Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/springer-journals/integrated-foam-fractionation-for-heterologous-rhamnolipid-production-f0gzGrHOi4
- Publisher
- Springer Journals
- Copyright
- Copyright © 2016 by Beuker et al.
- Subject
- Life Sciences; Microbiology; Microbial Genetics and Genomics; Biotechnology
- eISSN
- 2191-0855
- DOI
- 10.1186/s13568-016-0183-2
- pmid
- 26860613
- Publisher site
- See Article on Publisher Site
Abstract
Heterologeous production of rhamnolipids in Pseudomonas putida is characterized by advantages of a non-path- ogenic host and avoidance of the native quorum sensing regulation in Pseudomonas aeruginosa. Yet, downstream processing is a major problem in rhamnolipid production and increases in complexity at low rhamnolipid titers and when using chemical foam control. This leaves the necessity of a simple concentrating and purification method. Foam fractionation is an elegant method for in situ product removal when producing microbial surfactants. However, up to now in situ foam fractionation is nearly exclusively reported for the production of surfactin with Bacillus subtilis. So far no cultivation integrated foam fractionation process for rhamnolipid production has been reported. This is prob- ably due to excessive bacterial foam enrichment in that system. In this article a simple integrated foam fractionation process is reported for heterologous rhamnolipid production in a bioreactor with easily manageable bacterial foam enrichments. Rhamnolipids were highly concentrated in the foam during the cultivation process with enrichment factors up to 200. The described process was evaluated at different pH, media compositions and temperatures. Foam fractionation processes were characterized by calculating procedural parameter including rhamnolipid and bacte- rial enrichment, rhamnolipid recovery, Y , Y , and specific as well as volumetric productivities. Comparing foam X/S P/X fractionation parameters of the rhamnolipid process with the surfactin process a high effectiveness of the integrated foam fractionation for rhamnolipid production was demonstrated. Keywords: Foam fractionation, Heterologous rhamnolipid, Pseudomonas putida, Downstream processing, In situ product removal (ISPR), Biosurfactant −1 concentration) as low as 10–200 mg L (Lang and Wull- Introduction brandt 1999). Foam of rhamnolipids can exhibit gas con- Consumer concern for renewable sources of products tents from up to 99 % using rhamnolipid concentrations gained importance in the past. Microbially produced from 0.5, 1.0 and 1.5 % and display foam stabilities (time biosurfactants with their renewable raw material meet costumers requests. Rhamnolipids are one of the most till half of the foam collapsed at atmospheric pressure intensively studied microbial produced biosurfactants. and room temperature) of 17–41 min (Wang and Mulli- Rhamnolipids lower surface tension of water from 72 gan 2004). −1 to 25–30 mN m Bergström et al. (1946) firstly described rhamnolip - and exhibit CMCs (critical micelle ids and the structure of rhamnolipids was elucidated by Jarvis and Johnson (1949). In general, rhamnolipids con- tain one or two rhamnose moieties glycosidically bound *Correspondence: marius.henkel@uni-hohenheim.de Institute of Food Science and Biotechnology, Department of Bioprocess to a lipid moiety made out of one, two or three β-hydroxy Engineering (150k), University of Hohenheim, Fruwirthstr. 12, fatty acid chains which are in turn bound together 70599 Stuttgart, Germany through an ester bound (Abdel-Mawgoud et al. 2010). Full list of author information is available at the end of the article © 2016 Beuker et al. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. Beuker et al. AMB Expr (2016) 6:11 Page 2 of 10 Depending on the amount of rhamnose moieties rham- rhamnolipids can be retained using ultrafiltration with a nolipids are referred to as mono- or di- rhamnolipids. membrane cutoff of 10 kDa (Mulligan and Gibbs 1990). Production of rhamnolipids is mainly described in the An elegant downstream processing method for in situ opportunistic pathogen Pseudomonas aeruginosa using product concentrating and purification is foam fractiona - shake flask, batch, fed-batch or continuous systems (Mul - tion. It was previously shown that simple cultivation ligan et al. 1989; Wei et al. 2005; Müller et al. 2010, 2012). integrated foam fractionation is an effective tool for bio - Heterologeous production of rhamnolipids in Pseu- surfactant production e.g. of surfactin using Bacillus sub- domonas putida counteracts obstacles of strain patho- tilis (Chen et al. 2006; Willenbacher et al. 2014, 2015) or genicity and the native quorum sensing regulation in P. HFBII using Saccharomyces cerevisiae (Winterburn et al. aeruginosa (Ochsner et al. 1995; Cha et al. 2008; Wittgens 2011). The usability of foam fractionation in rhamnolipid et al. 2011; Henkel et al. 2013, 2014). First heterologous purification and concentration in a cell free process was rhamnolipid production was described by Ochsner et al. shown previously (Sarachat et al. 2010). However, cul- (1995) using P. putida, Escherichia coli and Pseudomonas tivation integrated foam fractionation in rhamnolipid uore fl scens as recombinant production hosts. P. putida production was shown to be not feasible due to highly −1 reached highest yields and productivities with 0.6 g L concentrated biomass in the foam leading to the neces- −1 −1 and 25 mg L h , respectively. Therefore, in this study sity to develop solutions regarding cell retention e.g. the fully sequenced P. putida KT2440 was used exhibit- using magnetic separation or cell recycling (Gruber 1991; ing a non-pathogenic character, close relativity and there- Heyd et al. 2011; Küpper et al. 2013). fore similar precursor capabilities to P. aeruginosa and In this article a cultivation integrated foam fractiona- availability of many established genetic tools like native tion process for rhamnolipids in a bioreactor using P. and synthetic inducible promoter systems and different putida KT2440 as a heterologous production strain is vector systems (Ochsner et al. 1995; Nelson et al. 2002; described with low biomass enrichment in the foamate Loeschcke and Thies 2015). However, reported heter - giving the opportunity to remove highly concentrated ologous rhamnolipid production with maximal product rhamnolipids from the cultivation broth in situ. −1 concentration of 7.3 g L (Cha et al. 2008) is by far not comparable to rhamnolipid production using P. aerugi- Materials and methods nosa wild type strains. Chemicals For rhamnolipid downstream processing several meth- All chemicals used in the current study were purchased ods are reported in literature and well summarized by from Carl Roth GmbH (Karlsruhe, Germany) if not Mukherjee et al. (2006) and Heyd et al. (2008). Next to stated otherwise. precipitation methods using either acid or ammonium sulfate followed by centrifugation (Zhang and Miller Microorganism and plasmid 1992; Déziel et al. 1999; Heyd et al. 2008) solvent extrac- A genetically engineered P. putida KT2440 strain pro- tion is a possible downstream processing method and ducing mono-rhamnolipids was used in all foam frac- may be combined with precipitation methods (Schenk tionation experiments. et al. 1995). Following solvent extraction selective crys- The genetic construct pSynPro8oT_rhlAB was obtained tallization could be applied and/or chromatographic as follows. The vector backbone (pBBR-P ) was amplified purification (Manso Pajarron et al. 1993) to obtain pure from pBBR1MCS-3 (Kovach et al. 1995) without promot- rhamnolipid crystals. ers, lac operator and lacZ gene and multiple cloning site Next to solvent and precipitation methods also adsorp- using the forward primer AAAACTTAAGTGGGGT tion methods are used in rhamnolipid downstream pro- GCCTAATGAGTGAGCTAACTCAC and the reversed cessing (Reiling et al. 1986). However, using Amberlite 2 primer TTTAGATCTTAACCAATAGGCCGACTGCGA or 16 resins or wood activated carbon also requires sol- TGAGTGG. The linear PCR product was phosphorylated vents for rhamnolipid recovery (Dubey et al. 2005; Heyd and ligated. et al. 2008). To obtain a simple detection method for rhlAB tran- Furthermore, anion exchange chromatography may scription a lov gene, an oxygen independent fluorescing be applied for downstream processing of rhamnolipids domain, was integrated in the vector construct. There - (Reiling et al. 1986). This method is based on the nega - fore, a 745 bp fragment containing a lov gene, a MluI tive charge of rhamnolipids at high pH. However, anion and SspI restriction site upstream of the lov gene, two exchange chromatography leads to a rhamnolipid mix- flanking transcription terminators and restriction sites ture still containing some fatty acids as well as pigments. for BglII and BspTI (Term-lov-Term) was subcloned via Additionally membrane filtration may be used BglII and BspTI into pBBR-P referred to as pTLT-vector. for rhamnolipid enrichment. The micelle building The Term-lov-Term fragment was designed as described Beuker et al. AMB Expr (2016) 6:11 Page 3 of 10 below and produced by GeneArt AG (Regensburg, Ger- Real time PCR many). As terminators the BBa_B0015 variant avail- LB cultures were inoculated to OD 0.05 using an over- able from iGEM (international genetically engineered night culture and incubated at 30 °C for 24 h. Total RNA machine competition) was used. Information for the lov was isolated of 1 ml culture and cDNA was synthesized gene and 20 bp upstream of the start codon was taken by reverse transcription. Afterwards, 50 ng cDNA was XN from a commercially available plasmid pGLOW-K - used for real time PCR and the amount of transcript Bs2 (Evocatal GmbH, Düsseldorf, Germany). Addition- was quantified using specific TaqMan probes (Applied ally, two restriction sites (MluI and SspI) were integrated Biosystems, Waltham, MA, USA). A PCR product of the between the first terminator and the lov gene. A BglII and synthetic rhlAB-lov operon was used as standard with its BspTI restriction site started and ended the fragment, concentration photometrically determined beforehand. respectively. The overall sequence of the Term-lov-Term fragment is provided as Additional file 1: Table S1. Culture conditions For rhamnolipid transcription different new synthetic Media promoters (P ) were developed following the strategy of Tetracycline was added to all media to an end concentra- syn −1 Jensen and Hammer (1998). −35 and −10 regions were tion of 20 mg L . 70 −1 taken from the consensus sequence of σ promoters For the first culture LB medium (5 g L yeast extract −1 whereas spacer and flanking regions were randomized. (BD, Heidelberg), 10 g L tryptone (BD, Heidel- −1 Therefore, many promoters were generated harbor - berg), 5 g L NaCl; pH 7.0) was utilized. For seed cul- ing a sequence of 5′–NNNNNTTGACANNNNNNN ture either cultivation medium adapted from Wilms NNNNNNNNNNTATAATNNNNNN–3′. To merge et al. (2001) using a phosophate buffer system (Wilms −1 −1 −1 these promoters in front of the rhamnosyl transferase medium: 2.6 g L K HPO , 0.65 g L KH PO , 5 g L 2 4 2 4 −1 −1 −1 genes, forward primers were constructed containing (NH ) SO , 0.5 g L NH Cl, 2 g L Na SO , 0.5 g L 4 2 4 4 2 4 −1 −1 DNA of the different promoter as well as a hybridized MgSO ∙ 7 H O, 35 g L glucose, 0.05 g L Thiamin HCl, 4 2 −1 section for amplification of the rhlAB operon of P. aer- 3 mL L trace element solution 1, pH 7.4; trace element −1 −1 uginosa PAO1 starting at the native transcription point solution 1: 0.18 g L ZnSO ∙ 7 H O, 0.16 g L CuSO ∙ 4 2 4 −1 −1 228 bp upstream of the rhlA start codon. After amplifica - 5 H O, 0.1 g L MnSO ∙ H O, 13.9 g L FeCl ∙ 6 H O, 2 4 2 3 2 −1 −1 tion the resulting PCR product was cut upstream of P 10.05 g L EDTA Titriplex III, 0.18 g L CoCl ∙ 6 H O, syn 2 2 −1 using SgsI. The target vector pTLT was cut using Mlu I 0.662 g L CaCl ∙ 2 H O) or a second medium termed 2 2 −1 and SspI and ligated with the construct. SupM (SupM medium: 4.4 g L Na HPO ∙ 2 H O, 2 4 2 −1 −1 −1 This strategy led to different rhamnolipid vectors, 1.5 g L KH PO , 1 g L NH Cl, 0.2 g L MgSO ∙ 7 2 4 4 4 −1 −1 −1 which were transformed in P. putida KT2440. Detection H O, 0.02 g L CaCl ∙ 2 H O, 0.006 g L FeCl , 30 g L 2 2 2 3 −1 −1 of rhamnolipid production proved difficult, because flu - glucose, 10 g L yeast extract, 1 mL L trace element −1 orescence of the lov gene product could not be detected solution 2, pH 6.8; trace element solution 2: 0.3 g L −1 −1 in any colony. Therefore, rhamnolipid producer strains H BO , 0.2 g L CoCl ∙ 6 H O, 0.1 g L ZnSO ∙ 7 3 3 2 2 4 −1 −1 were indentified using the hemolytic activity of rham - H O, 0.03 g L MnCl ∙ 4 H O, 0.01 g L CuCl ∙ 2 H O, 2 2 2 2 2 −1 −1 nolipids detected via blood agar plates as described 0.03 g L Na MoO ∙ 2 H O, 0.02 g L NiCl ∙ 6 H O) 2 4 2 2 2 by Carrillo et al. (1996). Thereafter, rhamnolipid pro - was applied. In the bioreactor cultivation either Wilms −1 duction efficiency was screened via an orcinol assay as medium or a third medium termed ModR (22 g L −1 −1 described by Chandrasekaran and Bemiller (1980) and KH PO , 2.6 g L (NH ) HPO , 1.4 g L MgSO ∙ 7 2 4 4 2 4 4 −1 −1 modified by Ochsner (1993). The highest rhamnolipid H O, 0.87 g L citric acid, 0.01 g L FeSO ∙ 7 H O, 2 4 2 −1 −1 concentration as well as the highest rhamnolipid/OD 35 g L glucose, 10 mL L trace element solution 2, pH amount could be detected for the plasmid pSynPro8_ 6.8) was used. rhlAB. Also highest transcript amounts determined via real time PCR could be detected for pSynPro8_rhlAB Preparation of seed culture with 0.1478 ng/50 ng and 0.0039 ng/50 ng for rhlA and All shake flasks were inoculated in a shake incubator rhlB, respectively. chamber (Multitron II, HT Infors, Bottmingen, Switzer- To generate a stable vector, the terminator on the land) at 30 °C and 120 rpm. First 25 mL LB in a 100 mL plasmid pSynPro8_rhlAB in front of the rhlAB gene baffled shake flask were inoculated with 50 µL from a was deleted. pSynPro8_rhlAB was cut using BglII and glycerol stock solution of P. putida KT2440 pSynPro8oT_ PsiI, ligated and transformed in P. putida KT2440 using rhlAB and incubated for 24 h. Seed cultures contained electroporation as described in Troeschel et al. (2010). 100 mL Wilms or SupM medium in a 1 L baffled shake This plasmid was used in this study and is referred to as flask inoculated with 1 mL from the 24 h LB culture and pSynPro8oT_rhlAB. incubated for 12 h. Beuker et al. AMB Expr (2016) 6:11 Page 4 of 10 Bioreactor cultivations 33 °C and pH was adjusted to 7.4 via 4 M H PO or 4 M 3 4 All bioreactor cultivations were carried out as dupli- NaOH. cates. The bioreactor setup was similar as described in In ModR medium inoculation of the bioreactor was Willenbacher et al. (2014) and illustrated in Fig. 1. The conducted using 12 h SupM seed culture. During bio- bioreactor (Minifors, HT Infors, Bottmingen, Switzer- reactor cultivation temperature was held constant at land) was equipped with an integrated pH, tempera- 30 °C. Due to pH controlling to 6.8 via 1 M H SO or 2 4 ture and aeration control system. Aeration was set at 19 % NH OH ammonium concentration was also held 0.067 vvm and pO was controlled at 13 % via stirring constant. rate starting with a minimum of 300 rpm. Bioreactors were inoculated with the 12 h seed culture to a final OD Analytical methods of 0.5 but no more than 10 % v/v. Since foam fractiona- Sampling and processing tion was applied, generated foam was channeled through At each sampling point foam fractions were collected, the exhaust cooler and the different fractions were col - samples were taken from the bioreactor and the collapsed lected in cooled interchangeable bags. Bioreactor culti- foam fractions (foamate) and foamate volume was deter- vations were terminated upon glucose depletion in the mined. Bioreactor and foamate samples were treated bioreactor. equally. In Wilms medium inoculation of the bioreactor was For biomass determination OD was measured conducted using 12 h Wilms seed culture. During bio- and divided by a OD /biomass correlation factor of −1 reactor cultivation temperature was held constant at 3.25 OD /(g L ). Fig. 1 Setup for integrated foam fractionation in a bioreactor. Foam is generated during cultivation process in the bioreactor and channeled through the off gas cooler into cooled exchangeable foam bags Beuker et al. AMB Expr (2016) 6:11 Page 5 of 10 The remaining sample was centrifuged (13,200 rpm, �m �m X P 15 min) to gain cell free supernatant for rhamnolipid, Y = ; Y = X/S P/X (2) �m �m Glu X glucose and ammonium detection. Rhamnolipid detection was performed as described Growth rates were calculated in a differential manner by Schenk et al. (1995) with minor adjustments. Part of using fits of the overall biomass. the liquid phase was acidified 1:100 (v/v) by phosphoric ln m /m X_t2 X_t1 acid and rhamnolipids were extracted twice with 1.25 µ( t ) = (3) �t(t , t ) 2 1 vol. ethyl acetate. For rhamnolipid measurement appro- priate amount of this ethyl acetate extract was evapo- Differential and integral specific productivities rated. Rhamnolipids were resolved in acetonitrile and were calculated using fitted biomass and rhamnolipid derivatized for 90 min at 1400 rpm and 60 °C using a 1:1 masses of the overall process. However, in differential mixture of 40 mM bromphenacylbromid and 20 mM tri- calculations the mean of biomass before and at the ethyl-ammonium/-amin. Detection of rhamnolipids was specific time point was considered whereas in integral performed using a HPLC device (Agilent 1100 Series, calculations the overall biomass produced was used. Agilent, Waldbronn, Germany) equipped with a 15 cm �m (t , t ) RL 2 1 reversed phase column (Supelcosil LC-18, Supelco, dif .spec.q (t ) = ; RL 2 ∅m (t , t ) × �t(t , t ) X 1 2 2 1 Deisenhofen, Germany) at 30 °C. The mobile phase was �m RL composed of 100 % methanol and ultrapure water. For int.spec.q = (4) RL �m × �t rhamnolipid detection a gradient was applied. During the first 17 min methanol concentration was increased Integral volumetric productivities were calculated to 100 % starting at 80 %. This methanol concentration using fitted rhamnolipid masses of the overall process. was held for 8 min and decreased to 80 % during the next RL 5 min. Rhamnolipids were detected at a wave length of vol.q = RL (5) V × t total 254 nm at 30 °C. For calibration standard solutions of rhamnolipid in acetonitrile were used. Bacterial and rhamnolipid enrichments were calculated The concentration of glucose and ammonium were in a differential manner using measurements of bacterial detected from the aqueous phase of samples using glu- and rhamnolipid concentration in foamate and bioreac- cose (Cat. no. 10 716 251 035, R-Biopharm AG, Darm- tor. The concentration of a component in the foamate stadt, Germany) and ammonium (1.14752.001, Merck was divided by its mean concentration in the bioreactor KGaA, Darmstadt, Germany) assay kits, respectively, at sampling and previous sampling. according to the manufacturers’ instructions. c (t ) ifoam 2 enrichment(t ) = (6) ∅c (t , t ) 1 2 ifermenter Data analysis To analyze and characterize the different bioreactor cul - Rhamnolipid recovery was calculated in an integral tivations total combined masses of biomass, rhamnolipid manner using measured rhamnolipid masses in foamate and glucose in the bioreactor and the integral foam frac- and bioreactor. tions were calculated and defined as “overall values”. These RLfoam recovery = overall values were fitted using a logistic equation with (7) m + m RLfoam RLfermenter four parameters in a scientific data analysis and graphing software (Sigma Plot 12.5, Systat, San Jose, USA). Results Time courses of overall biomass, rhamnolipid and glucose y = y + (1) during bioreactor cultivation 1 + Time courses of the overall (sum of bioreactor and −1 −1 −1 With these curves Y [g g ], Y [g∙g ], µ [h ], integral foam fractions) generated biomass and rham- X/S P/X −1 −1 −1 −1 spec. q [mg g h ] and vol. q [mg l h ] were nolipid and consumed glucose are depicted in Fig. 2. RL RL calculated. Bacterial and rhamnolipid enrichment and Using Wilms medium setup a maximal overall biomass rhamnolipid recovery [%] were determined using meas- of 6.9 ± 0.5 g and maximal overall rhamnolipid mass of urement data. 0.38 ± 0.04 g was reached at the end of bioreactor culti- Y and Y were determined in an integral manner vation after 28 h. However, rhamnolipid production did X/S P/X using fitted glucose, biomass and rhamnolipid masses of not start until 16 h. Until the end of bioreactor cultiva- the overall process at the time point of glucose depletion tion glucose was depleted in the bioreactor medium and in the bioreactor. 5.23 ± 0.04 g was removed by foaming. Beuker et al. AMB Expr (2016) 6:11 Page 6 of 10 Fig. 3 Time course of differential bacterial and rhamnolipid enrich- ment and integral rhamnolipid recovery during foam fractionation Fig. 2 Time course of overall biomass, glucose and rhamnolipid process. a shows rhamnolipid (blank) and bacterial (black) enrich- masses (sum of bioreactor and integral foam fractions) during foam ments using Wilms (triangles) and ModR (squares) medium setup fractionation process. a shows results of bioreactor cultivations using referring to a logarithmic axis. The values for rhamnolipid and Wilms medium setup, b shows results of bioreactor cultivations using bacterial enrichment were calculated as depicted in Eq. 6, b shows ModR medium setup. The values for biomass (black circles), glucose rhamnolipid recovery using Wilms (triangles) and ModR (squares) (grey triangles) and rhamnolipid (blank squares) are given as mean medium setup calculated according to Eq. 7 values of two bioreactor cultivations. Dotted, solid black and solid grey lines represent the logistic fit functions of the rhamnolipid, biomass and glucose time course, respectively based on Eq. 1 concentration in the foamate compared to the bioreac- Using ModR medium setup the cultivation till glucose tor. Rhamnolipid enrichment also started at values lower depletion in the bioreactor took 16 h and 16.1 ± 0.2 g 1 but increased upon rhamnolipid production after glucose was removed by foaming. Maximal overall bio- 16 h to values up to 129 to decrease till the end of bio- mass of 9.5 ± 0.1 g and maximal overall rhamnolipid reactor cultivation to values around 15. Therefore upon masses of 0.85 ± 0.03 g were reached at the end of biore- rhamnolipids production, rhamnolipids were constantly actor cultivation. concentrated in and removed by the foam. Rhamnolipid In general, bioreactor cultivation using Wilms medium recovery started at low values but increased upon rham- setup took 12 h longer. Additionally just 73 % of the bio- nolipid production to values up to 97 % and a final value mass and 45 % of the rhamnolipid was produced using of 81 %. Wilms medium setup compared to ModR medium Using ModR medium setup biomass enrichment setup. started at values slightly higher 1 but decreased imme- diately to values lower 1 representing a lower biomass Time course of bacterial and rhamnolipid enrichment concentration in the foamate compared to the bioreac- and rhamnolipid recovery tor. Rhamnolipid enrichment started at high values of Rhamnolipid recovery and bacterial and rhamnolipid up to 198 and decreased over time to values around 20 enrichment were calculated using Eqs. 6 and 7, respec- with a slightly increasing trend in the end. Therefore, tively and are depicted in Fig. 3. rhamnolipids were constantly highly concentrated in Using Wilms medium setup biomass enrichment the foamate. Rhamnolipid recovery started at 56 % and was constantly lower 1 representing a lower biomass increased over time to 97 %. Beuker et al. AMB Expr (2016) 6:11 Page 7 of 10 Process parameters of foam fractionations in different product enrichment with higher enrichments using the P. setups using P. putida—rhamnolipid system putida system applying ModR medium setup (2.5 times and comparison to B. subtilis—surfactin system higher). Process parameters of the different P. putida—rham- nolipid setups are summarized in Table 1. Furthermore, Discussion to compare foam fractionation of two different biosur - Production kinetics factant systems the P. putida—rhamnolipid system is Comparing the two different media, pH values and tem - compared to the B. subtilis—surfactin system. For this perature conditions used in this study different rham - the mean of different process parameters of all B. subtilis nolipid production kinetics could be detected. Whereas strains displayed in Willenbacher et al. (2014) were calcu- rhamnolipid production is growth associated using lated and depicted in Table 1. ModR medium conditions, it starts not until 16 h using Comparing process parameter of the two different Wilms medium conditions even though the same organ- media, pH and temperature setups for rhamnolipid pro- ism with the same plasmid is used in both cultivations. duction bioreactor cultivations using ModR medium Guerra-Santos et al. (1984, 1986) showed that tempera- setup reached higher values in all process parameter. ture, pH and medium composition have an influence on High differences could be detected in productivities. rhamnolipid production in P. aeruginosa. Temperatures The maximal specific as well as the volumetric rham - of 32–34 °C and pH values of 6.2–6.4 were advantageous nolipid productivity using the ModR medium setup was for rhamnolipid production. The lower pH of 6.8 using 4.2 and 4.4 times higher, respectively. Also integral spe- ModR medium conditions could therefore be one of the cific rhamnolipid productivity was 2.9 times higher using reasons for increased rhamnolipid production. However, ModR medium setup compared to Wilms medium setup. Wilms medium conditions would favor rhamnolipid pro- Additionally, maximal product concentration in the foa- duction regarding temperature. mate and product recovered in the foamate using ModR Also, differences in kinetics may be caused by medium medium setup was 2.1 and 2.8 times higher than using compositions. The cultivations in this study were carried Wilms medium setup, respectively. Furthermore, mean out in batch mode and therefore medium compounds bacterial enrichment was 3.5 times higher using ModR were consumed over time. Guerra-Santos et al. (1984, medium setup than using Wilms medium setup. How- 1986) studied rhamnolipid production in P. aeruginosa ever, in both setups bacterial enrichments were lower depending on media compositions. Elements with a than 1 accounting for lower biomass concentration in the major effect on rhamnolipid production were iron as foam than in the bioreactor. well as calcium, nitrogen, magnesium and phosphor with Comparing the two different foam fractionation sys - an increased rhamnolipid production upon iron limita- −3 −1 tems it becomes evident that all process parameters tion (27.5 10 mg L ), a C–to–N ratio of 18, optimal are quite similar in the B. subtilis—surfactin and in the C–to–Mg ratio of 364 or higher (MgSO ∙ 7 H O concen- 4 2 −1 P. putida—rhamnolipid system using ModR medium trations below 0.2 g L ) and a surplus of phosphor with setup. However, differences could be detected in maximal a C–to–P ratio of 16. Additionally, sodium, potassium, Table 1 Process parameter of different media setups of the P. putida—rhamnolipid system and B. subtilis—surfactin sys- tem P. putida—rhamnolipid in Wilms P. putida—rhamnolipid in ModR B. subtilis—surfactin Overall Y (g/g) 0.06 ±0.01 0.10 ±0.01 0.15 ±0.07 P/X Overall Y (g/g) 0.16 ±0.02 0.26 ±0.02 0.24 ±0.06 X/S Max. q [mg/(g∙h)] 5.90 ±0.29 24.71 ±0.69 45.00 ±26.93 Product Integral q [mg/(g∙h)] 1.89 ±0.44 5.57 ±0.39 4.37 ±1.98 Product Max. vol. q [mg/(L∙h)] 8.70 ±1.16 38.09 ±2.12 46.25 ±35.68 Product Overall product recovery (%) 83.39 ±1.51 97.38 ±0.33 85.35 ±13.19 Max. product enrichment 128.54 ±36.54 197.98 ±13.42 80.68 ±39.73 Mean bact. enrichment 0.25 ±0.07 0.86 ±0.19 0.79 ±0.45 Max. product conc. in foam (g/L) 1.04 ±0.04 2.15 ±0.04 2.35 ±0.76 Product recovered in foam (g) 0.30 ±0.02 0.83 ±0.03 0.53 ±0.35 The mean of different process parameters of all B. subtilis—surfactin systems is depicted (Willenbacher et al. 2014). In P. putida—rhamnolipid systems Y , Y , max. P/X X/S q , integral q and max. vol q were calculated using logistic fit data whereas all other parameter were calculated using measured data Product Product Product Beuker et al. AMB Expr (2016) 6:11 Page 8 of 10 2+ and calcium reduction caused higher rhamnolipid pro- same setup but adding Mg or other bivalently charged duction. Persson et al. (1990) also studied the influence ions to the media with a larger impact on the enrichment of medium compositions on biosurfactant production of P. uore fl scens than of B. subtilis var niger (Grieves and 2+ in P. uore fl scens. In their studies they elucidated a major Wang 1967a). High influence of Mg on the flotability effect of iron on biosurfactant production whereas the of Pseudomonas could be one of the reasons why also P. carbon to nitrogen ratio as well as the phosphor con- aeruginosa and P. putida in the studies of Küpper et al. centration did not influence biosurfactant production. (2013) and Gruber (1991) were enriched in the foam Taking these results into account differences in rham - using rhamnolipid production systems whereas in the nolipid production kinetics could be caused by different surfactin systems little bacterial enrichment occurred iron concentrations. In ModR medium the iron concen- (Willenbacher et al. 2014). Contrary, in this study P. −1 tration (2 mg L ) is more than four times lower than putida KT2440 pSynPro8oT_rhlAB was not enriched in Wilms medium. Therefore, fast iron limitation could in the foam suggesting that the combination of bacteria induce rhamnolipid production using ModR medium type and medium have an influence on bacterial foam whereas high iron concentrations could influence a delay adhesion. of rhamnolipid production using Wilms medium. Addi- Gruber (1991) used wild type strain P. aeruginosa tionally, high phosphor concentrations (9 × higher) and DSM2659 producing mono- and di-rhamnolipids. He calcium deficiency in ModR could also lead to beneficial showed that bacterial enrichment was higher than rham- conditions for rhamnolipid production. However, potas- nolipid enrichment independent of the retention times of sium and magnesium concentration are higher in ModR the foam in the foam column with a final bacterial enrich - medium than in Wilms medium having a negative effect ment of 3.4 and rhamnolipid enrichment of 2 at a reten- on rhamnolipid production in P. aeruginosa. Conclud- tion time of about 40 min. Comparing Gruber’s finding ing, the main reason of different rhamnolipid production with results shown in this article suggests that either the kinetics using different cultivation conditions and media producer strain or media could cause different bacterial is suspected to be caused by differences in medium com - enrichments in the foamate. positions or cultivation conditions. Astonishingly, Küpper et al. (2013) used a very similar system to the one used in this study but also described Eec ff tive foam fractionation high bacterial enrichments in the foamate of up to 3. The main finding under the experimental setup in this Küpper et al. (2013) also exploited genetically engineered article was unexpected low biomass enrichment in the P. putida producing just mono-rhamnolipids but used LB foamate in contrast to other statements in the literature medium as production medium. Furthermore, Küpper (Gruber 1991; Heyd et al. 2008; Küpper et al. 2013). et al. (2013) did not state the exact organism and plasmid This led to an unforeseeable effective method to pro - used in his studies. As production host the authors could duce and in situ concentrate rhamnolipids via simple have used either P. putida KT2440 or P. putida KT42C1, a cultivation integrated foam fractionation using the het- rifampicin resistant (P. putida KT2442) and polyhydroxy- erologous production strain P. putida KT2440 contain- alcanoates (PHA) negative (P. putida KT42C1) mutant of ing a plasmid for mono-rhamnolipid production in a P. putida KT2440 (de Eugenio et al. 2010; Wittgens et al. bioreactor. 2011; Goldstein 2014). Follonier et al. (2011) examined Highly enriched biomass as described by Küpper differences of PHA building in KT2440 and KT2442 and et al. (2013) and Gruber (1991) could be the effect of questioned transferability of results between KT2440 and particle flotation. It was shown before that a negative KT2442. Therefore, it could be suggested that the used charge of particles could be reversed using multivalent production hosts of Küpper et al. (2013) could exhibit dif- 2+ anionic ions (e.g. Mg ) and flotated using anionic sur - ferences to the one used in this article. As plasmids Küp- factants (Somasundaran 1975). If negatively charged per et al. (2013) could have used either pVLT31_rhlAB or bacteria (Hubbuch et al. 2006) are also seen as particles pVLT33_rhlAB being the same IPTG inducible construct 2+ their charge could be reversed by Mg ions present in but tetracycline and kanamycin resistant, respectively (de the cultivation medium and they could be flotated by Lorenzo et al. 1993) with genomic information for rhlA negatively charged produced rhamnolipids. Grieves and and rhlB taken from P. aeruginosa PAO1 (Wittgens et al. Wang (1967a, b) support this thesis with a couple of 2011). Differences in the plasmids used by Küpper et al. experiments. Using cationic surfactants P. uore fl scens as (2013) and the one used in this article are therefore given well as B. subtilis var niger and other bacteria suspended either in antibiotic resistances or by different plasmidic in distilled water could be readily removed by foam- backbones. ing (Grieves and Wang 1967b). However, bacterial foam In summary, differences in bacterial attachments to enrichment reduced dramatically in both cases using the the foam are suggested to be based on variations in the Beuker et al. AMB Expr (2016) 6:11 Page 9 of 10 Cha M, Lee N, Kim MM, Kim MM, Lee S. Heterologous production of Pseu- outer membrane compositions or membrane characteris- domonas aeruginosa EMS1 biosurfactant in Pseudomonas putida. Biore- tics in specific media. The low enrichment of the bacteria sour Technol. 2008;99:2192–9. doi:10.1016/j.biortech.2007.05.035. used in this article is little affected by pH, temperature or Chandrasekaran EV, Bemiller JN. Constituent analyses of glycosaminoglycans. In: Whistler RL, Bemiller JN, editors. Methods in carbohydrate chemistry. defined medium composition. However, taking former New York: Academic Press Inc; 1980. p. 372. literature into account suggests that complex medium Chen C-Y, Baker SC, Darton RC. Continuous production of biosurfactant with could have an effect on bacterial enrichment. Different foam fractionation. J Chem Technol Biotechnol. 2006;81:1915–22. de Eugenio LI, Escapa IF, Morales V, Dinjaski N, Galán B, García JL, Prieto membrane compositions or membrane characteristics MA. The turnover of medium-chain-length polyhydroxyalkanoates in may be caused by differences of strains, different anti - Pseudomonas putida KT2442 and the fundamental role of PhaZ depoly- biotic resistances or other dissimilarities related to the merase for the metabolic balance. Environ Microbiol. 2010;12:207–21. doi:10.1111/j.1462-2920.2009.02061.x. plasmidic backbone. Yet, a distinct reason for differences de Lorenzo V, Eltis L, Kessler B, Timmis KN. Analysis of Pseudomonas in bacterial foam adhesion could not be determined and gene products using lacIq/Ptrp-lac plasmids and transposons should be investigated in further detail. that confer conditional phenotypes. Gene. 1993;123:17–24. doi:10.1016/0378-1119(93)90533-9. However, taking advantage of the non adhesiveness of Déziel E, Lépine F, Dennie D, Boismenu D, Mamer OA, Villemur R. Liquid the cells this article presents an effective simple cultiva - chromatography/mass spectrometry analysis of mixtures of rhamnolipids tion integrated foam fractionation method to produce produced by Pseudomonas aeruginosa strain 57RP grown on mannitol or naphthalene. Biochim Biophys Acta Mol Cell Biol Lipids. 1999;1440:244– and in situ concentrate rhamnolipids using a heterolo- 52. doi:10.1016/S1388-1981(99)00129-8. gous production strain independent of pH, temperature Dubey KV, Juwarkar AA, Singh SK. Adsorption-desorption process using wood- and defined medium composition with little cell accumu - based activated carbon for recovery of biosurfactant from fermented distillery wastewater. Biotechnol Prog. 2005;21:860–7. doi:10.1021/ lation in the foam. bp040012e. Follonier S, Panke S, Zinn M. A reduction in growth rate of Pseudomonas putida Additional file KT2442 counteracts productivity advances in medium-chain-length polyhydroxyalkanoate production from gluconate. Microb Cell Fact. 2011;10:25. doi:10.1186/1475-2859-10-25. Additional file 1: Table S1: Sequence of the synthetic oligonucleotide Goldstein BP. Resistance to rifampicin: a review. J Antibiot. 2014;67:625–30. Term-lov-Term. doi:10.1038/ja.2014.107 (Tokyo). Grieves RB, Wang S-L. Foam separation of Pseudomonas fluorescens and Bacillus subtilis var. niger. Appl Microbiol. 1967a;15:76–81. Authors’ contributions Grieves RB, Wang SL. Foam separation of bacteria with a cationic surfactant. JB planned and executed the experiments, collected and calculated all data, Biotechnol Bioeng. 1967b;9(2):187–94. created the graphs and figures and drafted this manuscript. AW and FR gener - Gruber T. Verfahrenstechnische aspekte der kontinuierlichen produktion ated the plasmid pSynPro8_rhlAB. AS generated the plasmid pSynPro8oT_ von biotensiden am beispiel der rhamnolipide. Germany: Universität rhlAB. MH significantly contributed to data evaluation and interpretation of Stuttgart; 1991. the experiment. RH substantially contributed to conception and design of the Guerra-Santos L, Käppeli O, Fiechter A. Pseudomonas aeruginosa biosurfactant conducted experiments. All authors read and approved the final manuscript. production in continuous culture with glucose as carbon source. Appl Environ Microbiol. 1984;48:301–5. Author details Guerra-Santos LH, Käppeli O, Fiechter A. Dependence of Pseudomonas Institute of Food Science and Biotechnology, Department of Bioprocess aeruginosa continous culture biosurfactant production on nutritional Engineering (150k), University of Hohenheim, Fruwirthstr. 12, 70599 Stuttgart, and environmental factors. Appl Microbiol Biotechnol. 1986;24:443–8. Germany. Present Address: Center for Peptide Pharmaceuticals, Ulm Univer- doi:10.1007/BF00250320. sity, Meyerhofstr. 1, 89081 Ulm, Germany. Henkel M, Schmidberger A, Kühnert C, Beuker J, Bernard T, Schwartz T, Syldatk C, Hausmann R. Kinetic modeling of the time course of Acknowledgments N-butyryl-homoserine lactone concentration during batch cultiva- The authors would like to thank Dipl.-Ing. Michaela Zwick, Karlsruhe Institute tions of Pseudomonas aeruginosa PAO1. Appl Microbiol Biotechnol. of Technology (KIT ), Karlsruhe, Germany, for technical assistance and contribu- 2013;97:7607–16. tion to scientific discussions. Henkel M, Schmidberger A, Vogelbacher M, Kühnert C, Beuker J, Bernard T, Schwartz T, Syldatk C, Hausmann R. Kinetic modeling of rhamnolipid Competing interests production by Pseudomonas aeruginosa PAO1 including cell density- The authors declare that they have no competing interests. dependent regulation. Appl Microbiol Biotechnol. 2014;98:7013–25. doi:10.1007/s00253-014-5750-3. Received: 7 January 2016 Accepted: 29 January 2016 Heyd M, Franzreb M, Berensmeier S. Continuous rhamnolipid production with integrated product removal by foam fractionation and magnetic separation of immobilized Pseudomonas aeruginosa. Biotechnol Prog. 2011;27:706–16. doi:10.1002/btpr.607. Heyd M, Kohnert A, Tan TH, Nusser M, Kirschhöfer F, Brenner-Weiss G, References Franzreb M, Berensmeier S, Kirschhofer F, Brenner-Weiss G, Franzreb M, Abdel-Mawgoud AM, Lépine F, Déziel E. Rhamnolipids: diversity of structures, Berensmeier S. Development and trends of biosurfactant analysis and microbial origins and roles. Appl Microbiol Biotechnol. 2010;86:1323–36. purification using rhamnolipids as an example. Anal Bioanal Chem. doi:10.1007/s00253-010-2498-2. 2008;391:1579–90. doi:10.1007/s00216-007-1828-4. Bergström S, Theorell H, Davide H. Pyolipic acid, a metabolic product of Pseu- Hubbuch JJ, Brixius PJ, Lin D-Q, Mollerup I, Kula M-R. The influence of domonas pyocyanea, active against Mycobacterium tuberculosis. Ark Kemi homogenisation conditions on biomass-adsorbent interactions Miner Och Geol. 1946;23A:1–12. during ion-exchange expanded bed adsorption. Biotechnol Bioeng. Carrillo PG, Mardaraz C, Pitta-Alvarez SI, Giulietti AM. Isolation and selection 2006;94:543–53. of biosurfactant-producing bacteria. World J Microbiol Biotechnol. Jarvis FG, Johnson MJ. A glyco-lipide produced by Pseudomonas aeruginosa. J 1996;12:82–4. doi:10.1007/BF00327807. Am Chem Soc. 1949;71:4124–6. Beuker et al. AMB Expr (2016) 6:11 Page 10 of 10 Jensen PR, Hammer K. The sequence of spacers between the consensus Persson A, Molin G, Andersson N, Sjöholm J. Biosurfactant yields and nutrient sequences modulates the strength of prokaryotic promoters. Appl Envir consumption of Pseudomonas fluorescens 378 studied in a micro - Microbiol. 1998;64:82–7. computer controlled multifermentation system. Biotechnol Bioeng. Kovach ME, Elzer PH, Steven Hill D, Robertson GT, Farris MA, Roop RMM, 1990;36:252–5. doi:10.1002/bit.260360306. Peterson KM, Hill DS, Robertson GT, Farris MA, Roop RMM, Peterson KM. Reiling HE, Thanei-Wyss U, Guerra-Santos L, Hirt R, Käppeli O, Fiechter A. Pilot Four new derivatives of the broad-host-range cloning vector pBBR1MCS, plant production of rhamnolipid biosurfactant by Pseudomonas aerugi- carrying different antibiotic-resistance cassettes. Gene. 1995;166:175–6. nosa. Appl Environ Microbiol. 1986;51:985–9. doi:10.1016/0378-1119(95)00584-1. Sarachat T, Pornsunthorntawee O, Chavadej S, Rujiravanit R. Purification and Küpper B, Mause A, Halka L, Imhoff A, Nowacki C, Wichmann R. Fermentative concentration of a rhamnolipid biosurfactant produced by Pseu- produktion von monorhamnolipiden im Pilotmaßstab—herausforder- domonas aeruginosa SP4 using foam fractionation. Bioresour Technol. ungen der Maßstabsvergrößerung. Chemie Ing Tech. 2013;85:834–40. 2010;101:324–30. doi:10.1016/j.biortech.2009.08.012. doi:10.1002/cite.201200194. Schenk T, Schuphan I, Schmidt B. High-performance liquid chromatographic Lang S, Wullbrandt D. Rhamnose lipids—biosynthesis, microbial production determination of the rhamnolipids produced by Pseudomonas aerugi- and application potential. Appl Microbiol Biotechnol. 1999;51:22–32. nosa. J Chromatogr A. 1995;693:7–13. doi:10.1016/0021-9673(94)01127-Z. doi:10.1007/s002530051358. Somasundaran P. Separation using foaming techniques. Sep Sci. Loeschcke A, Thies S. Pseudomonas putida—a versatile host for the produc- 1975;10:93–109. tion of natural products. Appl Microbiol Biotechnol. 2015;99:6197–214. Troeschel SC, Drepper T, Leggewie C, Streit WR, Jaeger K-E. Novel tools for doi:10.1007/s00253-015-6745-4. the functional expression of metagenomic DNA. Methods Mol Biol. Manso Pajarron A, de Koster CG, Heerma W, Schmidt M, Haverkamp J. 2010;668:117–39. doi:10.1007/978-1-60761-823-2_8. Structure identification of natural rhamnolipid mixtures by fast atom Wang S, Mulligan CN. Rhamnolipid foam enhanced remediation of cadmium bombardment tandem mass spectrometry. Glycoconj J. 1993;10:219–26. and nickel contaminated soil. Water Air Soil Pollut. 2004;157:315–30. doi:10.1007/BF00702203. doi:10.1023/B:WATE.0000038904.91977.f0. Mukherjee S, Das P, Sen R. Towards commercial production of micro- Wei YH, Chou CL, Chang JS. Rhamnolipid production by indigenous Pseu- bial surfactants. Trends Biotechnol. 2006;24:509–15. doi:10.1016/j. domonas aeruginosa J4 originating from petrochemical wastewater. tibtech.2006.09.005. Biochem Eng J. 2005;27:146–54. doi:10.1016/j.bej.2005.08.028. Müller MM, Hörmann B, Syldatk C, Hausmann R. Pseudomonas aeruginosa Willenbacher J, Yeremchuk W, Mohr T, Syldatk C, Hausmann R. Enhancement of PAO1 as a model for rhamnolipid production in bioreactor systems. Appl surfactin yield by improving the medium composition and fermentation Microbiol Biotechnol. 2010;87:167–74. doi:10.1007/s00253-010-2513-7. process. AMB Express. 2015;5:145. doi:10.1186/s13568-015-0145-0. Müller MM, Kügler JH, Henkel M, Gerlitzki M, Hörmann B, Pöhnlein M, Syldatk Willenbacher J, Zwick M, Mohr T, Schmid F, Syldatk C, Hausmann R. Evaluation C, Hausmann R. Rhamnolipids-next generation surfactants? J Biotechnol. of different Bacillus strains in respect of their ability to produce Surfactin 2012;162:366–80. doi:10.1016/j.jbiotec.2012.05.022. in a model fermentation process with integrated foam fractionation. Appl Mulligan CN, Gibbs BF. Recovery of biosurfactants by ultrafiltration. J Chem Microbiol Biotechnol. 2014;98:9623–32. doi:10.1007/s00253-014-6010-2. Technol Biotechnol. 1990;47:23–9. doi:10.1002/jctb.280470104. Wilms B, Hauck A, Reuss M, Syldatk C, Mattes R, Siemann M, Altenbuchner J. Mulligan CN, Mahmourides G, Gibbs BF. The influence of phosphate metabo - High-cell-density fermentation for production of L-N-carbamoylase using lism on biosurfactant production by Pseudomonas aeruginosa. J Biotech- an expression system based on the Escherichia coli rhaBAD promoter. nol. 1989;12:199–210. doi:10.1016/0168-1656(89)90041-2. Biotechnol Bioeng. 2001;73:95–103. doi:10.1002/bit.1041. Nelson KE, Weinel C, Paulsen IT, Dodson RJ, Hilbert H, dos Santos VAPM, Fouts Winterburn JB, Russell AB, Martin PJ. Integrated recirculating foam fractiona- DE, Gill SR, Pop M, Holmes M, Brinkac L, Beanan M, DeBoy RT, Daugherty tion for the continuous recovery of biosurfactant from fermenters. S, Kolonay J, Madupu R, Nelson W, White O, Peterson J, Khouri H, Hance I, Biochem Eng J. 2011;54:132–9. Lee PC, Holtzapple E, Scanlan D, Tran K, Moazzez A, Utterback T, Rizzo M, Wittgens A, Tiso T, Arndt TT, Wenk P, Hemmerich J, Müller C, Wichmann R, Lee K, Kosack D, Moestl D, Wedler H, Lauber J, Stjepandic D, Hoheisel J, Küpper B, Zwick M, Wilhelm S, Hausmann R, Syldatk C, Rosenau F, Blank Straetz M, Heim S, Kiewitz C, Eisen J, Timmis KN, Düsterhöft A, Tümmler B, LM. Growth independent rhamnolipid production from glucose using Fraser CM. Complete genome sequence and comparative analysis of the the non-pathogenic Pseudomonas putida KT2440. Microb Cell Fact. metabolically versatile Pseudomonas putida KT2440. Environ Microbiol. 2011;10:80. doi:10.1186/1475-2859-10-80. 2002;4:799–808. doi:10.1046/j.1462-2920.2002.00366.x. Zhang Y, Miller RM. Enhanced octadecane dispersion and biodegradation Ochsner UA. Genetics and biochemistry of Pseudomonas aeruginosa rham- by a Pseudomonas rhamnolipid surfactant (biosurfactant). Appl Environ nolipid biosurfactant synthesis. 1993. Microbiol. 1992;58:3276–82. Ochsner UA, Reiser J, Fiechter A, Witholt B. Production of Pseudomonas aeruginosa rhamnolipid biosurfactants in heterologous hosts. Appl Env Microbiol. 1995;61:3503–6.
Journal
AMB Express – Springer Journals
Published: Feb 9, 2016