Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Hypertonic saline alleviates experimentally induced cerebral oedema through suppression of vascular endothelial growth factor and its receptor VEGFR2 expression in astrocytes

Hypertonic saline alleviates experimentally induced cerebral oedema through suppression of... Background: Cerebral oedema is closely related to the permeability of blood–brain barrier, vascular endothelial growth factor ( VEGF) and its receptor vascular endothelial growth factor receptor 2 ( VEGFR2) all of which are impor- tant blood–brain barrier (BBB) permeability regulatory factors. Zonula occludens 1 (ZO-1) and claudin-5 are also the key components of BBB. Hypertonic saline is widely used to alleviate cerebral oedema. This study aimed to explore the possible mechanisms underlying hypertonic saline that ameliorates cerebral oedema effectively. Methods: Middle cerebral artery occlusion (MCAO) model in Sprague-Dawley (SD) rats and of oxygen–glucose dep- rivation model in primary astrocytes were used in this study. The brain water content (BWC) was used to assess the effect of 10 % HS on cerebral oedema. The assessment of Evans blue (EB) extravasation was performed to evaluate the protective effect of 10 % HS on blood–brain barrier. The quantification of VEGF, VEGFR2, ZO-1 and claudin-5 was used to illustrate the mechanism of 10 % HS ameliorating cerebral oedema. Results: BWC was analysed by wet-to-dry ratios in the ischemic hemisphere of SD rats; it was significantly decreased after 10 % HS treatment (P < 0.05). We also investigated the blood–brain barrier protective effect by 10 % HS which reduced EB extravasation effectively in the peri-ischemic brain tissue. In parallel to the above notably at 24 h follow- ing MCAO, mRNA and protein expression of VEGF and VEGFR2 in the peri-ischemic brain tissue was down-regulated after 10 % HS treatment (P < 0.05). Along with this, in vitro studies showed increased VEGF and VEGFR2 mRNA and protein expression in primary astrocytes under hypoxic condition (P < 0.05), but it was suppressed after HS treatment (P < 0.05). In addition, HS inhibited the down-regulation of ZO-1, claudin-5 effectively. Conclusions: The results suggest that 10 % HS could alleviate cerebral oedema possibly through reducing the ischemia induced BBB permeability as a consequence of inhibiting VEGF–VEGFR2-mediated down-regulation of ZO-1, claudin-5. Keywords: Hypertonic saline, Cerebral oedema, Vascular endothelial growth factor, Astrocyte, ZO-1, Claudin-5 *Correspondence: zenghongke@vip.163.com Linqiang Huang and Wei Cao contributed equally to this work Department of Emergency and Critical Care Medicine, Guangdong General Hospital, Guangdong Academy of Medical Sciences, Guangzhou 510080, People’s Republic of China Full list of author information is available at the end of the article © 2016 The Author(s). This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/ publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Huang et al. BMC Neurosci (2016) 17:64 Page 2 of 15 function and increases vascular permeability as well [17, Background 18]. Many studies have reported that VEGF and VEGFR2 Cerebral oedema is an acute complication of various expression was significantly and time-dependently brain diseases such as cerebral ischemic stroke [1], and increased with increasing BBB permeability in acute traumatic brain injury [2]. The development of cerebral phase of cerebral oedema caused by middle cerebral oedema remains the most significant predictor of treat - artery occlusion (MCAO) [16, 19, 20]. It has remained ment outcome. If it is not treated timely and with an to be resolved whether VEGF and VEGFR2 expression effective strategy, it could be life-threatening due to for - would play a role in the therapeutic efficacy of HS in cer - mation of cerebral hernia. To this end, osmotherapy is ebral oedema. one of commonly used adjuvant therapies in clinical Because HS can alleviate cerebral oedema by down- patients with cerebral oedema such as osmotic dehydrat- regulating aquaporin-4 as reported previously by us [6, ing agents including mannitol and hypertonic saline (HS) 7], it was reasoned that it would also protect BBB perme- that are widely used to relieve cerebral oedema [3]. It is ability in the acute phase of cerebral oedema. The issue also well known that HS solutions may be more effective that follows is whether HS would regulate BBB permea- in ameliorating cerebral oedema than mannitol which bility via regulating the expression of VEGF and VEGFR2 is another classic osmotic dehydrating agent [3, 4]. The in astrocytes which are closely associated with the cer- group of Schwab has been reported that 10  % HS not ebral vessels. only effective in reducing the common cerebral oedema, In addition, the tight junction (TJ) between endothe- but also for cases that failed with mannitol treatment [5]. lial cells is the key element of BBB permeability, and dis- The traditional theory that HS removes free water from ruption of tight junction leads to BBB breakdown [21]. the intracellular into the extracellular space through Zonula occludens 1 (ZO-1), and claudin-5 are important establishing osmotic pressure gradient and lowers components of tight junction, and the down-regulation peripheral vascular resistance has been accepted widely of them would increase the permeability of BBB sig- [6]. However, the action of HS beyond its osmotic effects nificantly [22]. It remains to be ascertained whether HS has remained elusive. We have reported previously that could regulate the expression of aforementioned tight HS could alleviate cerebral oedema through down-regu- junction proteins. lating the expression of aquaporin-4 in astrocytes in peri- To ascertain these possibilities, the brain water content ischemic hemispheric tissue [7, 8]. Moreover, it may be (BWC), Evan’s Blue (EB) extravasation, and the expres- neuroprotective by reducing neuronal apoptosis [7] thus sion of VEGF, VEGFR2, ZO-1, claudin-5 mRNA and raising the possibility that HS alleviates cerebral oedema protein in peri-ischemic brain tissue were assessed in not only through an osmotic mechanism, but it may also an MCAO model in rats. Furthermore, VEGF, VEGFR2 mediate a non-osmotic molecular mechanism. mRNA and protein expression in primary astrocytes was Cerebral oedema can be classified into three parts [9, also examined. This aimed to determine if a functional 10], it starts from a cytotoxic brain oedema to ionic brain correlation may be drawn among the various compo- oedema, and then vasogenic brain oedema which is most nents both in vivo and in vitro. severe with a widest range of injury. The degree of cer - ebral oedema is closely related to the change of BBB per- Methods meability. The BBB is composed of endothelial cells that Animals and experimental groups line capillaries in brain parenchyma. Astrocytes, peri- 207 SPF male Sprague-Dawley (SD) rats weighing 200– cytes and perivascular microglia around capillaries are 250  g (provided by Guangdong Medical Laboratory very important for maintaining the proper functioning Animal Centre, Guangdong Province), are randomly of BBB [11, 12]. The up-regulation of the ionic channel divided into a sham-operated group (n  =  69), cerebral and water transporter in these cells is pivotal to hyper- ischemia + normal saline group (ischemia group, n = 69) permeability in BBB [10, 13]. The above-mentioned had and cerebral ischemic + 10 % HS treatment group (10 % prompted us to hypothesize that water and/or ionic HS group, n = 69). In ischemia group and 10 % HS group, channel in cerebral cells is related to BBB permeability rats were subjected to right-sided middle cerebral artery that may be the therapeutic targets of HS for ameliorat- occlusion (MCAO). Reperfusion started at 2  h after ing cerebral oedema. MCAO; meanwhile, the rats in the ischemia group and VEGF is the major vascular permeability regulator on 10  % HS group were treated with a continuous intrave- microvascular permeability. It has been reported that nous (i.v.) infusion of normal saline (0.3  ml/h) and 10  % BBB permeability was significantly increased and the HS, respectively. However, rats in sham-operated group degree of cerebral oedema deteriorated abruptly after were subjected to the same operating procedure but not treatment with VEGF [14–16]. VEGFR2, a receptor of subjected to MCAO. After this, the rats were treated with VEGF, plays an important role in regulating the VEGF Huang et al. BMC Neurosci (2016) 17:64 Page 3 of 15 an i.v. infusion of normal saline (0.3 ml/h) via the tail vein observable neurologic deficit; (1) a mild focal neurologic until the end of the experiment. The rats in each group deficit (failure to extend left forepaw fully); (2) a moder - were further subdivided into three groups at various time ate focal neurologic deficit (circling to the left); and (3) a points: 6, 12 and 24  h subgroups. Number of rats killed severe focal deficit (falling to the left); (4) no spontaneous at various time points in different groups is shown in motor activity (the rats did not walk spontaneously com- Table  1. All the animal experimental procedures were bined with depressed levels of consciousness). The rats approved by Institutional Animal Care and Use Com- with a score of 1–3 were used in experiments. mittee, Guangdong Province, China. All experiments After decapitation, peri-ischemic brain tissues were were carried out in accordance with the National Insti- obtained from the superior one-third of the cortical tute of Health Guide for the Care and Use of Laboratory area, extending from longitudinal cerebral fissure to lat - Animals. eral cerebral fissure in the section, which was located at 7–11 mm posterior to the tip of olfactory bulb [25]. Focal brain ischemia animal model The rats were allowed free access to water but were not Primary astrocyte cell culture and treatment fed the night before prior to surgery. Anaesthesia was Rat primary astrocytes were isolated from the cerebrum achieved with an intraperitoneal injection of 5  % Keta- of 0–24  h-old SD rats by a modification of a previously mine (40  mg/kg) before surgery. During the whole sur- described method [26]. Briefly, rats were killed and their gical procedure, a heating lamp was used to ensure that cerebral hemispheres were harvested. After the meninges the rectal temperature was maintained between 37 and and blood vessels were carefully cleared, the cortical tis- 37.5  °C. Focal cerebral ischemia was induced by intra- sues were collected into a beaker and dissected into tis- luminal occlusion of the right middle cerebral artery sue pieces of 1 mm size. This was followed by digesting as previously described [23, 24]. Briefly, after the expo - in 0.125 % trypsin for 10 min at 37 °C. At the termination sure of the right common carotid artery (CCA), internal of digestion, the tissue pieces were manually dissociated carotid artery (ICA), and external carotid artery (ECA) by triturating with Dulbecco’s modified Eagle’s medium- through a midline incision along the neck, a 4–0 head F12 nutrient mixture (DMEM-F12) with 10  % fetal end spherical nylon suture was inserted into the right bovine serum. The cell suspension was then filtrated with ICA to block the origin of right middle cerebral artery so a 70  μm cell strainer and centrifuged at 1500  rpm for that the blood flow to the cerebral somatosensory cor - 5  min. Finally, the supernatant was carefully discarded tex was impeded. Sham-operated rats were subjected and the cells resuspended with 10  ml of DMEM-F12 to the same surgical procedures without MCAO. At 2  h supplemented with 10  % FBS. The cells were plated in 2 6 after MCAO, reperfusion was commenced by withdraw- 75  cm culture flasks at density of 2  ×  10   cells/ml and ing the intraluminal filament which was followed by the cultured at 37  °C in an incubator with 95  % air and 5  % neurologic assessments. The Longa scores test was used CO . When the culture reached its confluence, astro - to evaluate neurologic deficits after MCAO [23]: 0, no cytes were purified by shaking to remove most microglia and oligodendrocytes on an orbital shaker. The purified astrocytes were divided into three groups: control group, hypoxia  +  glucose free medium group (Hypoxia group) Table 1 Number of rats killed at various time points in dif- and hypoxia + glucose free medium +100 mM HS group ferent groups (HS group). Hypoxia group and HS group were incubated BWC Evans blue RT-PCR/western Double immu- at 37 °C incubator filled with 3 % oxygen and 5 % CO for blot nofluorescence 4 h, and the control group was cultured with DMEM-F12 Sham group containing 10 % FBS at 37 °C in humidified 5 % CO and 6 h 6 6 9 0 95 % air. 12 h 6 6 9 0 24 h 6 6 9 6 Assessment of ischemic hemispheric brain water content Ischemia group Brain oedema was estimated by comparing wet to-dry 6 h 6 6 9 0 weight ratios [27]. Briefly, at the end of the experiment, 12 h 6 6 9 0 rats were killed by decapitation under deep anesthesia. 24 h 6 6 9 6 The brain was quickly removed and its moisture blotted 10 % HS group gently. The brain was bisected through the inter-hem - 6 h 6 6 9 0 ispheric fissure into right and left hemispheres. Subse - 12 h 6 6 9 0 quently, brain hemisphere was weighed on an electronic 24 h 6 6 9 6 balance with a scale reading to within 0.001  mg. Dry Huang et al. BMC Neurosci (2016) 17:64 Page 4 of 15 weight of ischemic hemispheres was measured after the Free dH O. After the reaction mixture was pre-incubated tissue was heated for 3  days at 100  °C in a drying oven. at 95  °C for 30  s. The polymerase chain reactions (PCR) Tissue water content was then calculated as follows: % were performed according to the following procedures H O = (wet weight − dry weight)/wet weight × 100 %. for 35 cycles: step 1: denaturation: 95  °C, 5  s; step 2: annealing: 60  °C, 30  s; step 3: elongation: 72  °C, 15  s. A −c Evaluation of blood-brain barrier integrity modification of 2 method was used to quantify the The integrity of the BBB was achieved by measuring target gene expression [30]. Evans-Blue extravasated in ischemic hemispheric tissue as previously described [28, 29]. Evans Blue (EB, 2  % in Western blot saline, 4  ml/kg) was injected intravenously at the begin- Total protein was extracted from the peri-ischemic brain ning of reperfusion. At 24  h after MCAO, the rats were tissue and astrocyte culture using a protein extraction transcardially perfused with 110 ml saline to remove the kit (KGP701, KeyGEN biotech, Nan Jing, China). Protein intravascular Evans blue dye under deep anesthesia. The concentration of samples was quantified using BCA-100 brain was cut into 2  mm thick coronal sections at the protein quantitative analysing kit (KGP207, KeyGEN bio- level of the optic chiasma. The ischemic hemisphere was tech, Nan Jing, China). Protein samples were separated by then weighed and homogenized in 2  ml 50  % trichloro- sodium dodecyl sulfate–polyacrylamide gels and trans- acetic acid, followed by centrifugation at 10,000  rpm for ferred to polyvinylidene difluoride transfer membranes. 20 min. The supernatants were analysed at 620 nm using The membranes were washed with TBS—0.1  % Tween a spectrophotometer. The total Evans blue content in buffer and blocked with 5  % non-fat dry milk for 1  h at ischemic hemisphere was quantified in reference to a lin - room temperature, and incubated with primary antibody ear standard curve derived from known amounts of the as follows: VEGF (1:1000, rabbit polyclonal IgG, Santa dye and was expressed as micrograms per gram of tissue. Cruz, USA, Cat. No. sc-152), VEGFR2 (1:1000; rabbit polyclonal IgG, Santa Cruz, USA, Cat. No. sc-505), ZO-1 RT real-time PCR (1:200; Rabbit polyclonal IgG; Invitrogen Life Technolo- Total RNA was extracted from peri-ischemic brain tis- gies Corporation; Cat. No. 40-2200), Claudin-5 (1:500; sue and primary astrocytes using the Trizol reagent Mouse monoclonal IgG; Invitrogen Life Technologies according to the manufacturer’s protocol (Invitrogen Corporation; Cat. No. 35-2500) and GAPDH (1:1000, Life Technologies Corporation, USA, Cat. No. 115596- Santa Cruz Biotechnology, USA, Cat. No. sc-20357) over- 026). Total RNA concentration was quantified with a night at 4  °C. After washing in TBS-0.1  % Tween three spectrophotometer at 260  nm. Forward and reverse times, they were incubated with the horseradish per- primer sequences for the respective genes are as follows: oxidase (HRP)-conjugated secondary antibody (1:3500, VEGF (93  bp), Forward: GCTTTACTGCTGTACCTC goat anti-rabbit, Cell Signaling Technology, USA; Cat. CAC, Reverse: AGAAGTTCGGCAGGACAC; VEGFR2 No. 7074) for 1  h. The immunoblots were developed on (180  bp), Forward: CAGACAGACAGTGGGATG GT, Kodak films with an enhanced chemiluminescence detec - Reverse: GGTATCTGTGTCGTCTGAGTGA; β-actin (203  tion system (Bei Jing Pu Li Lai Gene Technology Co., Ltd, bp), Forward: GCCAACACAGTGCTGTCTG, Reverse: China) according to the manufacturer’s instructions. The TACTCCTGCTTGCTGATCCA; ZO-1 (107  bp), For- band intensity of VEGF and VEGFR2 expression levels ward: GGAGCTACGCTTGCCACACT, Reverse: GGT relative to the GAPDH was quantified by FluorChem CAATCAGGACAGAAACACA GT; Claudin-5 (302  bp), 8900 software (version 4.0.1, Alpha Innotech Corpora- forward: TAAGGCACGGGTAGCACTCA, Reverse: GCC tion, USA). CAGCT CGTACTTCTGTG. The expression of tar - get genes was measured in triplicate and normalized to Double immunofluorescence β-actin, as an internal control. At 24  h after MCAO, coronal frozen sections of the Reverse transcription was carried out as follows: 500 ng brain of 30 μm thickness at the level of the optic chiasma RNA from the respective samples combined with 2  μl were cut and rinsed in PBS. Sections were incubated in ® ® 5×  PrimeScript Buffer (PrimeScript RT Master Mix, a humidified chamber with a mixture of glial fibrillary TaKaRa Biotechnology, Dalian, Co., Ltd, China; Cat No. acidic protein (GFAP) (1:50, monoclonal antibody IgG, DRR036S), RNase Free dH O was added to 10  μl. After Millipore, USA, Cat. No. MAB 360) and VEGF (1:50, rab- heated at 37 °C for 15 min and 85 °C for 5 s, the mixture bit polyclonal IgG, Santa Cruz, USA, Cat. No. sc-152) or was stored at −20 °C. For RT-PCR, the reaction mixture VEGFR2 (1:50; rabbit polyclonal IgG, Santa Cruz, USA, with a 10 μl final volume was composed of 5 μl 2  × SYBR Cat. NO. sc-505) overnight at 4  °C. Subsequently, these Green I master mix, 1 μl cDNA, 0.5 μl of 10 μM forward sections were washed and incubated with Alexa Fluor primer, 0.5  μl of 10  μM reverse primer and 3  μl RNase 488 goat anti-rabbit IgG (H  +  L) (1:200; Invitrogen Life Huang et al. BMC Neurosci (2016) 17:64 Page 5 of 15 Technologies Corporation, USA; Cat. No. CA11008s) Determination of BBB permeability with the use of Evans and Alexa Fluor 594 goat anti-mouse IgG (1:200; Inv- blue itrogen Life Technologies Corporation, USA; Cat. No. The extravasation of EB was significantly increased in CA11005s) for 1  h at room temperature. After several ischemia group and 10  % HS group at 6, 12 and 24  h as washes with PBS, the sections were mounted with a fluo - compared with the corresponding sham groups (Fig.  1C; rescent mounting medium. Colocalization was observed P < 0.05). However, after 10 % HS treatment, the concen- by confocal microscopy (Leica TCS SP2 AOBS; Leica tration of EB in 10 % HS group was markedly decreased Microsystems Ltd, Germany). as compared with ischemia group (Fig.  1C; *P  <  0.05). At 4  h after hypoxia, astrocytes in culture were fixed At 24  h after MCAO, EB staining area was significantly with 4  % paraformaldehyde for 20  min. Following rins- increased in brain sections of ischemia group, but was ing with PBS, cells were blocked with 5  % goat serum noticeably reduced with 10 % HS treatment (Fig. 1D–F). for 30  min, and then incubated with a mixture of anti- bodies against GFAP (1:50; Millipore, USA, Cat. No. VEGF mRNA and protein expression in the peri-ischemic MAB 360) and VEGF (1:50; Santa Cruz, USA, Cat. No. brain tissue sc-152) or VEGFR2 (1:50; Santa Cruz, USA, Cat. No. Western blot showed a moderate expression of VEGF in sc-505) at 4  °C overnight. On the following day, cells the sham group. The expression level in the peri-ischemic were incubated with Alexa Fluor 488 goat anti-rabbit brain tissue, however, was progressively increased up IgG (H + L) (1:200; Invitrogen Life Technologies Corpo- to 24  h; thus, at 6, 12 and 24  h after MCAO, compared ration, USA; Cat. No. CA11008s) and Alexa Fluor 594 with the corresponding sham groups, VEGF protein goat anti-mouse IgG (1:200; Invitrogen Life Technologies expression in hypoxia group was significantly increased Corporation, USA; Cat. No. CA11005s) for 1  h at room (Fig.  2A, B; P  <  0.05). Remarkably, treatment with 10  % temperature. After rinsing with PBS and mounted with a HS group markedly suppressed the VEGF protein expres- fluorescent mounting medium, the cells were examined sion when compared with the corresponding ischemia under a fluorescence microscope (Olympus DP73 Micro - group (Fig. 2A, B; *P < 0.05). scope, Olympus, Tokyo, Japan). RT-PCR showed that in ischemia group, VEGF mRNA expression in the peri-ischemic brain tissue was gradu- Statistical analysis ally increased at 6 and 12 h, followed by a decline at 24 h. SPSS13.0 statistical software was used to analyze data. At each time point after MCAO, VEGF mRNA expres- Different statistical methods were applied according to sion was significantly up-regulated as compared with the types of data. Values were expressed as mean  ±  stand- corresponding sham group (Fig.  2C; P < 0.05). As com- ard deviation (±SD). Univariate-factor measurement pared with the ischemia group, however, VEGF mRNA data was analyzed by one-way ANOVA, but two-factor expression in 10 % HS group was significantly decreased measurement data was analysed by two-way ANOVA. (Fig. 2C; *P < 0.05). Multiple comparisons were analyzed by Fisher’s Least In both sham and MCAO groups, VEGF expression was Significant Difference test method if the data was homo - detected specifically in astrocytes, as confirmed by dou - geneity of variance; otherwise, they were analyzed by ble immunofluorescence showing colocalization of GFAP. Dunnett’s T3 method. The difference was considered sta - At 24  h after MCAO, VEGF immunoreactivity in the tistically significance when P < 0.05. ischemia group (Fig. 2G–I) was markedly enhanced when compared with the sham group (Fig.  2D–F). In 10  % HS Results group (Fig. 2J–l), VEGF expression was evidently reversed Ipsilateral ischemic hemispheric BWC as compared with the ischemia group. VEGF expression as The Longa scores showed that no significant difference detected either by western or immunofluorescence in 10 % between ischemia group and 10 % HS group (Fig. 1A; ns: HS group showed that despite its reduction, it remained P  >  0.05). At 6, 12 and 24  h following MCAO, BWC in above the basal levels as expressed by the sham group. the ipsilateral ischemic hemispheres of ischemia group Furthermore, a feature worthy of note is that astrocytes in and 10  % HS group increased significantly when com - hypoxia group appeared hypertrophic (Fig.  2G–I) when pared with that in the corresponding sham operated compared with that in 10 % HS group and sham group. groups (Fig. 1B; P < 0.05); but, the difference in the BWC between ischemia group and 10 % HS group at 6, 12 and VEGFR2 mRNA and protein expression in the peri-ischemic 24 h following MCAO was significant (Fig.  1B; *P < 0.05). brain tissue It is evident that BWC in ischemia group is significantly In ischemia group, an up-regulated VEGFR2 protein greater than that in 10 % HS group. expression was observed in the peri-ischemic brain tissue Huang et al. BMC Neurosci (2016) 17:64 Page 6 of 15 Fig. 1 Assessment of BWC and Evans blue. Bar graph A the neurological score is not significantly different between ischemia group and 10 % HS group at 2 h after MCAO based on Zea-longa scores (ns: P > 0.05). Bar graph B the percentage of BWC in 10 % HS group was significantly decreased as compared with corresponding ischemia groups at 6, 12 and 24 h after MCAO (*P < 0.05). Bar graph C 10 % HS could reduce Evans blue extravasa- tion effectively when compared with corresponding ischemia groups at 6, 12 and 24 h after MCAO (*P < 0.05). indicates compared with sham group, P < 0.05. D, E and F Evans blue extravasation in each group at 24 h after MCAO. The values are presented as the mean ± SD (See figure on next page.) Fig. 2 VEGF mRNA and protein expression in the peri-ischemic brain tissue in each group. A VEGF (45 kDa) and GAPDH (37 kDa) immunoreactive bands, respectively. Bar graph B depicts significant changes in the optical density of VEGF expression when compared with the corresponding ischemia groups (*P < 0.05). Bar graph C the fold change in VEGF mRNA expression. When compared with ischemia group at 6, 12 and 24 h after MCAO, VEGF mRNA expression in corresponding 10 % HS group is evidently reduced (*P < 0.05). indicates compared with sham group, P < 0.05. The values are presented as the mean ± SD. Confocal images showing the distribution of GFAP labeled astrocytes (D, G, J, red), VEGF (E, H, K, green), and GFAP labeling overlapping VEGF immunofluorescence can be seen in F, I and L. Note that VEGF expression in astrocytes (arrows) is markedly enhanced at 24 h following MCAO. However, after treatment with 10 % HS, it is noticeably reduced. Scale bars (D–L), 50 μm Huang et al. BMC Neurosci (2016) 17:64 Page 7 of 15 Huang et al. BMC Neurosci (2016) 17:64 Page 8 of 15 at 6, 12 and 24  h after MCAO when compared with the with that in hypoxia group (Fig.  5A; *P  <  0.05). West- corresponding sham group (Fig.  3A, B; P  <  0.05). After ern blot analysis showed that VEGFR2 protein levels treatment with 10 % HS, however, VEGF protein expres- were significantly increased in primary astrocytes under sion in 10  % HS group was markedly decreased in com- hypoxic condition for 4  h when compared with that in parison to the ischemia group (Fig. 3A, B; *P < 0.05). control group (Fig. 5B, c; P < 0.05). But it was decreased A similar pattern change was observed in VEGFR2 significantly in HS group that was treated with 100  mM mRNA whose expression was markedly increased in HS (Fig. 5B, C; *P < 0.05). ischemia group at 6, 12 and 24 h following MCAO when Double immunofluorescence labeling showed that the compared with the corresponding sham group (Fig.  3C; GFAP labeling in astrocytes was totally coincident with P < 0.05). Treatment with 10 % HS markedly suppressed VEGFR2 expression (Fig.  5D–L). Following hypoxic the VEGFR2 mRNA expression level as compared with exposure for 4 h, VEGFR2 immunofluorescence in astro - the corresponding ischemia group (Fig. 3C; *P < 0.05). cytes was markedly increased in hypoxia group (Fig. 5G– Double immunofluorescence labeling showed that I). However, it was noticeably attenuated in 10  % HS VEGFR2 expression was specifically detected in cells, group (Fig. 5J–L) when compared with hypoxia group. confirmed to be the astrocytes by double labeling with GFAP (Figs.  3D–L). At 24  h after MCAO, very intense Zo-1, claudin-5 mRNA and protein expression in the VEGFR2 immunoreactivity was detected in ischemia peri-ischemic brain tissue group (Figs.  3G–I). It was also found in 10  % HS group Zo-1 and claudin-5 mRNA expression level was sig- (Figs.  3J–L) but the immunoreactivity was significantly nificantly decreased at 6, 12 and 24  h following MCAO decreased as compared with ischemia group. (Fig.  6A, B; P  <  0.05); however, at 6, 12 and 24  h after 10  % HS treatment, Zo-1 and claudin-5 were increased VEGF mRNA and protein expression in primary astrocytes significantly when compared with the corresponding VEGF mRNA was significantly increased in primary ischemia group (Fig. 6A, B; *P < 0.05). astrocytes at 4  h after hypoxia in comparison with the At 6, 12 and 24 h after MCAO, Zo-1 and claudin-5 pro- # # control group (Fig.  4A; P  <  0.05), but after treatment teins were significantly decreased (Fig.  6C, E; P  <  0.05), with 100  mM HS, VEGF mRNA in primary astrocytes but 10  % HS inhibited the down-regulation of them at in HS group was significantly decreased when compared each time point (Fig. 6C, E; *P < 0.05, **P < 0.01). with that in hypoxia group (Fig. 4A; *P < 0.05). The immu - noreactive band of VEGF protein levels that appeared at Discussion approximately 45 kDa, increased significantly in primary This study has shown that HS could significantly decrease astrocytes at 4 h after hypoxia when compared with that cerebral oedema. The present results suggest that such an in control group (Fig. 4B, C; P < 0.05). However, the opti- effect may be through restoring the BBB integrity as evi - cal density of VEGF protein in HS group that was treated denced by the reduced permeability to exogenous tracer with 100 mM HS was significantly decreased (Fig.  4B, C; EB that inundated the ischemic tissue after MCAO. Con- *P < 0.05). comitant to this is reduced VEGF, VEGFR2 and tight The results of double immunofluorescence showed junction proteins such as ZO-1 and claudin-5 expression that VEGF expression in astrocytes was completely co- suggesting their involvement in this process. It is there- localized with GFAP labeling. Very weak VEGF immu- fore suggested that 10 % HS is BBB protective in ischemic noreactivity was detected in control group (Fig.  4D–F). injuries. At 4  h after hypoxic exposure, VEGF immunoreactiv- Like most osmotic agents, HS could improve arterial ity was markedly enhanced in astrocytes (Fig.  4G–L) as pressure, lower ICP, and increase cerebral blood flow and compared with the control group (Fig. 4D–F), but VEGF oxygen delivery. It has been widely used for the treatment immunoexpression was evidently decreased at 4  h after of cerebral oedema because of its efficacy of decreasing treatment with 100 mM HS (Fig. 4J–L) and was compara- BWC [3]. In the present ischemia–reperfusion injury ble to that in the hypoxia group (Fig. 4G–I). experimental model, an obvious cerebral oedema was observed; but, after treatment with 10 % HS, the BWC of VEGFR2 mRNA and protein expression in primary 10  % HS group was significantly decreased as compared astrocytes with the corresponding ischemia group. These results are At 4  h after hypoxia, VEGFR2 mRNA was significantly consistent with the previous studies that HS could drasti- increased in primary astrocytes when compared with the cally reduce BWC [31–33] and, hence, cerebral oedema. control group (Fig. 5A; P < 0.05), but following treatment It has been reported that the alteration of BBB per- with 100 mM HS, VEGFR2 mRNA in primary astrocytes meability and the damage of BBB integrity were closely in HS group was significantly decreased in comparison related to cerebral oedema [34]. BBB is a selective Huang et al. BMC Neurosci (2016) 17:64 Page 9 of 15 Fig. 3 VEGFR2 mRNA and protein expression in the peri-ischemic brain tissue in each group. A VEGFR2 (154 kDa) and GAPDH (37 kDa) immuno- reactive bands, respectively. Bar graph B the optical density of VEGFR2 expression in 10 % HS group at 6, 12 and 24 h after MCAO is significantly decreased when compared with the corresponding ischemia group (*P < 0.05). Bar graph C the fold change in VEGFR2 mRNA expression. Significant differences in mRNA level in ischemia group at 6, 12 and 24 h after MCAO is evident when compared with the corresponding 10 % HS groups (*P < 0.05). indicates compared with sham group, P < 0.05. The values are presented as the mean ± SD. Immunofluorescence images showing the distribution of GFAP (D, G, J, red) and VEGFR2 (E, H, K, green) in astrocytes (arrows) after MCAO for 12 h. Co-localization of GFAP and VEGFR2 can be seen in F, I and L. Note expression of VEGFR2 is down-regulated after treatment with 10 % HS. Scale bars (D–L), 20 μm Huang et al. BMC Neurosci (2016) 17:64 Page 10 of 15 Fig. 4 VEGF mRNA and protein expression in primary astrocytes. Bar graph A VEGF mRNA expression in HS group was significantly decreased in comparison to hypoxia group after hypoxia for 4 h. B VEGF (45 kDa) and GAPDH (37 kDa) immunoreactive bands, respectively. Bar graph C the optical density of VEGF expression in HS group was drastically attenuated when compared with the hypoxia group (*P < 0.05). indicates compared with sham group, P < 0.05. The values are presented as the mean ± SD. Immunofluorescence images showing GFAP labelled astrocytes (D, G, J, red), double labelled with VEGF (E, H, K, green). Co-localized expression of GFAP and VEGF in astrocytes can be seen in F, I and L. Note that VEGF expression in astrocytes is markedly enhanced at 24 h following MCAO. However, after treatment with 10 % HS, it is noticeably reduced. Scale bars (D–L), 20 μm Huang et al. BMC Neurosci (2016) 17:64 Page 11 of 15 Fig. 5 VEGFR2 mRNA and protein expression in primary astrocytes. Bar graph A VEGFR2 mRNA expression in HS group was significantly decreased in comparison to hypoxia group after hypoxia for 4 h. B VEGFR2 (154 kDa) and GAPDH (37 kDa) immunoreactive bands, respectively. Bar graph C the optical density of VEGFR2 expression in HS group was drastically attenuated when compared with the hypoxia group (*P < 0.05). indicates compared with sham group, P < 0.05. The values are presented as the mean ± SD. Double immunofluorescence images show that the expression of GFAP (D, G, J, red), VEGFR2 (E, H, K, green). The co-localized expression of GFAP and VEGFR2 can be seen in F, I and L. Note expression of VEGFR2 is markedly enhanced after hypoxia which is reduced by HS. Scale bars (D–L), 20 μm Huang et al. BMC Neurosci (2016) 17:64 Page 12 of 15 Fig. 6 Zo-1, claudin-5 mRNA and protein expression in the peri-ischemic brain tissue in each group. Bar graphs A, B the mRNA expressions of Zo-1, claudin-5 were significantly decreased at 6, 12 and 24 h after MCAO, respectively, as compared with the corresponding sham group ( indicates compared with the corresponding sham group, P < 0.05), but they were increased significantly at corresponding ischemia group after treatment with 10 % HS (*P < 0.05, **P < 0.01). C Zo-1 (225 kDa), claudin-5 (22 kDa) and GAPDH (37 kDa) immunoreactive bands, respectively. As seen in Bar graphs D, E the optical density of Zo-1, claudin-5 was significantly attenuated after MCAO at 6, 12 and 24 h ( indicates compared with sham group, P < 0.05). But 10 % HS could inhibit the down-regulation of Zo-1, claudin-5 protein expression effectively at 6, 12 h after MCAO (*P < 0.05, **P < 0.01, ns non-significant). The values are presented as the mean ± SD semi-permeability membrane. It separates the brain after ischemia–reperfusion. The results are therefore in parenchyma from the peripheral circulation and stabi- accord with previous report that ischemia–reperfusion lizes the microenvironment of neurons, keeping it from caused an up-regulation of BBB permeability and break- deleterious effects of certain substances from blood [11, down [28]. As expected, after treatment with 10 % HS, EB 35]. The disruption of BBB will lead to extravasation of extravasation was significantly decreased. These results intravascular substances into the brain extracellular demonstrate that 10  % HS ameliorates cerebral oedema spaces. The present results have shown that EB extravasa - through reduction of BBB permeability and protection of tion in the ischemic hemisphere was gradually increased BBB integrity. The pertinent question arose from this was up to 24  h. This was coupled by an increase in BWC whether HS could perform such a function. Huang et al. BMC Neurosci (2016) 17:64 Page 13 of 15 VEGF is known as a pivotal vascular permeability fac- effectively. This suggests that VEGF expression is tor. In some pathological situations, such as MCAO [36], increased in astrocytes after ischemia–reperfusion and and brain injury [37], VEGF was remarkably increased HS intervention could inhibit its expression. in the border area of the lesion. Increased VEGF has In vitro, hypoxia model of primary astrocytes was been reported to induce leakage of BBB [38, 39]. This also performed to further determine the effect of HS not only leads to the formation of cerebral oedema but on the expression of VEGF and VEGFR2 in astrocytes. also aggravates it [38, 40, 41]. Application of a neutraliz- The results are in concert with in  vivo experiments. The ing anti-VEGF antibody can reverse the cerebral oedema levels of VEGF, VEGFR2 mRNA and protein expres- caused by VEGF [39]. It has also been reported that rats sion were significantly augmented, but they were mark - treatment with VEGF protein in early phase of cerebral edly depressed after treatment with 100 mM HS. Double ischemic leads to increase in BBB permeability, or even immunofluorescence labelling also supported this which intracerebral haemorrhage which are reduced by VEGF demonstrates that HS could directly suppress the expres- inhibitor [38]. sion of VEGF and VEGFR2 in astrocytes. VEGFR2, a major receptor of VEGF, is also an impor- Finally, it remains to be explained on why inhibition tant mediator of vascular permeability [42]. It is overex- of HS on VEGF and VEGFR2 expression had a benefi - pressed in endothelial cells, astrocytes, neuronal somata cial effect on down-regulating the permeability of BBB. and processes adjacent to the damage after brain injury The reason for this may be that VEGF could regulate the [42]. Previous reports have suggested that VEGFR2, like expression of components of the tight junction such as VEGF, increases with increasing BBB permeability during ZO-1, claudin-5 etc. the acute phase of cerebral oedema induced by various ZO-1 and claudin-5 are the main components of tight injuries [16, 19, 43]. Moreover, the effects of VEGF on junction. Previous study has showed that VEGF could BBB junction components were VEGFR2 dependent, and down-regulate ZO-1, and claudin-5 expression through inhibition of VEGF–VEGFR2 axis is beneficial to amelio - PLCγ/PKC/eNOS signaling pathway leading to the dis- rate oedema [44]. ruption of BBB. Silencing of VEGF expression in astro- The above-mentioned findings have demonstrated cytes by using siRNA, or inhibiting PLCγ/PKC/eNOS that BBB permeability and integrity are closely linked to signaling pathway in endothelial cells by specific inhibi - VEGF and VEGFR2. As a corollary, targeting at VEGF tor of PLCγ and eNOS could inhibit down-regulation of and VEGFR2 may prove to be a potential therapeutic claudin-5 and hence, the permeability of BBB is reduced strategy to prevent brain oedema formation. In view of [47]. this, we further defined whether HS would affect the In this study, HS could also inhibit the down-regu- expression of VEGF and VEGFR2. Indeed we show here lation of ZO-1, and claudin-5 significantly. Therefore, that expression of VEGF, VEGFR2 mRNA and protein the mechanism whereby HS could ameliorate cerebral was significantly up-regulated at 6  h after MCAO peak - oedema may be via inhibition of VEGF-mediated down- ing at 12  h. More strikingly, when compared with the regulation of ZO-1, and claudin-5 to protect the integrity ischemia group, the 10  % HS group displays a lower of BBB. It is suggested that the PLCγ/PKC/eNOS signal- VEGF, VEGFR2 mRNA and protein expression. The ing pathway maybe involved in this process, but it needs changes correlate with the reduced BBB permeability to be further clarified. after treatment with 10 % HS. This suggests that HS may It has been reported that VEGF expression is also down-regulate the BBB permeability through inhibiting detected in vascular endothelial cells and neurons. The VEGF and VEGFR2 expression. Hypoxia inducible fac- possibility that HS can also inhibit VEGF expression in tor-1 (HIF-1) has been implicated in the expression of these cells should therefore be considered. In addition, VEGF [45, 46] and this may offer explanation for the inhi - VEGF is also known as an important driver of immune bition of HS on VEGF, but further studies are necessary cell infiltration [49– 51]. This implicates that inhibi - to confirm this possibility. tion of VEGF may be beneficial to reduce inflammatory It is known that astrocytes play a significant role in response as well. We had reported previously that HS maintaining BBB permeability and integrity [11, 47, 48]. could significantly decrease TNF-α and IL-1β expres - In CNS inflammatory disease, astrocyte-derived VEGF-A sion levels through inhibition of JNK signaling pathway could aggravate BBB disruption. Inhibition of the VEGF in microglia [52]. It is well documented that inflamma - expression in astrocytes plays a protective role in BBB tory cytokines such as TNF-α and IL-1β are also pro- function [47]. The present results have shown that the duced by astrocytes via JNK signalling pathway [53], VEGF expression in astrocytes was remarkably increased and that they are known to be mediators of BBB dis- after MCAO, and 10  % HS could down-regulate it ruption [12]. Therefore, decreasing the production of Huang et al. BMC Neurosci (2016) 17:64 Page 14 of 15 Consent to publish proinflammatory cytokines released by astrocytes by All authors consent to publish. HS may prove to be beneficial or protective for the per - meability integrity of BBB. In the lack of experimental Ethics and consent to participate All the animal experimental procedures were approved by Institutional Animal evidence for this in this study, this remains purely specu- Care and Use Committee, Guangdong Province, China (NO.GBREC2012106A). lative. This study showed that the augmented VEGF and All experiments were carried out in accordance with the National Institute of VEGFR2 expression after ischemia–reperfusion plays an Health Guide for the Care and Use of Laboratory Animals. important role in increasing BBB permeability that exac- Funding erbates cerebral oedema as manifested by the leakage National Clinical Key Subject Construction Project (2012-649), Guangzhou of EB in the peri-ischemic brain tissue and the increase Clinical Medicine Research and Translational Centre Construction Project (201508020005), National Natural Science Foundation of China (81272150; of BWC. HS therefore has additional role by protecting 81271329), Science and Technology Foundation of Guangdong Province BBB permeability and can ameliorate cerebral oedema (2012B031800308). through inhibition of VEGF and VEGFR2-mediated Received: 9 October 2015 Accepted: 17 May 2016 tight junction disruption. Conclusion In conclusion, we have shown that ischemia–rep- erfusion induced up-regulated VEGF and VEGR2 References expression on astrocytes leading to subsequent down- 1. Qureshi AI, Suarez JI. Use of hypertonic saline solutions in treatment of cerebral edema and intracranial hypertension. Crit Care Med. regulation of ZO-1 and claudin-5 which contributes to 2000;28(9):3301–13. BBB dysfunction notably its increased permeability but 2. Donkin JJ, Vink R. Mechanisms of cerebral edema in traumatic brain that may be effectively reduced by HS. This has fur - injury: therapeutic developments. Curr Opin Neurol. 2010;23(3):293–9. 3. Ziai WC, Toung TJ, Bhardwaj A. Hypertonic saline: first-line therapy for thered and amplified our understanding of the mecha - cerebral edema? J Neurol Sci. 2007;261(1–2):157–66. nistic and molecular roles of HS in clinical management 4. Zeng HK, Wang QS, Deng YY, Jiang WQ, Fang M, Chen CB, Jiang X. A com- of cerebral oedema. parative study on the efficacy of 10% hypertonic saline and equal volume of 20% mannitol in the treatment of experimentally induced cerebral edema in adult rats. BMC Neurosci. 2010;11:153. 5. Schwarz S, Georgiadis D, Aschoff A, Schwab S. Eec ff ts of hypertonic (10%) Abbreviations saline in patients with raised intracranial pressure after stroke. Stroke. HS: hypertonic saline; BWC: brain water content; VEGF: vascular endothelial 2002;33(1):136–40. growth factor; VEGFR2: vascular endothelial growth factor receptor 2; EB: Evans 6. Nout YS, Mihai G, Tovar CA, Schmalbrock P, Bresnahan JC, Beattie MS. blue; MCAO: middle cerebral artery occlusion; CCA: common carotid artery; Hypertonic saline attenuates cord swelling and edema in experimental ECA: external carotid artery; ICA: internal carotid artery; DMEM-F12: Dulbecco’s spinal cord injury: a study utilizing magnetic resonance imaging. Crit Care Modified Eagle Medium/Nutrient Mixture-F12; FBS: fetal bovine serum; GFAP: Med. 2009;37(7):2160–6. glial fibrillary acidic protein; BBB: blood–brain barrier. 7. Zeng HK, Wang QS, Deng YY, Fang M, Chen CB, Fu YH, Jiang WQ, Jiang X. Hypertonic saline ameliorates cerebral edema through down- Authors’ contributions regulation of aquaporin-4 expression in the astrocytes. Neuroscience. WC carried out assessment of the VEGF and VEGFR2 expression in the cerebral 2010;166(3):878–85. cortex astrocytes by western blotting, Real-time RT-PCR. LH participated in 8. Cao C, Yu X, Liao Z, Zhu N, Huo H, Wang M, Ji G, She H, Luo Z, Yue study of effect of HS on VEGF and VEGFR2 expression in primary astrocytes, S. Hypertonic saline reduces lipopolysaccharide-induced mouse collected data and drafted the manuscript. GZ and YH carried out assessment brain edema through inhibiting aquaporin 4 expression. Crit Care. of the BWC after MCAO. YD participated in the design of the study and drafted 2012;16(5):R186. the manuscript. HZ carried out the design of the study and performed the 9. Simard JM, Kent TA, Chen M, Tarasov KV, Gerzanich V. Brain oedema in statistical analysis. All authors read and approved the final manuscript. focal ischaemia: molecular pathophysiology and theoretical implications. Lancet Neurol. 2007;6(3):258–68. Author details 10. Kahle KT, Simard JM, Staley KJ, Nahed BV, Jones PS, Sun D. Molecular Department of Emergency and Critical Care Medicine, Guangdong General mechanisms of ischemic cerebral edema: role of electroneutral ion trans- Hospital, Guangdong Academy of Medical Sciences, Guangzhou 510080, Peo- port. Physiol (Bethesda). 2009;24:257–65. ple’s Republic of China. Zhuzhou Central Hospital, Zhuzhou 412007, People’s 11. Hawkins BT, Davis TP. The blood-brain barrier/neurovascular unit in health Republic of China. and disease. Pharmacol Rev. 2005;57(2):173–85. 12. Kaur C, Ling EA. Blood brain barrier in hypoxic-ischemic conditions. Curr Acknowledgements Neurovasc Res. 2008;5(1):71–81. This study was supported by National Clinical Key Subject Construction 13. Dente CJ, Steffes CP, Speyer C, Tyburski JG. Pericytes augment the capil- Project (2012-649), Guangzhou Clinical Medicine Research and Translational lary barrier in in vitro cocultures. J Surg Res. 2001;97(1):85–91. Centre Construction Project (201508020005), National Natural Science Foun- 14. Mayhan WG. VEGF increases permeability of the blood-brain barrier dation of China (81272150; 81271329), Science and Technology Foundation of via a nitric oxide synthase/cGMP-dependent pathway. Am J Physiol. Guangdong Province (2012B031800308). The authors would like to thank Mr. 1999;276(5 Pt 1):C1148–53. Lin Lin Guo and Mr. Yu Kai Huang for technical assistance. 15. Dvorak HF, Brown LF, Detmar M, Dvorak AM. Vascular permeability factor/ vascular endothelial growth factor, microvascular hyperpermeability, and Competing interests angiogenesis. Am J Pathol. 1995;146(5):1029–39. The authors declare that they have no competing interests. 16. Skold MK, von Gertten C, Sandberg-Nordqvist AC, Mathiesen T, Holmin S. VEGF and VEGF receptor expression after experimental brain contusion in Availability of data and materials rat. J Neurotrauma. 2005;22(3):353–67. All the data supporting findings is contained within the manuscript. Huang et al. BMC Neurosci (2016) 17:64 Page 15 of 15 17. Olsson AK, Dimberg A, Kreuger J, Claesson-Welsh L. VEGF recep- 40. Valable S, Montaner J, Bellail A, Berezowski V, Brillault J, Cecchelli R, tor signalling—in control of vascular function. Nat Rev Mol Cell Biol. Divoux D, Mackenzie ET, Bernaudin M, Roussel S, et al. VEGF-induced BBB 2006;7(5):359–71. permeability is associated with an MMP-9 activity increase in cerebral 18. Shimotake J, Derugin N, Wendland M, Vexler ZS, Ferriero DM. Vascular ischemia: both effects decreased by Ang-1. J Cereb Blood Flow Metab. endothelial growth factor receptor-2 inhibition promotes cell death and 2005;25(11):1491–504. limits endothelial cell proliferation in a neonatal rodent model of stroke. 41. Paul R, Zhang ZG, Eliceiri BP, Jiang Q, Boccia AD, Zhang RL, Chopp M, Stroke. 2010;41(2):343–9. Cheresh DA. Src deficiency or blockade of Src activity in mice provides 19. Lennmyr F, Ata KA, Funa K, Olsson Y, Terent A. Expression of vascular cerebral protection following stroke. Nat Med. 2001;7(2):222–7. endothelial growth factor ( VEGF) and its receptors (Flt-1 and Flk-1) follow- 42. Lafuente JV, Argandona EG, Mitre B. VEGFR-2 expression in brain injury: ing permanent and transient occlusion of the middle cerebral artery in its distribution related to brain-blood barrier markers. J Neural Transm. the rat. J Neuropathol Exp Neurol. 1998;57(9):874–82. 2006;113(4):487–96. 20. Lennmyr F, Terent A, Syvanen AC, Barbany G. Vascular endothelial growth 43. Kovacs Z, Ikezaki K, Samoto K, Inamura T, Fukui M. VEGF and flt expression factor gene expression in middle cerebral artery occlusion in the rat. Acta time kinetics in rat brain infarct. Stroke. 1996;27(10):1865–73. Anaesthesiol Scand. 2005;49(4):488–93. 44. Vohra PK, Hoeppner LH, Sagar G, Dutta SK, Misra S, Hubmayr RD, Muk- 21. Luissint AC, Artus C, Glacial F, Ganeshamoorthy K, Couraud P. Tight junc- hopadhyay D. Dopamine inhibits pulmonary edema through the VEGF– tions at the blood brain barrier physiological architecture and disease- VEGFR2 axis in a murine model of acute lung injury. Am J Physiol Lung associated dysregulation. Fluids Barriers CNS. 2012;23(9):1. Cell Mol Physiol. 2012;302(2):L185–92. 22. Jiao H, Wang Z, Liu Y, Wang P, Xue Y. Specific role of tight junction proteins 45. Argaw AT, Zhang Y, Snyder BJ, Zhao ML, Kopp N, Lee SC, Raine CS, claudin-5, occludin, and ZO-1 of the blood-brain barrier in a focal cerebral Brosnan CF, John GR. IL-1beta regulates blood-brain barrier permeabil- ischemic insult. J Mol Neurosci. 2011;44(2):130–9. ity via reactivation of the hypoxia-angiogenesis program. J Immunol. 23. Longa EZ, Weinstein PR, Carlson S, Cummins R. Reversible middle cerebral 2006;177(8):5574–84. artery occlusion without craniectomy in rats. Stroke. 1989;20(1):84–91. 46. Forsythe JA, Jiang BH, Iyer NV, Agani F, Leung SW, Koos RD, Semenza GL. 24. Toung TJ, Tyler B, Brem H, Traystman RJ, Hurn PD, Bhardwaj A. Hypertonic Activation of vascular endothelial growth factor gene transcription by saline ameliorates cerebral edema associated with experimental brain hypoxia-inducible factor 1. Mol Cell Biol. 1996;16(9):4604–13. tumor. J Neurosurg Anesthesiol. 2002;14(3):187–93. 47. Argaw AT, Asp L, Zhang J, Navrazhina K, Pham T, Mariani JN, Mahase 25. Shi J, Panickar KS, Yang SH, Rabbani O, Day AL, Simpkins JW. Estro- S, Dutta DJ, Seto J, Kramer EG, et al. Astrocyte-derived VEGF-A drives gen attenuates over-expression of beta-amyloid precursor protein blood-brain barrier disruption in CNS inflammatory disease. J Clin Invest. messager RNA in an animal model of focal ischemia. Brain Res. 2012;122(7):2454–68. 1998;810(1–2):87–92. 48. Abbott NJ. Astrocyte-endothelial interactions and blood-brain barrier 26. McCarthy KD, de Vellis J. Preparation of separate astroglial and oligodendro- permeability. J Anat. 2002;200(6):629–38. glial cell cultures from rat cerebral tissue. J Cell Biol. 1980;85(3):890–902. 49. Yang ZF, Poon RT, Luo Y, Cheung CK, Ho DW, Lo CM, Fan ST. Up-regulation 27. Thiagarajah JR, Papadopoulos MC, Verkman AS. Noninvasive early detec- of vascular endothelial growth factor ( VEGF) in small-for-size liver grafts tion of brain edema in mice by near-infrared light scattering. J Neurosci enhances macrophage activities through VEGF receptor 2-dependent Res. 2005;80(2):293–9. pathway. J Immunol. 2004;173(4):2507–15. 28. Lee JH, Cui HS, Shin SK, Kim JM, Kim SY, Lee JE, Koo BN. Eec ff t of propofol 50. Argaw AT, Gurfein BT, Zhang Y, Zameer A, John GR. VEGF-mediated dis- post-treatment on blood–brain barrier integrity and cerebral edema after ruption of endothelial CLN-5 promotes blood-brain barrier breakdown. transient cerebral ischemia in rats. Neurochem Res. 2013;38(11):2276–86. Proc Natl Acad Sci USA. 2009;106(6):1977–82. 29. Belayev L, Busto R, Zhao W, Ginsberg MD. Quantitative evaluation of 51. Proescholdt MA, Jacobson S, Tresser N, Oldfield EH, Merrill MJ. Vascular blood-brain barrier permeability following middle cerebral artery occlu- endothelial growth factor is expressed in multiple sclerosis plaques and sion in rats. Brain Res. 1996;739(1–2):88–96. can induce inflammatory lesions in experimental allergic encephalomy- 30. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using elitis rats. J Neuropathol Exp Neurol. 2002;61(10):914–25. real-time quantitative PCR and the 2(−Delta Delta C( T )) Method. Meth- 52. Huang LQ, Zhu GF, Deng YY, Jiang WQ, Fang M, Chen CB, Cao W, Wen ods. 2001;25(4):402–8. MY, Han YL, Zeng HK. Hypertonic saline alleviates cerebral edema by 31. Mortazavi MM, Romeo AK, Deep A, Griessenauer CJ, Shoja MM, Tubbs inhibiting microglia-derived TNF-alpha and IL-1beta-induced Na-K-Cl RS, Fisher W. Hypertonic saline for treating raised intracranial pressure: Cotransporter up-regulation. J Neuroinflamm. 2014;11:102. literature review with meta-analysis. J Neurosurg. 2012;116(1):210–21. 53. Deng YY, Lu J, Ling EA, Kaur C. Microglia-derived macrophage colony 32. Toung TJ, Chen CH, Lin C, Bhardwaj A. Osmotherapy with hypertonic stimulating factor promotes generation of proinflammatory cytokines saline attenuates water content in brain and extracerebral organs. Crit by astrocytes in the periventricular white matter in the hypoxic neonatal Care Med. 2007;35(2):526–31. brain. Brain Pathol. 2010;20(5):909–25. 33. Chen CH, Xue R, Zhang J, Li X, Mori S, Bhardwaj A. Eec ff t of osmotherapy with hypertonic saline on regional cerebral edema following experimen- tal stroke: a study utilizing magnetic resonance imaging. Neurocrit Care. 2007;7(1):92–100. 34. Huang P, Zhou CM, Liu YY, Hu BH, Chang X, Zhao XR, Xu XS, Li Q, Wei XH, et al. Cerebralcare Granule attenuates blood-brain barrier disruption after middle cerebral artery occlusion in rats. Exp Neurol. Submit your next manuscript to BioMed Central 2012;237(2):453–63. and we will help you at every step: 35. Anfuso CD, Lupo G, Romeo L, Giurdanella G, Motta C, Pascale A, Tirolo C, Marchetti B, Alberghina M. Endothelial cell-pericyte cocultures induce • We accept pre-submission inquiries PLA2 protein expression through activation of PKCalpha and the MAPK/ • Our selector tool helps you to find the most relevant journal ERK cascade. J Lipid Res. 2007;48(4):782–93. • We provide round the clock customer support 36. Croll SD, Wiegand SJ. Vascular growth factors in cerebral ischemia. Mol Neurobiol. 2001;23(2–3):121–35. • Convenient online submission 37. Pilitsis JG, Rengachary SS. Complications of head injury. Neurol Res. • Thorough peer review 2001;23(2–3):227–36. • Inclusion in PubMed and all major indexing services 38. Zhang ZG, Zhang L, Jiang Q, Zhang R, Davies K, Powers C, Bruggen N, Chopp M. VEGF enhances angiogenesis and promotes blood-brain bar- • Maximum visibility for your research rier leakage in the ischemic brain. J Clin Invest. 2000;106(7):829–38. 39. Schoch HJ, Fischer S, Marti HH. Hypoxia-induced vascular endothelial Submit your manuscript at growth factor expression causes vascular leakage in the brain. Brain. www.biomedcentral.com/submit 2002;125(Pt 11):2549–57. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png BMC Neuroscience Springer Journals

Hypertonic saline alleviates experimentally induced cerebral oedema through suppression of vascular endothelial growth factor and its receptor VEGFR2 expression in astrocytes

Download PDF
15 pages

Loading next page...
 
/lp/springer-journals/hypertonic-saline-alleviates-experimentally-induced-cerebral-oedema-W60Y3dN3Md

References (56)

Publisher
Springer Journals
Copyright
Copyright © 2016 by The Author(s)
Subject
Biomedicine; Neurosciences; Neurobiology; Animal Models
eISSN
1471-2202
DOI
10.1186/s12868-016-0299-y
pmid
27733124
Publisher site
See Article on Publisher Site

Abstract

Background: Cerebral oedema is closely related to the permeability of blood–brain barrier, vascular endothelial growth factor ( VEGF) and its receptor vascular endothelial growth factor receptor 2 ( VEGFR2) all of which are impor- tant blood–brain barrier (BBB) permeability regulatory factors. Zonula occludens 1 (ZO-1) and claudin-5 are also the key components of BBB. Hypertonic saline is widely used to alleviate cerebral oedema. This study aimed to explore the possible mechanisms underlying hypertonic saline that ameliorates cerebral oedema effectively. Methods: Middle cerebral artery occlusion (MCAO) model in Sprague-Dawley (SD) rats and of oxygen–glucose dep- rivation model in primary astrocytes were used in this study. The brain water content (BWC) was used to assess the effect of 10 % HS on cerebral oedema. The assessment of Evans blue (EB) extravasation was performed to evaluate the protective effect of 10 % HS on blood–brain barrier. The quantification of VEGF, VEGFR2, ZO-1 and claudin-5 was used to illustrate the mechanism of 10 % HS ameliorating cerebral oedema. Results: BWC was analysed by wet-to-dry ratios in the ischemic hemisphere of SD rats; it was significantly decreased after 10 % HS treatment (P < 0.05). We also investigated the blood–brain barrier protective effect by 10 % HS which reduced EB extravasation effectively in the peri-ischemic brain tissue. In parallel to the above notably at 24 h follow- ing MCAO, mRNA and protein expression of VEGF and VEGFR2 in the peri-ischemic brain tissue was down-regulated after 10 % HS treatment (P < 0.05). Along with this, in vitro studies showed increased VEGF and VEGFR2 mRNA and protein expression in primary astrocytes under hypoxic condition (P < 0.05), but it was suppressed after HS treatment (P < 0.05). In addition, HS inhibited the down-regulation of ZO-1, claudin-5 effectively. Conclusions: The results suggest that 10 % HS could alleviate cerebral oedema possibly through reducing the ischemia induced BBB permeability as a consequence of inhibiting VEGF–VEGFR2-mediated down-regulation of ZO-1, claudin-5. Keywords: Hypertonic saline, Cerebral oedema, Vascular endothelial growth factor, Astrocyte, ZO-1, Claudin-5 *Correspondence: zenghongke@vip.163.com Linqiang Huang and Wei Cao contributed equally to this work Department of Emergency and Critical Care Medicine, Guangdong General Hospital, Guangdong Academy of Medical Sciences, Guangzhou 510080, People’s Republic of China Full list of author information is available at the end of the article © 2016 The Author(s). This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/ publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Huang et al. BMC Neurosci (2016) 17:64 Page 2 of 15 function and increases vascular permeability as well [17, Background 18]. Many studies have reported that VEGF and VEGFR2 Cerebral oedema is an acute complication of various expression was significantly and time-dependently brain diseases such as cerebral ischemic stroke [1], and increased with increasing BBB permeability in acute traumatic brain injury [2]. The development of cerebral phase of cerebral oedema caused by middle cerebral oedema remains the most significant predictor of treat - artery occlusion (MCAO) [16, 19, 20]. It has remained ment outcome. If it is not treated timely and with an to be resolved whether VEGF and VEGFR2 expression effective strategy, it could be life-threatening due to for - would play a role in the therapeutic efficacy of HS in cer - mation of cerebral hernia. To this end, osmotherapy is ebral oedema. one of commonly used adjuvant therapies in clinical Because HS can alleviate cerebral oedema by down- patients with cerebral oedema such as osmotic dehydrat- regulating aquaporin-4 as reported previously by us [6, ing agents including mannitol and hypertonic saline (HS) 7], it was reasoned that it would also protect BBB perme- that are widely used to relieve cerebral oedema [3]. It is ability in the acute phase of cerebral oedema. The issue also well known that HS solutions may be more effective that follows is whether HS would regulate BBB permea- in ameliorating cerebral oedema than mannitol which bility via regulating the expression of VEGF and VEGFR2 is another classic osmotic dehydrating agent [3, 4]. The in astrocytes which are closely associated with the cer- group of Schwab has been reported that 10  % HS not ebral vessels. only effective in reducing the common cerebral oedema, In addition, the tight junction (TJ) between endothe- but also for cases that failed with mannitol treatment [5]. lial cells is the key element of BBB permeability, and dis- The traditional theory that HS removes free water from ruption of tight junction leads to BBB breakdown [21]. the intracellular into the extracellular space through Zonula occludens 1 (ZO-1), and claudin-5 are important establishing osmotic pressure gradient and lowers components of tight junction, and the down-regulation peripheral vascular resistance has been accepted widely of them would increase the permeability of BBB sig- [6]. However, the action of HS beyond its osmotic effects nificantly [22]. It remains to be ascertained whether HS has remained elusive. We have reported previously that could regulate the expression of aforementioned tight HS could alleviate cerebral oedema through down-regu- junction proteins. lating the expression of aquaporin-4 in astrocytes in peri- To ascertain these possibilities, the brain water content ischemic hemispheric tissue [7, 8]. Moreover, it may be (BWC), Evan’s Blue (EB) extravasation, and the expres- neuroprotective by reducing neuronal apoptosis [7] thus sion of VEGF, VEGFR2, ZO-1, claudin-5 mRNA and raising the possibility that HS alleviates cerebral oedema protein in peri-ischemic brain tissue were assessed in not only through an osmotic mechanism, but it may also an MCAO model in rats. Furthermore, VEGF, VEGFR2 mediate a non-osmotic molecular mechanism. mRNA and protein expression in primary astrocytes was Cerebral oedema can be classified into three parts [9, also examined. This aimed to determine if a functional 10], it starts from a cytotoxic brain oedema to ionic brain correlation may be drawn among the various compo- oedema, and then vasogenic brain oedema which is most nents both in vivo and in vitro. severe with a widest range of injury. The degree of cer - ebral oedema is closely related to the change of BBB per- Methods meability. The BBB is composed of endothelial cells that Animals and experimental groups line capillaries in brain parenchyma. Astrocytes, peri- 207 SPF male Sprague-Dawley (SD) rats weighing 200– cytes and perivascular microglia around capillaries are 250  g (provided by Guangdong Medical Laboratory very important for maintaining the proper functioning Animal Centre, Guangdong Province), are randomly of BBB [11, 12]. The up-regulation of the ionic channel divided into a sham-operated group (n  =  69), cerebral and water transporter in these cells is pivotal to hyper- ischemia + normal saline group (ischemia group, n = 69) permeability in BBB [10, 13]. The above-mentioned had and cerebral ischemic + 10 % HS treatment group (10 % prompted us to hypothesize that water and/or ionic HS group, n = 69). In ischemia group and 10 % HS group, channel in cerebral cells is related to BBB permeability rats were subjected to right-sided middle cerebral artery that may be the therapeutic targets of HS for ameliorat- occlusion (MCAO). Reperfusion started at 2  h after ing cerebral oedema. MCAO; meanwhile, the rats in the ischemia group and VEGF is the major vascular permeability regulator on 10  % HS group were treated with a continuous intrave- microvascular permeability. It has been reported that nous (i.v.) infusion of normal saline (0.3  ml/h) and 10  % BBB permeability was significantly increased and the HS, respectively. However, rats in sham-operated group degree of cerebral oedema deteriorated abruptly after were subjected to the same operating procedure but not treatment with VEGF [14–16]. VEGFR2, a receptor of subjected to MCAO. After this, the rats were treated with VEGF, plays an important role in regulating the VEGF Huang et al. BMC Neurosci (2016) 17:64 Page 3 of 15 an i.v. infusion of normal saline (0.3 ml/h) via the tail vein observable neurologic deficit; (1) a mild focal neurologic until the end of the experiment. The rats in each group deficit (failure to extend left forepaw fully); (2) a moder - were further subdivided into three groups at various time ate focal neurologic deficit (circling to the left); and (3) a points: 6, 12 and 24  h subgroups. Number of rats killed severe focal deficit (falling to the left); (4) no spontaneous at various time points in different groups is shown in motor activity (the rats did not walk spontaneously com- Table  1. All the animal experimental procedures were bined with depressed levels of consciousness). The rats approved by Institutional Animal Care and Use Com- with a score of 1–3 were used in experiments. mittee, Guangdong Province, China. All experiments After decapitation, peri-ischemic brain tissues were were carried out in accordance with the National Insti- obtained from the superior one-third of the cortical tute of Health Guide for the Care and Use of Laboratory area, extending from longitudinal cerebral fissure to lat - Animals. eral cerebral fissure in the section, which was located at 7–11 mm posterior to the tip of olfactory bulb [25]. Focal brain ischemia animal model The rats were allowed free access to water but were not Primary astrocyte cell culture and treatment fed the night before prior to surgery. Anaesthesia was Rat primary astrocytes were isolated from the cerebrum achieved with an intraperitoneal injection of 5  % Keta- of 0–24  h-old SD rats by a modification of a previously mine (40  mg/kg) before surgery. During the whole sur- described method [26]. Briefly, rats were killed and their gical procedure, a heating lamp was used to ensure that cerebral hemispheres were harvested. After the meninges the rectal temperature was maintained between 37 and and blood vessels were carefully cleared, the cortical tis- 37.5  °C. Focal cerebral ischemia was induced by intra- sues were collected into a beaker and dissected into tis- luminal occlusion of the right middle cerebral artery sue pieces of 1 mm size. This was followed by digesting as previously described [23, 24]. Briefly, after the expo - in 0.125 % trypsin for 10 min at 37 °C. At the termination sure of the right common carotid artery (CCA), internal of digestion, the tissue pieces were manually dissociated carotid artery (ICA), and external carotid artery (ECA) by triturating with Dulbecco’s modified Eagle’s medium- through a midline incision along the neck, a 4–0 head F12 nutrient mixture (DMEM-F12) with 10  % fetal end spherical nylon suture was inserted into the right bovine serum. The cell suspension was then filtrated with ICA to block the origin of right middle cerebral artery so a 70  μm cell strainer and centrifuged at 1500  rpm for that the blood flow to the cerebral somatosensory cor - 5  min. Finally, the supernatant was carefully discarded tex was impeded. Sham-operated rats were subjected and the cells resuspended with 10  ml of DMEM-F12 to the same surgical procedures without MCAO. At 2  h supplemented with 10  % FBS. The cells were plated in 2 6 after MCAO, reperfusion was commenced by withdraw- 75  cm culture flasks at density of 2  ×  10   cells/ml and ing the intraluminal filament which was followed by the cultured at 37  °C in an incubator with 95  % air and 5  % neurologic assessments. The Longa scores test was used CO . When the culture reached its confluence, astro - to evaluate neurologic deficits after MCAO [23]: 0, no cytes were purified by shaking to remove most microglia and oligodendrocytes on an orbital shaker. The purified astrocytes were divided into three groups: control group, hypoxia  +  glucose free medium group (Hypoxia group) Table 1 Number of rats killed at various time points in dif- and hypoxia + glucose free medium +100 mM HS group ferent groups (HS group). Hypoxia group and HS group were incubated BWC Evans blue RT-PCR/western Double immu- at 37 °C incubator filled with 3 % oxygen and 5 % CO for blot nofluorescence 4 h, and the control group was cultured with DMEM-F12 Sham group containing 10 % FBS at 37 °C in humidified 5 % CO and 6 h 6 6 9 0 95 % air. 12 h 6 6 9 0 24 h 6 6 9 6 Assessment of ischemic hemispheric brain water content Ischemia group Brain oedema was estimated by comparing wet to-dry 6 h 6 6 9 0 weight ratios [27]. Briefly, at the end of the experiment, 12 h 6 6 9 0 rats were killed by decapitation under deep anesthesia. 24 h 6 6 9 6 The brain was quickly removed and its moisture blotted 10 % HS group gently. The brain was bisected through the inter-hem - 6 h 6 6 9 0 ispheric fissure into right and left hemispheres. Subse - 12 h 6 6 9 0 quently, brain hemisphere was weighed on an electronic 24 h 6 6 9 6 balance with a scale reading to within 0.001  mg. Dry Huang et al. BMC Neurosci (2016) 17:64 Page 4 of 15 weight of ischemic hemispheres was measured after the Free dH O. After the reaction mixture was pre-incubated tissue was heated for 3  days at 100  °C in a drying oven. at 95  °C for 30  s. The polymerase chain reactions (PCR) Tissue water content was then calculated as follows: % were performed according to the following procedures H O = (wet weight − dry weight)/wet weight × 100 %. for 35 cycles: step 1: denaturation: 95  °C, 5  s; step 2: annealing: 60  °C, 30  s; step 3: elongation: 72  °C, 15  s. A −c Evaluation of blood-brain barrier integrity modification of 2 method was used to quantify the The integrity of the BBB was achieved by measuring target gene expression [30]. Evans-Blue extravasated in ischemic hemispheric tissue as previously described [28, 29]. Evans Blue (EB, 2  % in Western blot saline, 4  ml/kg) was injected intravenously at the begin- Total protein was extracted from the peri-ischemic brain ning of reperfusion. At 24  h after MCAO, the rats were tissue and astrocyte culture using a protein extraction transcardially perfused with 110 ml saline to remove the kit (KGP701, KeyGEN biotech, Nan Jing, China). Protein intravascular Evans blue dye under deep anesthesia. The concentration of samples was quantified using BCA-100 brain was cut into 2  mm thick coronal sections at the protein quantitative analysing kit (KGP207, KeyGEN bio- level of the optic chiasma. The ischemic hemisphere was tech, Nan Jing, China). Protein samples were separated by then weighed and homogenized in 2  ml 50  % trichloro- sodium dodecyl sulfate–polyacrylamide gels and trans- acetic acid, followed by centrifugation at 10,000  rpm for ferred to polyvinylidene difluoride transfer membranes. 20 min. The supernatants were analysed at 620 nm using The membranes were washed with TBS—0.1  % Tween a spectrophotometer. The total Evans blue content in buffer and blocked with 5  % non-fat dry milk for 1  h at ischemic hemisphere was quantified in reference to a lin - room temperature, and incubated with primary antibody ear standard curve derived from known amounts of the as follows: VEGF (1:1000, rabbit polyclonal IgG, Santa dye and was expressed as micrograms per gram of tissue. Cruz, USA, Cat. No. sc-152), VEGFR2 (1:1000; rabbit polyclonal IgG, Santa Cruz, USA, Cat. No. sc-505), ZO-1 RT real-time PCR (1:200; Rabbit polyclonal IgG; Invitrogen Life Technolo- Total RNA was extracted from peri-ischemic brain tis- gies Corporation; Cat. No. 40-2200), Claudin-5 (1:500; sue and primary astrocytes using the Trizol reagent Mouse monoclonal IgG; Invitrogen Life Technologies according to the manufacturer’s protocol (Invitrogen Corporation; Cat. No. 35-2500) and GAPDH (1:1000, Life Technologies Corporation, USA, Cat. No. 115596- Santa Cruz Biotechnology, USA, Cat. No. sc-20357) over- 026). Total RNA concentration was quantified with a night at 4  °C. After washing in TBS-0.1  % Tween three spectrophotometer at 260  nm. Forward and reverse times, they were incubated with the horseradish per- primer sequences for the respective genes are as follows: oxidase (HRP)-conjugated secondary antibody (1:3500, VEGF (93  bp), Forward: GCTTTACTGCTGTACCTC goat anti-rabbit, Cell Signaling Technology, USA; Cat. CAC, Reverse: AGAAGTTCGGCAGGACAC; VEGFR2 No. 7074) for 1  h. The immunoblots were developed on (180  bp), Forward: CAGACAGACAGTGGGATG GT, Kodak films with an enhanced chemiluminescence detec - Reverse: GGTATCTGTGTCGTCTGAGTGA; β-actin (203  tion system (Bei Jing Pu Li Lai Gene Technology Co., Ltd, bp), Forward: GCCAACACAGTGCTGTCTG, Reverse: China) according to the manufacturer’s instructions. The TACTCCTGCTTGCTGATCCA; ZO-1 (107  bp), For- band intensity of VEGF and VEGFR2 expression levels ward: GGAGCTACGCTTGCCACACT, Reverse: GGT relative to the GAPDH was quantified by FluorChem CAATCAGGACAGAAACACA GT; Claudin-5 (302  bp), 8900 software (version 4.0.1, Alpha Innotech Corpora- forward: TAAGGCACGGGTAGCACTCA, Reverse: GCC tion, USA). CAGCT CGTACTTCTGTG. The expression of tar - get genes was measured in triplicate and normalized to Double immunofluorescence β-actin, as an internal control. At 24  h after MCAO, coronal frozen sections of the Reverse transcription was carried out as follows: 500 ng brain of 30 μm thickness at the level of the optic chiasma RNA from the respective samples combined with 2  μl were cut and rinsed in PBS. Sections were incubated in ® ® 5×  PrimeScript Buffer (PrimeScript RT Master Mix, a humidified chamber with a mixture of glial fibrillary TaKaRa Biotechnology, Dalian, Co., Ltd, China; Cat No. acidic protein (GFAP) (1:50, monoclonal antibody IgG, DRR036S), RNase Free dH O was added to 10  μl. After Millipore, USA, Cat. No. MAB 360) and VEGF (1:50, rab- heated at 37 °C for 15 min and 85 °C for 5 s, the mixture bit polyclonal IgG, Santa Cruz, USA, Cat. No. sc-152) or was stored at −20 °C. For RT-PCR, the reaction mixture VEGFR2 (1:50; rabbit polyclonal IgG, Santa Cruz, USA, with a 10 μl final volume was composed of 5 μl 2  × SYBR Cat. NO. sc-505) overnight at 4  °C. Subsequently, these Green I master mix, 1 μl cDNA, 0.5 μl of 10 μM forward sections were washed and incubated with Alexa Fluor primer, 0.5  μl of 10  μM reverse primer and 3  μl RNase 488 goat anti-rabbit IgG (H  +  L) (1:200; Invitrogen Life Huang et al. BMC Neurosci (2016) 17:64 Page 5 of 15 Technologies Corporation, USA; Cat. No. CA11008s) Determination of BBB permeability with the use of Evans and Alexa Fluor 594 goat anti-mouse IgG (1:200; Inv- blue itrogen Life Technologies Corporation, USA; Cat. No. The extravasation of EB was significantly increased in CA11005s) for 1  h at room temperature. After several ischemia group and 10  % HS group at 6, 12 and 24  h as washes with PBS, the sections were mounted with a fluo - compared with the corresponding sham groups (Fig.  1C; rescent mounting medium. Colocalization was observed P < 0.05). However, after 10 % HS treatment, the concen- by confocal microscopy (Leica TCS SP2 AOBS; Leica tration of EB in 10 % HS group was markedly decreased Microsystems Ltd, Germany). as compared with ischemia group (Fig.  1C; *P  <  0.05). At 4  h after hypoxia, astrocytes in culture were fixed At 24  h after MCAO, EB staining area was significantly with 4  % paraformaldehyde for 20  min. Following rins- increased in brain sections of ischemia group, but was ing with PBS, cells were blocked with 5  % goat serum noticeably reduced with 10 % HS treatment (Fig. 1D–F). for 30  min, and then incubated with a mixture of anti- bodies against GFAP (1:50; Millipore, USA, Cat. No. VEGF mRNA and protein expression in the peri-ischemic MAB 360) and VEGF (1:50; Santa Cruz, USA, Cat. No. brain tissue sc-152) or VEGFR2 (1:50; Santa Cruz, USA, Cat. No. Western blot showed a moderate expression of VEGF in sc-505) at 4  °C overnight. On the following day, cells the sham group. The expression level in the peri-ischemic were incubated with Alexa Fluor 488 goat anti-rabbit brain tissue, however, was progressively increased up IgG (H + L) (1:200; Invitrogen Life Technologies Corpo- to 24  h; thus, at 6, 12 and 24  h after MCAO, compared ration, USA; Cat. No. CA11008s) and Alexa Fluor 594 with the corresponding sham groups, VEGF protein goat anti-mouse IgG (1:200; Invitrogen Life Technologies expression in hypoxia group was significantly increased Corporation, USA; Cat. No. CA11005s) for 1  h at room (Fig.  2A, B; P  <  0.05). Remarkably, treatment with 10  % temperature. After rinsing with PBS and mounted with a HS group markedly suppressed the VEGF protein expres- fluorescent mounting medium, the cells were examined sion when compared with the corresponding ischemia under a fluorescence microscope (Olympus DP73 Micro - group (Fig. 2A, B; *P < 0.05). scope, Olympus, Tokyo, Japan). RT-PCR showed that in ischemia group, VEGF mRNA expression in the peri-ischemic brain tissue was gradu- Statistical analysis ally increased at 6 and 12 h, followed by a decline at 24 h. SPSS13.0 statistical software was used to analyze data. At each time point after MCAO, VEGF mRNA expres- Different statistical methods were applied according to sion was significantly up-regulated as compared with the types of data. Values were expressed as mean  ±  stand- corresponding sham group (Fig.  2C; P < 0.05). As com- ard deviation (±SD). Univariate-factor measurement pared with the ischemia group, however, VEGF mRNA data was analyzed by one-way ANOVA, but two-factor expression in 10 % HS group was significantly decreased measurement data was analysed by two-way ANOVA. (Fig. 2C; *P < 0.05). Multiple comparisons were analyzed by Fisher’s Least In both sham and MCAO groups, VEGF expression was Significant Difference test method if the data was homo - detected specifically in astrocytes, as confirmed by dou - geneity of variance; otherwise, they were analyzed by ble immunofluorescence showing colocalization of GFAP. Dunnett’s T3 method. The difference was considered sta - At 24  h after MCAO, VEGF immunoreactivity in the tistically significance when P < 0.05. ischemia group (Fig. 2G–I) was markedly enhanced when compared with the sham group (Fig.  2D–F). In 10  % HS Results group (Fig. 2J–l), VEGF expression was evidently reversed Ipsilateral ischemic hemispheric BWC as compared with the ischemia group. VEGF expression as The Longa scores showed that no significant difference detected either by western or immunofluorescence in 10 % between ischemia group and 10 % HS group (Fig. 1A; ns: HS group showed that despite its reduction, it remained P  >  0.05). At 6, 12 and 24  h following MCAO, BWC in above the basal levels as expressed by the sham group. the ipsilateral ischemic hemispheres of ischemia group Furthermore, a feature worthy of note is that astrocytes in and 10  % HS group increased significantly when com - hypoxia group appeared hypertrophic (Fig.  2G–I) when pared with that in the corresponding sham operated compared with that in 10 % HS group and sham group. groups (Fig. 1B; P < 0.05); but, the difference in the BWC between ischemia group and 10 % HS group at 6, 12 and VEGFR2 mRNA and protein expression in the peri-ischemic 24 h following MCAO was significant (Fig.  1B; *P < 0.05). brain tissue It is evident that BWC in ischemia group is significantly In ischemia group, an up-regulated VEGFR2 protein greater than that in 10 % HS group. expression was observed in the peri-ischemic brain tissue Huang et al. BMC Neurosci (2016) 17:64 Page 6 of 15 Fig. 1 Assessment of BWC and Evans blue. Bar graph A the neurological score is not significantly different between ischemia group and 10 % HS group at 2 h after MCAO based on Zea-longa scores (ns: P > 0.05). Bar graph B the percentage of BWC in 10 % HS group was significantly decreased as compared with corresponding ischemia groups at 6, 12 and 24 h after MCAO (*P < 0.05). Bar graph C 10 % HS could reduce Evans blue extravasa- tion effectively when compared with corresponding ischemia groups at 6, 12 and 24 h after MCAO (*P < 0.05). indicates compared with sham group, P < 0.05. D, E and F Evans blue extravasation in each group at 24 h after MCAO. The values are presented as the mean ± SD (See figure on next page.) Fig. 2 VEGF mRNA and protein expression in the peri-ischemic brain tissue in each group. A VEGF (45 kDa) and GAPDH (37 kDa) immunoreactive bands, respectively. Bar graph B depicts significant changes in the optical density of VEGF expression when compared with the corresponding ischemia groups (*P < 0.05). Bar graph C the fold change in VEGF mRNA expression. When compared with ischemia group at 6, 12 and 24 h after MCAO, VEGF mRNA expression in corresponding 10 % HS group is evidently reduced (*P < 0.05). indicates compared with sham group, P < 0.05. The values are presented as the mean ± SD. Confocal images showing the distribution of GFAP labeled astrocytes (D, G, J, red), VEGF (E, H, K, green), and GFAP labeling overlapping VEGF immunofluorescence can be seen in F, I and L. Note that VEGF expression in astrocytes (arrows) is markedly enhanced at 24 h following MCAO. However, after treatment with 10 % HS, it is noticeably reduced. Scale bars (D–L), 50 μm Huang et al. BMC Neurosci (2016) 17:64 Page 7 of 15 Huang et al. BMC Neurosci (2016) 17:64 Page 8 of 15 at 6, 12 and 24  h after MCAO when compared with the with that in hypoxia group (Fig.  5A; *P  <  0.05). West- corresponding sham group (Fig.  3A, B; P  <  0.05). After ern blot analysis showed that VEGFR2 protein levels treatment with 10 % HS, however, VEGF protein expres- were significantly increased in primary astrocytes under sion in 10  % HS group was markedly decreased in com- hypoxic condition for 4  h when compared with that in parison to the ischemia group (Fig. 3A, B; *P < 0.05). control group (Fig. 5B, c; P < 0.05). But it was decreased A similar pattern change was observed in VEGFR2 significantly in HS group that was treated with 100  mM mRNA whose expression was markedly increased in HS (Fig. 5B, C; *P < 0.05). ischemia group at 6, 12 and 24 h following MCAO when Double immunofluorescence labeling showed that the compared with the corresponding sham group (Fig.  3C; GFAP labeling in astrocytes was totally coincident with P < 0.05). Treatment with 10 % HS markedly suppressed VEGFR2 expression (Fig.  5D–L). Following hypoxic the VEGFR2 mRNA expression level as compared with exposure for 4 h, VEGFR2 immunofluorescence in astro - the corresponding ischemia group (Fig. 3C; *P < 0.05). cytes was markedly increased in hypoxia group (Fig. 5G– Double immunofluorescence labeling showed that I). However, it was noticeably attenuated in 10  % HS VEGFR2 expression was specifically detected in cells, group (Fig. 5J–L) when compared with hypoxia group. confirmed to be the astrocytes by double labeling with GFAP (Figs.  3D–L). At 24  h after MCAO, very intense Zo-1, claudin-5 mRNA and protein expression in the VEGFR2 immunoreactivity was detected in ischemia peri-ischemic brain tissue group (Figs.  3G–I). It was also found in 10  % HS group Zo-1 and claudin-5 mRNA expression level was sig- (Figs.  3J–L) but the immunoreactivity was significantly nificantly decreased at 6, 12 and 24  h following MCAO decreased as compared with ischemia group. (Fig.  6A, B; P  <  0.05); however, at 6, 12 and 24  h after 10  % HS treatment, Zo-1 and claudin-5 were increased VEGF mRNA and protein expression in primary astrocytes significantly when compared with the corresponding VEGF mRNA was significantly increased in primary ischemia group (Fig. 6A, B; *P < 0.05). astrocytes at 4  h after hypoxia in comparison with the At 6, 12 and 24 h after MCAO, Zo-1 and claudin-5 pro- # # control group (Fig.  4A; P  <  0.05), but after treatment teins were significantly decreased (Fig.  6C, E; P  <  0.05), with 100  mM HS, VEGF mRNA in primary astrocytes but 10  % HS inhibited the down-regulation of them at in HS group was significantly decreased when compared each time point (Fig. 6C, E; *P < 0.05, **P < 0.01). with that in hypoxia group (Fig. 4A; *P < 0.05). The immu - noreactive band of VEGF protein levels that appeared at Discussion approximately 45 kDa, increased significantly in primary This study has shown that HS could significantly decrease astrocytes at 4 h after hypoxia when compared with that cerebral oedema. The present results suggest that such an in control group (Fig. 4B, C; P < 0.05). However, the opti- effect may be through restoring the BBB integrity as evi - cal density of VEGF protein in HS group that was treated denced by the reduced permeability to exogenous tracer with 100 mM HS was significantly decreased (Fig.  4B, C; EB that inundated the ischemic tissue after MCAO. Con- *P < 0.05). comitant to this is reduced VEGF, VEGFR2 and tight The results of double immunofluorescence showed junction proteins such as ZO-1 and claudin-5 expression that VEGF expression in astrocytes was completely co- suggesting their involvement in this process. It is there- localized with GFAP labeling. Very weak VEGF immu- fore suggested that 10 % HS is BBB protective in ischemic noreactivity was detected in control group (Fig.  4D–F). injuries. At 4  h after hypoxic exposure, VEGF immunoreactiv- Like most osmotic agents, HS could improve arterial ity was markedly enhanced in astrocytes (Fig.  4G–L) as pressure, lower ICP, and increase cerebral blood flow and compared with the control group (Fig. 4D–F), but VEGF oxygen delivery. It has been widely used for the treatment immunoexpression was evidently decreased at 4  h after of cerebral oedema because of its efficacy of decreasing treatment with 100 mM HS (Fig. 4J–L) and was compara- BWC [3]. In the present ischemia–reperfusion injury ble to that in the hypoxia group (Fig. 4G–I). experimental model, an obvious cerebral oedema was observed; but, after treatment with 10 % HS, the BWC of VEGFR2 mRNA and protein expression in primary 10  % HS group was significantly decreased as compared astrocytes with the corresponding ischemia group. These results are At 4  h after hypoxia, VEGFR2 mRNA was significantly consistent with the previous studies that HS could drasti- increased in primary astrocytes when compared with the cally reduce BWC [31–33] and, hence, cerebral oedema. control group (Fig. 5A; P < 0.05), but following treatment It has been reported that the alteration of BBB per- with 100 mM HS, VEGFR2 mRNA in primary astrocytes meability and the damage of BBB integrity were closely in HS group was significantly decreased in comparison related to cerebral oedema [34]. BBB is a selective Huang et al. BMC Neurosci (2016) 17:64 Page 9 of 15 Fig. 3 VEGFR2 mRNA and protein expression in the peri-ischemic brain tissue in each group. A VEGFR2 (154 kDa) and GAPDH (37 kDa) immuno- reactive bands, respectively. Bar graph B the optical density of VEGFR2 expression in 10 % HS group at 6, 12 and 24 h after MCAO is significantly decreased when compared with the corresponding ischemia group (*P < 0.05). Bar graph C the fold change in VEGFR2 mRNA expression. Significant differences in mRNA level in ischemia group at 6, 12 and 24 h after MCAO is evident when compared with the corresponding 10 % HS groups (*P < 0.05). indicates compared with sham group, P < 0.05. The values are presented as the mean ± SD. Immunofluorescence images showing the distribution of GFAP (D, G, J, red) and VEGFR2 (E, H, K, green) in astrocytes (arrows) after MCAO for 12 h. Co-localization of GFAP and VEGFR2 can be seen in F, I and L. Note expression of VEGFR2 is down-regulated after treatment with 10 % HS. Scale bars (D–L), 20 μm Huang et al. BMC Neurosci (2016) 17:64 Page 10 of 15 Fig. 4 VEGF mRNA and protein expression in primary astrocytes. Bar graph A VEGF mRNA expression in HS group was significantly decreased in comparison to hypoxia group after hypoxia for 4 h. B VEGF (45 kDa) and GAPDH (37 kDa) immunoreactive bands, respectively. Bar graph C the optical density of VEGF expression in HS group was drastically attenuated when compared with the hypoxia group (*P < 0.05). indicates compared with sham group, P < 0.05. The values are presented as the mean ± SD. Immunofluorescence images showing GFAP labelled astrocytes (D, G, J, red), double labelled with VEGF (E, H, K, green). Co-localized expression of GFAP and VEGF in astrocytes can be seen in F, I and L. Note that VEGF expression in astrocytes is markedly enhanced at 24 h following MCAO. However, after treatment with 10 % HS, it is noticeably reduced. Scale bars (D–L), 20 μm Huang et al. BMC Neurosci (2016) 17:64 Page 11 of 15 Fig. 5 VEGFR2 mRNA and protein expression in primary astrocytes. Bar graph A VEGFR2 mRNA expression in HS group was significantly decreased in comparison to hypoxia group after hypoxia for 4 h. B VEGFR2 (154 kDa) and GAPDH (37 kDa) immunoreactive bands, respectively. Bar graph C the optical density of VEGFR2 expression in HS group was drastically attenuated when compared with the hypoxia group (*P < 0.05). indicates compared with sham group, P < 0.05. The values are presented as the mean ± SD. Double immunofluorescence images show that the expression of GFAP (D, G, J, red), VEGFR2 (E, H, K, green). The co-localized expression of GFAP and VEGFR2 can be seen in F, I and L. Note expression of VEGFR2 is markedly enhanced after hypoxia which is reduced by HS. Scale bars (D–L), 20 μm Huang et al. BMC Neurosci (2016) 17:64 Page 12 of 15 Fig. 6 Zo-1, claudin-5 mRNA and protein expression in the peri-ischemic brain tissue in each group. Bar graphs A, B the mRNA expressions of Zo-1, claudin-5 were significantly decreased at 6, 12 and 24 h after MCAO, respectively, as compared with the corresponding sham group ( indicates compared with the corresponding sham group, P < 0.05), but they were increased significantly at corresponding ischemia group after treatment with 10 % HS (*P < 0.05, **P < 0.01). C Zo-1 (225 kDa), claudin-5 (22 kDa) and GAPDH (37 kDa) immunoreactive bands, respectively. As seen in Bar graphs D, E the optical density of Zo-1, claudin-5 was significantly attenuated after MCAO at 6, 12 and 24 h ( indicates compared with sham group, P < 0.05). But 10 % HS could inhibit the down-regulation of Zo-1, claudin-5 protein expression effectively at 6, 12 h after MCAO (*P < 0.05, **P < 0.01, ns non-significant). The values are presented as the mean ± SD semi-permeability membrane. It separates the brain after ischemia–reperfusion. The results are therefore in parenchyma from the peripheral circulation and stabi- accord with previous report that ischemia–reperfusion lizes the microenvironment of neurons, keeping it from caused an up-regulation of BBB permeability and break- deleterious effects of certain substances from blood [11, down [28]. As expected, after treatment with 10 % HS, EB 35]. The disruption of BBB will lead to extravasation of extravasation was significantly decreased. These results intravascular substances into the brain extracellular demonstrate that 10  % HS ameliorates cerebral oedema spaces. The present results have shown that EB extravasa - through reduction of BBB permeability and protection of tion in the ischemic hemisphere was gradually increased BBB integrity. The pertinent question arose from this was up to 24  h. This was coupled by an increase in BWC whether HS could perform such a function. Huang et al. BMC Neurosci (2016) 17:64 Page 13 of 15 VEGF is known as a pivotal vascular permeability fac- effectively. This suggests that VEGF expression is tor. In some pathological situations, such as MCAO [36], increased in astrocytes after ischemia–reperfusion and and brain injury [37], VEGF was remarkably increased HS intervention could inhibit its expression. in the border area of the lesion. Increased VEGF has In vitro, hypoxia model of primary astrocytes was been reported to induce leakage of BBB [38, 39]. This also performed to further determine the effect of HS not only leads to the formation of cerebral oedema but on the expression of VEGF and VEGFR2 in astrocytes. also aggravates it [38, 40, 41]. Application of a neutraliz- The results are in concert with in  vivo experiments. The ing anti-VEGF antibody can reverse the cerebral oedema levels of VEGF, VEGFR2 mRNA and protein expres- caused by VEGF [39]. It has also been reported that rats sion were significantly augmented, but they were mark - treatment with VEGF protein in early phase of cerebral edly depressed after treatment with 100 mM HS. Double ischemic leads to increase in BBB permeability, or even immunofluorescence labelling also supported this which intracerebral haemorrhage which are reduced by VEGF demonstrates that HS could directly suppress the expres- inhibitor [38]. sion of VEGF and VEGFR2 in astrocytes. VEGFR2, a major receptor of VEGF, is also an impor- Finally, it remains to be explained on why inhibition tant mediator of vascular permeability [42]. It is overex- of HS on VEGF and VEGFR2 expression had a benefi - pressed in endothelial cells, astrocytes, neuronal somata cial effect on down-regulating the permeability of BBB. and processes adjacent to the damage after brain injury The reason for this may be that VEGF could regulate the [42]. Previous reports have suggested that VEGFR2, like expression of components of the tight junction such as VEGF, increases with increasing BBB permeability during ZO-1, claudin-5 etc. the acute phase of cerebral oedema induced by various ZO-1 and claudin-5 are the main components of tight injuries [16, 19, 43]. Moreover, the effects of VEGF on junction. Previous study has showed that VEGF could BBB junction components were VEGFR2 dependent, and down-regulate ZO-1, and claudin-5 expression through inhibition of VEGF–VEGFR2 axis is beneficial to amelio - PLCγ/PKC/eNOS signaling pathway leading to the dis- rate oedema [44]. ruption of BBB. Silencing of VEGF expression in astro- The above-mentioned findings have demonstrated cytes by using siRNA, or inhibiting PLCγ/PKC/eNOS that BBB permeability and integrity are closely linked to signaling pathway in endothelial cells by specific inhibi - VEGF and VEGFR2. As a corollary, targeting at VEGF tor of PLCγ and eNOS could inhibit down-regulation of and VEGFR2 may prove to be a potential therapeutic claudin-5 and hence, the permeability of BBB is reduced strategy to prevent brain oedema formation. In view of [47]. this, we further defined whether HS would affect the In this study, HS could also inhibit the down-regu- expression of VEGF and VEGFR2. Indeed we show here lation of ZO-1, and claudin-5 significantly. Therefore, that expression of VEGF, VEGFR2 mRNA and protein the mechanism whereby HS could ameliorate cerebral was significantly up-regulated at 6  h after MCAO peak - oedema may be via inhibition of VEGF-mediated down- ing at 12  h. More strikingly, when compared with the regulation of ZO-1, and claudin-5 to protect the integrity ischemia group, the 10  % HS group displays a lower of BBB. It is suggested that the PLCγ/PKC/eNOS signal- VEGF, VEGFR2 mRNA and protein expression. The ing pathway maybe involved in this process, but it needs changes correlate with the reduced BBB permeability to be further clarified. after treatment with 10 % HS. This suggests that HS may It has been reported that VEGF expression is also down-regulate the BBB permeability through inhibiting detected in vascular endothelial cells and neurons. The VEGF and VEGFR2 expression. Hypoxia inducible fac- possibility that HS can also inhibit VEGF expression in tor-1 (HIF-1) has been implicated in the expression of these cells should therefore be considered. In addition, VEGF [45, 46] and this may offer explanation for the inhi - VEGF is also known as an important driver of immune bition of HS on VEGF, but further studies are necessary cell infiltration [49– 51]. This implicates that inhibi - to confirm this possibility. tion of VEGF may be beneficial to reduce inflammatory It is known that astrocytes play a significant role in response as well. We had reported previously that HS maintaining BBB permeability and integrity [11, 47, 48]. could significantly decrease TNF-α and IL-1β expres - In CNS inflammatory disease, astrocyte-derived VEGF-A sion levels through inhibition of JNK signaling pathway could aggravate BBB disruption. Inhibition of the VEGF in microglia [52]. It is well documented that inflamma - expression in astrocytes plays a protective role in BBB tory cytokines such as TNF-α and IL-1β are also pro- function [47]. The present results have shown that the duced by astrocytes via JNK signalling pathway [53], VEGF expression in astrocytes was remarkably increased and that they are known to be mediators of BBB dis- after MCAO, and 10  % HS could down-regulate it ruption [12]. Therefore, decreasing the production of Huang et al. BMC Neurosci (2016) 17:64 Page 14 of 15 Consent to publish proinflammatory cytokines released by astrocytes by All authors consent to publish. HS may prove to be beneficial or protective for the per - meability integrity of BBB. In the lack of experimental Ethics and consent to participate All the animal experimental procedures were approved by Institutional Animal evidence for this in this study, this remains purely specu- Care and Use Committee, Guangdong Province, China (NO.GBREC2012106A). lative. This study showed that the augmented VEGF and All experiments were carried out in accordance with the National Institute of VEGFR2 expression after ischemia–reperfusion plays an Health Guide for the Care and Use of Laboratory Animals. important role in increasing BBB permeability that exac- Funding erbates cerebral oedema as manifested by the leakage National Clinical Key Subject Construction Project (2012-649), Guangzhou of EB in the peri-ischemic brain tissue and the increase Clinical Medicine Research and Translational Centre Construction Project (201508020005), National Natural Science Foundation of China (81272150; of BWC. HS therefore has additional role by protecting 81271329), Science and Technology Foundation of Guangdong Province BBB permeability and can ameliorate cerebral oedema (2012B031800308). through inhibition of VEGF and VEGFR2-mediated Received: 9 October 2015 Accepted: 17 May 2016 tight junction disruption. Conclusion In conclusion, we have shown that ischemia–rep- erfusion induced up-regulated VEGF and VEGR2 References expression on astrocytes leading to subsequent down- 1. Qureshi AI, Suarez JI. Use of hypertonic saline solutions in treatment of cerebral edema and intracranial hypertension. Crit Care Med. regulation of ZO-1 and claudin-5 which contributes to 2000;28(9):3301–13. BBB dysfunction notably its increased permeability but 2. Donkin JJ, Vink R. Mechanisms of cerebral edema in traumatic brain that may be effectively reduced by HS. This has fur - injury: therapeutic developments. Curr Opin Neurol. 2010;23(3):293–9. 3. Ziai WC, Toung TJ, Bhardwaj A. Hypertonic saline: first-line therapy for thered and amplified our understanding of the mecha - cerebral edema? J Neurol Sci. 2007;261(1–2):157–66. nistic and molecular roles of HS in clinical management 4. Zeng HK, Wang QS, Deng YY, Jiang WQ, Fang M, Chen CB, Jiang X. A com- of cerebral oedema. parative study on the efficacy of 10% hypertonic saline and equal volume of 20% mannitol in the treatment of experimentally induced cerebral edema in adult rats. BMC Neurosci. 2010;11:153. 5. Schwarz S, Georgiadis D, Aschoff A, Schwab S. Eec ff ts of hypertonic (10%) Abbreviations saline in patients with raised intracranial pressure after stroke. Stroke. HS: hypertonic saline; BWC: brain water content; VEGF: vascular endothelial 2002;33(1):136–40. growth factor; VEGFR2: vascular endothelial growth factor receptor 2; EB: Evans 6. Nout YS, Mihai G, Tovar CA, Schmalbrock P, Bresnahan JC, Beattie MS. blue; MCAO: middle cerebral artery occlusion; CCA: common carotid artery; Hypertonic saline attenuates cord swelling and edema in experimental ECA: external carotid artery; ICA: internal carotid artery; DMEM-F12: Dulbecco’s spinal cord injury: a study utilizing magnetic resonance imaging. Crit Care Modified Eagle Medium/Nutrient Mixture-F12; FBS: fetal bovine serum; GFAP: Med. 2009;37(7):2160–6. glial fibrillary acidic protein; BBB: blood–brain barrier. 7. Zeng HK, Wang QS, Deng YY, Fang M, Chen CB, Fu YH, Jiang WQ, Jiang X. Hypertonic saline ameliorates cerebral edema through down- Authors’ contributions regulation of aquaporin-4 expression in the astrocytes. Neuroscience. WC carried out assessment of the VEGF and VEGFR2 expression in the cerebral 2010;166(3):878–85. cortex astrocytes by western blotting, Real-time RT-PCR. LH participated in 8. Cao C, Yu X, Liao Z, Zhu N, Huo H, Wang M, Ji G, She H, Luo Z, Yue study of effect of HS on VEGF and VEGFR2 expression in primary astrocytes, S. Hypertonic saline reduces lipopolysaccharide-induced mouse collected data and drafted the manuscript. GZ and YH carried out assessment brain edema through inhibiting aquaporin 4 expression. Crit Care. of the BWC after MCAO. YD participated in the design of the study and drafted 2012;16(5):R186. the manuscript. HZ carried out the design of the study and performed the 9. Simard JM, Kent TA, Chen M, Tarasov KV, Gerzanich V. Brain oedema in statistical analysis. All authors read and approved the final manuscript. focal ischaemia: molecular pathophysiology and theoretical implications. Lancet Neurol. 2007;6(3):258–68. Author details 10. Kahle KT, Simard JM, Staley KJ, Nahed BV, Jones PS, Sun D. Molecular Department of Emergency and Critical Care Medicine, Guangdong General mechanisms of ischemic cerebral edema: role of electroneutral ion trans- Hospital, Guangdong Academy of Medical Sciences, Guangzhou 510080, Peo- port. Physiol (Bethesda). 2009;24:257–65. ple’s Republic of China. Zhuzhou Central Hospital, Zhuzhou 412007, People’s 11. Hawkins BT, Davis TP. The blood-brain barrier/neurovascular unit in health Republic of China. and disease. Pharmacol Rev. 2005;57(2):173–85. 12. Kaur C, Ling EA. Blood brain barrier in hypoxic-ischemic conditions. Curr Acknowledgements Neurovasc Res. 2008;5(1):71–81. This study was supported by National Clinical Key Subject Construction 13. Dente CJ, Steffes CP, Speyer C, Tyburski JG. Pericytes augment the capil- Project (2012-649), Guangzhou Clinical Medicine Research and Translational lary barrier in in vitro cocultures. J Surg Res. 2001;97(1):85–91. Centre Construction Project (201508020005), National Natural Science Foun- 14. Mayhan WG. VEGF increases permeability of the blood-brain barrier dation of China (81272150; 81271329), Science and Technology Foundation of via a nitric oxide synthase/cGMP-dependent pathway. Am J Physiol. Guangdong Province (2012B031800308). The authors would like to thank Mr. 1999;276(5 Pt 1):C1148–53. Lin Lin Guo and Mr. Yu Kai Huang for technical assistance. 15. Dvorak HF, Brown LF, Detmar M, Dvorak AM. Vascular permeability factor/ vascular endothelial growth factor, microvascular hyperpermeability, and Competing interests angiogenesis. Am J Pathol. 1995;146(5):1029–39. The authors declare that they have no competing interests. 16. Skold MK, von Gertten C, Sandberg-Nordqvist AC, Mathiesen T, Holmin S. VEGF and VEGF receptor expression after experimental brain contusion in Availability of data and materials rat. J Neurotrauma. 2005;22(3):353–67. All the data supporting findings is contained within the manuscript. Huang et al. BMC Neurosci (2016) 17:64 Page 15 of 15 17. Olsson AK, Dimberg A, Kreuger J, Claesson-Welsh L. VEGF recep- 40. Valable S, Montaner J, Bellail A, Berezowski V, Brillault J, Cecchelli R, tor signalling—in control of vascular function. Nat Rev Mol Cell Biol. Divoux D, Mackenzie ET, Bernaudin M, Roussel S, et al. VEGF-induced BBB 2006;7(5):359–71. permeability is associated with an MMP-9 activity increase in cerebral 18. Shimotake J, Derugin N, Wendland M, Vexler ZS, Ferriero DM. Vascular ischemia: both effects decreased by Ang-1. J Cereb Blood Flow Metab. endothelial growth factor receptor-2 inhibition promotes cell death and 2005;25(11):1491–504. limits endothelial cell proliferation in a neonatal rodent model of stroke. 41. Paul R, Zhang ZG, Eliceiri BP, Jiang Q, Boccia AD, Zhang RL, Chopp M, Stroke. 2010;41(2):343–9. Cheresh DA. Src deficiency or blockade of Src activity in mice provides 19. Lennmyr F, Ata KA, Funa K, Olsson Y, Terent A. Expression of vascular cerebral protection following stroke. Nat Med. 2001;7(2):222–7. endothelial growth factor ( VEGF) and its receptors (Flt-1 and Flk-1) follow- 42. Lafuente JV, Argandona EG, Mitre B. VEGFR-2 expression in brain injury: ing permanent and transient occlusion of the middle cerebral artery in its distribution related to brain-blood barrier markers. J Neural Transm. the rat. J Neuropathol Exp Neurol. 1998;57(9):874–82. 2006;113(4):487–96. 20. Lennmyr F, Terent A, Syvanen AC, Barbany G. Vascular endothelial growth 43. Kovacs Z, Ikezaki K, Samoto K, Inamura T, Fukui M. VEGF and flt expression factor gene expression in middle cerebral artery occlusion in the rat. Acta time kinetics in rat brain infarct. Stroke. 1996;27(10):1865–73. Anaesthesiol Scand. 2005;49(4):488–93. 44. Vohra PK, Hoeppner LH, Sagar G, Dutta SK, Misra S, Hubmayr RD, Muk- 21. Luissint AC, Artus C, Glacial F, Ganeshamoorthy K, Couraud P. Tight junc- hopadhyay D. Dopamine inhibits pulmonary edema through the VEGF– tions at the blood brain barrier physiological architecture and disease- VEGFR2 axis in a murine model of acute lung injury. Am J Physiol Lung associated dysregulation. Fluids Barriers CNS. 2012;23(9):1. Cell Mol Physiol. 2012;302(2):L185–92. 22. Jiao H, Wang Z, Liu Y, Wang P, Xue Y. Specific role of tight junction proteins 45. Argaw AT, Zhang Y, Snyder BJ, Zhao ML, Kopp N, Lee SC, Raine CS, claudin-5, occludin, and ZO-1 of the blood-brain barrier in a focal cerebral Brosnan CF, John GR. IL-1beta regulates blood-brain barrier permeabil- ischemic insult. J Mol Neurosci. 2011;44(2):130–9. ity via reactivation of the hypoxia-angiogenesis program. J Immunol. 23. Longa EZ, Weinstein PR, Carlson S, Cummins R. Reversible middle cerebral 2006;177(8):5574–84. artery occlusion without craniectomy in rats. Stroke. 1989;20(1):84–91. 46. Forsythe JA, Jiang BH, Iyer NV, Agani F, Leung SW, Koos RD, Semenza GL. 24. Toung TJ, Tyler B, Brem H, Traystman RJ, Hurn PD, Bhardwaj A. Hypertonic Activation of vascular endothelial growth factor gene transcription by saline ameliorates cerebral edema associated with experimental brain hypoxia-inducible factor 1. Mol Cell Biol. 1996;16(9):4604–13. tumor. J Neurosurg Anesthesiol. 2002;14(3):187–93. 47. Argaw AT, Asp L, Zhang J, Navrazhina K, Pham T, Mariani JN, Mahase 25. Shi J, Panickar KS, Yang SH, Rabbani O, Day AL, Simpkins JW. Estro- S, Dutta DJ, Seto J, Kramer EG, et al. Astrocyte-derived VEGF-A drives gen attenuates over-expression of beta-amyloid precursor protein blood-brain barrier disruption in CNS inflammatory disease. J Clin Invest. messager RNA in an animal model of focal ischemia. Brain Res. 2012;122(7):2454–68. 1998;810(1–2):87–92. 48. Abbott NJ. Astrocyte-endothelial interactions and blood-brain barrier 26. McCarthy KD, de Vellis J. Preparation of separate astroglial and oligodendro- permeability. J Anat. 2002;200(6):629–38. glial cell cultures from rat cerebral tissue. J Cell Biol. 1980;85(3):890–902. 49. Yang ZF, Poon RT, Luo Y, Cheung CK, Ho DW, Lo CM, Fan ST. Up-regulation 27. Thiagarajah JR, Papadopoulos MC, Verkman AS. Noninvasive early detec- of vascular endothelial growth factor ( VEGF) in small-for-size liver grafts tion of brain edema in mice by near-infrared light scattering. J Neurosci enhances macrophage activities through VEGF receptor 2-dependent Res. 2005;80(2):293–9. pathway. J Immunol. 2004;173(4):2507–15. 28. Lee JH, Cui HS, Shin SK, Kim JM, Kim SY, Lee JE, Koo BN. Eec ff t of propofol 50. Argaw AT, Gurfein BT, Zhang Y, Zameer A, John GR. VEGF-mediated dis- post-treatment on blood–brain barrier integrity and cerebral edema after ruption of endothelial CLN-5 promotes blood-brain barrier breakdown. transient cerebral ischemia in rats. Neurochem Res. 2013;38(11):2276–86. Proc Natl Acad Sci USA. 2009;106(6):1977–82. 29. Belayev L, Busto R, Zhao W, Ginsberg MD. Quantitative evaluation of 51. Proescholdt MA, Jacobson S, Tresser N, Oldfield EH, Merrill MJ. Vascular blood-brain barrier permeability following middle cerebral artery occlu- endothelial growth factor is expressed in multiple sclerosis plaques and sion in rats. Brain Res. 1996;739(1–2):88–96. can induce inflammatory lesions in experimental allergic encephalomy- 30. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using elitis rats. J Neuropathol Exp Neurol. 2002;61(10):914–25. real-time quantitative PCR and the 2(−Delta Delta C( T )) Method. Meth- 52. Huang LQ, Zhu GF, Deng YY, Jiang WQ, Fang M, Chen CB, Cao W, Wen ods. 2001;25(4):402–8. MY, Han YL, Zeng HK. Hypertonic saline alleviates cerebral edema by 31. Mortazavi MM, Romeo AK, Deep A, Griessenauer CJ, Shoja MM, Tubbs inhibiting microglia-derived TNF-alpha and IL-1beta-induced Na-K-Cl RS, Fisher W. Hypertonic saline for treating raised intracranial pressure: Cotransporter up-regulation. J Neuroinflamm. 2014;11:102. literature review with meta-analysis. J Neurosurg. 2012;116(1):210–21. 53. Deng YY, Lu J, Ling EA, Kaur C. Microglia-derived macrophage colony 32. Toung TJ, Chen CH, Lin C, Bhardwaj A. Osmotherapy with hypertonic stimulating factor promotes generation of proinflammatory cytokines saline attenuates water content in brain and extracerebral organs. Crit by astrocytes in the periventricular white matter in the hypoxic neonatal Care Med. 2007;35(2):526–31. brain. Brain Pathol. 2010;20(5):909–25. 33. Chen CH, Xue R, Zhang J, Li X, Mori S, Bhardwaj A. Eec ff t of osmotherapy with hypertonic saline on regional cerebral edema following experimen- tal stroke: a study utilizing magnetic resonance imaging. Neurocrit Care. 2007;7(1):92–100. 34. Huang P, Zhou CM, Liu YY, Hu BH, Chang X, Zhao XR, Xu XS, Li Q, Wei XH, et al. Cerebralcare Granule attenuates blood-brain barrier disruption after middle cerebral artery occlusion in rats. Exp Neurol. Submit your next manuscript to BioMed Central 2012;237(2):453–63. and we will help you at every step: 35. Anfuso CD, Lupo G, Romeo L, Giurdanella G, Motta C, Pascale A, Tirolo C, Marchetti B, Alberghina M. Endothelial cell-pericyte cocultures induce • We accept pre-submission inquiries PLA2 protein expression through activation of PKCalpha and the MAPK/ • Our selector tool helps you to find the most relevant journal ERK cascade. J Lipid Res. 2007;48(4):782–93. • We provide round the clock customer support 36. Croll SD, Wiegand SJ. Vascular growth factors in cerebral ischemia. Mol Neurobiol. 2001;23(2–3):121–35. • Convenient online submission 37. Pilitsis JG, Rengachary SS. Complications of head injury. Neurol Res. • Thorough peer review 2001;23(2–3):227–36. • Inclusion in PubMed and all major indexing services 38. Zhang ZG, Zhang L, Jiang Q, Zhang R, Davies K, Powers C, Bruggen N, Chopp M. VEGF enhances angiogenesis and promotes blood-brain bar- • Maximum visibility for your research rier leakage in the ischemic brain. J Clin Invest. 2000;106(7):829–38. 39. Schoch HJ, Fischer S, Marti HH. Hypoxia-induced vascular endothelial Submit your manuscript at growth factor expression causes vascular leakage in the brain. Brain. www.biomedcentral.com/submit 2002;125(Pt 11):2549–57.

Journal

BMC Neuroscience – Springer Journals

Published: Oct 13, 2016

There are no references for this article.