Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Interleukin-35 -producing B cells rescues inflammatory bowel disease in a mouse model via STAT3 phosphorylation and intestinal microbiota modification

Interleukin-35 -producing B cells rescues inflammatory bowel disease in a mouse model via STAT3... www.nature.com/cddiscovery ARTICLE OPEN Interleukin-35 -producing B cells rescues inflammatory bowel disease in a mouse model via STAT3 phosphorylation and intestinal microbiota modification 1,2 3 2 2 3 1,4,6✉ 1,5,6✉ Minxiang Xie , Yuzhen Zhu , Yunjiao Zhou , Qiao Wang , Erli Gu , Yiwei Chu and Luman Wang © The Author(s) 2023 + + Interleukin-35 (IL-35)-producing B cells (IL-35 B cells) play an important role in diseases, and the expansion of IL-35 immune cells have been observed in inflammatory bowel disease (IBD). However, how IL-35 B cells function and the manner in which they perform their roles remain unclear. In this study, human samples and animal models were used to confirm the expansion of IL-35 B −/− −/− cells during IBD. In addition, by using il12a and ebi3 mice, we demonstrated that the regulatory role of B cells in IBD depends on IL-35. Mechanically, IL-35 B cells can promote its own expansion through endocrine actions and depend on the transcription factor signal transducer and activator of transcription 3. Interestingly, we found that the diversity of intestinal microbes and expression of microbial metabolites decreased during IBD. IL-35 B cells promote the high expression of indoleacetic acid (IAA), and exogenous metabolite supplementation with IAA can further promote the expansion of IL-35 B cells and rescues the disease. This study provides a new concept for the regulatory model of B cells and a new approach for the treatment of IBD. Cell Death Discovery (2023) 9:67 ; https://doi.org/10.1038/s41420-023-01366-5 INTRODUCTION microenvironment and orchestrates the immune response to Interleukin-35 (IL-35) is a heterodimeric cytokine that consists of maintain homeostasis. two monomers, IL12a and Ebi3. It is a recently identified cytokine Microbes and their metabolites play a critical role in IBD, of the family, which plays a key role in the suppressive function of Ruminococcaceae, Enterobacteriaceae, and Escherichia coli are immune cells [1, 2]. The IL-35-producing B cells (IL-35 B cells) is highly expressed in the intestinal tract of patients with IBD, while the most recently described B cell subset and can exert inhibitory the expression of Lachnospiraceae, Coriobacteriaceae, and Bifido- effects through both monomers and as a whole [3–5]. The IL-35 B bacteriaceae are decreased in the intestinal tract of these patients cells and IL-35 play an important role in immune-related diseases. [12, 13]. Toll-like receptor ligand and microbe metabolites, short For instance, mice deficient in B cell derived IL-35 develop chain fatty acid (SCFA), conjugated linoleic acid, and indoleacetic exacerbated experimental autoimmune uveoretinitis and experi- acid (IAA) can reshape and reprogram immune cells, including B mental allergic encephalomyelitis (EAE) [4, 5]. In hepatitis B virus cells [14, 15]. For example, TLR5 is a key receptor for the infection, it has been suggested that IL-35 modulates the balance maintenance of B-1a B cells. And flagellin, the TLR5 ligand on between regulatory and effector lymphocytes with disease the surface of intestinal microbes, is an indispensable factor for outcome depending on the stage of the disease [6]. In the remodeling of this B cell subtype [16]. The SCFA butyric acid inflammatory bowel disease (IBD), studies have shown that IL-35 increased the anti-tumor effect in CD8 T cells by increasing the is abnormally expressed in patients [7, 8], but the role of IL-35 B expression and function of the inhibitor of DNA binding 2 (ID2) cells in IBD has not been reported. IL-35 functions through [15]. IAA as a microbe metabolite can induce Th22 cells to produce receptors, but it has various receptors. In T or B cells, IL-35 is more IL-22 by regulating the islet regeneration protein, thus thought to signal through the IL12Rβ2/lL12Rβ2, IL12Rβ2/gp130, performing a negative regulatory role [17]. Importantly, recent gp130/gp130, and IL-12Rβ2/IL27Rα receptors [5, 9]. Upon binding reports have indicated that IAA and lipopolysaccharide (LPS) can to cognate receptors, the receptor-associated Janus kinases (Jak1, induce IL-35 B cell expression in vitro and in vivo [18]. However, Jak2, and Tyk2) are activated, providing phosphotyrosine-docking the relationship between microbe metabolites and IL-35 B cells in sites that recruit specific members of the signal transducer and IBD remains unknown. activator of transcription (STAT) transcription factors [10, 11]. Our results suggest that IL-35 B cell expansion during IBD relies However, there are many unknown aspects about IL-35 B cells, on EBI3 and IL12A to perform their inhibitory functions to including how IL-35 B cells interact with the disease maintain intestinal homeostasis for disease remission. During the 1 2 Department of Immunology, School of Basic Medical Sciences, and Institutes of Biomedical Sciences, Fudan University, Shanghai 200032, China. Key Laboratory of Medical Molecular Virology (MOE/NHC/CAMS), School of Basic Medical Sciences, Fudan University, Shanghai 200032, China. Department of gastroenterology, Jing’an District Central 4 5 Hospitals, Fudan University, Shanghai, China. Biotherapy Research Center, Fudan University, Shanghai 200032, China. Department of Endocrinology and Metabolism, Shanghai Fifth People’s Hospital, Fudan University, Shanghai, China. These authors contributed equally: Yiwei Chu, Luman Wang. email: yiweichu@fudan.edu.cn; lumanwang@fudan.edu.cn Received: 11 December 2022 Revised: 8 February 2023 Accepted: 10 February 2023 Official journal of CDDpress 1234567890();,: M. Xie et al. disease, both the microbe diversity and microbe metabolite Next, we used a widely accepted 2.5% dextran sulfate sodium expression were decreased. After the metabolites were supple- (DSS)-induced colitis murine model and performed more detailed mented with IAA the expression of IL-35 B cells was significantly intestinal and in vivo experiments to confirm the above results increased, and the disease was effectively treated. (Fig. S2A). As shown in Fig. S2, the DSS-induced mice exhibited significantly more weight loss (Fig. S2B) and severe disease symptoms as measured by the disease activity index (DAI) score RESULTS (Fig. S2C). The DSS-treated mice showed shortening of the colon IL-35 B cell expansion in the intestinal tract of patients with in the acute stage (day 4 and 7) and recovered in the remission IBD and dextran sulfate sodium induced colitis in mice stage (day 10) (Fig. S2D). Moreover, the overall survival was To identify the immune system-related profiles of patients with decreased after DSS induction (Fig. S2E). To further evaluate the ulcerative colitis (UC), we found a suitable dataset from the Gene disease severity the degree of intestinal injury was histopatholo- Expression Omnibus (GEO) database. According to GSE11223, in gically assessed and acute colitis in the DSS-induced mice was samples from patients with active UC, regulatory cytokines such as IL- characterized by epithelial damage, focal crypt injury, goblet cell 10 and EBI3 were significantly increased (Fig. S1A). In addition, the depletion, and inflammatory cell invasion, which were milder in gene expression profile was obtained from GSE38713, and the remission stage (Fig. S2F). We then extracted RNA from the B cells immune cell proportions in the colon of healthy controls and of the Payers patches and the intestinal proteins to detect the patients with UC were analyzed using xCell. As shown in Fig. S1B, C, cytokine profile. We found that pro-inflammation cytokines such compared with the healthy controls B cells were more active in as IL-6, IFN-γ, and TNF-α were increased during acute stage and patients with UC. Cytokine analysis of B cells confirmed that Ebi3 decreased in remission stage, while anti-inflammation cytokines expression was positively correlated with B cell activity (Fig. S1D, E). such as IL-35 (Il12a and Ebi3) were consistently increased We collected peripheral blood and biopsy samples from 15 patients throughout, suggesting that IL-35 may play an important role in with UC and flow cytometry and ELISA results showed increased IL- maintaining homeostasis (Fig. S2G, H). Moreover, we found that 35 B cells (IL12a and EBI3) (Fig. 1A–C) and IL-35 expression (Fig. 1D) the source of IL-35 was mainly the B cells in the intestine (Fig. S2I, J). in the peripheral blood, respectively. Immunofluorescence staining Importantly, using fluorescence-activated cell sorting and immu- + + confirmed the expression of IL-35 B cells infiltration in the intestine nofluorescence, we confirmed that IL-35 B cells in intestine samples of patients with UC (Fig. 1E). associated lymph tissues were expanded during inflammation Fig. 1 IL-35 producing B cells are preferentially upregulated in patients with ulcerative colitis (UC). A Expression levels of IL-35 in B cells + + from the peripheral blood from patients with UC and healthy controls were detected by flow cytometry, representative IL-12A EBI3 + + + expression in CD19 B cells isolated from the healthy control group (n = 14); UC patient group (n = 11). B Dots represent IL-12A EBI3 cell + + + frequencies in isolated CD19 B cells and total peripheral blood mononuclear cells (PBMCs). C Dots represent IL-12A EBI3 cell frequencies in total PBMCs. D IL-35 production in the serum from patients with UC and healthy controls were detected by ELISA (healthy control group n = 14; patients with UC group n = 14, two representative independent experiments are presented out of three similar experiments performed). E Expression levels of IL-35 in CD20 B cells from formalin-fixed paraffin-embedded colon tissue sections from six patients with UC and six healthy controls were determined by immunofluorescence staining. B–D Two-tailed unpaired Student’s t-test. Data are shown as mean ±standard error of the mean (SEM) (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). Cell Death Discovery (2023) 9:67 M. Xie et al. Fig. 2 IL-35 producing B cells are the dominant regulatory population during colitis. A–C Cells were isolated from mesenteric lymph nodes (MLNs) (A), Peyer’s patches (Patches) (B), and colorectal lamina propria (LP) (C) from 2.5% dextran sulfate sodium (DSS)-treated wildtype (WT) + + + mice at day 0, 4, 7, and 10 post-disease onset. The percentage and absolute number of IL-35 producing B cells (CD19 IL-12A EBI3 cells) + + + were determined by flow cytometry (n = 3 per group). D Expression levels of IL-35 producing B cells (CD20 IL-12A EBI3 cells) in formalin- fixed paraffin-embedded Peyer’s patches tissue sections from DSS-treated mice were determined by immunofluorescence staining (n = 6 per group). A–D Two-tailed unpaired Student’s t-test. Data are shown as mean ± standard error of the mean (SEM) and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). (Fig. 2A–D), which was consistent with the database results from B cell rescue of colitis is dependent on IL-35 patients with UC. Taken together, these results suggest that B cell We next sought to determine if IL-35 was essential for B cells to derived IL-35 expansion during colitis may play an important role maintain intestine homeostasis. B cells were purified from −/− −/− in maintaining intestinal homeostasis. wildtype (WT), Il12a , and Ebi3 mice and transferred into B Cell Death Discovery (2023) 9:67 M. Xie et al. Fig. 3 Functional impairment of IL-35 production in B cells leads to severe colitis in a DSS-induced colitis mouse model. A CD19 B cells −/− −/− from the spleens of wildtype (WT), Il12a and/or Ebi3 mice were adoptively transferred into B cell depleted (μMT) mice intravenously 48 h before 2.5% dextran sulfate sodium (DSS) administration. B Body weight was calculated (n = 5 per group). C Disease activity index (DAI) was calculated (n = 5 per group). D Representative colon sections are shown for each group (left panel). Length of the colon is shown on the bar graph (right panel) (n = 5 per group). E Survival analysis of each group was calculated (n = 5 per group). F Representative colon sections stained with hematoxylin and eosin (upper panels) and periodic acid-Schiff (lower panels) are shown for each group. Images are shown at ×20 magnification. Histological sections were blindly scored on a scale of 0–4 to generate a histological score and individual mouse scores are shown with each data point representing a single mouse (n = 10 per group, right panel). B, C Two-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons test. D, F Two-tailed unpaired Student’s t-test. E Log-rank (Mantel–Cox) test. Data are shown as mean ± standard error of the mean (SEM) and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). cell-deficient (μMT) mice (Fig. 3A, S4). Body weight loss was massive loss of crypts and leukocyte infiltration observed on day 7 observed in WT transferred group on day 6 and the decrease (Fig. 3F). These results suggest that B cell rescued colitis is −/− −/− stopped on day 8. In contrast, Il12a and/or Ebi3 transferred dependent on IL-35. Notably, when we induced colitis directly into −/− −/− group began to show significant body weight loss on day 5 and Il12a and Ebi3 mice (Fig. S3A), the knockout mice were not continued to lose weight until the last day of the experiment found to be more severely affected than the WT mice (Fig. S3B−G). −/− −/− (Fig. 3B). Furthermore, the Il12a and/or Ebi3 transferred This indicates that only B cell derived IL-35 and EBI3 displayed group showed an increased DAI score, which were significantly inhibitory effects in colitis. higher than WT transferred group (Fig. 3C). The gross pathology of the intestines from each group is shown in Fig. 3D, and the rmIL-35 induces IL-35 B cells expansion and rescued colitis −/− −/− + Il12a and/or Ebi3 transferred group showed apparent We further investigated whether IL-35 or IL-35 B cells could be used shortening and reddening of the colon, which are typical colitis to treat colitis. The mice were injected intraperitoneally with characteristics. The WT transferred group showed milder intestine recombined murine IL-35 (rmIL-35, 400 ng/mouse) 48 h before DSS −/− −/− changes (Fig. 3D). The Il12a and Ebi3 transferred group had induction of colitis (Fig. 4A). Mice that received rmIL-35 exhibited reduced overall survival (Fig. 3E). Histologically, the control mice milder symptoms in the intestines than mice that received isotype −/− −/− from the Il12a and Ebi3 transferred group exhibited the IgG1. The rmIL-35 treated mice experienced almost no body weight most severe inflammation throughout the entire intestine, with loss and diarrhea (Fig. 4B, C). The gross pathology of the intestines, Cell Death Discovery (2023) 9:67 M. Xie et al. Fig. 4 Recombinant IL-35 supplement suppresses severe colitis symptoms in a DSS-induced colitis mouse model. A Wildtype (WT) mice were pre-treated with recombinant IL-35 or IgG isotype intravenously 48 h before 2.5% dextran sulfate sodium (DSS) administration. B Body weight was calculated (n = 4 per group). C Disease activity index (DAI) was calculated (n = 4 per group). D Representative colon sections are shown for each group (left panel). Length of the colon is shown on the bar graph (right panel) (n = 4 per group). E Survival analysis of each group was calculated (n = 10 per group). F Representative colon sections stained with hematoxylin and eosin (upper panels) and periodic acid-Schiff (lower panels) are shown for each group. Images are shown at ×100 magnification. Histological sections were blindly scored on a scale of 0–4 to generate a histological score and individual mouse scores are shown with each data point representing a single mouse (n = 4 per group). B, C Two-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons test. D, F Two-tailed unpaired Student’s t-test. E Log-rank (Mantel–Cox) test. Data are shown as mean ± standard error of the mean (SEM) and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). histological staining, and overall survival showed that injection with can effectively inhibit the phosphorylation of STAT3 (Fig. 6D). LPS rmIL-35 significantly alleviated colitis (Fig. 4D–F). Intriguingly, rmIL- can induce the expression of IL-35 in B cells, but the expression of + + 35 promoted IL-35 B cell expansion in the gut-associated lymphoid IL-35 B cells was significantly reduced after the addition of Stattic, tissue (GALT) (Fig. 5A–C). In addition, the in vitro experiments and the addition of exogenous IL-35 was not able to reverse this showed that the proportion of IL-35 B cells increased after the reduction. In addition, rmIL-35 can also promote the increase of addition of rmIL-35 in the cultured system (Fig. 5D, E). This data IL-10 B cells, but was inhibited by Stattic (Fig. S5A, B), indicating that strongly suggests that IL-35 promotes the IL-35 B cells expansion the induction of IL-35 in B cells is biased towards the regulatory and consequently alleviated the DSS-induced colitis, thus exhibiting phenotype. Taken together, these results suggest that after a therapeutic effect. inhibition of STAT3 phosphorylation, autocrine IL-35 cannot + + promote the expression of IL-35 B cells, and IL-35 B cells can self- Autocrine IL-35 promoting IL-35 B cells through STAT3 promote through STAT3 phosphorylation. phosphorylation + + As showninFig. 5, IL-35 has positive feedback to promote IL-35 B IL-35 B cells modify the intestinal microbiota and their cells in vivo and in vitro, thus maintaining tissue homeostasis. metabolites Therefore, further exploration into the molecular mechanism of Previous studies have demonstrated that the cytokines that autocrine action of IL-35 B cells was warranted. RNA-seq revealed alleviate colitis are closely dependent on the intestinal microbiota an overall increase in the expression of the STAT family of B cells [19–22]. The mutual crosstalk between the cytokines and intestinal during colitis, and the STAT3 expression was most consistent with microbiota may lead to the hypothesis that IL-35 B cell are that of IL-35 (Fig. 6A, B). We analyzed the phosphorylation of STAT3 closely related to the modification of intestinal microbiota. by flow cytometry and western blot and found that the Therefore, we characterized the microbial composition of fecal phosphorylation of B cells was significantly increased after samples collected from mice with DSS-induced colitis on day 0, 4, stimulation with IL-35 (Fig. 6C, D). Stattic is a STAT3 inhibitor, which 7, and 10 using 16 S ribosomal RNA (rRNA) gene sequencing Cell Death Discovery (2023) 9:67 M. Xie et al. Fig. 5 Supplemented IL-35 attenuates severe colitis by skewing the B cell compartment in favor of IL-35 production. A–C Cells were isolated from mesenteric lymph nodes (MLNs) (A), Peyer’s patches (Patches) (B) and lamina propria (LP) (C) of mice pre-treated with + + + recombinant IL-35 or IgG at day 0 and 10 post-disease onset. The percentage of IL-35 producing B cells (CD19 IL-12A EBI3 cells) was + + + determined by flow cytometry (n = 3 per group). D Percentage of IL-35 producing B cells (B220 IL-12A EBI3 cells) with or without 20 ng/mL rIL-35 stimulation was detected by flow cytometry (n = 13 per group). E Production of IL-35 (Il12a and Ebi3) in B cells with or without 20 ng/mL rIL-35 stimulation was detected by RT-PCR (Il12a: lipopolysaccharide (LPS) group n = 9; LPS + rIL-35 group n = 15; Ebi3: LPS group n = 9; LPS + rIL-35 group n = 14). A–E Two-tailed unpaired Student’s t-test. Data are shown as mean ± standard error of the mean (SEM) and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). analyses. Figure 7A, B show that the diversity of the intestinal course (Fig. 7D). We hypothesized that IL-35 B cells could modify microbiota gradually decreased and then increased during the the diversity of gut microbiota and metabolites, thereby remission stage of the disease. Generally, the intestinal micro- alleviating disease. A fecal microbiota transplantation (FMT) biota immunomodulatory function depends on their metabolites was performed to confirm our hypothesis. Recipient mice were [23, 24]. Therefore, to further explain the association between IL- divided into two groups. The first group was stimulated with 35 B cell and the intestinal microbiota, we performed trypto- rmIL-35 and then their stool was transplanted into ABX-treated phan (indole) targeted metabolomic tests. We measured 21 mice (rmIL-35); and the second group was stimulated with the differential metabolites and analyzed their correlation with 32 isotype control and then their stool was transplanted into ABX- intestinal microbiotas as shown in Fig. 7C. The diversity of treated mice (isotype) (Fig. 7E). We measured the body weight microbial metabolites was consistent with that of the micro- and DAI every day, and the colon length was measured with the organisms (Fig. 7C, S6), and it is worth noting that, the expression histological staining. The rmIL-35 FMT group shown significantly of IAA, Indole-3-propionic acid (IPA), Indole-3-acrylic acid (IArA), reduced colitis symptoms (Fig. 7F–I) and we found that IAA was and Tryptophol (Iet) were decreased during the acute stage and increased after IL-35 treatment (Fig. 7J). These results suggest recovered during the remission stage. Among them, the that the presence of IL-35 could regulate the state of intestinal expression of IAA consistently followed the changes of disease microbiota and metabolic state. Cell Death Discovery (2023) 9:67 M. Xie et al. Fig. 6 Autocrine action of IL-35 producing B cells depends on the STAT3 pathway. A Bubble diagram shows transcription factor enrichment analysis ranked by significance in CD19 B cells isolated from Peyer’s patches of colitis induced mice at day 0, 4, 7, and 10 post-disease onset (n = 6 per group). B Heatmap shows the expression of the STAT family proteins in CD19 B cells isolated from Peyer’s patches of colitis induced mice at day 0, 4, 7, and 10 post-disease onset. Data are normalized and shown in the format of transcripts per million. Genes that are highly correlated with the expression levels of IL-35 in colitis are highlighted (n = 6 per group). C The expression of p-STAT3 in CD19 B cells after 72 h stimulation with or without rIL-35 are shown as mean fluorescence intensity (MFI) (n = 3 per group). Bar graphs represent the MFI of the groups (right panel). D Western blot of B cells stimulated under IL-35 producing B cells culture conditions with or without 10 nM STAT3 + + + inhibitor (stattic, 10 ng/mL) (n = 3 per group). E Percentage of IL-35 producing B cells (B220 IL-12A EBI3 cells) under IL-35 producing B cells culture conditions with or without 10 nM STAT3 inhibitor (stattic) was detected by flow cytometry (lipopolysaccharide (LPS) group n = 6; LPS + rIL-35 group n = 6; LPS + stattic group n= 6; LPS + rIL-35+stattic group n = 9). C–E Two-tailed unpaired Student’s t-test. Data are shown as mean ± standard error of the mean (SEM) and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). The intestinal microbes can promote the secretion of cytokines by establishing an IAA supplement experiment. Before the such as IL-10, which plays an important role in alleviating induction of the colitis model, IAA (0.5 mg/mouse/day) was inflammation [18, 25–27]. Therefore, according to the results of administered by gavage for seven consecutive days (Fig. 8B), metabolic measurements (Fig. 7C, D), we selected the substance and the changes in colitis progression were closely monitored. Body with the highest relative expression and the most significant weight loss (Fig. 8C), DAI score (Fig. 8D), pathological changes of change in colitis to verify its function. To clarify the direct intestinal tissue (Fig. 8E), and gross pathology of the intestines relationship between IAA and IL-35 secretion by B cells we (Fig. 8F) suggested that IAA treatment rescued the disease. stimulated B cells with IAA and the results showed that IAA could Subsequently, flow cytometry was performed to detect the stimulate IL-35 secretion by B cells in a concentration-dependent expression of IL-35 B cells in the intestinal tissues (Fig. 8G, H). The manner within a certain range under different concentration results showed that the GALT IL-35 B cells of IAA treatment group gradients (Fig. S7A). Further studies showed that 1000 µM IAA were significantly upregulated, suggesting that IAA can induce the could induce B cells to differentiate towards the regulatory B cell production of IL-35 B cells in vivo, and play a role in alleviating phenotype and secrete more IL-10 and IL-35 under IL-35 culture colitis. Taken together, IL-35 B cells can interact with intestinal conditions (Fig. 8A, S7B). We further confirmed the results in vivo microbes to cooperatively maintain intestinal homeostasis. Cell Death Discovery (2023) 9:67 M. Xie et al. DISCUSSION disease by secreting IL-35 which promotes its own expansion In this study, through in vivo and in vitro experiments and high- through STAT3. throughput sequencing methods, we demonstrated that IL-35 B Our previous studies have shown that B cells play a crucial role cells alleviate IBD by interacting with the microbial metabolite IAA in the remission of autoimmune diseases such as IBD [28, 29]. in the IBD microenvironment. Moreover, IL-35 B cells alleviate the When B cells are depleted in vivo, the disease deteriorates Cell Death Discovery (2023) 9:67 M. Xie et al. Fig. 7 Gut microbiota and tryptophan metabolite profiles in colitis. A Fecal samples (n = 24) were collected from 2.5% dextran sulfate sodium (DSS)-treated wildtype (WT) mice at day 0, 4, 7, and 10 post-disease onset and isolated genomic DNA was sequenced for the 16 S rRNA gene at the V3-V4 region. Principal coordinate analysis, Shannon index, and Chao1 index were calculated (n = 6 per group). B The taxonomic variations of microbial communities across mice of different post-disease onset were analyzed and shown as a stack bar plot (n = 6 per group). C Tryptophan metabolites in the 24 fecal samples were detected by high performance liquid chromatography (n = 6 per group). The correlations between the 21 metabolites and 32 significant microbiota families (shown in B) were calculated using spearman’s rank correlation analysis. Microbiota families or metabolites which were upregulated in colitis were clustered into the red color module, and downregulated ones were clustered into the blue color module. D Metabolites concentration of differential metabolites (IAA, IArA, IPA, and IEt) which were highlighted in C are shown as density in the bar plots (n = 6 per group). E Experimental scheme outlining the water schedule, duration of diet, and microbial transplantation. F Body weight was calculated (n = 6 per group). G Disease activity index (DAI) was calculated (n = 6 per group). H Representative colon sections are shown for each group. Length of the colon is shown on the bar graph (n = 6 per group). I Representative colon sections stained with hematoxylin and eosin (upper panel) and periodic acid-Schiff (lower panel) are shown for each group. Images are shown at ×100 magnification (n = 8 in each group). J The concentration of IAA after FMT. A, D, H, I, J Two-tailed unpaired Student’s t-test. C Spearman’s rank correlation coefficient. F, G Two-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons test. Data are shown as mean ±standard error of the mean (SEM) and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). irretrievably. Cytokines play a vital role in B-cell disease remission. found that the expression of microbial diversity and the Although IL-10 has been reported to play an important role in metabolite IAA decreased significantly during the acute phase of diseases, there is increasing evidence that other cytokines are also colitis and increased during the remission phase. These results essential [30]. Thus, we searched the GEO database and found that confirmed that there were significant differences in the composi- EBI3 was elevated. EBI3 and IL-12a form IL-35, while EBI3 and P28 tion of intestinal microbiota in mice during the different stages of form IL-27. The peripheral blood and colon samples of patients colitis, which was often a key factor affecting the outcome of the with UC were collected, and an increase of IL-35 but not IL-27 disease. Importantly, there was a significantly increased expression (data not shown) in B cells was observed, indicating that IL-35 may of IAA observed when exogenous IL-35 was administered, and IAA be involved in the process of UC. also promoted IL-35 B cell differentiation and expansion. Thus, we We hypothesized that B cells can rescue colitis dependent on IL- elucidated the interaction between IL-35 B cells and IAA in 35; therefore, we attempted to knock down the IL-35-related maintaining intestinal homeostasis. molecules. IL-35 is a dimer, consisting of IL-12a and EBI3. Because IL-12a and P40 constitute IL-12, and EBI3 and P28 constitute IL-27 [10, 31], the double-knock mice would have too many deletions of METHODS AND MATERIAL the involved cytokines and the mice did not survive. Therefore, Human subjects the existing reports all use either EBI3 or IL-12a knockout mice to A total of 14 UC patients and 11 age-matched healthy individuals establish the disease models and demonstrate the role of IL-35 were recruited at the Department of Gastroenterology of Jing’an [5, 32]. We found that mice with either EBI3 or IL-12a knockout did District Central Hospital of Shanghai, China with the protocol not have a more severe disease presentation, suggesting that approved by ethics committee of Jing’an District Central Hospital these molecules themselves cannot solely alleviate the disease. It of Shanghai (Approval number: 2022-018). UC was diagnosed in is worth noting that the disease improved after IL-12a knockdown, accordance with The European Crohn’s and Colitis Organization which indicates that IL-12 may play a pathogenic role. Interest- guidelines [38]. Peripheral blood was obtained from 14 UC ingly, B cell-derived EBI3 and IL-12a knockdown significantly patients and formalin fixed paraffin-embedded human colon aggravated the disease, indicating that B cell-derived IL-35 has an specimens from 6 UC patients were randomly collected at Jing’an alleviatory effect, which is consistent with other reports [4, 5, 33]. District Central Hospital of Shanghai, China. All patients and We then attempted to adoptively transfer IL-35 Bcells into mice. healthy volunteers enrolled in this study provided informed IL-35 can induce large amounts of IL-35 in B cells, and about 20% of consents. Detailed Patient information is listed in Table 1. the intestinal B cells can differentiate into IL-35 Bcells, but because there is no specificsurface marker of IL-35 Bcells they cannot be Mice isolated. Because rmIL-35 can promote the expansion of many IL- Wild-type (WT) C57BL/6 mice purchased from SLRC Laboratory 35 B cells in vitro and in vivo, we injected exogenous rmIL-35 Animal (Shanghai, China) were used in this study. B6.129×1- −/− −/− intraperitoneally to observe the therapeutic effects. We have Ebi3tm1Rsb/J(Ebi3 ), B6.129S1-Il12atm1Jm/J(Il12a )and performed studies regarding the mechanisms of B cells function B6.129S2-Ighmtm1cng/J (μMT) mice were purchased from Jackson [28, 34, 35], such as cooperating with Tregs, producing of HSP70 and Laboratory (Bar Harbor, ME, USA). Prior assessments were conducted IgA, etc. Here we aimed to reveal how IL-35 B cells work. When based on our experience performing survival rate of colitis model intestinal B cells were treated with rmIL-35 in vivo and in vitro it was under different doses of DSS and other experiments included in this found that IL-35 B cells were expanded, and because they continue work. All animal procedures in this study were approved by the to self-promote andexpandfurther,IL-35 B cells are sufficient to animal care and use committee of Fudan University and conformed alleviate the disease during the course of infection. The molecular to the Guide for the Care and Use of Laboratory Animals. pathway by which B cell-derived IL-35 function with other cells has not been extensively reported. We used RNA-seq and determined Dextran sodium sulfate (DSS)-induced Colitis that the expression of the STAT family was significantly increased in Experimental colitis was established by administering 2.5% DSS cells stimulated with IL-35, especially STAT3 expression, and STAT3 (w/v; MP Biomedicals, Irvine, CA, USA) in the drinking water for phosphorylation levels were significantly increased which was 7 days as previously described [39], normal drinking water was consistent with other reports [11, 36]. then given for 3 days in order to mimic the remission phase of Microbial therapy is the future of medical biology [37], and IAA ulcerative colitis. was reported to promote IL-35 B regulatory cells [18]. Therefore, we explored whether the relationship between IL-35 B cells and Adoptive transfer microbes with their metabolites in the intestines could interact to B cells were purified from the spleens of WT mouse or IL-35 gene −/− −/− maintain the immune system and intestinal homeostasis. We knockout (Il12a and Ebi3 ) mouse by using a mouse B cell Cell Death Discovery (2023) 9:67 M. Xie et al. negative isolation kit (StemCell Technologies, Vancouver, BC, IL-35 in vitro rescue assay Canada). Purified B cells were adoptively transferred into 8-week- Recombined mouse IL-35(rIL-35) was purchased from Chimerigen old male μMT mice intravenously, followed by the administration of (Liestal, Switzerland). WT mice were randomly assigned to four 2.5% DSS. Adoptive transfer was performed with 1 × 10 cells/mouse groups: (1) Isotype; (2) rIL-35; (3) Isotype+DSS induction and (4) 48 h before DSS administration. rIL-35+DSS induction. In group (2) and group (4), rIL-35 was Cell Death Discovery (2023) 9:67 M. Xie et al. Fig. 8 Supplementation with IAA suppresses colitis by skewing the B cell compartment in favor of an IL-35 producing B cell phenotype. + + + A Percentage of IL-35 producing B cells (B220 IL-12A EBI3 ) in B cells with or without 1000 nM IAA treatment was detected by flow cytometry (lipopolysaccharide (LPS) group n = 12; LPS + rIL-35 group n= 11; LPS + rIL-35+IAA group n = 12). Bar graphs represent the frequencies of IL-35 producing B cells in the groups (right panel). B Wildtype (WT) mice were gavaged with IAA daily 1 week prior to the induction of colitis and throughout the experiment. C Body weight was calculated (n = 4 per group). D Disease activity index (DAI) was calculated (n = 7 per group). E Representative colon sections stained with hematoxylin and eosin (upper panel) and periodic acid-Schiff (lower panel) are shown for each group. Images are shown at ×100 magnification (n = 8 per group). F Representative colon sections are shown for each group. Length of the colon is shown on the bar graph (n = 9 per group). G, H Cells were isolated from Peyer’s patches (Patches) G (n = 6 per group) and lamina propria (LP) (H)(n = 6 per group) of the control or IAA treatment group and the percentage of the IL-35-producing B + + + cells (CD19 IL-12A EBI3 ) in B cells was determined by flow cytometry. C, D Two-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons test. A, E–H Two-tailed unpaired Student’s t-test. Data are shown as mean ± standard error of the mean (SEM) and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). were collected on day 7 and then resuspended in 5% Table 1. Sample Information: Gender, age, patient or Healthy control, thioglycollate broth (w/v, Solarbio, Beijing, China). Fecal mixture stage of disease. was centrifuged at 2000 rpm, supernatant was collected. The supernatant was orally gavaged into ABX mice for 7 days fecal Subject Gender Age (years) Classification Stage transplantation, mice were then administered with 2.5% DSS to 1 F 21 UC Active induce colitis. 2 F 24 UC Active 3 M 56 UC Active Gavage with IAA Wild-type mice were orally gavaged with IAA (0.5 mg/mice, 4 F 62 UC Active dissolved in oil) daily 1 week prior to the induction of colitis and 5 M 58 UC Active throughout the experiment. Control group mice received oil only. 6 M 43 UC Active 7 M 33 UC Active Histopathology Colons were flushed using PBS and then fixed in 4% paraformal- 8 M 25 UC Active dehyde and embedded in paraffin. Colon sections were stained 9 M 65 UC Active with hematoxylin & eosin (H&E) or Periodic Acid Schiff (PAS). 10 F 34 UC Active Histological scoring of colitis was performed by at least two 11 F 57 UC Active pathologists under a blinded fashion. The score was a combina- tion of tissue Integrity and inflammatory cell infiltration. 12 F 19 UC Active 13 M 65 UC Active Immunofluorescence staining 14 M 48 UC Active Peyer’s patches and human colon biopsy samples were collected 15 M 42 Healthy control / and fixed in paraformaldehyde and embedded in paraffin. For immunofluorescence (IF) staining, tissue sections were blocked 16 M 56 Healthy control / with 5% (w/v) fetal bovine serum (FBS) for 30 min at room 17 F 28 Healthy control / temperature, and then stained with purified antibodies for CD20 18 F 24 Healthy control / (for mice samples: 1:100,Abcam,Cambridge,MA, USA, 19 F 31 Healthy control / ab271288; for human samples: 1:100, Abcam, ab279300), IL- 12A (1:100, Abcam,ab131039) and EBi3 (1:50, Santa Cruz 20 M 25 Healthy control / Biotechnology, Santa Cruz, CA, USA) for 15 h at 4 °C, and then 21 F 21 Healthy control / stained with Alexa Fluor 488 anti-rabbit IgG monoclonal 22 F 20 Healthy control / antibody (Thermo Fisher Scientific, Waltham, MA, USA), Alexa 23 M 38 Healthy control / Fluor 568 anti-rat IgG monoclonal antibody (Thermo Fisher) and Alexa Fluor 647 anti-mouse IgG monoclonal antibody (Thermo 24 M 32 Healthy control / Fisher) for 1 h at room temperature. The specmens were 25 F 64 Healthy control / analysed using fluorescence microscopy. 26 M 59 Healthy control / 27 F 40 Healthy control / Cell isolation and differentiation B cells were purified from the spleens of WT mouse by using a 28 M 65 Healthy control / mouse B cell negative isolation kit (StemCell Technologies). sorted naive B cells were then stimulated for 72 h with 10 µg/mL LPS (Sigma-Aldrich, St. Louis, MO, USA). administered intravenously [0.75 μg/mice, dissolved in 200 μl For IL-35 producing B cell differentiation, naive B were cultured phosphate-buffered saline (PBS)] to the mice 48 h before model under IL-35 producing B cell culture system with 10 µg/mL LPS induction. Isotype groups [group (1) and group (3)] were received and 20 ng/mL rmIL-35 for 72 h. IgG administration [0.75 μg/mice, dissolved in 200 μl phosphate- buffered saline (PBS)]. Real-time polymerase chain reaction (PCR) analysis Total RNA of B cells was extracted using RNA extraction kit Microbiota transplantation (Tiangen Scientific, Beijing, China) followed reverse transcription. To eliminate gut microbiota, Wild-type mice were treated with Real-time polymerase chain reaction was performed using SYBR antibiotic cocktail ABX (1 g/L metronidazole; 0.5 g/L vancomycin; Green Master Mix (TaKaRa, Tokyo, Japan) on the ABI 7500 1 g/L ampicillin; 1 g/L neomycin) as described previously for Thermocycler (Applied Biosystems, California, USA) according to 14 days (ABX mice). Feces of mice treated with rIL-35 or isotype the manufacture’s instructions. The relative gene expression Cell Death Discovery (2023) 9:67 M. Xie et al. Table 2. Primer Sequence: Primer sequence of mice genotyping and qRT-PCR. Primer Sequence(5′-3′) Usage muMT Mutant R TTGTGCCCAGTCATAGCCGAAT Mice genotyping muMT common CCGTCTAGCTTGAGCTATTAGG Mice genotyping muMT WT R GAAGAGGACGATGAAGGTGG Mice genotyping IL12A Mutant F CTGAATGAACTGCAGGACGA Mice genotyping IL12A Mutant R ATA CTT TCT CGG CAG GAG CA Mice genotyping IL12A Wild Type F CAG CAT GTG TCA ATC ACG Mice genotyping IL12A Wild Type R TCA CCA TGT CAT CTG TGG Mice genotyping EBi3 Mutant R GCC AGA GGC CAC TTG TGT AG Mice genotyping EBi3 Common AAC CTC AGG CCA GGC AGT Mice genotyping EBi3 Wild Type R TTC CGT AGG CCA TGT AGG AC Mice genotyping IL12p35 F GACCTGTTTACCACTGGAACTA qRT-PCR IL12p35 R GATCTGCTGATGGTTGTGATTC qRT-PCR EBi3 F CTTCTCTCTCAAGTACCGACTC qRT-PCR EBi3 R TTATGGGGTGCACTTTCTACTT qRT-PCR β-actin F CCAGCCTTCCTTCTTGGGTATG qRT-PCR β-actin R TGTGTTGGCATAGAGGTCTTTACG qRT-PCR compared with GAPDH was calculated using the ΔΔCt method. For intranuclear (p-STAT3) marker staining, cells were previously Primers for target genes are listed in Table 2. surface stained and then fixed and permeabilized using a transcription factor staining buffer set (Thermo Fisher Scientific) Western blot and stained with PE-p-STAT3 (Thermo Fisher Scientific) for 45 min B cells were negatively purified from WT mice and cultured under according to the manufacturer’s protocol. IL-35 producing B cells’ culture system. Then B cells were lysed Isotype antibodies were used as negative controls. Flow and protein from 1 × 10 cells was resolved by SDS-PAGE and cytometry analysis was performed using BD Celesta Analyzer. transferred to polyvinylidene fluoride (PVDF) membranes (Merck Millipore, Billerica, MA, USA), and blotted with anti-STAT3 (1:5000, RNA sequencing Abcam) and anti-p-STAT3 (1:5000, Abcam). Bound antibodies were Patches’ CD19 B cells were isolated from wild type mice at day 0, revealed with HRP-conjugated species-specific secondary anti- 4, 7 and 10. Total RNA was isolated from sorted B cells using the bodies using ECL substrate (Amersham Pharmacia Biotech, Total RNA isolation kit (Tiangen Scientific) according to manu- Station, NY, USA). facturer’s instructions. And then total RNA was qualified and quantified with a Nano Drop and Agilent 2100 bioanalyzer Enzyme-linked immunosorbent assay (Thermo Fisher Scientific) followed by mRNA purification. Fecal supernatant was collected from colitis mice on days 0, 4, 7, A total of 500 ng purified mRNA was fragmented followed by and 10. IL-6, TNF-α, interferon (IFN)-γ, IL-10, IL-35 and immuno- reverse transcription and second strand cDNA synthesis. The globulin A (IgA) levels in the supernatants were determined by double strand PCR products above were heated denatured and enzyme-linked immunosorbent assay (ELISA) according to the circularized by the splint oligo sequence. The final library was manufacture’s protocols (Thermo Fisher Scientific). amplified with phi29 (Thermo Fisher Scientific) and single end 50 bases reads were generated on BGISEQ500 platform (BGI, Measurement of IAA in Mouse Feces Shenzhen, China). Reads were then mapped to the Mus musculus Fecal supernatant was collected from colitis mice treated with rIL- GRCm38 reference genome. Gene annotations were applied from 35 or isotype at day 10. The contents of IAA in the fecal samples Ensembl. Gene expression levels were quantified using htseq- were determined with ELISA kit from Shanghai ShuHua Biological count and estimated independently with TPM with Kallisto. Technology Co. Ltd. (Shanghai, China), according to the manu- facture’s instruction. 16 S rDNA sequencing 24 samples of fecal material from Wild-type mice at day 0, 4, 7 and Flow cytometry 10 after 2.5% DSS administration was extracted using the CTAB kit For surface marker staining, mononuclear cells were previously according to manufacturer’s protocol. Total DNA was eluted in blocked with anti-CD16/32 antibody (Thermo Fisher Scientific) for Elution buffer and barcoded primers[341 F(5’-CCTACGGGNGGCWGC 15 min and then incubated with the following anti-mouse AG-3’);805 R(5’-GACTACHVGGGTATCTAATCC-3’)] were designed to antibodies: PE-CD19, PE-B220 and Pacific blue-CD45 (all purchased span the V3-V4 region of 16 S rRNA gene as previously described. from Thermo Fisher Scientific). The PCR conditions was consisted of an initial denaturation at 98 °C For intracellular marker staining, cells were previously stimulated for30s;32cyclesofdenaturation at98°Cfor 10s, annealingat54°C with 50 ng/mL PMA and 750 ng/mL ionomycin in the presence of for 30 s, and extension at 72 °C for 45 s; and then final extension at 20 µg/mL brefeldin A for 5 h, then surface-stained for 30 min. After 72 °C for 10 min. The amplicon pools were prepared for sequencing surface marker staining, cells were resuspended in Fixation/ and the size and quantity of the amplicon library were assessed on Permeabilization Buffer Set (Thermo Fisher Scientific) and stained Agilent 2100 Bioanalyzer and with the Library Quantification Kit for with PE-Cy7-IL-10 (BioLegend, San Diego, CA, USA); APC-IL-12A Illumina, respectively. The libraries were sequenced on NovaSeq (Thermo Fisher Scientific) and FITC-EBI3 (Novus Biologicals, Littleton, PE250 platform. Samples were sequenced on an Illumina NovaSeq CO, USA) for 45 min according to the manufacturer’sprotocol. platform according to the manufacturer’s recommendations. Cell Death Discovery (2023) 9:67 M. Xie et al. Analysis of tryptophan metabolites by high performance 14. Lin D, Yang L, Wen L, Lu H, Chen Q, Wang Z. Crosstalk between the oral microbiota, mucosal immunity, and the epithelial barrier regulates oral mucosal liquid chromatography disease pathogenesis. Mucosal Immunol. 2021;14:1247–58. For High Performance Liquid Chromatography analysis of 15. He Y, Fu L, Li Y, Wang W, Gong M, Zhang J, et al. Gut microbial metabolites tryptophan metabolites, feacal samples were collected and froze facilitate anticancer therapy efficacy by modulating cytotoxic CD8(+) T cell in liquid nitrogen before metabolites measurement. The metabo- immunity. Cell Metab. 2021;33:988–1000. lites were extracted from feacal samples using high throughput 16. Oh JZ, Ravindran R, Chassaing B, Carvalho FA, Maddur MS, Bower M, et al. TLR5- tissue lyser according to the manufacture’s protocol. Then mediated sensing of gut microbiota is necessary for antibody responses to extracted metabolites were resolved using ACQUITY UPLC® HSS seasonal influenza vaccination. Immunity. 2014;41:478–92. T3 Column (2.1×150 mm, 1.8 μm, Waters, Watertown, MA, USA) on 17. Hendrikx T, Duan Y, Wang Y, Oh JH, Alexander LM, Huang W, et al. Bacteria a ACQUITY analysis system from Waters and identified using Lipid engineered to produce IL-22 in intestine induce expression of REG3G to reduce Search software. ethanol-induced liver disease in mice. Gut. 2019;68:1504–15. 18. Su X, Zhang M, Qi H, Gao Y, Yang Y, Yun H, et al. Gut microbiota-derived metabolite 3-idoleacetic acid together with LPS induces IL-35(+) B cell genera- Data accession tion. Microbiome. 2022;10:13. The raw data of RNA sequencing are available in GEO (http:// 19. James KR, Gomes T, Elmentaite R, Kumar N, Gulliver EL, King HW, et al. Distinct www.ncbi.nlm.nih.gov/geo/) with the accession number microbial and immune niches of the human colon. Nat Immunol. 2020;21:343–53. GSE210506. And the accession number for the 16 S rRNA 20. Mishima Y, Oka A, Liu B, Herzog JW, Eun CS, Fan TJ, et al. Microbiota maintain sequencing reported in this paper is PRJNA866337. colonic homeostasis by activating TLR2/MyD88/PI3K signaling in IL-10-producing regulatory B cells. J Clin Invest. 2019;129:3702–16. Statistical analysis 21. Ihara S, Hirata Y, Koike K. TGF-beta in inflammatory bowel disease: a key regulator of immune cells, epithelium, and the intestinal microbiota. J Gastroenterol. Quantitative data were expressed as mean ± Standard Error of 2017;52:777–87. Mean (SEM). Differences were determined by unpaired two-tailed 22. Freychet P. New data in the domain of insulin resistance. Sem Hop. t-test for comparing two groups. For murine clinical data (body 1977;53:1421–4. weight and clinical scores), differences among different groups 23. Cohen I, Ruff WE, Longbrake EE. Influence of immunomodulatory drugs on the were determined using two-way ANOVA (Dunnett’s multiple gut microbiota. Transl Res. 2021;233:144–61. comparisons test). Correlations of 32 representative gut microbiota 24. Yu B, Wang L, Chu Y. Gut microbiota shape B cell in health and disease settings. J species and 21 representative tryptophan metabolites were Leukoc Biol. 2021;110:271–81. evaluated using Spearman’s rank correlation coefficient. All 25. Gasaly N, de Vos P, Hermoso MA. Impact of bacterial metabolites on gut barrier p < 0.05 were considered significant. Statistical tests were carried function and host immunity: a focus on bacterial metabolism and its relevance for intestinal inflammation. Front Immunol. 2021;12:658354. out using GraphPad Prism (La Jolla, CA, USA, USA) v. 8.0.1 Software. 26. Krishnan S, Ding Y, Saedi N, Choi M, Sridharan GV, Sherr DH, et al. Gut microbiota- derived tryptophan metabolites modulate inflammatory response in hepatocytes and macrophages. Cell Rep. 2018;23:1099–111. DATA AVAILABILITY 27. Gao J, Xu K, Liu H, Liu G, Bai M, Peng C, et al. Impact of the gut microbiota on The authors confirm that the data supporting the findings of this study are available intestinal immunity mediated by tryptophan metabolism. Front Cell Infect within the article and its supplementary materials. Microbiol. 2018;8:13. 28. Wang L, Ray A, Jiang X, Wang JY, Basu S, Liu X, et al. T regulatory cells and B cells cooperate to form a regulatory loop that maintains gut homeostasis and sup- presses dextran sulfate sodium-induced colitis. Mucosal Immunol. REFERENCES 2015;8:1297–312. 1. Ye C, Yano H, Workman CJ, Vignali DAA. Interleukin-35: structure, function and its 29. Wang Z, Zhang H, Liu R, Qian T, Liu J, Huang E, et al. Peyer’s patches-derived impact on immune-related diseases. J Interferon Cytokine Res: Off J Int Soc CD11b(+) B cells recruit regulatory T cells through CXCL9 in DSS-induced colitis. Interferon Cytokine Res. 2021;41:391–406. Immunology. 2018:155;356–66. 2. Collison LW, Workman CJ, Kuo TT, Boyd K, Wang Y, Vignali KM, et al. The inhi- 30. Ray A, Wang L, Dittel B. N IL-10-independent regulatory B cell subsets and bitory cytokine IL-35 contributes to regulatory T-cell function. Nature. mechanisms of action. Int Immunol. 2015:27;531–6 2007;450:566–9. 31. Collison LW, Vignali DA. Interleukin-35: odd one out or part of the family? 3. Dambuza IM, He C, Choi JK, Yu CR, Wang R, Mattapallil MJ, et al. IL-12p35 induces Immunol Rev. 2008;226:248–62. expansion of IL-10 and IL-35-expressing regulatory B cells and ameliorates 32. Damo M, Joshi NS. Treg cell IL-10 and IL-35 exhaust CD8(+) T cells in tumors. Nat autoimmune disease. Nat Commun. 2017;8:719. Immunol. 2019;20:674–5. 4. Shen P, Roch T, Lampropoulou V, O’Connor RA, Stervbo U, Hilgenberg E, et al. IL- 33. Michaud D, Steward CR, Mirlekar B, Pylayeva-Gupta Y. Regulatory B cells in 35-producing B cells are critical regulators of immunity during autoimmune and cancer. Immunol Rev. 2021;299:74–92. infectious diseases. Nature. 2014;507:366–70. 34. Fu Y, Wang Z, Yu B, Lin Y, Huang E, Liu R, et al. Intestinal CD11b(+) B cells 5. Wang RX, Yu CR, Dambuza IM, Mahdi RM, Dolinska MB, Sergeev YV, et al. ameliorate colitis by secreting immunoglobulin A. Front Immunol. Interleukin-35 induces regulatory B cells that suppress autoimmune disease. Nat 2021;12:697725. Med. 2014;20:633–41. 35. Wang L, Fu Y, Yu B, Jiang X, Liu H, Liu J, et al. HSP70, a novel regulatory molecule 6. Yang L, Jia S, Shao X, Liu S, Zhang Q, Song J, et al. Interleukin-35 modulates the in B cell-mediated suppression of autoimmune diseases. J Mol Biol. balance between viral specific CD4(+)CD25(+)CD127(dim/-) regulatory T cells 2021;433:166634. and T helper 17 cells in chronic hepatitis B virus infection. Virol J. 2019;16:48. 36. Ma N, Fang Y, Xu R, Zhai B, Hou C, Wang X, et al. Ebi3 promotes T- and B-cell 7. Wang S, Qin C. Interleukin 35 rescues regulatory B cell function, but the effect is division and differentiation via STAT3. Mol Immunol. 2019;107:61–70. dysregulated in ulcerative colitis. DNA cell Biol. 2017;36:413–21. 37. Wu M, Bai J, Ma C, Wei J, Du X. The role of gut microbiota in tumor immu- 8. Fonseca-Camarillo G, Furuzawa-Carballeda J, Yamamoto-Furusho JK. Interleukin notherapy. J Immunol Res. 2021;2021:5061570. 35 (IL-35) and IL-37: Intestinal and peripheral expression by T and B regulatory 38. Gionchetti P, Dignass A, Danese S, Magro Dias FJ, Rogler G, Lakatos PL, et al. 3rd cells in patients with Inflammatory Bowel Disease. Cytokine. 2015;75:389–402. European evidence-based consensus on the diagnosis and management of 9. Collison LW, Delgoffe GM, Guy CS, Vignali KM, Chaturvedi V, Fairweather D, et al. Crohn’s disease 2016: part 2: surgical management and special situations. J The composition and signaling of the IL-35 receptor are unconventional. Nat Crohn’s colitis. 2017;11:135–49. Immunol. 2012;13:290–9. 39. Das S, Batra SK, Rachagani S. Mouse model of dextran sodium sulfate (DSS)- 10. Banchereau J, Pascual V, O’Garra A. From IL-2 to IL-37: the expanding spectrum of induced Colitis. Bio Protoc. 2017;7:e2515. anti-inflammatory cytokines. Nat Immunol. 2012;13:925–31. 11. Choi JK, Egwuagu CE. Interleukin 35 regulatory B cells. J Mol Biol. 2021;433:166607. 12. Kamada N, Seo SU, Chen GY, Nunez G. Role of the gut microbiota in immunity ACKNOWLEDGEMENTS and inflammatory disease. Nat Rev Immunol. 2013;13:321–35. The authors thank all the volunteers in this study for devoting time to our research. 13. Fitzgerald RS, Sanderson IR, Claesson MJ. Paediatric inflammatory bowel disease We also thank Dr. Xunjia Cheng, Dr. Mingfang lu and Dr. Yuli Lin for valuable and its relationship with the microbiome. Micro Ecol. 2021;82:833–44. suggestions and helpful discussions. Cell Death Discovery (2023) 9:67 M. Xie et al. AUTHOR CONTRIBUTIONS Correspondence and requests for materials should be addressed to Yiwei Chu or MX designed and performed the experiments, analyzed data, and wrote the Luman Wang. manuscript. LW and YC designed the experiments and wrote the manuscript. QW and EG improved the manuscript. Y Zhu and Y Zhou performed the experiments and Reprints and permission information is available at http://www.nature.com/ analyzed the data. The last two authors contributed equally to this work. reprints Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. FUNDING This work was supported by the General Program of the National Natural Science Foundation of China (81971493), Major Program of National Natural Science Foundation of China (81730045, 82130050), Young Scientists Fund of the National Open Access This article is licensed under a Creative Commons Natural Science Foundation of China (81501394), Shanghai Rising-Star Program Attribution 4.0 International License, which permits use, sharing, (20QA1407900), and Innovative Research Team of High-level Local Universities in adaptation, distribution and reproduction in any medium or format, as long as you give Shanghai. appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the COMPETING INTERESTS article’s Creative Commons license and your intended use is not permitted by statutory The authors declare no competing interests. regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http:// creativecommons.org/licenses/by/4.0/. ADDITIONAL INFORMATION Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41420-023-01366-5. © The Author(s) 2023 Cell Death Discovery (2023) 9:67 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Cell Death Discovery Springer Journals

Interleukin-35 -producing B cells rescues inflammatory bowel disease in a mouse model via STAT3 phosphorylation and intestinal microbiota modification

Loading next page...
 
/lp/springer-journals/interleukin-35-producing-b-cells-rescues-inflammatory-bowel-disease-in-k9StK5K1Yq

References (39)

Publisher
Springer Journals
Copyright
Copyright © The Author(s) 2023
eISSN
2058-7716
DOI
10.1038/s41420-023-01366-5
Publisher site
See Article on Publisher Site

Abstract

www.nature.com/cddiscovery ARTICLE OPEN Interleukin-35 -producing B cells rescues inflammatory bowel disease in a mouse model via STAT3 phosphorylation and intestinal microbiota modification 1,2 3 2 2 3 1,4,6✉ 1,5,6✉ Minxiang Xie , Yuzhen Zhu , Yunjiao Zhou , Qiao Wang , Erli Gu , Yiwei Chu and Luman Wang © The Author(s) 2023 + + Interleukin-35 (IL-35)-producing B cells (IL-35 B cells) play an important role in diseases, and the expansion of IL-35 immune cells have been observed in inflammatory bowel disease (IBD). However, how IL-35 B cells function and the manner in which they perform their roles remain unclear. In this study, human samples and animal models were used to confirm the expansion of IL-35 B −/− −/− cells during IBD. In addition, by using il12a and ebi3 mice, we demonstrated that the regulatory role of B cells in IBD depends on IL-35. Mechanically, IL-35 B cells can promote its own expansion through endocrine actions and depend on the transcription factor signal transducer and activator of transcription 3. Interestingly, we found that the diversity of intestinal microbes and expression of microbial metabolites decreased during IBD. IL-35 B cells promote the high expression of indoleacetic acid (IAA), and exogenous metabolite supplementation with IAA can further promote the expansion of IL-35 B cells and rescues the disease. This study provides a new concept for the regulatory model of B cells and a new approach for the treatment of IBD. Cell Death Discovery (2023) 9:67 ; https://doi.org/10.1038/s41420-023-01366-5 INTRODUCTION microenvironment and orchestrates the immune response to Interleukin-35 (IL-35) is a heterodimeric cytokine that consists of maintain homeostasis. two monomers, IL12a and Ebi3. It is a recently identified cytokine Microbes and their metabolites play a critical role in IBD, of the family, which plays a key role in the suppressive function of Ruminococcaceae, Enterobacteriaceae, and Escherichia coli are immune cells [1, 2]. The IL-35-producing B cells (IL-35 B cells) is highly expressed in the intestinal tract of patients with IBD, while the most recently described B cell subset and can exert inhibitory the expression of Lachnospiraceae, Coriobacteriaceae, and Bifido- effects through both monomers and as a whole [3–5]. The IL-35 B bacteriaceae are decreased in the intestinal tract of these patients cells and IL-35 play an important role in immune-related diseases. [12, 13]. Toll-like receptor ligand and microbe metabolites, short For instance, mice deficient in B cell derived IL-35 develop chain fatty acid (SCFA), conjugated linoleic acid, and indoleacetic exacerbated experimental autoimmune uveoretinitis and experi- acid (IAA) can reshape and reprogram immune cells, including B mental allergic encephalomyelitis (EAE) [4, 5]. In hepatitis B virus cells [14, 15]. For example, TLR5 is a key receptor for the infection, it has been suggested that IL-35 modulates the balance maintenance of B-1a B cells. And flagellin, the TLR5 ligand on between regulatory and effector lymphocytes with disease the surface of intestinal microbes, is an indispensable factor for outcome depending on the stage of the disease [6]. In the remodeling of this B cell subtype [16]. The SCFA butyric acid inflammatory bowel disease (IBD), studies have shown that IL-35 increased the anti-tumor effect in CD8 T cells by increasing the is abnormally expressed in patients [7, 8], but the role of IL-35 B expression and function of the inhibitor of DNA binding 2 (ID2) cells in IBD has not been reported. IL-35 functions through [15]. IAA as a microbe metabolite can induce Th22 cells to produce receptors, but it has various receptors. In T or B cells, IL-35 is more IL-22 by regulating the islet regeneration protein, thus thought to signal through the IL12Rβ2/lL12Rβ2, IL12Rβ2/gp130, performing a negative regulatory role [17]. Importantly, recent gp130/gp130, and IL-12Rβ2/IL27Rα receptors [5, 9]. Upon binding reports have indicated that IAA and lipopolysaccharide (LPS) can to cognate receptors, the receptor-associated Janus kinases (Jak1, induce IL-35 B cell expression in vitro and in vivo [18]. However, Jak2, and Tyk2) are activated, providing phosphotyrosine-docking the relationship between microbe metabolites and IL-35 B cells in sites that recruit specific members of the signal transducer and IBD remains unknown. activator of transcription (STAT) transcription factors [10, 11]. Our results suggest that IL-35 B cell expansion during IBD relies However, there are many unknown aspects about IL-35 B cells, on EBI3 and IL12A to perform their inhibitory functions to including how IL-35 B cells interact with the disease maintain intestinal homeostasis for disease remission. During the 1 2 Department of Immunology, School of Basic Medical Sciences, and Institutes of Biomedical Sciences, Fudan University, Shanghai 200032, China. Key Laboratory of Medical Molecular Virology (MOE/NHC/CAMS), School of Basic Medical Sciences, Fudan University, Shanghai 200032, China. Department of gastroenterology, Jing’an District Central 4 5 Hospitals, Fudan University, Shanghai, China. Biotherapy Research Center, Fudan University, Shanghai 200032, China. Department of Endocrinology and Metabolism, Shanghai Fifth People’s Hospital, Fudan University, Shanghai, China. These authors contributed equally: Yiwei Chu, Luman Wang. email: yiweichu@fudan.edu.cn; lumanwang@fudan.edu.cn Received: 11 December 2022 Revised: 8 February 2023 Accepted: 10 February 2023 Official journal of CDDpress 1234567890();,: M. Xie et al. disease, both the microbe diversity and microbe metabolite Next, we used a widely accepted 2.5% dextran sulfate sodium expression were decreased. After the metabolites were supple- (DSS)-induced colitis murine model and performed more detailed mented with IAA the expression of IL-35 B cells was significantly intestinal and in vivo experiments to confirm the above results increased, and the disease was effectively treated. (Fig. S2A). As shown in Fig. S2, the DSS-induced mice exhibited significantly more weight loss (Fig. S2B) and severe disease symptoms as measured by the disease activity index (DAI) score RESULTS (Fig. S2C). The DSS-treated mice showed shortening of the colon IL-35 B cell expansion in the intestinal tract of patients with in the acute stage (day 4 and 7) and recovered in the remission IBD and dextran sulfate sodium induced colitis in mice stage (day 10) (Fig. S2D). Moreover, the overall survival was To identify the immune system-related profiles of patients with decreased after DSS induction (Fig. S2E). To further evaluate the ulcerative colitis (UC), we found a suitable dataset from the Gene disease severity the degree of intestinal injury was histopatholo- Expression Omnibus (GEO) database. According to GSE11223, in gically assessed and acute colitis in the DSS-induced mice was samples from patients with active UC, regulatory cytokines such as IL- characterized by epithelial damage, focal crypt injury, goblet cell 10 and EBI3 were significantly increased (Fig. S1A). In addition, the depletion, and inflammatory cell invasion, which were milder in gene expression profile was obtained from GSE38713, and the remission stage (Fig. S2F). We then extracted RNA from the B cells immune cell proportions in the colon of healthy controls and of the Payers patches and the intestinal proteins to detect the patients with UC were analyzed using xCell. As shown in Fig. S1B, C, cytokine profile. We found that pro-inflammation cytokines such compared with the healthy controls B cells were more active in as IL-6, IFN-γ, and TNF-α were increased during acute stage and patients with UC. Cytokine analysis of B cells confirmed that Ebi3 decreased in remission stage, while anti-inflammation cytokines expression was positively correlated with B cell activity (Fig. S1D, E). such as IL-35 (Il12a and Ebi3) were consistently increased We collected peripheral blood and biopsy samples from 15 patients throughout, suggesting that IL-35 may play an important role in with UC and flow cytometry and ELISA results showed increased IL- maintaining homeostasis (Fig. S2G, H). Moreover, we found that 35 B cells (IL12a and EBI3) (Fig. 1A–C) and IL-35 expression (Fig. 1D) the source of IL-35 was mainly the B cells in the intestine (Fig. S2I, J). in the peripheral blood, respectively. Immunofluorescence staining Importantly, using fluorescence-activated cell sorting and immu- + + confirmed the expression of IL-35 B cells infiltration in the intestine nofluorescence, we confirmed that IL-35 B cells in intestine samples of patients with UC (Fig. 1E). associated lymph tissues were expanded during inflammation Fig. 1 IL-35 producing B cells are preferentially upregulated in patients with ulcerative colitis (UC). A Expression levels of IL-35 in B cells + + from the peripheral blood from patients with UC and healthy controls were detected by flow cytometry, representative IL-12A EBI3 + + + expression in CD19 B cells isolated from the healthy control group (n = 14); UC patient group (n = 11). B Dots represent IL-12A EBI3 cell + + + frequencies in isolated CD19 B cells and total peripheral blood mononuclear cells (PBMCs). C Dots represent IL-12A EBI3 cell frequencies in total PBMCs. D IL-35 production in the serum from patients with UC and healthy controls were detected by ELISA (healthy control group n = 14; patients with UC group n = 14, two representative independent experiments are presented out of three similar experiments performed). E Expression levels of IL-35 in CD20 B cells from formalin-fixed paraffin-embedded colon tissue sections from six patients with UC and six healthy controls were determined by immunofluorescence staining. B–D Two-tailed unpaired Student’s t-test. Data are shown as mean ±standard error of the mean (SEM) (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). Cell Death Discovery (2023) 9:67 M. Xie et al. Fig. 2 IL-35 producing B cells are the dominant regulatory population during colitis. A–C Cells were isolated from mesenteric lymph nodes (MLNs) (A), Peyer’s patches (Patches) (B), and colorectal lamina propria (LP) (C) from 2.5% dextran sulfate sodium (DSS)-treated wildtype (WT) + + + mice at day 0, 4, 7, and 10 post-disease onset. The percentage and absolute number of IL-35 producing B cells (CD19 IL-12A EBI3 cells) + + + were determined by flow cytometry (n = 3 per group). D Expression levels of IL-35 producing B cells (CD20 IL-12A EBI3 cells) in formalin- fixed paraffin-embedded Peyer’s patches tissue sections from DSS-treated mice were determined by immunofluorescence staining (n = 6 per group). A–D Two-tailed unpaired Student’s t-test. Data are shown as mean ± standard error of the mean (SEM) and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). (Fig. 2A–D), which was consistent with the database results from B cell rescue of colitis is dependent on IL-35 patients with UC. Taken together, these results suggest that B cell We next sought to determine if IL-35 was essential for B cells to derived IL-35 expansion during colitis may play an important role maintain intestine homeostasis. B cells were purified from −/− −/− in maintaining intestinal homeostasis. wildtype (WT), Il12a , and Ebi3 mice and transferred into B Cell Death Discovery (2023) 9:67 M. Xie et al. Fig. 3 Functional impairment of IL-35 production in B cells leads to severe colitis in a DSS-induced colitis mouse model. A CD19 B cells −/− −/− from the spleens of wildtype (WT), Il12a and/or Ebi3 mice were adoptively transferred into B cell depleted (μMT) mice intravenously 48 h before 2.5% dextran sulfate sodium (DSS) administration. B Body weight was calculated (n = 5 per group). C Disease activity index (DAI) was calculated (n = 5 per group). D Representative colon sections are shown for each group (left panel). Length of the colon is shown on the bar graph (right panel) (n = 5 per group). E Survival analysis of each group was calculated (n = 5 per group). F Representative colon sections stained with hematoxylin and eosin (upper panels) and periodic acid-Schiff (lower panels) are shown for each group. Images are shown at ×20 magnification. Histological sections were blindly scored on a scale of 0–4 to generate a histological score and individual mouse scores are shown with each data point representing a single mouse (n = 10 per group, right panel). B, C Two-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons test. D, F Two-tailed unpaired Student’s t-test. E Log-rank (Mantel–Cox) test. Data are shown as mean ± standard error of the mean (SEM) and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). cell-deficient (μMT) mice (Fig. 3A, S4). Body weight loss was massive loss of crypts and leukocyte infiltration observed on day 7 observed in WT transferred group on day 6 and the decrease (Fig. 3F). These results suggest that B cell rescued colitis is −/− −/− stopped on day 8. In contrast, Il12a and/or Ebi3 transferred dependent on IL-35. Notably, when we induced colitis directly into −/− −/− group began to show significant body weight loss on day 5 and Il12a and Ebi3 mice (Fig. S3A), the knockout mice were not continued to lose weight until the last day of the experiment found to be more severely affected than the WT mice (Fig. S3B−G). −/− −/− (Fig. 3B). Furthermore, the Il12a and/or Ebi3 transferred This indicates that only B cell derived IL-35 and EBI3 displayed group showed an increased DAI score, which were significantly inhibitory effects in colitis. higher than WT transferred group (Fig. 3C). The gross pathology of the intestines from each group is shown in Fig. 3D, and the rmIL-35 induces IL-35 B cells expansion and rescued colitis −/− −/− + Il12a and/or Ebi3 transferred group showed apparent We further investigated whether IL-35 or IL-35 B cells could be used shortening and reddening of the colon, which are typical colitis to treat colitis. The mice were injected intraperitoneally with characteristics. The WT transferred group showed milder intestine recombined murine IL-35 (rmIL-35, 400 ng/mouse) 48 h before DSS −/− −/− changes (Fig. 3D). The Il12a and Ebi3 transferred group had induction of colitis (Fig. 4A). Mice that received rmIL-35 exhibited reduced overall survival (Fig. 3E). Histologically, the control mice milder symptoms in the intestines than mice that received isotype −/− −/− from the Il12a and Ebi3 transferred group exhibited the IgG1. The rmIL-35 treated mice experienced almost no body weight most severe inflammation throughout the entire intestine, with loss and diarrhea (Fig. 4B, C). The gross pathology of the intestines, Cell Death Discovery (2023) 9:67 M. Xie et al. Fig. 4 Recombinant IL-35 supplement suppresses severe colitis symptoms in a DSS-induced colitis mouse model. A Wildtype (WT) mice were pre-treated with recombinant IL-35 or IgG isotype intravenously 48 h before 2.5% dextran sulfate sodium (DSS) administration. B Body weight was calculated (n = 4 per group). C Disease activity index (DAI) was calculated (n = 4 per group). D Representative colon sections are shown for each group (left panel). Length of the colon is shown on the bar graph (right panel) (n = 4 per group). E Survival analysis of each group was calculated (n = 10 per group). F Representative colon sections stained with hematoxylin and eosin (upper panels) and periodic acid-Schiff (lower panels) are shown for each group. Images are shown at ×100 magnification. Histological sections were blindly scored on a scale of 0–4 to generate a histological score and individual mouse scores are shown with each data point representing a single mouse (n = 4 per group). B, C Two-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons test. D, F Two-tailed unpaired Student’s t-test. E Log-rank (Mantel–Cox) test. Data are shown as mean ± standard error of the mean (SEM) and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). histological staining, and overall survival showed that injection with can effectively inhibit the phosphorylation of STAT3 (Fig. 6D). LPS rmIL-35 significantly alleviated colitis (Fig. 4D–F). Intriguingly, rmIL- can induce the expression of IL-35 in B cells, but the expression of + + 35 promoted IL-35 B cell expansion in the gut-associated lymphoid IL-35 B cells was significantly reduced after the addition of Stattic, tissue (GALT) (Fig. 5A–C). In addition, the in vitro experiments and the addition of exogenous IL-35 was not able to reverse this showed that the proportion of IL-35 B cells increased after the reduction. In addition, rmIL-35 can also promote the increase of addition of rmIL-35 in the cultured system (Fig. 5D, E). This data IL-10 B cells, but was inhibited by Stattic (Fig. S5A, B), indicating that strongly suggests that IL-35 promotes the IL-35 B cells expansion the induction of IL-35 in B cells is biased towards the regulatory and consequently alleviated the DSS-induced colitis, thus exhibiting phenotype. Taken together, these results suggest that after a therapeutic effect. inhibition of STAT3 phosphorylation, autocrine IL-35 cannot + + promote the expression of IL-35 B cells, and IL-35 B cells can self- Autocrine IL-35 promoting IL-35 B cells through STAT3 promote through STAT3 phosphorylation. phosphorylation + + As showninFig. 5, IL-35 has positive feedback to promote IL-35 B IL-35 B cells modify the intestinal microbiota and their cells in vivo and in vitro, thus maintaining tissue homeostasis. metabolites Therefore, further exploration into the molecular mechanism of Previous studies have demonstrated that the cytokines that autocrine action of IL-35 B cells was warranted. RNA-seq revealed alleviate colitis are closely dependent on the intestinal microbiota an overall increase in the expression of the STAT family of B cells [19–22]. The mutual crosstalk between the cytokines and intestinal during colitis, and the STAT3 expression was most consistent with microbiota may lead to the hypothesis that IL-35 B cell are that of IL-35 (Fig. 6A, B). We analyzed the phosphorylation of STAT3 closely related to the modification of intestinal microbiota. by flow cytometry and western blot and found that the Therefore, we characterized the microbial composition of fecal phosphorylation of B cells was significantly increased after samples collected from mice with DSS-induced colitis on day 0, 4, stimulation with IL-35 (Fig. 6C, D). Stattic is a STAT3 inhibitor, which 7, and 10 using 16 S ribosomal RNA (rRNA) gene sequencing Cell Death Discovery (2023) 9:67 M. Xie et al. Fig. 5 Supplemented IL-35 attenuates severe colitis by skewing the B cell compartment in favor of IL-35 production. A–C Cells were isolated from mesenteric lymph nodes (MLNs) (A), Peyer’s patches (Patches) (B) and lamina propria (LP) (C) of mice pre-treated with + + + recombinant IL-35 or IgG at day 0 and 10 post-disease onset. The percentage of IL-35 producing B cells (CD19 IL-12A EBI3 cells) was + + + determined by flow cytometry (n = 3 per group). D Percentage of IL-35 producing B cells (B220 IL-12A EBI3 cells) with or without 20 ng/mL rIL-35 stimulation was detected by flow cytometry (n = 13 per group). E Production of IL-35 (Il12a and Ebi3) in B cells with or without 20 ng/mL rIL-35 stimulation was detected by RT-PCR (Il12a: lipopolysaccharide (LPS) group n = 9; LPS + rIL-35 group n = 15; Ebi3: LPS group n = 9; LPS + rIL-35 group n = 14). A–E Two-tailed unpaired Student’s t-test. Data are shown as mean ± standard error of the mean (SEM) and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). analyses. Figure 7A, B show that the diversity of the intestinal course (Fig. 7D). We hypothesized that IL-35 B cells could modify microbiota gradually decreased and then increased during the the diversity of gut microbiota and metabolites, thereby remission stage of the disease. Generally, the intestinal micro- alleviating disease. A fecal microbiota transplantation (FMT) biota immunomodulatory function depends on their metabolites was performed to confirm our hypothesis. Recipient mice were [23, 24]. Therefore, to further explain the association between IL- divided into two groups. The first group was stimulated with 35 B cell and the intestinal microbiota, we performed trypto- rmIL-35 and then their stool was transplanted into ABX-treated phan (indole) targeted metabolomic tests. We measured 21 mice (rmIL-35); and the second group was stimulated with the differential metabolites and analyzed their correlation with 32 isotype control and then their stool was transplanted into ABX- intestinal microbiotas as shown in Fig. 7C. The diversity of treated mice (isotype) (Fig. 7E). We measured the body weight microbial metabolites was consistent with that of the micro- and DAI every day, and the colon length was measured with the organisms (Fig. 7C, S6), and it is worth noting that, the expression histological staining. The rmIL-35 FMT group shown significantly of IAA, Indole-3-propionic acid (IPA), Indole-3-acrylic acid (IArA), reduced colitis symptoms (Fig. 7F–I) and we found that IAA was and Tryptophol (Iet) were decreased during the acute stage and increased after IL-35 treatment (Fig. 7J). These results suggest recovered during the remission stage. Among them, the that the presence of IL-35 could regulate the state of intestinal expression of IAA consistently followed the changes of disease microbiota and metabolic state. Cell Death Discovery (2023) 9:67 M. Xie et al. Fig. 6 Autocrine action of IL-35 producing B cells depends on the STAT3 pathway. A Bubble diagram shows transcription factor enrichment analysis ranked by significance in CD19 B cells isolated from Peyer’s patches of colitis induced mice at day 0, 4, 7, and 10 post-disease onset (n = 6 per group). B Heatmap shows the expression of the STAT family proteins in CD19 B cells isolated from Peyer’s patches of colitis induced mice at day 0, 4, 7, and 10 post-disease onset. Data are normalized and shown in the format of transcripts per million. Genes that are highly correlated with the expression levels of IL-35 in colitis are highlighted (n = 6 per group). C The expression of p-STAT3 in CD19 B cells after 72 h stimulation with or without rIL-35 are shown as mean fluorescence intensity (MFI) (n = 3 per group). Bar graphs represent the MFI of the groups (right panel). D Western blot of B cells stimulated under IL-35 producing B cells culture conditions with or without 10 nM STAT3 + + + inhibitor (stattic, 10 ng/mL) (n = 3 per group). E Percentage of IL-35 producing B cells (B220 IL-12A EBI3 cells) under IL-35 producing B cells culture conditions with or without 10 nM STAT3 inhibitor (stattic) was detected by flow cytometry (lipopolysaccharide (LPS) group n = 6; LPS + rIL-35 group n = 6; LPS + stattic group n= 6; LPS + rIL-35+stattic group n = 9). C–E Two-tailed unpaired Student’s t-test. Data are shown as mean ± standard error of the mean (SEM) and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). The intestinal microbes can promote the secretion of cytokines by establishing an IAA supplement experiment. Before the such as IL-10, which plays an important role in alleviating induction of the colitis model, IAA (0.5 mg/mouse/day) was inflammation [18, 25–27]. Therefore, according to the results of administered by gavage for seven consecutive days (Fig. 8B), metabolic measurements (Fig. 7C, D), we selected the substance and the changes in colitis progression were closely monitored. Body with the highest relative expression and the most significant weight loss (Fig. 8C), DAI score (Fig. 8D), pathological changes of change in colitis to verify its function. To clarify the direct intestinal tissue (Fig. 8E), and gross pathology of the intestines relationship between IAA and IL-35 secretion by B cells we (Fig. 8F) suggested that IAA treatment rescued the disease. stimulated B cells with IAA and the results showed that IAA could Subsequently, flow cytometry was performed to detect the stimulate IL-35 secretion by B cells in a concentration-dependent expression of IL-35 B cells in the intestinal tissues (Fig. 8G, H). The manner within a certain range under different concentration results showed that the GALT IL-35 B cells of IAA treatment group gradients (Fig. S7A). Further studies showed that 1000 µM IAA were significantly upregulated, suggesting that IAA can induce the could induce B cells to differentiate towards the regulatory B cell production of IL-35 B cells in vivo, and play a role in alleviating phenotype and secrete more IL-10 and IL-35 under IL-35 culture colitis. Taken together, IL-35 B cells can interact with intestinal conditions (Fig. 8A, S7B). We further confirmed the results in vivo microbes to cooperatively maintain intestinal homeostasis. Cell Death Discovery (2023) 9:67 M. Xie et al. DISCUSSION disease by secreting IL-35 which promotes its own expansion In this study, through in vivo and in vitro experiments and high- through STAT3. throughput sequencing methods, we demonstrated that IL-35 B Our previous studies have shown that B cells play a crucial role cells alleviate IBD by interacting with the microbial metabolite IAA in the remission of autoimmune diseases such as IBD [28, 29]. in the IBD microenvironment. Moreover, IL-35 B cells alleviate the When B cells are depleted in vivo, the disease deteriorates Cell Death Discovery (2023) 9:67 M. Xie et al. Fig. 7 Gut microbiota and tryptophan metabolite profiles in colitis. A Fecal samples (n = 24) were collected from 2.5% dextran sulfate sodium (DSS)-treated wildtype (WT) mice at day 0, 4, 7, and 10 post-disease onset and isolated genomic DNA was sequenced for the 16 S rRNA gene at the V3-V4 region. Principal coordinate analysis, Shannon index, and Chao1 index were calculated (n = 6 per group). B The taxonomic variations of microbial communities across mice of different post-disease onset were analyzed and shown as a stack bar plot (n = 6 per group). C Tryptophan metabolites in the 24 fecal samples were detected by high performance liquid chromatography (n = 6 per group). The correlations between the 21 metabolites and 32 significant microbiota families (shown in B) were calculated using spearman’s rank correlation analysis. Microbiota families or metabolites which were upregulated in colitis were clustered into the red color module, and downregulated ones were clustered into the blue color module. D Metabolites concentration of differential metabolites (IAA, IArA, IPA, and IEt) which were highlighted in C are shown as density in the bar plots (n = 6 per group). E Experimental scheme outlining the water schedule, duration of diet, and microbial transplantation. F Body weight was calculated (n = 6 per group). G Disease activity index (DAI) was calculated (n = 6 per group). H Representative colon sections are shown for each group. Length of the colon is shown on the bar graph (n = 6 per group). I Representative colon sections stained with hematoxylin and eosin (upper panel) and periodic acid-Schiff (lower panel) are shown for each group. Images are shown at ×100 magnification (n = 8 in each group). J The concentration of IAA after FMT. A, D, H, I, J Two-tailed unpaired Student’s t-test. C Spearman’s rank correlation coefficient. F, G Two-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons test. Data are shown as mean ±standard error of the mean (SEM) and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). irretrievably. Cytokines play a vital role in B-cell disease remission. found that the expression of microbial diversity and the Although IL-10 has been reported to play an important role in metabolite IAA decreased significantly during the acute phase of diseases, there is increasing evidence that other cytokines are also colitis and increased during the remission phase. These results essential [30]. Thus, we searched the GEO database and found that confirmed that there were significant differences in the composi- EBI3 was elevated. EBI3 and IL-12a form IL-35, while EBI3 and P28 tion of intestinal microbiota in mice during the different stages of form IL-27. The peripheral blood and colon samples of patients colitis, which was often a key factor affecting the outcome of the with UC were collected, and an increase of IL-35 but not IL-27 disease. Importantly, there was a significantly increased expression (data not shown) in B cells was observed, indicating that IL-35 may of IAA observed when exogenous IL-35 was administered, and IAA be involved in the process of UC. also promoted IL-35 B cell differentiation and expansion. Thus, we We hypothesized that B cells can rescue colitis dependent on IL- elucidated the interaction between IL-35 B cells and IAA in 35; therefore, we attempted to knock down the IL-35-related maintaining intestinal homeostasis. molecules. IL-35 is a dimer, consisting of IL-12a and EBI3. Because IL-12a and P40 constitute IL-12, and EBI3 and P28 constitute IL-27 [10, 31], the double-knock mice would have too many deletions of METHODS AND MATERIAL the involved cytokines and the mice did not survive. Therefore, Human subjects the existing reports all use either EBI3 or IL-12a knockout mice to A total of 14 UC patients and 11 age-matched healthy individuals establish the disease models and demonstrate the role of IL-35 were recruited at the Department of Gastroenterology of Jing’an [5, 32]. We found that mice with either EBI3 or IL-12a knockout did District Central Hospital of Shanghai, China with the protocol not have a more severe disease presentation, suggesting that approved by ethics committee of Jing’an District Central Hospital these molecules themselves cannot solely alleviate the disease. It of Shanghai (Approval number: 2022-018). UC was diagnosed in is worth noting that the disease improved after IL-12a knockdown, accordance with The European Crohn’s and Colitis Organization which indicates that IL-12 may play a pathogenic role. Interest- guidelines [38]. Peripheral blood was obtained from 14 UC ingly, B cell-derived EBI3 and IL-12a knockdown significantly patients and formalin fixed paraffin-embedded human colon aggravated the disease, indicating that B cell-derived IL-35 has an specimens from 6 UC patients were randomly collected at Jing’an alleviatory effect, which is consistent with other reports [4, 5, 33]. District Central Hospital of Shanghai, China. All patients and We then attempted to adoptively transfer IL-35 Bcells into mice. healthy volunteers enrolled in this study provided informed IL-35 can induce large amounts of IL-35 in B cells, and about 20% of consents. Detailed Patient information is listed in Table 1. the intestinal B cells can differentiate into IL-35 Bcells, but because there is no specificsurface marker of IL-35 Bcells they cannot be Mice isolated. Because rmIL-35 can promote the expansion of many IL- Wild-type (WT) C57BL/6 mice purchased from SLRC Laboratory 35 B cells in vitro and in vivo, we injected exogenous rmIL-35 Animal (Shanghai, China) were used in this study. B6.129×1- −/− −/− intraperitoneally to observe the therapeutic effects. We have Ebi3tm1Rsb/J(Ebi3 ), B6.129S1-Il12atm1Jm/J(Il12a )and performed studies regarding the mechanisms of B cells function B6.129S2-Ighmtm1cng/J (μMT) mice were purchased from Jackson [28, 34, 35], such as cooperating with Tregs, producing of HSP70 and Laboratory (Bar Harbor, ME, USA). Prior assessments were conducted IgA, etc. Here we aimed to reveal how IL-35 B cells work. When based on our experience performing survival rate of colitis model intestinal B cells were treated with rmIL-35 in vivo and in vitro it was under different doses of DSS and other experiments included in this found that IL-35 B cells were expanded, and because they continue work. All animal procedures in this study were approved by the to self-promote andexpandfurther,IL-35 B cells are sufficient to animal care and use committee of Fudan University and conformed alleviate the disease during the course of infection. The molecular to the Guide for the Care and Use of Laboratory Animals. pathway by which B cell-derived IL-35 function with other cells has not been extensively reported. We used RNA-seq and determined Dextran sodium sulfate (DSS)-induced Colitis that the expression of the STAT family was significantly increased in Experimental colitis was established by administering 2.5% DSS cells stimulated with IL-35, especially STAT3 expression, and STAT3 (w/v; MP Biomedicals, Irvine, CA, USA) in the drinking water for phosphorylation levels were significantly increased which was 7 days as previously described [39], normal drinking water was consistent with other reports [11, 36]. then given for 3 days in order to mimic the remission phase of Microbial therapy is the future of medical biology [37], and IAA ulcerative colitis. was reported to promote IL-35 B regulatory cells [18]. Therefore, we explored whether the relationship between IL-35 B cells and Adoptive transfer microbes with their metabolites in the intestines could interact to B cells were purified from the spleens of WT mouse or IL-35 gene −/− −/− maintain the immune system and intestinal homeostasis. We knockout (Il12a and Ebi3 ) mouse by using a mouse B cell Cell Death Discovery (2023) 9:67 M. Xie et al. negative isolation kit (StemCell Technologies, Vancouver, BC, IL-35 in vitro rescue assay Canada). Purified B cells were adoptively transferred into 8-week- Recombined mouse IL-35(rIL-35) was purchased from Chimerigen old male μMT mice intravenously, followed by the administration of (Liestal, Switzerland). WT mice were randomly assigned to four 2.5% DSS. Adoptive transfer was performed with 1 × 10 cells/mouse groups: (1) Isotype; (2) rIL-35; (3) Isotype+DSS induction and (4) 48 h before DSS administration. rIL-35+DSS induction. In group (2) and group (4), rIL-35 was Cell Death Discovery (2023) 9:67 M. Xie et al. Fig. 8 Supplementation with IAA suppresses colitis by skewing the B cell compartment in favor of an IL-35 producing B cell phenotype. + + + A Percentage of IL-35 producing B cells (B220 IL-12A EBI3 ) in B cells with or without 1000 nM IAA treatment was detected by flow cytometry (lipopolysaccharide (LPS) group n = 12; LPS + rIL-35 group n= 11; LPS + rIL-35+IAA group n = 12). Bar graphs represent the frequencies of IL-35 producing B cells in the groups (right panel). B Wildtype (WT) mice were gavaged with IAA daily 1 week prior to the induction of colitis and throughout the experiment. C Body weight was calculated (n = 4 per group). D Disease activity index (DAI) was calculated (n = 7 per group). E Representative colon sections stained with hematoxylin and eosin (upper panel) and periodic acid-Schiff (lower panel) are shown for each group. Images are shown at ×100 magnification (n = 8 per group). F Representative colon sections are shown for each group. Length of the colon is shown on the bar graph (n = 9 per group). G, H Cells were isolated from Peyer’s patches (Patches) G (n = 6 per group) and lamina propria (LP) (H)(n = 6 per group) of the control or IAA treatment group and the percentage of the IL-35-producing B + + + cells (CD19 IL-12A EBI3 ) in B cells was determined by flow cytometry. C, D Two-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons test. A, E–H Two-tailed unpaired Student’s t-test. Data are shown as mean ± standard error of the mean (SEM) and are representative of at least three independent experiments (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). were collected on day 7 and then resuspended in 5% Table 1. Sample Information: Gender, age, patient or Healthy control, thioglycollate broth (w/v, Solarbio, Beijing, China). Fecal mixture stage of disease. was centrifuged at 2000 rpm, supernatant was collected. The supernatant was orally gavaged into ABX mice for 7 days fecal Subject Gender Age (years) Classification Stage transplantation, mice were then administered with 2.5% DSS to 1 F 21 UC Active induce colitis. 2 F 24 UC Active 3 M 56 UC Active Gavage with IAA Wild-type mice were orally gavaged with IAA (0.5 mg/mice, 4 F 62 UC Active dissolved in oil) daily 1 week prior to the induction of colitis and 5 M 58 UC Active throughout the experiment. Control group mice received oil only. 6 M 43 UC Active 7 M 33 UC Active Histopathology Colons were flushed using PBS and then fixed in 4% paraformal- 8 M 25 UC Active dehyde and embedded in paraffin. Colon sections were stained 9 M 65 UC Active with hematoxylin & eosin (H&E) or Periodic Acid Schiff (PAS). 10 F 34 UC Active Histological scoring of colitis was performed by at least two 11 F 57 UC Active pathologists under a blinded fashion. The score was a combina- tion of tissue Integrity and inflammatory cell infiltration. 12 F 19 UC Active 13 M 65 UC Active Immunofluorescence staining 14 M 48 UC Active Peyer’s patches and human colon biopsy samples were collected 15 M 42 Healthy control / and fixed in paraformaldehyde and embedded in paraffin. For immunofluorescence (IF) staining, tissue sections were blocked 16 M 56 Healthy control / with 5% (w/v) fetal bovine serum (FBS) for 30 min at room 17 F 28 Healthy control / temperature, and then stained with purified antibodies for CD20 18 F 24 Healthy control / (for mice samples: 1:100,Abcam,Cambridge,MA, USA, 19 F 31 Healthy control / ab271288; for human samples: 1:100, Abcam, ab279300), IL- 12A (1:100, Abcam,ab131039) and EBi3 (1:50, Santa Cruz 20 M 25 Healthy control / Biotechnology, Santa Cruz, CA, USA) for 15 h at 4 °C, and then 21 F 21 Healthy control / stained with Alexa Fluor 488 anti-rabbit IgG monoclonal 22 F 20 Healthy control / antibody (Thermo Fisher Scientific, Waltham, MA, USA), Alexa 23 M 38 Healthy control / Fluor 568 anti-rat IgG monoclonal antibody (Thermo Fisher) and Alexa Fluor 647 anti-mouse IgG monoclonal antibody (Thermo 24 M 32 Healthy control / Fisher) for 1 h at room temperature. The specmens were 25 F 64 Healthy control / analysed using fluorescence microscopy. 26 M 59 Healthy control / 27 F 40 Healthy control / Cell isolation and differentiation B cells were purified from the spleens of WT mouse by using a 28 M 65 Healthy control / mouse B cell negative isolation kit (StemCell Technologies). sorted naive B cells were then stimulated for 72 h with 10 µg/mL LPS (Sigma-Aldrich, St. Louis, MO, USA). administered intravenously [0.75 μg/mice, dissolved in 200 μl For IL-35 producing B cell differentiation, naive B were cultured phosphate-buffered saline (PBS)] to the mice 48 h before model under IL-35 producing B cell culture system with 10 µg/mL LPS induction. Isotype groups [group (1) and group (3)] were received and 20 ng/mL rmIL-35 for 72 h. IgG administration [0.75 μg/mice, dissolved in 200 μl phosphate- buffered saline (PBS)]. Real-time polymerase chain reaction (PCR) analysis Total RNA of B cells was extracted using RNA extraction kit Microbiota transplantation (Tiangen Scientific, Beijing, China) followed reverse transcription. To eliminate gut microbiota, Wild-type mice were treated with Real-time polymerase chain reaction was performed using SYBR antibiotic cocktail ABX (1 g/L metronidazole; 0.5 g/L vancomycin; Green Master Mix (TaKaRa, Tokyo, Japan) on the ABI 7500 1 g/L ampicillin; 1 g/L neomycin) as described previously for Thermocycler (Applied Biosystems, California, USA) according to 14 days (ABX mice). Feces of mice treated with rIL-35 or isotype the manufacture’s instructions. The relative gene expression Cell Death Discovery (2023) 9:67 M. Xie et al. Table 2. Primer Sequence: Primer sequence of mice genotyping and qRT-PCR. Primer Sequence(5′-3′) Usage muMT Mutant R TTGTGCCCAGTCATAGCCGAAT Mice genotyping muMT common CCGTCTAGCTTGAGCTATTAGG Mice genotyping muMT WT R GAAGAGGACGATGAAGGTGG Mice genotyping IL12A Mutant F CTGAATGAACTGCAGGACGA Mice genotyping IL12A Mutant R ATA CTT TCT CGG CAG GAG CA Mice genotyping IL12A Wild Type F CAG CAT GTG TCA ATC ACG Mice genotyping IL12A Wild Type R TCA CCA TGT CAT CTG TGG Mice genotyping EBi3 Mutant R GCC AGA GGC CAC TTG TGT AG Mice genotyping EBi3 Common AAC CTC AGG CCA GGC AGT Mice genotyping EBi3 Wild Type R TTC CGT AGG CCA TGT AGG AC Mice genotyping IL12p35 F GACCTGTTTACCACTGGAACTA qRT-PCR IL12p35 R GATCTGCTGATGGTTGTGATTC qRT-PCR EBi3 F CTTCTCTCTCAAGTACCGACTC qRT-PCR EBi3 R TTATGGGGTGCACTTTCTACTT qRT-PCR β-actin F CCAGCCTTCCTTCTTGGGTATG qRT-PCR β-actin R TGTGTTGGCATAGAGGTCTTTACG qRT-PCR compared with GAPDH was calculated using the ΔΔCt method. For intranuclear (p-STAT3) marker staining, cells were previously Primers for target genes are listed in Table 2. surface stained and then fixed and permeabilized using a transcription factor staining buffer set (Thermo Fisher Scientific) Western blot and stained with PE-p-STAT3 (Thermo Fisher Scientific) for 45 min B cells were negatively purified from WT mice and cultured under according to the manufacturer’s protocol. IL-35 producing B cells’ culture system. Then B cells were lysed Isotype antibodies were used as negative controls. Flow and protein from 1 × 10 cells was resolved by SDS-PAGE and cytometry analysis was performed using BD Celesta Analyzer. transferred to polyvinylidene fluoride (PVDF) membranes (Merck Millipore, Billerica, MA, USA), and blotted with anti-STAT3 (1:5000, RNA sequencing Abcam) and anti-p-STAT3 (1:5000, Abcam). Bound antibodies were Patches’ CD19 B cells were isolated from wild type mice at day 0, revealed with HRP-conjugated species-specific secondary anti- 4, 7 and 10. Total RNA was isolated from sorted B cells using the bodies using ECL substrate (Amersham Pharmacia Biotech, Total RNA isolation kit (Tiangen Scientific) according to manu- Station, NY, USA). facturer’s instructions. And then total RNA was qualified and quantified with a Nano Drop and Agilent 2100 bioanalyzer Enzyme-linked immunosorbent assay (Thermo Fisher Scientific) followed by mRNA purification. Fecal supernatant was collected from colitis mice on days 0, 4, 7, A total of 500 ng purified mRNA was fragmented followed by and 10. IL-6, TNF-α, interferon (IFN)-γ, IL-10, IL-35 and immuno- reverse transcription and second strand cDNA synthesis. The globulin A (IgA) levels in the supernatants were determined by double strand PCR products above were heated denatured and enzyme-linked immunosorbent assay (ELISA) according to the circularized by the splint oligo sequence. The final library was manufacture’s protocols (Thermo Fisher Scientific). amplified with phi29 (Thermo Fisher Scientific) and single end 50 bases reads were generated on BGISEQ500 platform (BGI, Measurement of IAA in Mouse Feces Shenzhen, China). Reads were then mapped to the Mus musculus Fecal supernatant was collected from colitis mice treated with rIL- GRCm38 reference genome. Gene annotations were applied from 35 or isotype at day 10. The contents of IAA in the fecal samples Ensembl. Gene expression levels were quantified using htseq- were determined with ELISA kit from Shanghai ShuHua Biological count and estimated independently with TPM with Kallisto. Technology Co. Ltd. (Shanghai, China), according to the manu- facture’s instruction. 16 S rDNA sequencing 24 samples of fecal material from Wild-type mice at day 0, 4, 7 and Flow cytometry 10 after 2.5% DSS administration was extracted using the CTAB kit For surface marker staining, mononuclear cells were previously according to manufacturer’s protocol. Total DNA was eluted in blocked with anti-CD16/32 antibody (Thermo Fisher Scientific) for Elution buffer and barcoded primers[341 F(5’-CCTACGGGNGGCWGC 15 min and then incubated with the following anti-mouse AG-3’);805 R(5’-GACTACHVGGGTATCTAATCC-3’)] were designed to antibodies: PE-CD19, PE-B220 and Pacific blue-CD45 (all purchased span the V3-V4 region of 16 S rRNA gene as previously described. from Thermo Fisher Scientific). The PCR conditions was consisted of an initial denaturation at 98 °C For intracellular marker staining, cells were previously stimulated for30s;32cyclesofdenaturation at98°Cfor 10s, annealingat54°C with 50 ng/mL PMA and 750 ng/mL ionomycin in the presence of for 30 s, and extension at 72 °C for 45 s; and then final extension at 20 µg/mL brefeldin A for 5 h, then surface-stained for 30 min. After 72 °C for 10 min. The amplicon pools were prepared for sequencing surface marker staining, cells were resuspended in Fixation/ and the size and quantity of the amplicon library were assessed on Permeabilization Buffer Set (Thermo Fisher Scientific) and stained Agilent 2100 Bioanalyzer and with the Library Quantification Kit for with PE-Cy7-IL-10 (BioLegend, San Diego, CA, USA); APC-IL-12A Illumina, respectively. The libraries were sequenced on NovaSeq (Thermo Fisher Scientific) and FITC-EBI3 (Novus Biologicals, Littleton, PE250 platform. Samples were sequenced on an Illumina NovaSeq CO, USA) for 45 min according to the manufacturer’sprotocol. platform according to the manufacturer’s recommendations. Cell Death Discovery (2023) 9:67 M. Xie et al. Analysis of tryptophan metabolites by high performance 14. Lin D, Yang L, Wen L, Lu H, Chen Q, Wang Z. Crosstalk between the oral microbiota, mucosal immunity, and the epithelial barrier regulates oral mucosal liquid chromatography disease pathogenesis. Mucosal Immunol. 2021;14:1247–58. For High Performance Liquid Chromatography analysis of 15. He Y, Fu L, Li Y, Wang W, Gong M, Zhang J, et al. Gut microbial metabolites tryptophan metabolites, feacal samples were collected and froze facilitate anticancer therapy efficacy by modulating cytotoxic CD8(+) T cell in liquid nitrogen before metabolites measurement. The metabo- immunity. Cell Metab. 2021;33:988–1000. lites were extracted from feacal samples using high throughput 16. Oh JZ, Ravindran R, Chassaing B, Carvalho FA, Maddur MS, Bower M, et al. TLR5- tissue lyser according to the manufacture’s protocol. Then mediated sensing of gut microbiota is necessary for antibody responses to extracted metabolites were resolved using ACQUITY UPLC® HSS seasonal influenza vaccination. Immunity. 2014;41:478–92. T3 Column (2.1×150 mm, 1.8 μm, Waters, Watertown, MA, USA) on 17. Hendrikx T, Duan Y, Wang Y, Oh JH, Alexander LM, Huang W, et al. Bacteria a ACQUITY analysis system from Waters and identified using Lipid engineered to produce IL-22 in intestine induce expression of REG3G to reduce Search software. ethanol-induced liver disease in mice. Gut. 2019;68:1504–15. 18. Su X, Zhang M, Qi H, Gao Y, Yang Y, Yun H, et al. Gut microbiota-derived metabolite 3-idoleacetic acid together with LPS induces IL-35(+) B cell genera- Data accession tion. Microbiome. 2022;10:13. The raw data of RNA sequencing are available in GEO (http:// 19. James KR, Gomes T, Elmentaite R, Kumar N, Gulliver EL, King HW, et al. Distinct www.ncbi.nlm.nih.gov/geo/) with the accession number microbial and immune niches of the human colon. Nat Immunol. 2020;21:343–53. GSE210506. And the accession number for the 16 S rRNA 20. Mishima Y, Oka A, Liu B, Herzog JW, Eun CS, Fan TJ, et al. Microbiota maintain sequencing reported in this paper is PRJNA866337. colonic homeostasis by activating TLR2/MyD88/PI3K signaling in IL-10-producing regulatory B cells. J Clin Invest. 2019;129:3702–16. Statistical analysis 21. Ihara S, Hirata Y, Koike K. TGF-beta in inflammatory bowel disease: a key regulator of immune cells, epithelium, and the intestinal microbiota. J Gastroenterol. Quantitative data were expressed as mean ± Standard Error of 2017;52:777–87. Mean (SEM). Differences were determined by unpaired two-tailed 22. Freychet P. New data in the domain of insulin resistance. Sem Hop. t-test for comparing two groups. For murine clinical data (body 1977;53:1421–4. weight and clinical scores), differences among different groups 23. Cohen I, Ruff WE, Longbrake EE. Influence of immunomodulatory drugs on the were determined using two-way ANOVA (Dunnett’s multiple gut microbiota. Transl Res. 2021;233:144–61. comparisons test). Correlations of 32 representative gut microbiota 24. Yu B, Wang L, Chu Y. Gut microbiota shape B cell in health and disease settings. J species and 21 representative tryptophan metabolites were Leukoc Biol. 2021;110:271–81. evaluated using Spearman’s rank correlation coefficient. All 25. Gasaly N, de Vos P, Hermoso MA. Impact of bacterial metabolites on gut barrier p < 0.05 were considered significant. Statistical tests were carried function and host immunity: a focus on bacterial metabolism and its relevance for intestinal inflammation. Front Immunol. 2021;12:658354. out using GraphPad Prism (La Jolla, CA, USA, USA) v. 8.0.1 Software. 26. Krishnan S, Ding Y, Saedi N, Choi M, Sridharan GV, Sherr DH, et al. Gut microbiota- derived tryptophan metabolites modulate inflammatory response in hepatocytes and macrophages. Cell Rep. 2018;23:1099–111. DATA AVAILABILITY 27. Gao J, Xu K, Liu H, Liu G, Bai M, Peng C, et al. Impact of the gut microbiota on The authors confirm that the data supporting the findings of this study are available intestinal immunity mediated by tryptophan metabolism. Front Cell Infect within the article and its supplementary materials. Microbiol. 2018;8:13. 28. Wang L, Ray A, Jiang X, Wang JY, Basu S, Liu X, et al. T regulatory cells and B cells cooperate to form a regulatory loop that maintains gut homeostasis and sup- presses dextran sulfate sodium-induced colitis. Mucosal Immunol. REFERENCES 2015;8:1297–312. 1. Ye C, Yano H, Workman CJ, Vignali DAA. Interleukin-35: structure, function and its 29. Wang Z, Zhang H, Liu R, Qian T, Liu J, Huang E, et al. Peyer’s patches-derived impact on immune-related diseases. J Interferon Cytokine Res: Off J Int Soc CD11b(+) B cells recruit regulatory T cells through CXCL9 in DSS-induced colitis. Interferon Cytokine Res. 2021;41:391–406. Immunology. 2018:155;356–66. 2. Collison LW, Workman CJ, Kuo TT, Boyd K, Wang Y, Vignali KM, et al. The inhi- 30. Ray A, Wang L, Dittel B. N IL-10-independent regulatory B cell subsets and bitory cytokine IL-35 contributes to regulatory T-cell function. Nature. mechanisms of action. Int Immunol. 2015:27;531–6 2007;450:566–9. 31. Collison LW, Vignali DA. Interleukin-35: odd one out or part of the family? 3. Dambuza IM, He C, Choi JK, Yu CR, Wang R, Mattapallil MJ, et al. IL-12p35 induces Immunol Rev. 2008;226:248–62. expansion of IL-10 and IL-35-expressing regulatory B cells and ameliorates 32. Damo M, Joshi NS. Treg cell IL-10 and IL-35 exhaust CD8(+) T cells in tumors. Nat autoimmune disease. Nat Commun. 2017;8:719. Immunol. 2019;20:674–5. 4. Shen P, Roch T, Lampropoulou V, O’Connor RA, Stervbo U, Hilgenberg E, et al. IL- 33. Michaud D, Steward CR, Mirlekar B, Pylayeva-Gupta Y. Regulatory B cells in 35-producing B cells are critical regulators of immunity during autoimmune and cancer. Immunol Rev. 2021;299:74–92. infectious diseases. Nature. 2014;507:366–70. 34. Fu Y, Wang Z, Yu B, Lin Y, Huang E, Liu R, et al. Intestinal CD11b(+) B cells 5. Wang RX, Yu CR, Dambuza IM, Mahdi RM, Dolinska MB, Sergeev YV, et al. ameliorate colitis by secreting immunoglobulin A. Front Immunol. Interleukin-35 induces regulatory B cells that suppress autoimmune disease. Nat 2021;12:697725. Med. 2014;20:633–41. 35. Wang L, Fu Y, Yu B, Jiang X, Liu H, Liu J, et al. HSP70, a novel regulatory molecule 6. Yang L, Jia S, Shao X, Liu S, Zhang Q, Song J, et al. Interleukin-35 modulates the in B cell-mediated suppression of autoimmune diseases. J Mol Biol. balance between viral specific CD4(+)CD25(+)CD127(dim/-) regulatory T cells 2021;433:166634. and T helper 17 cells in chronic hepatitis B virus infection. Virol J. 2019;16:48. 36. Ma N, Fang Y, Xu R, Zhai B, Hou C, Wang X, et al. Ebi3 promotes T- and B-cell 7. Wang S, Qin C. Interleukin 35 rescues regulatory B cell function, but the effect is division and differentiation via STAT3. Mol Immunol. 2019;107:61–70. dysregulated in ulcerative colitis. DNA cell Biol. 2017;36:413–21. 37. Wu M, Bai J, Ma C, Wei J, Du X. The role of gut microbiota in tumor immu- 8. Fonseca-Camarillo G, Furuzawa-Carballeda J, Yamamoto-Furusho JK. Interleukin notherapy. J Immunol Res. 2021;2021:5061570. 35 (IL-35) and IL-37: Intestinal and peripheral expression by T and B regulatory 38. Gionchetti P, Dignass A, Danese S, Magro Dias FJ, Rogler G, Lakatos PL, et al. 3rd cells in patients with Inflammatory Bowel Disease. Cytokine. 2015;75:389–402. European evidence-based consensus on the diagnosis and management of 9. Collison LW, Delgoffe GM, Guy CS, Vignali KM, Chaturvedi V, Fairweather D, et al. Crohn’s disease 2016: part 2: surgical management and special situations. J The composition and signaling of the IL-35 receptor are unconventional. Nat Crohn’s colitis. 2017;11:135–49. Immunol. 2012;13:290–9. 39. Das S, Batra SK, Rachagani S. Mouse model of dextran sodium sulfate (DSS)- 10. Banchereau J, Pascual V, O’Garra A. From IL-2 to IL-37: the expanding spectrum of induced Colitis. Bio Protoc. 2017;7:e2515. anti-inflammatory cytokines. Nat Immunol. 2012;13:925–31. 11. Choi JK, Egwuagu CE. Interleukin 35 regulatory B cells. J Mol Biol. 2021;433:166607. 12. Kamada N, Seo SU, Chen GY, Nunez G. Role of the gut microbiota in immunity ACKNOWLEDGEMENTS and inflammatory disease. Nat Rev Immunol. 2013;13:321–35. The authors thank all the volunteers in this study for devoting time to our research. 13. Fitzgerald RS, Sanderson IR, Claesson MJ. Paediatric inflammatory bowel disease We also thank Dr. Xunjia Cheng, Dr. Mingfang lu and Dr. Yuli Lin for valuable and its relationship with the microbiome. Micro Ecol. 2021;82:833–44. suggestions and helpful discussions. Cell Death Discovery (2023) 9:67 M. Xie et al. AUTHOR CONTRIBUTIONS Correspondence and requests for materials should be addressed to Yiwei Chu or MX designed and performed the experiments, analyzed data, and wrote the Luman Wang. manuscript. LW and YC designed the experiments and wrote the manuscript. QW and EG improved the manuscript. Y Zhu and Y Zhou performed the experiments and Reprints and permission information is available at http://www.nature.com/ analyzed the data. The last two authors contributed equally to this work. reprints Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. FUNDING This work was supported by the General Program of the National Natural Science Foundation of China (81971493), Major Program of National Natural Science Foundation of China (81730045, 82130050), Young Scientists Fund of the National Open Access This article is licensed under a Creative Commons Natural Science Foundation of China (81501394), Shanghai Rising-Star Program Attribution 4.0 International License, which permits use, sharing, (20QA1407900), and Innovative Research Team of High-level Local Universities in adaptation, distribution and reproduction in any medium or format, as long as you give Shanghai. appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the COMPETING INTERESTS article’s Creative Commons license and your intended use is not permitted by statutory The authors declare no competing interests. regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http:// creativecommons.org/licenses/by/4.0/. ADDITIONAL INFORMATION Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41420-023-01366-5. © The Author(s) 2023 Cell Death Discovery (2023) 9:67

Journal

Cell Death DiscoverySpringer Journals

Published: Feb 17, 2023

There are no references for this article.