indicate a few possible Authors ‘contributions pathways by which probiotics and synbiotics can affect se- EPO, PM, PAK, designed the study, obtained the data and wrote the cretion and expression of incretins in K- and L-cells. The manuscript. LN, MB, DJ, TSz, MS contributed to the study design, edited, most convincing seems to be the effect of microbiomes on supported and critically revised the manuscript and contributed to the discussion. MSass, NL, DCh, KS obtained the data, collected and analyzed short chain fatty acid (SCFA) concentrations in the intes- the data and revised the manuscript. All authors have given final approval tine. SCFA are produced during bacterial fermentation of to the current version to be published. dietary fiber or of non-absorbed carbohydrate. It was Ethics approval and consent to participate shown in the literature that there exists a link between This study was undertaken with the approval of the Polish Local Ethical fiber, gut microbiota and K, L-cells acting via GPR41, Commission (Bydgoszcz, Poland, No.36/2012). GPR43, FFAR2 and FFAR3. Moreover, a possible role of Consent for publication FFAR2 in GLP-1 secretion was suggested by the discover- Not applicable 2+ ies that SCFA temporary triggered Ca in primary L-cells and mice lacking ffar2or ffar3 exhibited reduced SCFA- Competing interests The authors declare that they have no competing interests. triggered GLP-1 secretion in vitro [38, 39]. The mecha- nisms which combine the incretins with the exocrine pan- Author details creas and digestion in the intestine of chickens require Department of Animal Physiology and Biochemistry, Poznan University of Life Sciences, Wolynska 35, 60-637 Poznan, Poland. Department of Animal further investigation and the fact should be considered Nutrition and Feed Management, Poznan University of Life Sciences, that the results obtained for specific synbiotics in broiler Wolynska 33, 60-637 Poznan, Poland. Department of Genetics and Animal chickens should not be generalized to other synbiotics, Breeding, Poznan University of Life Sciences, Wolynska 33, 60-637 Poznan, Poland. Department of Animal Biochemistry and Biotechnology, UTP other populations of chicken as well as other poultry and University of Science and Technology, 85-084 Bydgoszcz, Poland. livestock species and, of course, humans. Received: 16 June 2017 Accepted: 22 December 2017 Conclusions In summary, we found that in ovo injection of two differ- References 1. Pruszynska-Oszmalek E, Kolodziejski PA, Stadnicka K, Sassek M, Chalupka D, ent synbiotics [Lb. salivarius plus galactooligosaccharide Kuston B, et al. In ovo injection of prebiotics and synbiotics affects the digestive (Syn1) and Lb. plantarum plus RFO (Syn2)] leads to a potency of the pancreas in growing chickens. Poult Sci. 2015;94:1909–16. lowering of the level of incretins (GLP-1 and GIP) in 2. Bednarczyk M, Stadnicka K, Kozłowska I, Abiuso C, Tavaniello S, Dankowiakowska A, et al. Influence of different prebiotics and mode of their blood serum. Furthermore, these two synbiotics downreg- administration on broiler chicken performance. Animal. 2016;10:1271–9. ulated GLP-1 and GIP mRNA expression in the duode- 3. Sáez-Lara MJ, Robles-Sanchez C, Ruiz-Ojeda FJ, Plaza-Diaz J, Gil A. Effects of num and GLP-1R in the pancreas. Moreover, Syn2 probiotics and synbiotics on obesity, insulin resistance syndrome, type 2 diabetes and non-alcoholic fatty liver disease: a review of human clinical increased trypsin and lipase activities in the duodenum trials. Int J Mol Sci. 2016;17:1–15. content, simultaneously decreasing amylase activity. Such 4. Cani PD, Dewever C, Delzenne NM. Inulin-type fructans modulate activity can promote digestion of proteins and lipids. Our gastrointestinal peptides involved in appetite regulation (glucagon-like peptide-1 and ghrelin) in rats. Br J Nutr. 2004;92:521–6. results suggest that synbiotics can be directly or indirectly 5. Nikbakht E, Khalesi S, Singh I, Williams LT, West NP, Colson N. Effect of involved in incretin secretion and reception. probiotics and synbiotics on blood glucose: a systematic review and meta- analysis of controlled trials. Eur. J. Nutr. Springer Berlin Heidelberg; 2016;1–12. Abbreviations https://doi.org/10.1007/s00394-016-1300-3. ALP: alkaline phosphatase; ALT: alanine aminotransferase; AST: aspartate 6. Awad WA, Ghareeb K, Abdel-Raheem S, Bohm J. Effects of dietary inclusion aminotransferase; GGT: gamma glutamyl transferase; GIP: gastric inhibitory of probiotic and synbiotic on growth performance, organ weights, and polypeptide or glucose-dependent insulinotropic peptide; GIP-R: gastric intestinal histomorphology of broiler chickens. Poult Sci. 2009;88:49–56. inhibitory peptide receptor; GLP-1: glucagon like peptide 1; GLP-1R: glucagon 7. Mookiah S, Sieo CC, Ramasamy K, Abdullah N, Ho YW. Effects of dietary like peptide 1 receptor; RFO: raffinose family oligosaccharides; Syn1: synbiotic 1 prebiotics, probiotic and synbiotics on performance, caecal bacterial Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 9 of 9 populations and caecal fermentation concentrations of broiler chickens. J 32. Turton M, O’Shea D, Gunn I, Beak S, Edwards C, Meeran K, et al. A role for Sci Food Agric. 2014;94:341–8. glucagon-like peptide-1 in the central regulation of feeding. Nature. 8. Brown J, Dryburgh J, Ross S, Dupre J. Identification and actions of gastric 1996;379:69–72. inhibitory polypeptide. Recent Prog Horm Res. 1975;31:487–532. 33. Furuse M, Matsumoto M, Okumura JI, Sugahara K, Hasegawa S. Intracerebroventricular injection of mammalian and chicken glucagon-like 9. Seino Y, Fukushima M, Yabe D. GIP and GLP-1, the two incretin hormones: peptide-1 inhibits food intake of the neonatal chick. Brain Res Elsevier. similarities and differences. J Diabetes Investig. 2010;1:8–23. 1997;755:167–9. 10. Rudovich N, Kaiser S, Engeli S, Osterhoff M, Gögebakan Ö, Bluher M, et al. 34. Delzenne NM, Cani PD, Daubioul C, Neyrinck AM. Impact of inulin and GIP receptor mRNA expression in different fat tissue depots in oligofructose on gastrointestinal peptides. Br J Nutr. 2005;93(Suppl 1):S157–61. postmenopausal non-diabetic women. Regul Pept. 2007;142:138–45. 35. Tachibana T, Sato M, Oikawa D, Furuse M. Involvement of CRF on the 11. Saxena R, Hivert M, Langenberg C, Tanaka T, Pankow J, Vollenweider P, et al. anorexic effect of GLP-1 in layer chicks. Comp. Biochem. Physiol. - a Mol. Genetic variation in GIPR influences the glucose and insulin responses to an Integr. Physiol. 2006;143:112–7. oral glucose challenge. Nat Genet. 2010;42:142–8. 36. Salarmoini M, Fooladi MH. Efficacy of lactobacillus acidophilus as probiotic 12. Preitner F, Ibberson M, Franklin I, Binnert C, Pende M, Gjinovci A, et al. to improve broiler chicks performance. J Agric Sci Technol. 2011;13:165–72. Gluco-incretins control insulin secretion at multiple levels as revealed in 37. Shareef A, Al-Dabbagh A. Effect of probiotic (Saccharomyces Cerevisiae) on mice lacking GLP-1 and GIP receptors. J Clin Invest. 2004;113:635–45. performance of broiler chicks. Iraqi. J Vet Sci. 2009;23:23–9. 13. Baba ASH, Harper JMM, Buttery PJ. Effects of gastric inhibitory polypeptide, 38. Ezcurra M, Reimann F, Gribble FM, Emery E. Molecular mechanisms of somatostatin and epidermal growth factor on lipogenesis in ovine adipose incretin hormone secretion. Curr Opin Pharmacol Elsevier Ltd. 2013;13:922–7. explants. Comp. Biochem. Physiol. - B Biochem. Mol Biol. 2000;127:173–82. 39. Tolhurst G, Heffron H, Lam YS, Parker HE, Habib AM, Diakogiannaki E, et al. 14. Henriksen DB, Alexandersen P, Bjarnason NH, Vilsbøll T, Hartmann B, Short-chain fatty acids stimulate glucagon-like peptide-1 secretion via the Henriksen EEG, et al. Role of gastrointestinal hormones in postprandial G-protein-coupled receptor FFAR2. Diabetes. 2012;61:364–71. reduction of bone resorption. J Bone Miner Res. 2003;18:2180–9. 15. Tolhurst G, Reimann F, Gribble FM. Nutritional regulation of glucagon-like peptide-1 secretion. J Physiol. 2009;587:27–32. 16. Kreymann B, Williams G, Ghatei M, Bloom S. Glucagon-like peptide-1 7-36: a physiological incretin in man. Lancet. 1987;330:1300–4. 17. Wang Y, Meng F, Zhong Y, Huang G, Li J. Discovery of a novel glucagon- like peptide (GCGL) and its receptor (GCGLR) in chickens: evidence for the existence of GCGL and GCGLR genes in nonmammalian vertebrates. Endocrinology. 2012;153:5247–60. 18. Bodnaruc AM, Prud D, Blanchet R, Giroux I. Nutritional modulation of endogenous glucagon-like peptide-1 secretion : a review. Nutr. Metab. (Lond). Nutrition & Metabolism; 2016;1:1–16. 19. Prigeon RL, Quddusi S, Paty B, D’Alessio D. a. Suppression of glucose production by GLP-1 independent of islet hormones: a novel extrapancreatic effect. Am J Physiol Endocrinol Metab. 2003;285:E701–7. 20. Schirra J, Kuwert P, Wank U, Leicht P, Arnold R, Göke B, et al. Differential effects of subcutaneous GLP-1 on gastric emptying, antroduodenal motility, and pancreatic function in men. Proc Assoc Am Physicians. 1997;109:84–97. 21. Baggio LL, Drucker DJ. Biology of incretins: GLP-1 and GIP. Gastroenterology. 2007;132:2131–57. 22. Bullock B, Heller R, Habener J. Tissue distribution of messenger ribonucleic acid encoding the rat glucagon-like peptide-1 receptor. Endocrinology. 1996;137:31–3. 23. Gupta NA, Mells J, Dunham RM, Grakoui A, Saxena NK, Anania FA. Glucagon- like Peptide-1 receptor (GLP-1R) is present on human hepatocytes and has a direct role in decreasing hepatic steatosis in vitro by modulating elements of the insulin signaling pathway. Hepatology. 2010;51:1584–92. 24. Liu WJ, Jin HY, Lee KA, Xie SH, Baek HS, Park TS. Neuroprotective effect of the glucagon-like peptide-1 receptor agonist, synthetic exendin-4, in streptozotocin-induced diabetic rats. Br J Pharmacol. 2011;164:1410–20. 25. Dunislawska A, Slawinska A, Stadnicka K, Bednarczyk M, Gulewicz P, Jozefiak D, et al. Synbiotics for broiler chickens—in vitro design and evaluation of the influence on host and selected microbiota populations following in Ovo delivery. PLoS One. 2017;12:e0168587. 26. Gulewicz P, Ciesiołka D, Frias J, Vidal-Valverde C, Frejnagel S, Trojanowska K, et al. Simple method of isolation and purification of alpha-galactosides from legumes. J Agric Food Chem. 2000;48:3120–3. Submit your next manuscript to BioMed Central 27. Bednarczyk M, Urbanowski M, Gulewicz P, Kasperczyk K, Maiorano G, Szwaczkowski T. Field and in vitro study on prebiotic effect of raffinose and we will help you at every step: family oligosaccharides in chickens. Bull Vet Inst Pulawy. 2011;55:465–9. • We accept pre-submission inquiries 28. Wettergren A, Schjoldager B, Mortensen PE, Myhre J, Christiansen J, Holst JJ. Truncated GLP-1 (proglucagon 78-107-amide) inhibits gastric and pancreatic � Our selector tool helps you to find the most relevant journal functions in man. Dig Dis Sci. 1993;38:665–73. � We provide round the clock customer support 29. Zhou J, Montrose-Rafizadeh C, Janczewski AM, Pineyro MA, Sollott SJ, Wang � Convenient online submission Y, et al. Glucagon-like peptide-1 does not mediate amylase release from AR42J cells. J Cell Physiol. 1999;181:470–8. � Thorough peer review 30. Sjodin L, Conlon TP. Effects of gastric inhibitory polypeptide on dispersed � Inclusion in PubMed and all major indexing services pancreatic acinar cells from the guinea pig. Acta Physiol Scand. 1984;122:79–84. � Maximum visibility for your research 31. Honda K. Glucagon-related peptides and the regulation of food intake in chickens. Anim Sci J. 2016;87:1090–8. Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Animal Science and Biotechnology Springer Journals

GLP1 and GIP are involved in the action of synbiotics in broiler chickens

Download PDF
9 pages

Loading next page...
 
/lp/springer-journals/glp1-and-gip-are-involved-in-the-action-of-synbiotics-in-broiler-qpzm0aAR3p

References (46)

Publisher
Springer Journals
Copyright
Copyright © 2018 by The Author(s).
Subject
Life Sciences; Agriculture; Biotechnology; Food Science; Animal Genetics and Genomics; Animal Physiology
eISSN
2049-1891
DOI
10.1186/s40104-017-0227-8
Publisher site
See Article on Publisher Site

Abstract

Background: In order to discover new strategies to replace antibiotics in the post-antibiotic era in meat-type chicken production, two new synbiotics were tested: (Lactobacillus salivarius IBB3154 plus galactooligosaccharide (Syn1) and Lactobacillus plantarum IBB3036 plus raffinose family oligosaccharides (Syn2). Methods: The synbiotics were administered via syringe, using a special automatic system, into the egg air chamber th 5 of Cobb 500 broiler chicks on the 12 day of egg incubation (2 mg of prebiotics + 10 cfu bacteria per egg). Hatched roosters (total 2,400) were reared on an experimental farm, kept in pens (75 animals per pen), with free access to feed and water. After 42 d animals were slaughtered. Blood serum, pancreas, duodenum and duodenum content were collected. Results: Syn2 increased trypsin activity by 2.5-fold in the pancreas and 1.5-fold in the duodenal content. In the duodenum content, Syn2 resulted in ca 30% elevation in lipase activity and 70% reduction in amylase activity. Syn1 and Syn2 strongly decreased expression of mRNA for GLP-1 and GIP in the duodenum and for GLP-1 receptors in the pancreas. Simultaneously, concentrations of the incretins significantly diminished in the blood serum (P < 0.05). The decreased expression of incretins coincides with changed activity of digestive enzymes in the pancreas and in the duodenal content. The results indicate that incretins are involved in the action of Syn1 and Syn2 or that they may even be their target. No changes were observed in key hormones regulating metabolism (insulin, glucagon, corticosterone, thyroid hormones, and leptin) or in metabolic indices (glucose, NEFA, triglycerides, cholesterol). Additionally, synbiotics did not cause significant changes in the activities of alanine and aspartate aminotransferases in broiler chickens. Simultaneously, the activity of alkaline phosphatase and gamma glutamyl transferase diminished after Syn2 and Syn1, respectively. Conclusion: The selected synbiotics may be used as in ovo additives for broiler chickens, and Syn2 seems to improve their potential digestive proteolytic and lipolytic ability. Our results suggest that synbiotics can be directly or indirectly involved in incretin secretion and reception. Keywords: GIP, GLP-1, Incretins, In ovo, Synbiotics Background poultry breeding to replace the usage of antibiotics as In recent years the administration of natural non-anti- growth promoters banned in some parts of the world, biotic and non-hormonal growth stimulators supporting strengthen health, improve production parameters and di- chicken health has been most intensively studied. Prebi- minish environmental pollution. Both the manner and otics and probiotics, either alone or in combination (syn- moment of addition of biologically active compounds biotics), are considered to be a helpful alternative in seem to be important to achieve the best effects. The in ovo technique applied in the present paper is a relatively new method of supplementation, which allows for the ap- * Correspondence: ewaprusz@up.poznan.pl; ewaprusz27@gmail.com plication of prebiotics or synbiotics in early developmental Department of Animal Physiology and Biochemistry, Poznan University of Life Sciences, Wolynska 35, 60-637 Poznan, Poland stages and enables the modulation of gastrointestinal tract Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 2 of 9 activity [1, 2]. Besides being an important location for bac- present paper studied the expression of mRNA for GIP terial settlement and enzymatic digestion of feed, the in- and GLP-1 in the duodenum, for their receptors in the testine is also a source of incretins which play a significant pancreas, and the levels of both incretins in the blood role, among others, in the regulation of pancreatic serum. Previously, we have demonstrated the effect on function. the enzymatic activity of the pancreas of in ovo adminis- Synbiotics may contribute to the modification of the tered synbiotics composed of inulin plus Lactococcus gut activity. Some results indicate that synbiotics can lactis subsp. lactis, and of Bi tos plus Lactococcus lactis affect incretins in humans and rodents [3–5]. Moreover, subsp. cremoris [1]. In the present study, two synbiotics previous research has shown that synbiotics are able to were chosen (Syn1 – Lactobacillus salivarius IBB3154 modify the entire spectrum of phenotypic features, e.g. plus galactooligosaccharide [Bi tos]; Syn2 – Lactobacillus growth, intestinal tissue structure, pancreas potency, mo- plantarum IBB3036 plus raffinose family oligosaccharides lecular changes in liver, and also spleen, tonsils and caecal [RFO]) and, besides the enzymatic activity of the pancreas, bacterial populations and caecal fermentation [6, 7]. There analyses also focused on enzymatic activity in the duo- are no reports related to the impact of synbiotics on incre- denum content. Moreover, a wide panel of hormones tins in poultry. Therefore, in birds treated with synbiotics, regulating metabolism (insulin, glucagon, corticosterone, we decided to study simultaneously the activity of di- leptin, and thyroid hormones), as well as a broad gestive enzymes in the pancreas and duodenum, and spectrum of biochemical indices (glucose, non-esterified the synthesis, secretion and reception of two important fatty acids, triglycerides, total and free cholesterol, total incretins –– gastric inhibitory polypeptide or glucose- proteins and albumins) and diagnostic enzymes (alanine dependent insulinotropic peptide (GIP) and glucagon- aminotransferase, aspartate aminotransferase, alkaline like peptide 1 (GLP-1) –– exerting stimulatory action phosphatase, and gamma glutamyl transferase) were an- on insulin secretion. GIP, described by Brown et al. [8], alyzed. All the analyses allowed us to answer the question is a 42-amino acid compound synthesized and secreted of whether the chosen in ovo implemented synbiotics act by K cells in the entire small intestine. The biological long-term and whether they modulate the hormonal and activity of GIP is regulated via gastric inhibitory peptide enzymatic activities of the digestive tract. receptors (GIP-R). GIP-R in humans and rodents are expressed in various tissues and organs, such as the Methods brain, pancreas, small intestine, stomach, adipose tis- This study was undertaken with the approval of the sue, pituitary, heart, spleen, thymus, lung, kidney, and Polish Local Ethical Commission (Bydgoszcz, Poland, thyroid [9–11]. Among the various functions of GIP the No. 36/2012). following can be mentioned: reduction of gastric acid secretion [9]; stimulation of insulin secretion [9, 12]; Experimental design control of food intake as a negative regulator of NPY Selection of synbiotics was performed based on the in [9]; stimulation of lipogenesis in fat tissue [13]; and a vitro and in vivo experiments described by Dunislawska et positive effect on bone formation and downregulation al. [25]. Also, detailed procedures for the experimental of bone resorption [14]. Unfortunately, the biological setup and rearing conditions were presented previously by functions of GIP in chicken are still insufficiently Dunislawska et al. [25]. In brief, 5,850 eggs (approx. 65 g understood. Equally important for the regulation of the each) from Cobb500FF hens (42-week-old) were incu- body’s metabolism is another incretin – glucagon-like bated at a commercial hatchery. On d 12, eggs were ran- peptide 1 (GLP-1). GLP-1 is secreted by L-cells located domly allotted to 3 groups and injected with 0.2 mL of mainly in the duodenum, ileum, and colon [15]. There either saline or synbiotics. The control group received are two biologically active forms of GLP-1: GLP-1-(7–37) pure saline (0.9%), whereas experimental groups received and GLP-1-(7–36)NH , and both derive from the proglu- synbiotics: Syn1 – Lactobacillus salivarius IBB3154 plus cagon molecule by post-translational processing [16–18]. galactooligosaccharide [Bi tos, Clasado Biosciences, Ltd., GLP-1 inhibits gastric emptying [9], glucose production in Jersey, UK]; Syn2 – Lactobacillus plantarum IBB3036 plus the liver [19], peristaltic movements, and pancreas raffinose family oligosaccharides [RFO – combination of functions [18, 20], and decreases appetite [21]. GLP-1R 6.1% of sucrose, 9.4% of raffinose, 65.2% of stachyose, 18.0% (glucagon-like peptide 1 receptor) belongs to the group of verbascose, and 1.3%.of other saccharides] [26, 27]. The of G-protein coupled receptors and is expressed in vari- prebiotic component was given at a dose of 2 mg and ous tissues, such as the central nervous system, pancre- bacteria at a quantity of 10 cfu per egg. atic islets, pancreas, stomach, intestine, liver, and fat For further investigations only those roosters were tissue [22–24]. qualified which had hatched from eggs previously in ovo Considering that the final action of hormones is the injected into air chamber eggs (total 2400). The roosters result of their synthesis, secretion and reception, the were reared on a commercial farm registered also as an Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 3 of 9 experimental farm (Piast, Olszowa, Poland). Birds from kit, RIA – Cis International), total triiodothyronine control and experimental groups were kept on the floor (Triiodothyronine (T3) kit, RIA – Cis International), in pens (75 animals per pen) and had free access to feed free triiodothyronine (Free Triiodothyronine (fT3) kit, and water. Body weight, feed consumption, feed conver- RIA – Cis International), corticosterone (Corticosterone sion efficiency and mortality were measured. The rearing ELISA kit – Enzo Life Sci., Warsaw, Poland), leptin data from the experiment are described by Dunislawska (Multi-Species Leptin RIA, Millipore, USA), incretins GIP et al. [25]. For the investigations described in the paper, (Gastric Inhibitory Polypeptide) (SunRed, Jufengyuan 42-day-old birds randomly chosen from the pens were Road, Baoshan, District, Shanghai), and GLP-1 (Glucagon- used. like Polypeptide-1) (Phoenix Pharmaceuticals Inc., USA). In order to verify the specificity of binding of kits, serum Blood collection dilution curve was performed. For this purpose serum On d 42 birds were slaughtered, the blood was collected from five randomly chickens was diluted 2×, 4× and 10 and then the blood serum obtained. Immediately after times in Elisa/RIA buffer, and next concentrations of in- the blood collection, pancreases and duodenum were ex- vestigated hormones were determined in all dilutions. cised. Also, the duodenum content was taken for ana- lyses. Next, the whole material was frozen and kept for Enzyme activity in the blood serum further investigations at −80 °C. The activity of diagnostic enzymes and concentration of main blood biochemical parameters were analyzed in the Pancreatic enzyme activity blood serum. The activities of alanine (ALT; GPT) and The activity of pancreatic enzymes was measured as aspartate (AST; GOT) aminotransferases as well as alka- described previously [1]. line phosphatase (ALP) and gamma glutamyl transpepti- In brief, after being weighed pancreases were dase (GGT) were estimated using commercial kits (Pointe homogenized in TBS buffer on ice and 20% homoge- Scientific, USA). nates were centrifuged (10,000×g for 16 min.). Activ- ities of amylase, lipase, and trypsin were measured Biochemical parameters in the blood serum using appropriate commercial colorimetric tests The parameters of carbohydrate (glucose), protein (total (Biovision, USA). For measurement of lipase activity, proteins and albumins), and lipid (triglycerides, free fatty homogenates were diluted 100× using TBS buffer, acids, cholesterol) metabolism were estimated: glucose while for measurement of amylase activity these were was measured using a Glucose Assay Kit – Pointe Scien- diluted 1,000X with commercially supplied buffer. In tific (USA), total protein and albumins were estimated the case of trypsin measurement, diluted supernatants using a Total Proteins Kit (Alpha Diagnostics, Poland) (100× with TBS) were incubated with 1% enterokinase and Total Albumins Kit (Alpha Diagnostics, Poland), tri- (prepared in 0.1 mol/L Tris-HCl with 0.1 mol/L CaCl ; glycerides were measured using a kit from Pointe Scien- pH 7.2). The temperatures for measurement of enzyme tific (USA) (Alpha Diagnostics, Poland), free fatty acids activities were as follows: for amylase and trypsin 25 °C, were estimated with a kit from Wako Chemicals (USA), and for lipase 37 °C. Activities were measured as the and cholesterol was measured with a Cholesterol/ amount of product formed during reactions (glycerol, Cholesteryl Ester Quantitation Kit – BioVision (USA). nitrophenol, p-nitroaniline) and these are expressed in the manuscript as % of control. Real-Time PCR To determine the activity of the lipase, amylase and Determination of incretins (GIP; GLP-1) and their recep- trypsin in the duodenal content, 250 μL of PBS was tors (GIP-R; GLP-1R) mRNA and incretins serum con- added to 100 mg of content, the mixture was homoge- centration is described below. Isolation of total RNA nized on ice and centrifuged (10,000×g for 16 min.). The was performed using Tripure reagent (Roche, Germany) activity of enzymes was measured using the commercial according to the manufacturer’s instructions. The effi- kits mentioned above. ciency of isolation and the quality of isolated RNA were determined using NanoDrop 1000. Additionally, the in- Hormonal profile tegrity of RNA was determined by electrophoresis in 1% The concentrations of blood serum hormones involved agarose gel. cDNA was synthesized from 1 μg of total in the regulation of feed intake and catabolic/anabolic RNA using a high-capacity cDNA reverse transcription pathways and carbohydrate/lipid/protein turnover were kit (Thermo Fisher Scientific). Moreover, to exclude con- investigated in the blood serum as follows using commer- tamination of genomic DNA, we performed all RT-PCRs cial RIA and EIA kits: insulin (Insulin RIA kit, Millipore, in parallel without added RT and detected no signals. USA), total thyroxine (Thyroxine (T4) kit, RIA – Cis Primers for reactions were designed using Primer- International), free thyroxine (Free Thyroxine (fT4) BLAST (Primers sequences are presented in Table 1). Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 4 of 9 Real-Time PCR was performed using QuantStudio 12 K Flex™ Real-Time PCR and Fast SYBR Green Master Mix (Life Technologies, Grand Island, NY, USA). Amplification involved one cycle at 95 °C for 1 min for initial denatur- ation and then 45 cycles consisting of denaturation (95 °C for 3 s) and annealing (62 °C for 30 s). Detection of the fluorescent product was set at the last step of each cycle. To determine the specificity of amplification, analyses of product melting were performed after each amplification (0.1 °C/s increment from 65 °C to 95 °C, with fluorescence collection at 0.1 °C intervals). Relative gene expression was evaluated by Delta Delta CT (ΔΔCT) with GAPDH as a reference. Statistical analysis Statistical analyses were performed as previously de- scribed [1]. In brief, all data were analyzed using one- way ANOVA followed by the Duncan’s multiple range test. Data are presented as means ±SEM, (n = 8 per group) and P < 0.05 was considered statistically signifi- cant. Statistical significance compared to controls was marked * P <0.05, ** P <0.01. Results Synbiotics modulate GLP-1/GLP-1R and GIP/GIP-R mRNA expression levels and decrease concentrations of GLP-1 Fig. 1 GLP-1 and GLP-1R mRNA expression in chicken duodenum and GIP in the blood serum and pancreas. Results are means ± SEM (n = 8). *P < 0.05, **P < 0.01 In the experiment, the effect of synbiotics on the expres- compared with control sion of mRNA for GLP-1, GIP and their receptors mRNA in chicken duodenum and pancreas was stated. In the duodenum, downregulation of GLP-1 mRNA level trypsin activity in birds which had been administered (Fig. 1a) was observed after Syn1 (P < 0.05) and Syn2 Syn2. On the other hand, in the duodenal content activ- (P < 0.05). Similar results were obtained for GIP.Syn1 ity of trypsin and lipase were noticeably heightened after (P < 0.01) and Syn2 (P < 0.01) decreased its mRNA ex- synbiotics with significant changes observed after Syn2. pression (Fig. 2a). Also, we investigated the effects of In turn, amylase activity in the duodenum was less than synbiotics on GIP-R and GLP-1R mRNA in the chicken half that of the control value and again a statistically pancreas. In synbiotic groups, we found lower mRNA significant change was observed only for Syn2. All levels of GLP-1R compared to the control group (Fig. 1b; alterations are included in Table 2. P < 0.05). Statistically significant differences were not ob- served for GIP-R mRNA in the pancreas (Fig. 2b). Simul- Effect of synbiotics on biochemical parameters and taneously, the effect of the synbiotics on serum levels of enzyme activity in blood serum GIP and GLP-1 was examined and, using immunoenzy- The concentrations of other blood parameters including matic assays, lower concentrations of the both incretins hormones are presented in Table 3. Besides the changes were found. The effect of synbiotics on GLP-1 concentra- noticed for incretins and their receptors and for the ac- tion (P < 0.01) was more pronounced; however, statistically tivity of digestive enzymes, no significant changes were significant changes were also observed in GIP levels stated for the measured hormones or biochemical com- (P < 0.05) (Fig. 3). pounds. The levels of insulin, glucagon, corticosterone, thyroid hormones, and leptin were similar in both con- Synbiotics modulate pancreatic enzyme activity trol and experimental groups. Moreover, the insulin/ The decreased expression of incretins coincided with glucagon molar ratio was not evidently changed and no changed activity of digestive enzymes in the pancreas significant alterations in metabolic parameters were and in the duodenal content. The activity of all investi- shown. The levels of serum glucose, non-esterified fatty gated enzymes in the pancreas was elevated; however, a acids, triglycerides, cholesterol, total protein and albu- statistically significant difference was observed only for mins did not change. The synbiotics used did not cause Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 5 of 9 Discussion The heightened activity of all enzymes in the pancreases may be ascribed to their greater stored amount in exo- crine cells. Thus, by elevating trypsin activity the synbio- tics prepared organisms especially well to digest proteins. The most effective was Syn2, which increased 2.5-fold the “potential” activity of pancreases and 1.5-fold trypsin ac- tivity in the content of duodenum. Also, none of the in ovo injected synbiotics decreased the amylolytic or lipo- lytic potential of pancreases. The changes observed after in ovo administration of synbiotics are not unusual, be- cause alterations in the total activity of digestive enzymes in the pancreas had been observed previously by Pruszynska-Oszmalek et al. [1]. In that paper, in ovo injected synbiotics (inulin + Lactococcus lactis spp. lactis; Bi tos + Lactococcus lactis subsp. cremoris) elevated the amylolytic and lipolytic activity of the pancreas at the end of the rearing period, and synbiotics based on Bi tos also elevated trypsin activity. In the present paper, we con- firmed that synbiotics injected early during development may exert long-lasting effects on pancreatic enzymes. Additionally, the present study also covers the activity of the main pancreatic enzymes in the duodenal content, which reflects their ability to digest three main groups of nutrients: proteins, lipids and carbohydrates. Elevated ac- tivities of trypsin and lipase indicate that Syn2 may im- prove the process of protein and lipid digestion. However, Fig. 2 GIP and GIP-R mRNA expression in chicken duodenum and the amylolytic activity in the intestine was strongly de- pancreas. Results are means ± SEM (n = 8). *P < 0.05, **P <0.01 creased after synbiotic treatment. This phenomenon was compared with control probably the result of a lower level of secretion of amylase to the duodenum. It is possible that, as a result, the con- bigger changes in the activities of two diagnostic en- centration of glucose in the duodenum content was low- zymes: alanine and aspartate aminotransferases. How- ered. In comparison to control birds, appropriate averages ever, the activity of ALP and GGT markers was were 88.7% and 90.4% after treatment with Syn1 and modified. Alkaline phosphatase was lower after synbio- Syn2, respectively; both changes were statistically signifi- tics; however, a statistically significant difference was cant at P < 0.05. This, in turn, was reflected in a lower se- observed only for Syn2. The activity of gamma glutamyl cretion of incretins to the blood. This could offer an transferase was also lower after synbiotics but, in turn, explanation for the parallel decrease in amylase activity in a statistically significant change was observed after the gastrointestinal tract, diminished expression of mRNA Syn1 administration (Table 4). for incretins and their lowered concentration in the blood ab Fig. 3 GLP-1 and GIP concentrations in blood serum. Results are means ± SEM (n = 8). *P < 0.05, **P < 0.01 compared with control Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 6 of 9 Table 1 Polymerase chain reaction primer sequences and product size Genes Forward primer (5′→3′) Reverse primer (5′→3′) Product Size, bp GLP-1 CCAAGCGTCATTCTGAATTTG TGACCTTCCAAATAAGAGGTGATA 76 GIP CGCAGTGAGTGACCAAAGC TAGGAGCCATGCAAGGAAGT 67 GLP-1R GTGTACCGGTTCTGCACCTC GGGCAGAGTCGAGTTCTCCT 60 GIP-R GCGTTACCTCTACGAGAACGA GCGGATGATCCACCACAC 70 GAPDH GTGAAAGTCGGAGTCAACGG ACAGTGCCCTTGAAGTGTCC 170 serum. Additionally, the increase in trypsin and lipase ac- highly diminished concentration of GLP-1 and a signifi- tivity could be connected with the lower levels of GLP-1 cantly reduced level of GIP in the blood serum. Simul- after synbiotic application. Intravenous infusion of GLP-1 taneously, expression of mRNA for both receptors in reduced trypsin and lipase activity in men [28]. Simultan- the pancreases was lower and for GLP-1R this was sta- eously, none of the effects of synbiotics on amylase con- tistically significant. This situation should not promote tent in pancreas could be explained by the fact that GLP-1 insulin secretion by meal via incretins. However, no sig- does not mediate amylase release from a model of pancre- nificant changes were observed either for insulin level, atic cells (AR42J), as observed previously [29]. Similarly, which was not lower in the blood serum after synbio- no effect of GIP on amylase release from dispersed pan- tics, or for other investigated hormones: glucagon, cor- creatic acinar cells was noted by Sjodin and Conlon [30]. ticosterone, leptin. Also, metabolic parameters, glucose, On the other hand, it is difficult to explain the strongly di- non-esterified acids, triglycerides, cholesterol, total pro- minished amylolytic activity in the duodenum content teins and albumins in the blood serum were unchanged from the above observations. It seems to be the case that following in ovo treatment with synbiotics. Thus, the secretion of amylase to the duodenum is also controlled alterations in the activity of pancreatic enzymes and in by other mechanisms. Nevertheless, incretins appear to be incretins did not translate into changes in additional an important element in the duodeno-pancreatic and parameters, such as other hormones and biochemical duodeno-brain loops. Besides the continuously explored indices. Also, in parallel studies within this experiment new functions of incretins, they are important for such a lack of synbiotic-induced changes on breeding parame- key processes as insulin secretion and appetite regulation. ters was observed, as calculated for the whole period from Honda reviewed and discussed a role of some incretins in days 1 to 41 [25]. Neither body weight gain nor feed in- food intake regulation [31]. Turton et al. described the take, feed conversion efficiency or mortality differed presence of GLP-1 and its receptors in the hypothalamus significantly between control and experimental groups and the suppressive effect of GLP-1 given ICV on food in- treated with synbiotics. take in rats [32]. Also, the same effect has been noted in In the present study, a multilateral network of connec- chicken [33]. The two incretins, GLP-1 and GIP, are se- tions was observed, involving the synbiotic – incretins – creted by L and K cells of the intestine, respectively. These pancreatic digestive potential – activity of enzymes in cells are believed to be sensors of the nutrient ingredients duodenum. Synbiotics given in ovo initiate changes and passing through the intestine [15]. Of these, glucose are the first link in the chain of events finally exerting strongly stimulates both GLP-1 release [15] and GIP long-lasting effects. The succession of subsequent secretion. changes can be differently interpreted. On the one side, In the present paper, the mRNA transcripts of both the altered microbiome could in no way reduce the amy- investigated incretins were strongly reduced in the duo- lolytic activity in duodenum by restriction of amylase se- denum and these changes were accompanied by a very cretion. In turn, the slowed down digestion of complex Table 2 Changes in amylase, lipase and trypsin activities in pancreas and duodenum content after in ovo synbiotic treatment Enzymes Determination location Control Synbiotic 1 Synbiotic 2 Trypsin Pancreas 100.0 ± 38.52 191.49 ± 25.45 246.49* ± 25.13 Duodenum content 100.0 ± 18.39 93.99 ± 27.35 150.69* ± 14.55 Lipase Pancreas 100.0 ± 27.43 158.43 ± 30.94 128.96 ± 32.98 Duodenum content 100.0 ± 6.41 110.58 ± 17.86 127.43* ± 10.66 Amylase Pancreas 100.0 ± 27.03 117.94 ± 18.46 116.64 ± 12.79 Duodenum content 100.0 ± 26.21 48.07 ± 20.78 30.05* ± 7.63 Differences are expressed as % of control. Results are the mean ± SEM (n = 8). *P < 0.05 Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 7 of 9 Table 3 Hormone and metabolic profiles in blood serum 1 inhibits food intake in neonatal chicks [33, 35]. Add- itionally, administration of GLP-1 increased cortico- Items Control Synbiotic 1 Synbiotic 2 sterone in blood serum [35]. In contrast, in our studies Insulin, nmol/L 0.184 ± 0.027 0.167 ± 0.032 0.251 ± 0.058 no corticosterone changes were stated. Furthermore, the Glucagon, nmol/L 0.088 ± 0.010 0.091 ± 0.019 0.087 ± 0.020 observed alterations in the pancreatic duodenal axis and Insulin/Glucagon, 2.592 ± 0.812 2.372 ± 0.699 3.459 ± 0.770 expression of incretins did not transpose onto breeding mol/mol parameters. The organisms of the birds probably Corticosterone, ng/mL 96.21 ± 3.10 101.7 ± 11.34 97.62 ± 6.01 adapted themselves to a new physiological situation by Leptin, ng/mL 0.170 ± 0.047 0.139 ± 0.012 0.161 ± 0.019 switching on/off other mechanisms. On the other hand, Total T4, ng/mL 19.35 ± 1.59 16.75 ± 0.75 16.99 ± 1.08 it is significant that the synbiotics did not lead to a de- Free T4, pg/mL 8.827 ± 1.703 10.350 ± 1.071 8.575 ± 1.110 terioration in rearing parameters. Together with analyzing enzymatic, hormonal, and Total T3, ng/mL 0.774 ± 0.150 0.971 ± 0.227 0.761 ± 0.164 biochemical indices linked directly to body growth and Free T3, pg/mL 1.847 ± 0.126 2.270 ± 0.272 1.684 ± 0.132 metabolism, diagnostic enzyme activity in the blood Glucose, mg/dL 206.40 ± 1.51 201.91 ± 2.53 198.48 ± 5.34 serum was also measured to estimate the overall health NEFA, mmol/L 0.56 ± 0.02 0.68 ± 0.03 0.56 ± 0.02 of broilers. ALP and GGT were used as markers of bone Triglycerides, mg/dL 115.61 ± 11.19 124.20 ± 8.71 106.62 ± 8.36 diseases (ALP) and liver and bile duct diseases (GGT Total cholesterol, mg/dL 121.53 ± 2.28 117.95 ± 9.46 119.28 ± 6.57 and ALP). While not statistically heightened, in two cases lower values of ALP (Syn2) and GGT (Syn1) indi- Free cholesterol, mg/dL 10.06 ± 0.97 10.57 ± 3.32 9.53 ± 1.66 cated a good or even improved health status for Results are means ± SEM (n =8) synbiotic-treated birds. Other health markers are ami- carbohydrates and smaller amount of glucose might notransferases. Their activity increases in disorders lower expression of incretins in the duodenum and their such as liver damage. The activity of aminotransferases level in the blood. On the other hand, alterations within in the blood serum was not significantly changed, incretins could precede changes in enzyme activity in which indicates no negative action from the used syn- the pancreas and in the duodenum. Whatever the se- biotics on the health status of birds. Also, Pruszynska- quence of events, it is undeniable that the activities of Oszmalek et al. [1] stated that in ovo administered syn- digestive enzymes in the pancreas and in the duodenum biotics (inulin plus Lactococcus lactis subsp. lactis; are associated with synbiotic in ovo delivery, incretin ex- Bi tos plus Lactococcus lactis subsp. cremoris)had no pression and their concentration in the blood. It is an negative effect on the activity of alanine and aspartate open question as to whether the noticed effect on both aminotransferases. However, on the contrary, the activity incretin and enzyme activity is a general property of of both aminotransferases was diminished. Also, after various synbiotics or is just characteristic for those treatment with prebiotic Bi tos alanine aminotransferase chosen. These results showed that synbiotics are able to activity was significantly lower. The activity of alanine and change trypsin, amylase and lipase activity in the chicken aspartate aminotransferases has also been measured by duodenum. Previous studies performed on humans and other authors. Salarmoini and Fooladi [36] investigated an rodents have suggested that modulation of gut micro- addition of probiotic L. acidophilus and did not note any biota by synbiotics or probiotics can affect incretin ex- elevation of the activities of aminotransferases and so no pression [4, 34]. However, our results are the first to link negative consequences of the use of these bacteria. Also, a few elements: in ovo technique, synbiotics, incretins Saccharomyces cerevisiae used as probiotics which had a and digestive enzymes in broiler chickens. A search of beneficial effect on body weight and feed consumption the literature provides limited information about the role efficiency in chickens did not elevate the activities of of incretins in chicken physiology. It had been shown aminotransferases [37]. Analyzing and summarizing previously that intracerebroventricular injection of GLP- data obtained on the influence of the two investigated Table 4 Activity of transferases and alkaline phosphatase in the blood serum Target, IU/L Control Synbiotic 1 Synbiotic 2 Alanine aminotransferase (ALT) 7.04 ± 1.49 6.63 ± 0.90 5.53 ± 0.75 Aspartate aminotransferase (AST) 68.78 ± 6.89 76.73 ± 3.86 67.98 ± 5.54 Alkaline 519.6 ± 34.96 394.9 ± 72.07 355.5* ± 50.26 Phosphatase (ALP) Gamma glutamyl transferase (GGT) 4.423 ± 0.807 2.371* ± 0.507 2.844 ± 0.408 Results are means ± SEM (n = 8). *P < 0.05, compared with control Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 8 of 9 synbiotics (Lb. salivarius IBB3154 plus galacto- (Lb. salivarius IBB3154 plus galactooligosaccharide – Bi tos); Syn2: synbiotic 2 (Lb. plantarum IBB3036 plus RFO) oligosaccharide [Bi tos] and Lb. plantarum IBB3036 plus raffinose family oligosaccharides [RFO]), it seems Acknowledgments to be obvious that they may be used as in ovo additives The authors would like to thank Jacek Bardowski and Roman Krzysztof th Górecki from IBB PAS in Warsaw for providing bacterial strains. in chickens without negative, up to the 6 week, effects on health and basic production parameters. Simultan- Funding eously, they must affect the pancreas, evoking significant This study was supported by the European Union Seventh Framework Programme for research, technological development and demonstration as alterations in the activity of gastrointestinal tract digestive part of the ECO-FCE project under grant agreement No. 311794. Additionally, enzymes and in the expression of incretins. So, they influ- this scientific work was partly funded by the Ministry of Science and Higher ence an important function of the organism, which is Education from funds for science in the years 2015–2016 allocated to an international co-financed project (no W171.PR/2015). proper food digestion, and they downregulate (control) expression of incretins. As mentioned above, synbiotics Availability of data and materials and prebiotics can modulate intestinal microflora. Based All data generated or analyzed during this study are included in this article. on these findings, literature data indicate a few possible Authors ‘contributions pathways by which probiotics and synbiotics can affect se- EPO, PM, PAK, designed the study, obtained the data and wrote the cretion and expression of incretins in K- and L-cells. The manuscript. LN, MB, DJ, TSz, MS contributed to the study design, edited, most convincing seems to be the effect of microbiomes on supported and critically revised the manuscript and contributed to the discussion. MSass, NL, DCh, KS obtained the data, collected and analyzed short chain fatty acid (SCFA) concentrations in the intes- the data and revised the manuscript. All authors have given final approval tine. SCFA are produced during bacterial fermentation of to the current version to be published. dietary fiber or of non-absorbed carbohydrate. It was Ethics approval and consent to participate shown in the literature that there exists a link between This study was undertaken with the approval of the Polish Local Ethical fiber, gut microbiota and K, L-cells acting via GPR41, Commission (Bydgoszcz, Poland, No.36/2012). GPR43, FFAR2 and FFAR3. Moreover, a possible role of Consent for publication FFAR2 in GLP-1 secretion was suggested by the discover- Not applicable 2+ ies that SCFA temporary triggered Ca in primary L-cells and mice lacking ffar2or ffar3 exhibited reduced SCFA- Competing interests The authors declare that they have no competing interests. triggered GLP-1 secretion in vitro [38, 39]. The mecha- nisms which combine the incretins with the exocrine pan- Author details creas and digestion in the intestine of chickens require Department of Animal Physiology and Biochemistry, Poznan University of Life Sciences, Wolynska 35, 60-637 Poznan, Poland. Department of Animal further investigation and the fact should be considered Nutrition and Feed Management, Poznan University of Life Sciences, that the results obtained for specific synbiotics in broiler Wolynska 33, 60-637 Poznan, Poland. Department of Genetics and Animal chickens should not be generalized to other synbiotics, Breeding, Poznan University of Life Sciences, Wolynska 33, 60-637 Poznan, Poland. Department of Animal Biochemistry and Biotechnology, UTP other populations of chicken as well as other poultry and University of Science and Technology, 85-084 Bydgoszcz, Poland. livestock species and, of course, humans. Received: 16 June 2017 Accepted: 22 December 2017 Conclusions In summary, we found that in ovo injection of two differ- References 1. Pruszynska-Oszmalek E, Kolodziejski PA, Stadnicka K, Sassek M, Chalupka D, ent synbiotics [Lb. salivarius plus galactooligosaccharide Kuston B, et al. In ovo injection of prebiotics and synbiotics affects the digestive (Syn1) and Lb. plantarum plus RFO (Syn2)] leads to a potency of the pancreas in growing chickens. Poult Sci. 2015;94:1909–16. lowering of the level of incretins (GLP-1 and GIP) in 2. Bednarczyk M, Stadnicka K, Kozłowska I, Abiuso C, Tavaniello S, Dankowiakowska A, et al. Influence of different prebiotics and mode of their blood serum. Furthermore, these two synbiotics downreg- administration on broiler chicken performance. Animal. 2016;10:1271–9. ulated GLP-1 and GIP mRNA expression in the duode- 3. Sáez-Lara MJ, Robles-Sanchez C, Ruiz-Ojeda FJ, Plaza-Diaz J, Gil A. Effects of num and GLP-1R in the pancreas. Moreover, Syn2 probiotics and synbiotics on obesity, insulin resistance syndrome, type 2 diabetes and non-alcoholic fatty liver disease: a review of human clinical increased trypsin and lipase activities in the duodenum trials. Int J Mol Sci. 2016;17:1–15. content, simultaneously decreasing amylase activity. Such 4. Cani PD, Dewever C, Delzenne NM. Inulin-type fructans modulate activity can promote digestion of proteins and lipids. Our gastrointestinal peptides involved in appetite regulation (glucagon-like peptide-1 and ghrelin) in rats. Br J Nutr. 2004;92:521–6. results suggest that synbiotics can be directly or indirectly 5. Nikbakht E, Khalesi S, Singh I, Williams LT, West NP, Colson N. Effect of involved in incretin secretion and reception. probiotics and synbiotics on blood glucose: a systematic review and meta- analysis of controlled trials. Eur. J. Nutr. Springer Berlin Heidelberg; 2016;1–12. Abbreviations https://doi.org/10.1007/s00394-016-1300-3. ALP: alkaline phosphatase; ALT: alanine aminotransferase; AST: aspartate 6. Awad WA, Ghareeb K, Abdel-Raheem S, Bohm J. Effects of dietary inclusion aminotransferase; GGT: gamma glutamyl transferase; GIP: gastric inhibitory of probiotic and synbiotic on growth performance, organ weights, and polypeptide or glucose-dependent insulinotropic peptide; GIP-R: gastric intestinal histomorphology of broiler chickens. Poult Sci. 2009;88:49–56. inhibitory peptide receptor; GLP-1: glucagon like peptide 1; GLP-1R: glucagon 7. Mookiah S, Sieo CC, Ramasamy K, Abdullah N, Ho YW. Effects of dietary like peptide 1 receptor; RFO: raffinose family oligosaccharides; Syn1: synbiotic 1 prebiotics, probiotic and synbiotics on performance, caecal bacterial Kolodziejski et al. Journal of Animal Science and Biotechnology (2018) 9:13 Page 9 of 9 populations and caecal fermentation concentrations of broiler chickens. J 32. Turton M, O’Shea D, Gunn I, Beak S, Edwards C, Meeran K, et al. A role for Sci Food Agric. 2014;94:341–8. glucagon-like peptide-1 in the central regulation of feeding. Nature. 8. Brown J, Dryburgh J, Ross S, Dupre J. Identification and actions of gastric 1996;379:69–72. inhibitory polypeptide. Recent Prog Horm Res. 1975;31:487–532. 33. Furuse M, Matsumoto M, Okumura JI, Sugahara K, Hasegawa S. Intracerebroventricular injection of mammalian and chicken glucagon-like 9. Seino Y, Fukushima M, Yabe D. GIP and GLP-1, the two incretin hormones: peptide-1 inhibits food intake of the neonatal chick. Brain Res Elsevier. similarities and differences. J Diabetes Investig. 2010;1:8–23. 1997;755:167–9. 10. Rudovich N, Kaiser S, Engeli S, Osterhoff M, Gögebakan Ö, Bluher M, et al. 34. Delzenne NM, Cani PD, Daubioul C, Neyrinck AM. Impact of inulin and GIP receptor mRNA expression in different fat tissue depots in oligofructose on gastrointestinal peptides. Br J Nutr. 2005;93(Suppl 1):S157–61. postmenopausal non-diabetic women. Regul Pept. 2007;142:138–45. 35. Tachibana T, Sato M, Oikawa D, Furuse M. Involvement of CRF on the 11. Saxena R, Hivert M, Langenberg C, Tanaka T, Pankow J, Vollenweider P, et al. anorexic effect of GLP-1 in layer chicks. Comp. Biochem. Physiol. - a Mol. Genetic variation in GIPR influences the glucose and insulin responses to an Integr. Physiol. 2006;143:112–7. oral glucose challenge. Nat Genet. 2010;42:142–8. 36. Salarmoini M, Fooladi MH. Efficacy of lactobacillus acidophilus as probiotic 12. Preitner F, Ibberson M, Franklin I, Binnert C, Pende M, Gjinovci A, et al. to improve broiler chicks performance. J Agric Sci Technol. 2011;13:165–72. Gluco-incretins control insulin secretion at multiple levels as revealed in 37. Shareef A, Al-Dabbagh A. Effect of probiotic (Saccharomyces Cerevisiae) on mice lacking GLP-1 and GIP receptors. J Clin Invest. 2004;113:635–45. performance of broiler chicks. Iraqi. J Vet Sci. 2009;23:23–9. 13. Baba ASH, Harper JMM, Buttery PJ. Effects of gastric inhibitory polypeptide, 38. Ezcurra M, Reimann F, Gribble FM, Emery E. Molecular mechanisms of somatostatin and epidermal growth factor on lipogenesis in ovine adipose incretin hormone secretion. Curr Opin Pharmacol Elsevier Ltd. 2013;13:922–7. explants. Comp. Biochem. Physiol. - B Biochem. Mol Biol. 2000;127:173–82. 39. Tolhurst G, Heffron H, Lam YS, Parker HE, Habib AM, Diakogiannaki E, et al. 14. Henriksen DB, Alexandersen P, Bjarnason NH, Vilsbøll T, Hartmann B, Short-chain fatty acids stimulate glucagon-like peptide-1 secretion via the Henriksen EEG, et al. Role of gastrointestinal hormones in postprandial G-protein-coupled receptor FFAR2. Diabetes. 2012;61:364–71. reduction of bone resorption. J Bone Miner Res. 2003;18:2180–9. 15. Tolhurst G, Reimann F, Gribble FM. Nutritional regulation of glucagon-like peptide-1 secretion. J Physiol. 2009;587:27–32. 16. Kreymann B, Williams G, Ghatei M, Bloom S. Glucagon-like peptide-1 7-36: a physiological incretin in man. Lancet. 1987;330:1300–4. 17. Wang Y, Meng F, Zhong Y, Huang G, Li J. Discovery of a novel glucagon- like peptide (GCGL) and its receptor (GCGLR) in chickens: evidence for the existence of GCGL and GCGLR genes in nonmammalian vertebrates. Endocrinology. 2012;153:5247–60. 18. Bodnaruc AM, Prud D, Blanchet R, Giroux I. Nutritional modulation of endogenous glucagon-like peptide-1 secretion : a review. Nutr. Metab. (Lond). Nutrition & Metabolism; 2016;1:1–16. 19. Prigeon RL, Quddusi S, Paty B, D’Alessio D. a. Suppression of glucose production by GLP-1 independent of islet hormones: a novel extrapancreatic effect. Am J Physiol Endocrinol Metab. 2003;285:E701–7. 20. Schirra J, Kuwert P, Wank U, Leicht P, Arnold R, Göke B, et al. Differential effects of subcutaneous GLP-1 on gastric emptying, antroduodenal motility, and pancreatic function in men. Proc Assoc Am Physicians. 1997;109:84–97. 21. Baggio LL, Drucker DJ. Biology of incretins: GLP-1 and GIP. Gastroenterology. 2007;132:2131–57. 22. Bullock B, Heller R, Habener J. Tissue distribution of messenger ribonucleic acid encoding the rat glucagon-like peptide-1 receptor. Endocrinology. 1996;137:31–3. 23. Gupta NA, Mells J, Dunham RM, Grakoui A, Saxena NK, Anania FA. Glucagon- like Peptide-1 receptor (GLP-1R) is present on human hepatocytes and has a direct role in decreasing hepatic steatosis in vitro by modulating elements of the insulin signaling pathway. Hepatology. 2010;51:1584–92. 24. Liu WJ, Jin HY, Lee KA, Xie SH, Baek HS, Park TS. Neuroprotective effect of the glucagon-like peptide-1 receptor agonist, synthetic exendin-4, in streptozotocin-induced diabetic rats. Br J Pharmacol. 2011;164:1410–20. 25. Dunislawska A, Slawinska A, Stadnicka K, Bednarczyk M, Gulewicz P, Jozefiak D, et al. Synbiotics for broiler chickens—in vitro design and evaluation of the influence on host and selected microbiota populations following in Ovo delivery. PLoS One. 2017;12:e0168587. 26. Gulewicz P, Ciesiołka D, Frias J, Vidal-Valverde C, Frejnagel S, Trojanowska K, et al. Simple method of isolation and purification of alpha-galactosides from legumes. J Agric Food Chem. 2000;48:3120–3. Submit your next manuscript to BioMed Central 27. Bednarczyk M, Urbanowski M, Gulewicz P, Kasperczyk K, Maiorano G, Szwaczkowski T. Field and in vitro study on prebiotic effect of raffinose and we will help you at every step: family oligosaccharides in chickens. Bull Vet Inst Pulawy. 2011;55:465–9. • We accept pre-submission inquiries 28. Wettergren A, Schjoldager B, Mortensen PE, Myhre J, Christiansen J, Holst JJ. Truncated GLP-1 (proglucagon 78-107-amide) inhibits gastric and pancreatic � Our selector tool helps you to find the most relevant journal functions in man. Dig Dis Sci. 1993;38:665–73. � We provide round the clock customer support 29. Zhou J, Montrose-Rafizadeh C, Janczewski AM, Pineyro MA, Sollott SJ, Wang � Convenient online submission Y, et al. Glucagon-like peptide-1 does not mediate amylase release from AR42J cells. J Cell Physiol. 1999;181:470–8. � Thorough peer review 30. Sjodin L, Conlon TP. Effects of gastric inhibitory polypeptide on dispersed � Inclusion in PubMed and all major indexing services pancreatic acinar cells from the guinea pig. Acta Physiol Scand. 1984;122:79–84. � Maximum visibility for your research 31. Honda K. Glucagon-related peptides and the regulation of food intake in chickens. Anim Sci J. 2016;87:1090–8. Submit your manuscript at www.biomedcentral.com/submit

Journal

Journal of Animal Science and Biotechnology – Springer Journals

Published: Jan 26, 2018

There are no references for this article.