Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Intrinsic differentiation potential of adolescent human tendon tissue: an in-vitro cell differentiation study

Intrinsic differentiation potential of adolescent human tendon tissue: an in-vitro cell... Background: Tendinosis lesions show an increase of glycosaminoglycan amount, calcifications, and lipid accumulation. Therefore, altered cellular differentiation might play a role in the etiology of tendinosis. This study investigates whether adolescent human tendon tissue contains a population of cells with intrinsic differentiation potential. Methods: Cells derived from adolescent non-degenerative hamstring tendons were characterized by immunohistochemistry and FACS-analysis. Cells were cultured for 21 days in osteogenic, adipogenic, and chondrogenic medium and phenotypical evaluation was carried out by immunohistochemical and qPCR analysis. The results were compared with the results of similar experiments on adult bone marrow-derived stromal cells (BMSCs). Results: Tendon-derived cells stained D7-FIB (fibroblast-marker) positive, but α-SMA (marker for smooth muscle cells and pericytes) negative. Tendon-derived cells were 99% negative for CD34 (endothelial cell marker), and 73% positive for CD105 (mesenchymal progenitor-cell marker). In adipogenic medium, intracellular lipid vacuoles were visible and tendon-derived fibroblasts showed upregulation of adipogenic markers FABP4 (fatty-acid binding protein 4) and PPARG (peroxisome proliferative activated receptor γ). In chondrogenic medium, some cells stained positive for collagen 2 and tendon-derived fibroblasts showed upregulation of collagen 2 and collagen 10. In osteogenic medium Von Kossa staining showed calcium deposition although osteogenic markers remained unaltered. Tendon-derived cells and BMCSs behaved largely comparable, although some distinct differences were present between the two cell populations. Conclusion: This study suggests that our population of explanted human tendon cells has an intrinsic differentiation potential. These results support the hypothesis that there might be a role for altered tendon-cell differentiation in the pathophysiology of tendinosis. Page 1 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 chemical staining and FACS-analysis. Then, after a culture Background Tendinosis is a chronic degenerative tendon disorder period of 21 days in adipogenic, chondrogenic, and oste- occurring particularly among athletes and middle-aged ogenic medium, we evaluated changes in their phenotype people [1]. As its pathophysiology is still largely using immunohistochemical and histochemical stainings unknown, only symptomatic treatment options are avail- as well as gene expression analysis. able, with limited success rates [1,2]. A better understand- ing of the cellular processes involved in the development Methods of tendinosis lesions may ultimately improve treatment Study design and prevention. Cells were explanted from human adolescent non-degen- erative hamstring tendon tissue (n = 5). After the pheno- Histopathological findings in tendinosis have been type of the cells was analyzed by immunohistochemical described in detail [3,4]. In brief, hypercellularity and staining and FACS-analysis, cells were cultured for 21 days rounding of the cell nuclei indicate a relatively high met- on osteogenic, adipogenic, or chondrogenic medium. The abolic activity. Likewise, altered extracellular matrix com- differentiation potential of the tendon-derived cell popu- position reflects changes in cellular behaviour. For lation was evaluated by immunohistochemical and histo- instance, in tendinosis lesions there is a higher amount of chemical staining and real-time RT-PCR, and was glycosaminoglycans [3]. Lipid accumulation and calcium compared with the differentiation potential of human deposition have also been described [5]. Thus, the his- femoral-shaft-derived BMSCs (n = 5). topathological findings may indicate the presence of cells with diverse phenotypes, different from that of tenocytes Isolation of tendon-derived cells and BMSCs under healthy conditions. Human tendon-derived cells were cultured from explants from hamstring tendon tissue of five adolescents (age 12– Cells with multilineage differentiation potential likely 17 years) undergoing hamstring-tendon release for treat- play an important role in the body's capacity to naturally ment of knee-contractures (MEC-2006-069). In this clini- remodel, repair, and regenerate various tissue types where cal condition the tendon is primarily not affected, but is necessary [6]. However, the multilineage differentiation exposed to continuously high tensile strains. After the per- potential of cells might also be involved in pathological itendineum had been carefully removed, the tendon was processes. Although the pathophysiology of tendinosis is cut into 3 mm sections, transferred into six-well plates largely unclear, histological findings suggest that multipo- (Corning, NY, USA) and cultured in expansion medium tent cells might be implicated in its development. The ori- (Dulbecco's modified Eagle's medium, 10% fetal calf gin of these multipotent cells is unknown. They may be serum (FCS), 50 μg/ml gentamicin and 1.5 μg/ml fungi- recruited from the bone marrow in response to tendon tis- zone (all Invitrogen, Scotland, UK)). Tissue cultures were sue injury, and migrate through the circulation to the site maintained at 37°C in a humidified atmosphere of 5% of tissue damage [7]. They might also be present in the CO for ten days, with three medium changes. During this tendon tissue itself. time, fibroblasts migrated out of the tissue and adhered to the bottom of the culture dish. Cells were subcultured and Local progenitor cells with multilineage potential have trypsinized at subconfluency and cells from the third to previously been found in many locations within the mus- the fifth passage were used for the differentiation experi- culoskeletal system, e.g. in bone marrow, skin, perios- ments. teum, bone, muscle and adipose tissue [8-15]. On the other hand, progenitor cells are not the only cells with Human bone marrow stromal cells (BMSCs) were isolated multilineage potential: some highly differentiated cells from femoral shaft biopsies of six patients (age 42–72 are capable of transdifferentiation, i.e. switching their years) undergoing total hip replacement for treatment of phenotype to another lineage. This transdifferentiation osteoarthritis (MEC-2004-142). BMSCs were isolated has been demonstrated for highly differentiated chondro- from aspirated marrow acccording to procedures cytes [16,17]. described earlier [18]. Briefly, heparinized femoral-shaft marrow aspirate was plated out and after 24 hours, non- Multipotent cells have been found in virtually all tissues adherent cells were removed with 2% FCS in 1×PBS. of the musculoskeletal system, but it is not known if ten- Adherent cells were subcultured in medium with 10% FCS don tissue has a cell population with multilineage poten- and trypsinized at subconfluency. Cells from the second tial. In this study, we investigated whether the population to the fourth passage were used for the differentiation of cells derived from non-degenerative tendon tissue has experiments. The used serum lot was selected specifically differentiation potential similar to bone marrow-derived for the maintenance of multipotential cells. stromal cells (BMSCs). Specifically, we characterized human tendon-derived fibroblasts by immunohisto- Page 2 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 Phenotypic characterization of tendon-derived cells cells/cm to induce adipogenic differentiation, and cul- Explants harvested on day 6 of the explantation period tured in adipogenic induction medium containing were fresh frozen in liquid nitrogen and 6 μm frozen sec- DMEM with 10% FCS, supplemented with dexametha- tions were fixated in acetone. Cells in monolayer cultures, sone 1 μM, indo-methacin 0.2 mM, insulin 0.01 mg/ml, passage 1 and 4, were fixated in ice-cold 70% ethanol. and 3-isobutyl-l-methyl-xanthine 0.5 mM (all from Sigma). To induce chondrogenic differentiation, cells Ki-67, D7-FIB, and α-SMA staining were cultured in 1.2% low viscosity alginate beads at a Cells and histological sections were incubated with either density of 4 × 10 cells/ml in serum-free chondrogenic mouse monoclonal antibody against 11-fibrau (Clone induction medium containing DMEM supplemented D7-FIB; diluted 1:400; Imgen, Netherlands), a marker for with TGF-β2 10 ng/ml (R&D Systems, UK), L-ascorbic fibroblasts [19], or monoclonal antibody against α-SMA acid 2 phosphate 25 μg/ml (Sigma), sodium pyruvate 100 (Clone 1A4; diluted 1:1000; Sigma, St.Louis, Missouri, μg/ml (Invitrogen), proline 40 μg/ml (Sigma) and ITS+ USA), a marker for smooth muscle cells and pericytes (diluted 1:100; BD Biosciences, Bedford, MA). All media [20], for two hours. Cells were rinsed in 1×PBS and IHC contained 50 μg/ml gentamicin and 1.5 μg/ml fungizone. detection was performed using Link-Label (Biotin-based) Cells were cultured in differentiation media for 21 days, Multilink IHC Detection Kit (Biogenex, San Ramon, CA). with media changes twice a week. On day 21 of culture, Finally, a new fuchsin substrate was added to obtain a two wells were harvested for RNA extraction and one well pink signal in positive cultures. Cells were counterstained was used for histochemical evaluation. One well was cul- with Gill's haematoxilin (Sigma). For Ki-67 staining histo- tured for 21 days on expansion medium as control condi- logical sections were pre-incubated in 1% H O (Sigma) tion for the histochemical stainings. 2 2 in methanol (Sigma) and then incubated with mouse monoclonal antibody Ki-67 (M7187; diluted 1:25; Dako, Gene expression analysis Glostrup, Denmark). IHC detection was performed using At harvesting, monolayer cell cultures were suspended in StrAviGen Multilink Kit (Biogenex, San Ramon, CA), sub- RNA-Bee™ (TEL-TEST, Friendswood, TX, USA). Alginate strate development was performed using the SK-4800 Vec- beads were dissolved in 150 μl of 55 mM sodium citrate tor NovaRED™ Substrate kit (Vector Laboratories, in 150 mM sodium chloride per bead (both Fluka, Stein- Burlingame, CA), and no counterstaining was performed. heim, Switzerland) and cell pellets were subsequently sus- pended in RNA-Bee™. RNA was precipitated with 2- FACS-analysis propanol, purified with lithium chloride, and 1 μg total Trypsinized first to fifth passage cells were incubated at RNA of each sample was reverse-transcribed into cDNA 4°C for 30 minutes with saturating amounts of human using RevertAid™ First Strand cDNA Synthesis Kit (MBI antibodies CD105-PE (dilution 1:20; BD Biosciences, San Fermentas, St. Leon-Rot, Germany). Primers were Jose, USA), a marker for mesenchymal progenitor cells designed using PrimerExpress 2.0 software (Applied Bio- [21], and CD34-PE (dilution 1:20; Ancell, Bayport, USA), systems, Foster City, CA, USA) to meet Taqman or a marker that remains negative in non-hematogenic pro- SYBR Green requirements and were designed to bind to genitor cells [20] and is positive for hematogenic progen- separate exons to avoid co-amplification of genomic itor cells, endothelial cells, and pericytes [22-24]. Cells DNA. BLASTN ensured gene specificity of all primers were washed and resuspended in 300 μl HBN buffer listed in Table 1. As osteogenic markers osterix (SP7), (Hank's Balanced Salt Solution (HBSS; GIBCO, Breda, RUNT-related transcription factor 2 (RUNX2), and osteo- The Netherlands) + 0.5% (wt/vol) Bovine Serum Albumin calcin (BGLAP) were studied, while SOX9, aggrecan + 0.05% (wt/vol) sodium azide) and analyzed by flow (AGC1), collagen 2 (COL2A1), and collagen 10 cytometric analysis using a FACSCalibur flow cytometer (COL10A1) were used as chondrogenic markers. Adipo- and Cellquest software (BD Biosciences, San Jose, USA) genic markers studied were fatty acid binding protein 4 with a minimum of 10,000 events acquired. (FABP4) and peroxisome proliferative activated receptor γ (PPARG). Amplifications were performed as 25 μl reac- Differentiation experiment tions using either TaqMan Universal PCR MasterMix After trypsinisation, cells were seeded in six-well plates (ABI, Branchburg, New Jersey, USA) or qPCR™ Mastermix and cultured in a modified version of three differentiation Plus for SYBR Green I (Eurogentec, Nederland B.V., Maas- media described earlier [18]. Briefly, cells were seeded at tricht, The Netherlands) according to the manufacturer's 3,000 cells/cm to induce osteogenic differentiation and guidelines. Real-Time RT-PCR (QPCR) was done using an then cultured in an osteogenic induction medium con- ABI PRISM 7000 with SDS software version 1.7. Data taining DMEM plus 10% FCS and freshly added β-glycer- were normalized to GAPDH which was stably expressed ophosphate 10 mM (Sigma, St. Louis, USA), across sample conditions (not shown). Relative expres- -ΔCT dexamethasone 0.1 μM (Sigma) and L-ascorbic acid 2 sion was calculated according to the 2 formula [25] phosphate 0.5 mM (Sigma). Cells were seeded at 20,000 using averages of duplo samples. Page 3 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 Table 1: Primer and probe nucleotide sequences of the tested genes Gene Accession no. Primer Probe GAPDH NM_002046.2 F: ATGGGGAAGGTGAAGGTCG CGCCCAATACGACCAAATCCGTTGAC R: TAAAAGCAGCCCTGGTGACC RUNX2 NM_001024630.1 F: GCCTTCAAGGTGGTAGCCC CCACAGTCCCATCTGGTACCTCTCCG NM_00101505.1 R: CGTTACCCGCCATGACAGTA NM_0043468.3 BGLAP NM_199173.2 F: GAAGCCCAGCGGTGCA TGGACACAAAGGCTGCACCTTTGCT R: CACTACCTCGCTGCCCTCC PPARG* NM_138712.2 F: AGGGCGATCTTGACAGGAAA NM_015869.3 R: TCTCCCATCATTAAGGAATTCATG NM_005037.4 NM_138711.2 SOX9 NM_000346.2 F: CAACGCCGAGCTCAGCA TGGGCAAGCTCTGGAGACTTCTGAACG R: TCCACGAAGGGCCGC AGC1 NM_001135.1 F:TCGAGGACAGCGAGGCC ATGGAACACGATGCCTTTCACCACGA NM_013227.1 R:TCGAGGGTGTAGCGTGTAGAGA COL2A1 NM_033150 F: GGCAATAGCAGGTTCACGTACA CCGGTATGTTTCGTGCAGCCATCCT R: CGATAACAGTCTTGCCCCACTT COL10A1 NM_000493.2 F: CAAGGCACCATCTCCAGGAA TCCAGCACGCAGAATCCATCTGA R: AAAGGGTATTTGTGGCAGCATATT F: forward; R: reverse; * SYBR Green assay. Commercially available, so-called assays-on-demand (Applied Biosystems, Foster City, CA, U.S.A.) were used to detect osterix (SP7; Hs_00541729_m1) and fatty acid binding protein 4 (FABP4; Hs_00609791)-specific mRNA. Statistical analysis on averages of duplo samples was per- bated with mouse monoclonal antibody against collagen formed using SPSS 11.5 software (SPSS Inc., Chicago, IL, type 2 (II-II6B3, diluted 1:100; Developmental Studies USA). Groups on differentiation media were compared Hybridoma Bank) for 2 hours. Anti-mouse Fab fragments with a Kruskall-Wallis H test and post-hoc Mann-Whitney conjugated with alkaline phosphatase (GAMAP, diluted U test. For both tests p < 0.05 was considered to indicate 1:100; Immunotech, Marseille, France) were added. statistically significant differences. The graphs are Box- Finally, alkaline phosphatase conjugated anti-mouse anti- Whisker plots, with the box representing the middle two bodies in combination with a new fuchsin substrate were quartiles (25–75) and the Whiskers the highest and low- added to obtain a pink signal in positive cultures. Coun- est value. All outlier variables were included in the statis- terstaining with Gill's haematoxilin (Sigma) was per- tical analyses but excluded in the graphical display. formed. Histochemical and immunohistochemical stainings Results Von Kossa staining Characterization of tendon-derived fibroblasts Cells were fixed in formalin, hydrated in milliQ water, Histological examination of the adolescent hamstring ten- immersed in 5% silver nitrate solution (Sigma) for 10 don explants confirmed normal tissue morphology. Spe- minutes, rinsed and exposed to light for 10 minutes. cifically, no degenerative lesions, inflammatory cell Excess silver nitrate was removed with 5% sodium-thio- infiltration, (partial) ruptures, chondroid metaplasia, or sulphate (Sigma) and cells were rinsed in distilled water, calcifications were seen. followed by a counterstaining with azophloxine (Sigma). During the explant culture period, proliferating cells (Ki- Oil Red O staining 67 positive) were located between the highly organized Cells were fixed in 10% formalin, treated with 0.3% Oil collagen fibres of the tendon tissue and also in the con- red O solution (Sigma) for 15 min, and then repeatedly nective tissue of the endotenon. These cells stained posi- washed with tap water. tive for fibroblast-marker D7-FIB. On the other hand, proliferating cells were also seen in the vascular walls, Collagen type 2 staining staining negative for D7-FIB but positive for α-SMA, a Alginate beads were dissolved in sodium citrate, cytospins marker for pericytes and smooth muscle cells (Figure 1). were prepared and stored at -80°C. Cytospins were fixed in acetone and treated with 1% hyaluronidase (Sigma) for Cells explanted from the tendon tissue had a characteristic 20 min. Cell monolayers were fixed with 70% ethanol, spindle-shaped fibroblastic morphology. Through the treated with 50 mM NH Cl (Sigma), and permeabilised in first four passages in monolayer culture all tendon- a 0.1% Triton X-100 (Sigma) solution. Cells were incu- derived cells stained positive for D7-FIB but stained nega- Page 4 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 Ki-67, D7-FIB, in monolayer Figure 1 cultur and α e-SMA staining on tendon explants (day 6 of explantation period) and on tendon-derived fibroblasts (TDF) Ki-67, D7-FIB, and α-SMA staining on tendon explants (day 6 of explantation period) and on tendon-derived fibroblasts (TDF) in monolayer culture. Ki-67 positive (proliferating) cells in the explants were located in the tendinous tissue (A, black arrow), in the endotenon (A, white arrow), and in the vascular walls (A, circle). Cells in the tendon tissue and in the endotenon stained positive for fibroblastmarker D7-FIB (B). Cells in the vascular walls remained negative for D7-FIB (B) and instead stained posi- tive for α-SMA, a marker for pericytes and smooth muscle cells (C). All TDFs in monolayer culture stained positive for D7-FIB from passage one (D) to passage four (E) and remained negative for α-SMA from passage one (F) to passage four (G). tive for α-SMA (Figure 1). On further characterization by In addition to this, culture of tendon-derived fibroblasts FACS-analysis 99.1 +/- 1.1 % of the tendon-derived in adipogenic medium significantly upregulated expres- fibroblasts were CD34 negative and 72.6 +/- 22.9 % were sion of FABP4 and PPARG compared to those cultured in CD105 positive (average of passage 2 to 5 tendon-derived osteogenic (both p = 0.009) and chondrogenic medium cells, n = 4). The BMSCs had 99.7 +/- 0.4 % CD34 negative (both p = 0.025). Similar findings were seen in the BMSC cells and 93.8 +/- 4.6 % CD105 positive cells (average of cultures although the difference in PPARG expression passage 1 to 5 BMSCs, n = 8). between the osteogenic and adipogenic medium condi- tion did not reach statistical significance in the BMSC cul- Adipogenic markers tures (Figure 3). In the BMSC cultures PPARG expression Light microscopy revealed the presence of vacuoles within was significantly higher in adipogenic medium compared approximately one third of the cells in all adipogenic cul- to chondrogenic medium (p = 0.021); FABP4 expression tures of tendon-derived fibroblasts. Oil Red O staining was upregulated in the adipogenic medium compared to confirmed that these were lipid vacuoles (Figure 2A). osteogenic medium (p = 0.021) and chondrogenic Only cells aggregated into clusters stained positively for medium (p = 0.021). lipid vacuoles. Tendon-derived fibroblasts cultured on control medium (Figure 2B), on osteogenic, or on chon- Chondrogenic markers drogenic medium (not shown) did not develop any lipid Immunohistochemical staining for collagen type 2 was vacuoles. Cellular distribution of Oil Red O positive performed on tendon-derived fibroblasts cultured in BMSCs cultured in adipogenic medium was more homog- chondrogenic, adipogenic, osteogenic, and control enous with approximately 75% of cells staining positively medium for 21 days. In all chondrogenic medium condi- (results not shown). tions approximately 5% of the cells stained positive for Page 5 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 Oil Red O staining m Figure 2 erely clusters of cells formed on tendon-derived fib Oil Red O p robo lasts cu sitive lipid vacuol ltured for 21 days in adipogenic es inside the cell's main b medium (A ody) or in control m ) (note that not edium (B all cells b ) ut Oil Red O staining on tendon-derived fibroblasts cultured for 21 days in adipogenic medium (A) (note that not all cells but merely clusters of cells formed Oil Red O positive lipid vacuoles inside the cell's main body) or in control medium (B). Like cells in control medium, cells cultured in osteogenic or chondrogenic medium were negative (figures not shown). collagen type 2 (Figure 4A). Tendon-derived fibroblasts Culture of tendon-derived fibroblast in chondrogenic cultured in control medium (Figure 4B), as well as adipo- medium significantly increased expression of chondro- genic and osteogenic medium were immunonegative for genic markers COL2A1 and COL10A1 (the latter is con- collagen type 2 (not shown). BMSC cultures showed a sidered to be a marker for hypertrophic cartilage similar amount of collagen type 2 staining in chondro- formation) compared to the osteogenic condition (p = genic medium (not shown). 0.025 for both genes) and adipogenic condition (p = Expres Figure 3 sion levels of adipogenic markers in tendon-derived fibroblasts (TDF) and bone marrow-derived stromal cells (BMSC) Expression levels of adipogenic markers in tendon-derived fibroblasts (TDF) and bone marrow-derived stromal cells (BMSC). Cells were cultured for 21 days on osteogenic (N = 5 for TDF, N = 4 for BMSC), adipogenic (N = 5 for TDF, N = 5 for BMSC), or chondrogenic (N = 3 for TDF, N = 5 for BMSC) induction medium. The relative, GAPDH-normalized, expression levels of fatty acid binding protein 4 (FABP4)(A) and peroxisome proliferator activated receptor γ (PPARG)(B) is displayed on the verti- cal axis. * Indicates a P-value<0.05. Page 6 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 Immunohistochemica Figure 4 l staining for collagen type 2 on tendon-derived fibroblasts Immunohistochemical staining for collagen type 2 on tendon-derived fibroblasts. 5% of the cells cultured for 21 days in alginate beads in chondrogenic medium stained positive (A). Cells cultured in monolayer in control medium remained negative (B) as did cells in adipogenic or osteogenic media (figures not shown). 0.025 for both genes). Expression of SOX9 and AGC1 in Although we did find expression of osteogenic markers chondrogenic medium compared to osteogenic and adi- RUNX2, osterix, and osteocalcin, culture of tendon- pogenic medium was not significantly different (Figure derived fibroblasts in osteogenic medium did not induce 5). statistically significant upregulation of any of these genes. Similar results were found by QPCR of these markers in BMSC cultures also showed a significantly higher expres- BMSCs cultured in osteogenic medium (Figure 7). In the sion of COL2A1 and COL10A1 in chondrogenic medium tendon-derived fibroblast cultures SP7 and RUNX2 (both compared to osteogenic medium (p = 0.014 for both also known to play an important role in chondrogenic dif- genes) and adipogenic medium (p = 0.028 for COL2A1 ferentiation and hypertrophic cartilage formation [26]) and p = 0.009 for COL10A1). SOX9 expression in BMSCs were significantly upregulated in the chondrogenic showed the same trend as in the tendon-derived fibroblast medium compared to the osteogenic (p = 0.025 for both cultures, but the differences only reached significance in genes) and adipogenic medium (p = 0.025 for both the BMSC cultures (osteogenic versus adipogenic medium genes)(Figure 7). BMSCs also showed an upregulation of p = 0.014 and osteogenic versus chondrogenic medium p SP7 and RUNX2 in the chondrogenic medium. RUNX2 = 0.014). Expression of AGC1 in the BMSCs did not differ upregulation was significant (p = 0.016 for the difference significantly between the three medium conditions. Inter- in gene expression of RUNX2 between adipogenic and estingly, BMSCs cultured in osteogenic medium had sig- chondrogenic medium in BMCSs), but SP7 upregulation nificantly upregulated COL10A1 compared to the in chondrogenic medium did not reach significance (Fig- adipogenic condition (p = 0.027). This phenomenon was ure 7). In summary, chondrogenic medium not only stim- not seen in the tendon-derived fibroblasts (Figure 5). ulated expression of chondrogenic marker COL2A1, but also of COL10A1, RUNX2, and SP7. Osteogenic markers Von Kossa staining of tendon-derived fibroblasts in the Discussion osteogenic condition showed clustered areas of calcium This in-vitro differentiation study suggests that a propor- deposition, whereas the tendon-derived fibroblast cul- tion of the cell population explanted from adolescent tures in control medium had no calcium deposition (Fig- human tendon tissue may have adipogenic and chondro- ure 6). Also, tendon-derived fibroblast cultures in genic differentiation potential. In adipogenic medium adipogenic and chondrogenic medium remained negative lipid vacuoles were visible and tendon-derived fibroblasts for calcium (results not shown). Similarly, in BMSC cul- showed upregulation of FABP4 and PPARG. In chondro- tures, calcium deposition was found only in the osteo- genic medium, positive collagen 2 staining was visible genic condition (not shown). around some of the tendon-derived fibroblasts and the Page 7 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 (B Figure 5 Expres MSC) sion levels of chondrogenic markers in tendon-derived fibroblasts (TDF) and bone marrow-derived stromal cells Expression levels of chondrogenic markers in tendon-derived fibroblasts (TDF) and bone marrow-derived stromal cells (BMSC). SOX9 (A), aggrecan (AGC1)(B), collagen 2 (COL2A1)(C) and collagen 10 (COL10A1)(D). See figure 3 for reminder of key. tendon-derived fibroblasts showed upregulation of To our knowledge, this is the first study evaluating the COL2A1 and COL10A1. In osteogenic medium Von intrinsic differentiation potential of human tendon cells Kossa staining showed calcium deposition, although oste- in vitro. Previously, Salingcarnboriboon et al [27] estab- ogenic markers remained unaltered, as assessed by qPCR. lished three murine tendon cell lines by clonal expansion Compared to the BMSCs, the diffentiation capacity of our and showed that these single cell clones could differenti- tendon-derived fibroblasts was similar, although some ate towards multiple mesenchymal lineages upon culture differences were visible, mainly concerning the number of in appropriate differentiation media. Therefore, they sug- Oil Red O positive cells. gested that cells with mesenchymal stem-cell-like charac- Page 8 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 Von Kossa Figure 6 staining on tendon-derived fibroblasts cultured for 21 days in osteogenic (A) or control medium (B) Von Kossa staining on tendon-derived fibroblasts cultured for 21 days in osteogenic (A) or control medium (B). Calcium depo- sition was seen in osteogenic medium (A), not in control medium (B) or in adipogenic or chondrogenic media (figures not shown). teristics might exist in murine tendon tissue. Our Due to their spindle-shaped morphology in monolayer experiments cannot distinguish between individual cells culture and because all explanted cells stained D7-FIB with multilineage potential and a cell population contain- positive in passage one through passage four, we identi- ing more or less strongly committed cells. We did find that fied these cells as tendon-derived fibroblasts. Based on the not all of the tendon-derived fibroblasts appeared to be results of the Ki-67 staining, it could be surmised that this capable of differentiating towards other lineages, e.g. not mixed population may be partly derived from the tendon all fibroblasts but merely clusters of fibroblasts created tissue and partly from the endotenon. It is possible that lipid vacuoles in adipogenic medium and only a small these cells were already preselected for during the explan- proportion of approximately 5% of the cells stained posi- tation procedure, based on cellular motility, chemotactic tive for collagen type 2. In addition to this observation, responses or plastic adherence characteristics. Within this only a subpopulation of 72.6 +/- 22.9 % of these tendon- culture population, mature tendon-derived fibroblasts derived fibroblasts stained positive for CD105 and this with transdifferentiation capacity or a specific subpopula- subpopulation might be responsible for the observed dif- tion of tendon-derived progenitor cells might exist. Sev- ferentiation potential. eral authors have found that pericytes isolated from Expres Figure 7 sion levels of osteogenic markers in tendon-derived fibroblasts (TDF) and bone marrow-derived stromal cells (BMSC) Expression levels of osteogenic markers in tendon-derived fibroblasts (TDF) and bone marrow-derived stromal cells (BMSC). RUNT-related transcription factor 2 (RUNX2) (A), SP7 (B), and BGLAP (C). See figure 3 for reminder of key. Page 9 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 different tissues can be induced to differentiate into vari- microruptures in tendinosis lesions [37], tendon cells ous connective tissue phenotypes [8]. It seems unlikely may experience an altered mechanical microenvironment, that the presence of vascular pericytes in tendon tissue, which in turn might influence chondrogenic, osteogenic, which might be another multipotent cell source in tendon or tenogenic differentiation [38]. tissue [28], can account for our findings. Not only is ten- don a poorly vascularized tissue, but also the tendon- Our findings demonstrate that an intrinsic differentiation derived fibroblasts remained negative for pericyte marker capacity is present in tendon tissue of adolescent individ- α-SMA through the first four passages. Furthermore, our uals. However, age plays an important role in the response explanted cell population was 98.5 +/- 0.7 % negative for of musculoskeletal tissues in response to environmental CD34 on FACS-analysis. It seems unlikely that the small changes. It has been demonstrated that adult but not juve- portion of 1.5% CD34-positive tendon-derived fibrob- nile cartilage has lost its ability to regenerate (cited by lasts accounts for the results of the immunohistochemical Hunter [39]) and BMSCs gradually loose their differentia- staining and the changes in gene expression pattern. tion potential as subjects grow older [40]. Therefore, the adolescent tendon samples used in this study might not A cell population with multilineage potential that might be representative of tendon tissue in adult tendinosis be present in tendon tissue, is likely involved in tendon lesions. Since tendon cell populations derived from adult repair. Such a population might also contribute to the and from late fetal equine tendons have demonstrated development of tendinosis, as this tendon disorder is similar levels of a weak progenitor cell ability [41], it associated with fatty degeneration, glycosaminoglycan might be justified to speculate that tendon-derived fibrob- accumulation, and calcifications. In addition to these lasts from older subjects may still have some differentia- internal multipotent cells other cells with multilineage tion capacity. However, this certainly needs further potential may arrive at the site of overuse or tendon dam- investigation. age through the vascular system and contribute to the development or repair of tendinosis: upregulation of A tendon-cell population with intrinsic differentiation VEGF was found in human achilles tendinosis lesions capacity might be used in vivo for repair of lesions and [29] and VEGF can act as a chemotactic stimulus for mes- might play a role in tendinosis. However, extrapolating enchymal cells [30]. In-vivo control of differentiation of results from in-vitro cultures to the in-vivo situation must cells with multilineage potential might prove useful in the be done with tremendous caution, particularly as the future for prevention of tendinosis lesions or induction of expansion-culture period prior to experimentation may in-situ repair of these lesions. have led to the loss of the original tendon fibroblast phe- notype (due to dedifferentiation): the latter being well The exact changes in the tendon microenvironment out- known in chondrocyte-cultures [42]. Whether cells in vivo side the cells that play a role in cellular differentiation are can be stimulated to display this differentiation potential still the subject of many investigations. First, the capabil- remains to be elucidated. ity of specific growth factors, cytokines, and other inflam- matory mediators to influence the cellular differentiation Conclusion process has been demonstrated. Changes in the concen- Obtaining insight in the cellular behaviour and pathogen- tration of various growth factors have also been found in esis in tendinosis is crucial in order to develop mecha- tendinosis lesions: for instance, a higher number of cells nism-based therapies. Our study suggests that adolescent expressing TGF-β2 and TGF-βRII (a TGF-β receptor) in tendon tissue has an intrinsic differentiation potential. chronic achilles tendinosis lesions [31] and increased This study conducted on human tenocytes corroborates expression of TGF-β1 in patellar tendinosis [32] have the findings that cells with mesenchymal stem-cell-like been reported. TGF-β molecules are also used in vitro to characteristics might exist in murine tendon tissue. Our induce chondrogenic differentiation of mesenchymal results support the hypothesis that altered tendon-cell dif- progenitor cells [21]. Second, changes in the degree of vas- ferentiation might play a role in the pathophysiology of cularization of the tissue, as reported in achilles tendino- tendinosis. sis lesions [33], might influence the tendon cell differentiation state in vivo. For instance, oxygen tension Abbreviations influences the redifferentiation potential of dedifferenti- AGC1 = aggrecan ated chondrocytes in vitro [34] and hypoxia not only pro- motes the differentiation of bone mesenchymal stem cells BGLAP = osteocalcin along a chondrocyte pathway [35], but can also promote the formation of an adipocyte-like phenotype with cyto- BMSC = bone marrow-derived stromal cell plasmic lipid inclusions in human MSCs [36]. Third, fol- lowing repetitive tendon overload and its resulting COL10A1 = collagen type 10, alpha 1 chain Page 10 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 COL2A1 = collagen type 2, alpha 1 chain the study, and helped to draft the manuscript. JANV was involved in the study design and conception and helped D7-FIB = 11-fibrau, fibroblast antibody to draft the manuscript. GJVMO was involved in the study design and conception, and helped to draft the manu- DMEM = Dulbecco's modified Eagle's medium script. All authors read and approved the manuscript. FABP4 = adipocyte fatty acid binding protein 4 Acknowledgements This research was supported by the Erasmus MC Translational Research Fund. The authors would like to thank the orthopedic surgeon Ad Diep- FACS = fluorescense activated cell sorter straten for providing the tendon tissue and Han van Neck and Aleko Chato- jev for their support and interest in this work. The antibody II-116B3 was FCS = fetal calf serum obtained from the Developmental Studies Hybridoma Bank, under contract N01-HD-6-2915 from the NICHD. HBN buffer = Hank's Balanced Salt Solution (HBSS; GIBCO, Breda, The Netherlands) + 0.5% (wt/vol) Bovine References Serum Albumin + 0.05% (wt/vol) sodium azide 1. Paavola M, Kannus P, Jarvinen TA, Khan K, Jozsa L, Jarvinen M: Achil- les tendinopathy. J Bone Joint Surg Am 2002, 84-A:2062-2076. 2. Maffulli N, Kader D: Tendinopathy of tendo achillis. J Bone Joint IHC = immunohistochemistry Surg Br 2002, 84:1-8. 3. Movin T, Gad A, Reinholt FP, Rolf C: Tendon pathology in long- standing achillodynia. Biopsy findings in 40 patients. Acta Ki-67 = a protein strictly associated with cell proliferation Orthop Scand 1997, 68:170-175. 4. Tallon C, Maffulli N, Ewen SW: Ruptured Achilles tendons are significantly more degenerated than tendinopathic tendons. MEC = medical ethical committee Med Sci Sports Exerc 2001, 33:1983-1990. 5. Jarvinen M, Jozsa L, Kannus P, Jarvinen TL, Kvist M, Leadbetter W: SOX9 = SRY-box 9 Histopathological findings in chronic tendon disorders. Scand J Med Sci Sports 1997, 7:86-95. 6. Caplan AI, Bruder SP: Mesenchymal stem cells: building blocks PPARG = peroxisome proliferative activated receptor for molecular medicine in the 21st century. Trends Mol Med 2001, 7:259-264. gamma 7. Roufosse CA, Direkze NC, Otto WR, Wright NA: Circulating mesenchymal stem cells. Int J Biochem Cell Biol 2004, 36:585-597. QPCR = quantitative polymerase chain reaction 8. Muschler GF, Midura RJ: Connective tissue progenitors: practi- cal concepts for clinical applications. Clin Orthop Relat Res 2002:66-80. RT-PCR = reverse transcriptase polymerase chain reaction 9. Gregory CA, Prockop DJ, Spees JL: Non-hematopoietic bone marrow stem cells: molecular control of expansion and dif- ferentiation. Exp Cell Res 2005, 306:330-335. RUNX2 = RUNT-related transcription factor 2 10. Morasso MI, Tomic-Canic M: Epidermal stem cells: the cradle of epidermal determination, differentiation and wound healing. Biol Cell 2005, 97:173-183. SP7 = Sp7 transcription factor/osterix 11. Nakahara H, Dennis JE, Bruder SP, Haynesworth SE, Lennon DP, Cap- lan AI: In vitro differentiation of bone and hypertrophic carti- TDF = tendon-derived fibroblast lage from periosteal-derived cells. Exp Cell Res 1991, 195:492-503. 12. Nakahara H, Goldberg VM, Caplan AI: Culture-expanded human α-SMA = alpha smooth muscle actin periosteal-derived cells exhibit osteochondral potential in vivo. J Orthop Res 1991, 9:465-476. 13. Bosch P, Musgrave DS, Lee JY, Cummins J, Shuler T, Ghivizzani TC, Competing interests Evans T, Robbins TD, Huard: Osteoprogenitor cells within skel- The author(s) declare that they have no competing inter- etal muscle. J Orthop Res 2000, 18:933-944. 14. Seale P, Rudnicki MA: A new look at the origin, function, and ests. "stem-cell" status of muscle satellite cells. Dev Biol 2000, 218:115-124. Authors' contributions 15. Rodriguez AM, Elabd C, Amri EZ, Ailhaud G, Dani C: The human adipose tissue is a source of multipotent stem cells. Biochimie MM performed the study, performed the statistical analy- 2005, 87:125-128. sis, and drafted the manuscript. JLK participated in the 16. Kahn AJ, Simmons DJ: Chondrocyte-to-osteocyte transforma- tion in grafts of perichondrium-free epiphyseal cartilage. Clin design of the study and in the culture work. HJ designed Orthop Relat Res 1977:299-304. primers and probes, helped with the molecular biology, 17. Barbero A, Ploegert S, Heberer M, Martin I: Plasticity of clonal and helped to draft the manuscript. MMAV: performed populations of dedifferentiated adult human articular chondrocytes. Arthritis Rheum 2003, 48:1315-1325. the FACS analysis. MPH was involved in the study design 18. Caterson EJ, Nesti LJ, Danielson KG, Tuan RS: Human marrow- and conception and helped to draft the manuscript. NK derived mesenchymal progenitor cells: isolation, culture participated in the culture work and immunohistological expansion, and analysis of differentiation. Mol Biotechnol 2002, 20:245-256. staining. JPTML participated in the design of the study and 19. van Osch GJ, van der Veen SW, Marijnissen WJ, Verhaar JA: Mono- helped to draft the manuscript. HW was involved in the clonal antibody 11-fibrau: a useful marker to characterize chondrocyte differentiation stage. Biochem Biophys Res Commun study design and conception, participated in the design of 2001, 280:806-812. Page 11 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 20. Shi S, Gronthos S: Perivascular niche of postnatal mesenchy- mesenchymal stem cells. In 52nd Annual Meeting Orthopaedic mal stem cells in human bone marrow and dental pulp. J Bone Research Society 2006; Chicago; 2006. Miner Res 2003, 18:696-704. 42. Mandl EW, Jahr H, Koevoet JL, van Leeuwen JP, Weinans H, Verhaar 21. Tuli R, Tuli S, Nandi S, Wang ML, Alexander PG, Haleem-Smith H, JA, van Osch GJ: Fibroblast growth factor-2 in serum-free Hozack WJ, Manner PA, Danielson KG, Tuan RS: Characterization medium is a potent mitogen and reduces dedifferentiation of of multipotential mesenchymal progenitor cells derived human ear chondrocytes in monolayer culture. Matrix Biol from human trabecular bone. Stem Cells 2003, 21:681-693. 2004, 23:231-241. 22. Zocchi MR, Poggi A: PECAM-1, apoptosis and CD34+ precur- sors. Leuk Lymphoma 2004, 45:2205-2213. Pre-publication history 23. Middleton J, Americh L, Gayon R, Julien D, Mansat M, Mansat P, The pre-publication history for this paper can be accessed Anract P, Cantagrel A, Cattan P, Reimund JM, Aguilar L, Amalric F, Girard JP: A comparative study of endothelial cell markers here: expressed in chronically inflamed human tissues: MECA-79, Duffy antigen receptor for chemokines, von Willebrand fac- tor, CD31, CD34, CD105 and CD146. J Pathol 2005, http://www.biomedcentral.com/1471-2474/8/16/prepub 206:260-268. 24. Howson KM, Aplin AC, Gelati M, Alessandri G, Parati EA, Nicosia RF: The postnatal rat aorta contains pericyte progenitor cells that form spheroidal colonies in suspension culture. Am J Phys- iol Cell Physiol 2005, 289:C1396-407. 25. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25:402-408. 26. Wang Y, Belflower RM, Dong YF, Schwarz EM, O'Keefe RJ, Drissi H: Runx1/AML1/Cbfa2 mediates onset of mesenchymal cell dif- ferentiation toward chondrogenesis. J Bone Miner Res 2005, 20:1624-1636. 27. Salingcarnboriboon R, Yoshitake H, Tsuji K, Obinata M, Amagasa T, Nifuji A, Noda M: Establishment of tendon-derived cell lines exhibiting pluripotent mesenchymal stem cell-like property. Exp Cell Res 2003, 287:289-300. 28. Katenkamp D, Stiller D, Schulze E: Ultrastructural cytology of regenerating tendon--an experimental study. Exp Pathol (Jena) 1976, 12:25-37. 29. Alfredson H, Lorentzon M, Backman S, Backman A, Lerner UH: cDNA-arrays and real-time quantitative PCR techniques in the investigation of chronic Achilles tendinosis. J Orthop Res 2003, 21:970-975. 30. Fiedler J, Leucht F, Waltenberger J, Dehio C, Brenner RE: VEGF-A and PlGF-1 stimulate chemotactic migration of human mes- enchymal progenitor cells. Biochem Biophys Res Commun 2005, 334:561-568. 31. Fenwick SA, Curry V, Harrall RL, Hazleman BL, Hackney R, Riley GP: Expression of transforming growth factor-beta isoforms and their receptors in chronic tendinosis. J Anat 2001, 199:231-240. 32. Fu SC, Wang W, Pau HM, Wong YP, Chan KM, Rolf CG: Increased expression of transforming growth factor-beta1 in patellar tendinosis. Clin Orthop Relat Res 2002:174-183. 33. Pufe T, Petersen WJ, Mentlein R, Tillmann BN: The role of vascu- lature and angiogenesis for the pathogenesis of degenerative tendons disease. Scand J Med Sci Sports 2005, 15:211-222. 34. Murphy CL, Polak JM: Control of human articular chondrocyte differentiation by reduced oxygen tension. J Cell Physiol 2004, 199:451-459. 35. Robins JC, Akeno N, Mukherjee A, Dalal RR, Aronow BJ, Koopman P, Clemens TL: Hypoxia induces chondrocyte-specific gene expression in mesenchymal cells in association with tran- scriptional activation of Sox9. Bone 2005, 37:313-322. 36. Fink T, Abildtrup L, Fogd K, Abdallah BM, Kassem M, Ebbesen P, Zachar V: Induction of adipocyte-like phenotype in human mesenchymal stem cells by hypoxia. Stem Cells 2004, Publish with Bio Med Central and every 22:1346-1355. scientist can read your work free of charge 37. Wang JH, Iosifidis MI, Fu FH: Biomechanical basis for tendinop- athy. Clin Orthop Relat Res 2006, 443:320-332. "BioMed Central will be the most significant development for 38. Forslund C, Aspenberg P: CDMP-2 induces bone or tendon-like disseminating the results of biomedical researc h in our lifetime." tissue depending on mechanical stimulation. J Orthop Res 2002, Sir Paul Nurse, Cancer Research UK 20:1170-1174. 39. Hunter W: Of the structure and disease of articulating carti- Your research papers will be: lages. 1743. Clin Orthop Relat Res 1995:3-6. available free of charge to the entire biomedical community 40. Muraglia A, Cancedda R, Quarto R: Clonal mesenchymal progen- itors from human bone marrow differentiate in vitro accord- peer reviewed and published immediately upon acceptance ing to a hierarchical model. J Cell Sci 2000, 113 ( Pt cited in PubMed and archived on PubMed Central 7):1161-1166. 41. Strassburg S, Goodship A, Hardingham T, Clegg P: Adult and late yours — you keep the copyright fetal equine tendons contain cell populations with weak pro- BioMedcentral genitor properties in comparison to bone marrow derived Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp Page 12 of 12 (page number not for citation purposes) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png BMC Musculoskeletal Disorders Springer Journals

Intrinsic differentiation potential of adolescent human tendon tissue: an in-vitro cell differentiation study

Download PDF
12 pages

Loading next page...
 
/lp/springer-journals/intrinsic-differentiation-potential-of-adolescent-human-tendon-tissue-yFA3i0PPLQ

References (49)

Publisher
Springer Journals
Copyright
Copyright © 2007 by de Mos et al; licensee BioMed Central Ltd.
Subject
Medicine & Public Health; Orthopedics; Rehabilitation; Rheumatology; Sports Medicine; Internal Medicine; Epidemiology
eISSN
1471-2474
DOI
10.1186/1471-2474-8-16
pmid
17319938
Publisher site
See Article on Publisher Site

Abstract

Background: Tendinosis lesions show an increase of glycosaminoglycan amount, calcifications, and lipid accumulation. Therefore, altered cellular differentiation might play a role in the etiology of tendinosis. This study investigates whether adolescent human tendon tissue contains a population of cells with intrinsic differentiation potential. Methods: Cells derived from adolescent non-degenerative hamstring tendons were characterized by immunohistochemistry and FACS-analysis. Cells were cultured for 21 days in osteogenic, adipogenic, and chondrogenic medium and phenotypical evaluation was carried out by immunohistochemical and qPCR analysis. The results were compared with the results of similar experiments on adult bone marrow-derived stromal cells (BMSCs). Results: Tendon-derived cells stained D7-FIB (fibroblast-marker) positive, but α-SMA (marker for smooth muscle cells and pericytes) negative. Tendon-derived cells were 99% negative for CD34 (endothelial cell marker), and 73% positive for CD105 (mesenchymal progenitor-cell marker). In adipogenic medium, intracellular lipid vacuoles were visible and tendon-derived fibroblasts showed upregulation of adipogenic markers FABP4 (fatty-acid binding protein 4) and PPARG (peroxisome proliferative activated receptor γ). In chondrogenic medium, some cells stained positive for collagen 2 and tendon-derived fibroblasts showed upregulation of collagen 2 and collagen 10. In osteogenic medium Von Kossa staining showed calcium deposition although osteogenic markers remained unaltered. Tendon-derived cells and BMCSs behaved largely comparable, although some distinct differences were present between the two cell populations. Conclusion: This study suggests that our population of explanted human tendon cells has an intrinsic differentiation potential. These results support the hypothesis that there might be a role for altered tendon-cell differentiation in the pathophysiology of tendinosis. Page 1 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 chemical staining and FACS-analysis. Then, after a culture Background Tendinosis is a chronic degenerative tendon disorder period of 21 days in adipogenic, chondrogenic, and oste- occurring particularly among athletes and middle-aged ogenic medium, we evaluated changes in their phenotype people [1]. As its pathophysiology is still largely using immunohistochemical and histochemical stainings unknown, only symptomatic treatment options are avail- as well as gene expression analysis. able, with limited success rates [1,2]. A better understand- ing of the cellular processes involved in the development Methods of tendinosis lesions may ultimately improve treatment Study design and prevention. Cells were explanted from human adolescent non-degen- erative hamstring tendon tissue (n = 5). After the pheno- Histopathological findings in tendinosis have been type of the cells was analyzed by immunohistochemical described in detail [3,4]. In brief, hypercellularity and staining and FACS-analysis, cells were cultured for 21 days rounding of the cell nuclei indicate a relatively high met- on osteogenic, adipogenic, or chondrogenic medium. The abolic activity. Likewise, altered extracellular matrix com- differentiation potential of the tendon-derived cell popu- position reflects changes in cellular behaviour. For lation was evaluated by immunohistochemical and histo- instance, in tendinosis lesions there is a higher amount of chemical staining and real-time RT-PCR, and was glycosaminoglycans [3]. Lipid accumulation and calcium compared with the differentiation potential of human deposition have also been described [5]. Thus, the his- femoral-shaft-derived BMSCs (n = 5). topathological findings may indicate the presence of cells with diverse phenotypes, different from that of tenocytes Isolation of tendon-derived cells and BMSCs under healthy conditions. Human tendon-derived cells were cultured from explants from hamstring tendon tissue of five adolescents (age 12– Cells with multilineage differentiation potential likely 17 years) undergoing hamstring-tendon release for treat- play an important role in the body's capacity to naturally ment of knee-contractures (MEC-2006-069). In this clini- remodel, repair, and regenerate various tissue types where cal condition the tendon is primarily not affected, but is necessary [6]. However, the multilineage differentiation exposed to continuously high tensile strains. After the per- potential of cells might also be involved in pathological itendineum had been carefully removed, the tendon was processes. Although the pathophysiology of tendinosis is cut into 3 mm sections, transferred into six-well plates largely unclear, histological findings suggest that multipo- (Corning, NY, USA) and cultured in expansion medium tent cells might be implicated in its development. The ori- (Dulbecco's modified Eagle's medium, 10% fetal calf gin of these multipotent cells is unknown. They may be serum (FCS), 50 μg/ml gentamicin and 1.5 μg/ml fungi- recruited from the bone marrow in response to tendon tis- zone (all Invitrogen, Scotland, UK)). Tissue cultures were sue injury, and migrate through the circulation to the site maintained at 37°C in a humidified atmosphere of 5% of tissue damage [7]. They might also be present in the CO for ten days, with three medium changes. During this tendon tissue itself. time, fibroblasts migrated out of the tissue and adhered to the bottom of the culture dish. Cells were subcultured and Local progenitor cells with multilineage potential have trypsinized at subconfluency and cells from the third to previously been found in many locations within the mus- the fifth passage were used for the differentiation experi- culoskeletal system, e.g. in bone marrow, skin, perios- ments. teum, bone, muscle and adipose tissue [8-15]. On the other hand, progenitor cells are not the only cells with Human bone marrow stromal cells (BMSCs) were isolated multilineage potential: some highly differentiated cells from femoral shaft biopsies of six patients (age 42–72 are capable of transdifferentiation, i.e. switching their years) undergoing total hip replacement for treatment of phenotype to another lineage. This transdifferentiation osteoarthritis (MEC-2004-142). BMSCs were isolated has been demonstrated for highly differentiated chondro- from aspirated marrow acccording to procedures cytes [16,17]. described earlier [18]. Briefly, heparinized femoral-shaft marrow aspirate was plated out and after 24 hours, non- Multipotent cells have been found in virtually all tissues adherent cells were removed with 2% FCS in 1×PBS. of the musculoskeletal system, but it is not known if ten- Adherent cells were subcultured in medium with 10% FCS don tissue has a cell population with multilineage poten- and trypsinized at subconfluency. Cells from the second tial. In this study, we investigated whether the population to the fourth passage were used for the differentiation of cells derived from non-degenerative tendon tissue has experiments. The used serum lot was selected specifically differentiation potential similar to bone marrow-derived for the maintenance of multipotential cells. stromal cells (BMSCs). Specifically, we characterized human tendon-derived fibroblasts by immunohisto- Page 2 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 Phenotypic characterization of tendon-derived cells cells/cm to induce adipogenic differentiation, and cul- Explants harvested on day 6 of the explantation period tured in adipogenic induction medium containing were fresh frozen in liquid nitrogen and 6 μm frozen sec- DMEM with 10% FCS, supplemented with dexametha- tions were fixated in acetone. Cells in monolayer cultures, sone 1 μM, indo-methacin 0.2 mM, insulin 0.01 mg/ml, passage 1 and 4, were fixated in ice-cold 70% ethanol. and 3-isobutyl-l-methyl-xanthine 0.5 mM (all from Sigma). To induce chondrogenic differentiation, cells Ki-67, D7-FIB, and α-SMA staining were cultured in 1.2% low viscosity alginate beads at a Cells and histological sections were incubated with either density of 4 × 10 cells/ml in serum-free chondrogenic mouse monoclonal antibody against 11-fibrau (Clone induction medium containing DMEM supplemented D7-FIB; diluted 1:400; Imgen, Netherlands), a marker for with TGF-β2 10 ng/ml (R&D Systems, UK), L-ascorbic fibroblasts [19], or monoclonal antibody against α-SMA acid 2 phosphate 25 μg/ml (Sigma), sodium pyruvate 100 (Clone 1A4; diluted 1:1000; Sigma, St.Louis, Missouri, μg/ml (Invitrogen), proline 40 μg/ml (Sigma) and ITS+ USA), a marker for smooth muscle cells and pericytes (diluted 1:100; BD Biosciences, Bedford, MA). All media [20], for two hours. Cells were rinsed in 1×PBS and IHC contained 50 μg/ml gentamicin and 1.5 μg/ml fungizone. detection was performed using Link-Label (Biotin-based) Cells were cultured in differentiation media for 21 days, Multilink IHC Detection Kit (Biogenex, San Ramon, CA). with media changes twice a week. On day 21 of culture, Finally, a new fuchsin substrate was added to obtain a two wells were harvested for RNA extraction and one well pink signal in positive cultures. Cells were counterstained was used for histochemical evaluation. One well was cul- with Gill's haematoxilin (Sigma). For Ki-67 staining histo- tured for 21 days on expansion medium as control condi- logical sections were pre-incubated in 1% H O (Sigma) tion for the histochemical stainings. 2 2 in methanol (Sigma) and then incubated with mouse monoclonal antibody Ki-67 (M7187; diluted 1:25; Dako, Gene expression analysis Glostrup, Denmark). IHC detection was performed using At harvesting, monolayer cell cultures were suspended in StrAviGen Multilink Kit (Biogenex, San Ramon, CA), sub- RNA-Bee™ (TEL-TEST, Friendswood, TX, USA). Alginate strate development was performed using the SK-4800 Vec- beads were dissolved in 150 μl of 55 mM sodium citrate tor NovaRED™ Substrate kit (Vector Laboratories, in 150 mM sodium chloride per bead (both Fluka, Stein- Burlingame, CA), and no counterstaining was performed. heim, Switzerland) and cell pellets were subsequently sus- pended in RNA-Bee™. RNA was precipitated with 2- FACS-analysis propanol, purified with lithium chloride, and 1 μg total Trypsinized first to fifth passage cells were incubated at RNA of each sample was reverse-transcribed into cDNA 4°C for 30 minutes with saturating amounts of human using RevertAid™ First Strand cDNA Synthesis Kit (MBI antibodies CD105-PE (dilution 1:20; BD Biosciences, San Fermentas, St. Leon-Rot, Germany). Primers were Jose, USA), a marker for mesenchymal progenitor cells designed using PrimerExpress 2.0 software (Applied Bio- [21], and CD34-PE (dilution 1:20; Ancell, Bayport, USA), systems, Foster City, CA, USA) to meet Taqman or a marker that remains negative in non-hematogenic pro- SYBR Green requirements and were designed to bind to genitor cells [20] and is positive for hematogenic progen- separate exons to avoid co-amplification of genomic itor cells, endothelial cells, and pericytes [22-24]. Cells DNA. BLASTN ensured gene specificity of all primers were washed and resuspended in 300 μl HBN buffer listed in Table 1. As osteogenic markers osterix (SP7), (Hank's Balanced Salt Solution (HBSS; GIBCO, Breda, RUNT-related transcription factor 2 (RUNX2), and osteo- The Netherlands) + 0.5% (wt/vol) Bovine Serum Albumin calcin (BGLAP) were studied, while SOX9, aggrecan + 0.05% (wt/vol) sodium azide) and analyzed by flow (AGC1), collagen 2 (COL2A1), and collagen 10 cytometric analysis using a FACSCalibur flow cytometer (COL10A1) were used as chondrogenic markers. Adipo- and Cellquest software (BD Biosciences, San Jose, USA) genic markers studied were fatty acid binding protein 4 with a minimum of 10,000 events acquired. (FABP4) and peroxisome proliferative activated receptor γ (PPARG). Amplifications were performed as 25 μl reac- Differentiation experiment tions using either TaqMan Universal PCR MasterMix After trypsinisation, cells were seeded in six-well plates (ABI, Branchburg, New Jersey, USA) or qPCR™ Mastermix and cultured in a modified version of three differentiation Plus for SYBR Green I (Eurogentec, Nederland B.V., Maas- media described earlier [18]. Briefly, cells were seeded at tricht, The Netherlands) according to the manufacturer's 3,000 cells/cm to induce osteogenic differentiation and guidelines. Real-Time RT-PCR (QPCR) was done using an then cultured in an osteogenic induction medium con- ABI PRISM 7000 with SDS software version 1.7. Data taining DMEM plus 10% FCS and freshly added β-glycer- were normalized to GAPDH which was stably expressed ophosphate 10 mM (Sigma, St. Louis, USA), across sample conditions (not shown). Relative expres- -ΔCT dexamethasone 0.1 μM (Sigma) and L-ascorbic acid 2 sion was calculated according to the 2 formula [25] phosphate 0.5 mM (Sigma). Cells were seeded at 20,000 using averages of duplo samples. Page 3 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 Table 1: Primer and probe nucleotide sequences of the tested genes Gene Accession no. Primer Probe GAPDH NM_002046.2 F: ATGGGGAAGGTGAAGGTCG CGCCCAATACGACCAAATCCGTTGAC R: TAAAAGCAGCCCTGGTGACC RUNX2 NM_001024630.1 F: GCCTTCAAGGTGGTAGCCC CCACAGTCCCATCTGGTACCTCTCCG NM_00101505.1 R: CGTTACCCGCCATGACAGTA NM_0043468.3 BGLAP NM_199173.2 F: GAAGCCCAGCGGTGCA TGGACACAAAGGCTGCACCTTTGCT R: CACTACCTCGCTGCCCTCC PPARG* NM_138712.2 F: AGGGCGATCTTGACAGGAAA NM_015869.3 R: TCTCCCATCATTAAGGAATTCATG NM_005037.4 NM_138711.2 SOX9 NM_000346.2 F: CAACGCCGAGCTCAGCA TGGGCAAGCTCTGGAGACTTCTGAACG R: TCCACGAAGGGCCGC AGC1 NM_001135.1 F:TCGAGGACAGCGAGGCC ATGGAACACGATGCCTTTCACCACGA NM_013227.1 R:TCGAGGGTGTAGCGTGTAGAGA COL2A1 NM_033150 F: GGCAATAGCAGGTTCACGTACA CCGGTATGTTTCGTGCAGCCATCCT R: CGATAACAGTCTTGCCCCACTT COL10A1 NM_000493.2 F: CAAGGCACCATCTCCAGGAA TCCAGCACGCAGAATCCATCTGA R: AAAGGGTATTTGTGGCAGCATATT F: forward; R: reverse; * SYBR Green assay. Commercially available, so-called assays-on-demand (Applied Biosystems, Foster City, CA, U.S.A.) were used to detect osterix (SP7; Hs_00541729_m1) and fatty acid binding protein 4 (FABP4; Hs_00609791)-specific mRNA. Statistical analysis on averages of duplo samples was per- bated with mouse monoclonal antibody against collagen formed using SPSS 11.5 software (SPSS Inc., Chicago, IL, type 2 (II-II6B3, diluted 1:100; Developmental Studies USA). Groups on differentiation media were compared Hybridoma Bank) for 2 hours. Anti-mouse Fab fragments with a Kruskall-Wallis H test and post-hoc Mann-Whitney conjugated with alkaline phosphatase (GAMAP, diluted U test. For both tests p < 0.05 was considered to indicate 1:100; Immunotech, Marseille, France) were added. statistically significant differences. The graphs are Box- Finally, alkaline phosphatase conjugated anti-mouse anti- Whisker plots, with the box representing the middle two bodies in combination with a new fuchsin substrate were quartiles (25–75) and the Whiskers the highest and low- added to obtain a pink signal in positive cultures. Coun- est value. All outlier variables were included in the statis- terstaining with Gill's haematoxilin (Sigma) was per- tical analyses but excluded in the graphical display. formed. Histochemical and immunohistochemical stainings Results Von Kossa staining Characterization of tendon-derived fibroblasts Cells were fixed in formalin, hydrated in milliQ water, Histological examination of the adolescent hamstring ten- immersed in 5% silver nitrate solution (Sigma) for 10 don explants confirmed normal tissue morphology. Spe- minutes, rinsed and exposed to light for 10 minutes. cifically, no degenerative lesions, inflammatory cell Excess silver nitrate was removed with 5% sodium-thio- infiltration, (partial) ruptures, chondroid metaplasia, or sulphate (Sigma) and cells were rinsed in distilled water, calcifications were seen. followed by a counterstaining with azophloxine (Sigma). During the explant culture period, proliferating cells (Ki- Oil Red O staining 67 positive) were located between the highly organized Cells were fixed in 10% formalin, treated with 0.3% Oil collagen fibres of the tendon tissue and also in the con- red O solution (Sigma) for 15 min, and then repeatedly nective tissue of the endotenon. These cells stained posi- washed with tap water. tive for fibroblast-marker D7-FIB. On the other hand, proliferating cells were also seen in the vascular walls, Collagen type 2 staining staining negative for D7-FIB but positive for α-SMA, a Alginate beads were dissolved in sodium citrate, cytospins marker for pericytes and smooth muscle cells (Figure 1). were prepared and stored at -80°C. Cytospins were fixed in acetone and treated with 1% hyaluronidase (Sigma) for Cells explanted from the tendon tissue had a characteristic 20 min. Cell monolayers were fixed with 70% ethanol, spindle-shaped fibroblastic morphology. Through the treated with 50 mM NH Cl (Sigma), and permeabilised in first four passages in monolayer culture all tendon- a 0.1% Triton X-100 (Sigma) solution. Cells were incu- derived cells stained positive for D7-FIB but stained nega- Page 4 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 Ki-67, D7-FIB, in monolayer Figure 1 cultur and α e-SMA staining on tendon explants (day 6 of explantation period) and on tendon-derived fibroblasts (TDF) Ki-67, D7-FIB, and α-SMA staining on tendon explants (day 6 of explantation period) and on tendon-derived fibroblasts (TDF) in monolayer culture. Ki-67 positive (proliferating) cells in the explants were located in the tendinous tissue (A, black arrow), in the endotenon (A, white arrow), and in the vascular walls (A, circle). Cells in the tendon tissue and in the endotenon stained positive for fibroblastmarker D7-FIB (B). Cells in the vascular walls remained negative for D7-FIB (B) and instead stained posi- tive for α-SMA, a marker for pericytes and smooth muscle cells (C). All TDFs in monolayer culture stained positive for D7-FIB from passage one (D) to passage four (E) and remained negative for α-SMA from passage one (F) to passage four (G). tive for α-SMA (Figure 1). On further characterization by In addition to this, culture of tendon-derived fibroblasts FACS-analysis 99.1 +/- 1.1 % of the tendon-derived in adipogenic medium significantly upregulated expres- fibroblasts were CD34 negative and 72.6 +/- 22.9 % were sion of FABP4 and PPARG compared to those cultured in CD105 positive (average of passage 2 to 5 tendon-derived osteogenic (both p = 0.009) and chondrogenic medium cells, n = 4). The BMSCs had 99.7 +/- 0.4 % CD34 negative (both p = 0.025). Similar findings were seen in the BMSC cells and 93.8 +/- 4.6 % CD105 positive cells (average of cultures although the difference in PPARG expression passage 1 to 5 BMSCs, n = 8). between the osteogenic and adipogenic medium condi- tion did not reach statistical significance in the BMSC cul- Adipogenic markers tures (Figure 3). In the BMSC cultures PPARG expression Light microscopy revealed the presence of vacuoles within was significantly higher in adipogenic medium compared approximately one third of the cells in all adipogenic cul- to chondrogenic medium (p = 0.021); FABP4 expression tures of tendon-derived fibroblasts. Oil Red O staining was upregulated in the adipogenic medium compared to confirmed that these were lipid vacuoles (Figure 2A). osteogenic medium (p = 0.021) and chondrogenic Only cells aggregated into clusters stained positively for medium (p = 0.021). lipid vacuoles. Tendon-derived fibroblasts cultured on control medium (Figure 2B), on osteogenic, or on chon- Chondrogenic markers drogenic medium (not shown) did not develop any lipid Immunohistochemical staining for collagen type 2 was vacuoles. Cellular distribution of Oil Red O positive performed on tendon-derived fibroblasts cultured in BMSCs cultured in adipogenic medium was more homog- chondrogenic, adipogenic, osteogenic, and control enous with approximately 75% of cells staining positively medium for 21 days. In all chondrogenic medium condi- (results not shown). tions approximately 5% of the cells stained positive for Page 5 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 Oil Red O staining m Figure 2 erely clusters of cells formed on tendon-derived fib Oil Red O p robo lasts cu sitive lipid vacuol ltured for 21 days in adipogenic es inside the cell's main b medium (A ody) or in control m ) (note that not edium (B all cells b ) ut Oil Red O staining on tendon-derived fibroblasts cultured for 21 days in adipogenic medium (A) (note that not all cells but merely clusters of cells formed Oil Red O positive lipid vacuoles inside the cell's main body) or in control medium (B). Like cells in control medium, cells cultured in osteogenic or chondrogenic medium were negative (figures not shown). collagen type 2 (Figure 4A). Tendon-derived fibroblasts Culture of tendon-derived fibroblast in chondrogenic cultured in control medium (Figure 4B), as well as adipo- medium significantly increased expression of chondro- genic and osteogenic medium were immunonegative for genic markers COL2A1 and COL10A1 (the latter is con- collagen type 2 (not shown). BMSC cultures showed a sidered to be a marker for hypertrophic cartilage similar amount of collagen type 2 staining in chondro- formation) compared to the osteogenic condition (p = genic medium (not shown). 0.025 for both genes) and adipogenic condition (p = Expres Figure 3 sion levels of adipogenic markers in tendon-derived fibroblasts (TDF) and bone marrow-derived stromal cells (BMSC) Expression levels of adipogenic markers in tendon-derived fibroblasts (TDF) and bone marrow-derived stromal cells (BMSC). Cells were cultured for 21 days on osteogenic (N = 5 for TDF, N = 4 for BMSC), adipogenic (N = 5 for TDF, N = 5 for BMSC), or chondrogenic (N = 3 for TDF, N = 5 for BMSC) induction medium. The relative, GAPDH-normalized, expression levels of fatty acid binding protein 4 (FABP4)(A) and peroxisome proliferator activated receptor γ (PPARG)(B) is displayed on the verti- cal axis. * Indicates a P-value<0.05. Page 6 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 Immunohistochemica Figure 4 l staining for collagen type 2 on tendon-derived fibroblasts Immunohistochemical staining for collagen type 2 on tendon-derived fibroblasts. 5% of the cells cultured for 21 days in alginate beads in chondrogenic medium stained positive (A). Cells cultured in monolayer in control medium remained negative (B) as did cells in adipogenic or osteogenic media (figures not shown). 0.025 for both genes). Expression of SOX9 and AGC1 in Although we did find expression of osteogenic markers chondrogenic medium compared to osteogenic and adi- RUNX2, osterix, and osteocalcin, culture of tendon- pogenic medium was not significantly different (Figure derived fibroblasts in osteogenic medium did not induce 5). statistically significant upregulation of any of these genes. Similar results were found by QPCR of these markers in BMSC cultures also showed a significantly higher expres- BMSCs cultured in osteogenic medium (Figure 7). In the sion of COL2A1 and COL10A1 in chondrogenic medium tendon-derived fibroblast cultures SP7 and RUNX2 (both compared to osteogenic medium (p = 0.014 for both also known to play an important role in chondrogenic dif- genes) and adipogenic medium (p = 0.028 for COL2A1 ferentiation and hypertrophic cartilage formation [26]) and p = 0.009 for COL10A1). SOX9 expression in BMSCs were significantly upregulated in the chondrogenic showed the same trend as in the tendon-derived fibroblast medium compared to the osteogenic (p = 0.025 for both cultures, but the differences only reached significance in genes) and adipogenic medium (p = 0.025 for both the BMSC cultures (osteogenic versus adipogenic medium genes)(Figure 7). BMSCs also showed an upregulation of p = 0.014 and osteogenic versus chondrogenic medium p SP7 and RUNX2 in the chondrogenic medium. RUNX2 = 0.014). Expression of AGC1 in the BMSCs did not differ upregulation was significant (p = 0.016 for the difference significantly between the three medium conditions. Inter- in gene expression of RUNX2 between adipogenic and estingly, BMSCs cultured in osteogenic medium had sig- chondrogenic medium in BMCSs), but SP7 upregulation nificantly upregulated COL10A1 compared to the in chondrogenic medium did not reach significance (Fig- adipogenic condition (p = 0.027). This phenomenon was ure 7). In summary, chondrogenic medium not only stim- not seen in the tendon-derived fibroblasts (Figure 5). ulated expression of chondrogenic marker COL2A1, but also of COL10A1, RUNX2, and SP7. Osteogenic markers Von Kossa staining of tendon-derived fibroblasts in the Discussion osteogenic condition showed clustered areas of calcium This in-vitro differentiation study suggests that a propor- deposition, whereas the tendon-derived fibroblast cul- tion of the cell population explanted from adolescent tures in control medium had no calcium deposition (Fig- human tendon tissue may have adipogenic and chondro- ure 6). Also, tendon-derived fibroblast cultures in genic differentiation potential. In adipogenic medium adipogenic and chondrogenic medium remained negative lipid vacuoles were visible and tendon-derived fibroblasts for calcium (results not shown). Similarly, in BMSC cul- showed upregulation of FABP4 and PPARG. In chondro- tures, calcium deposition was found only in the osteo- genic medium, positive collagen 2 staining was visible genic condition (not shown). around some of the tendon-derived fibroblasts and the Page 7 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 (B Figure 5 Expres MSC) sion levels of chondrogenic markers in tendon-derived fibroblasts (TDF) and bone marrow-derived stromal cells Expression levels of chondrogenic markers in tendon-derived fibroblasts (TDF) and bone marrow-derived stromal cells (BMSC). SOX9 (A), aggrecan (AGC1)(B), collagen 2 (COL2A1)(C) and collagen 10 (COL10A1)(D). See figure 3 for reminder of key. tendon-derived fibroblasts showed upregulation of To our knowledge, this is the first study evaluating the COL2A1 and COL10A1. In osteogenic medium Von intrinsic differentiation potential of human tendon cells Kossa staining showed calcium deposition, although oste- in vitro. Previously, Salingcarnboriboon et al [27] estab- ogenic markers remained unaltered, as assessed by qPCR. lished three murine tendon cell lines by clonal expansion Compared to the BMSCs, the diffentiation capacity of our and showed that these single cell clones could differenti- tendon-derived fibroblasts was similar, although some ate towards multiple mesenchymal lineages upon culture differences were visible, mainly concerning the number of in appropriate differentiation media. Therefore, they sug- Oil Red O positive cells. gested that cells with mesenchymal stem-cell-like charac- Page 8 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 Von Kossa Figure 6 staining on tendon-derived fibroblasts cultured for 21 days in osteogenic (A) or control medium (B) Von Kossa staining on tendon-derived fibroblasts cultured for 21 days in osteogenic (A) or control medium (B). Calcium depo- sition was seen in osteogenic medium (A), not in control medium (B) or in adipogenic or chondrogenic media (figures not shown). teristics might exist in murine tendon tissue. Our Due to their spindle-shaped morphology in monolayer experiments cannot distinguish between individual cells culture and because all explanted cells stained D7-FIB with multilineage potential and a cell population contain- positive in passage one through passage four, we identi- ing more or less strongly committed cells. We did find that fied these cells as tendon-derived fibroblasts. Based on the not all of the tendon-derived fibroblasts appeared to be results of the Ki-67 staining, it could be surmised that this capable of differentiating towards other lineages, e.g. not mixed population may be partly derived from the tendon all fibroblasts but merely clusters of fibroblasts created tissue and partly from the endotenon. It is possible that lipid vacuoles in adipogenic medium and only a small these cells were already preselected for during the explan- proportion of approximately 5% of the cells stained posi- tation procedure, based on cellular motility, chemotactic tive for collagen type 2. In addition to this observation, responses or plastic adherence characteristics. Within this only a subpopulation of 72.6 +/- 22.9 % of these tendon- culture population, mature tendon-derived fibroblasts derived fibroblasts stained positive for CD105 and this with transdifferentiation capacity or a specific subpopula- subpopulation might be responsible for the observed dif- tion of tendon-derived progenitor cells might exist. Sev- ferentiation potential. eral authors have found that pericytes isolated from Expres Figure 7 sion levels of osteogenic markers in tendon-derived fibroblasts (TDF) and bone marrow-derived stromal cells (BMSC) Expression levels of osteogenic markers in tendon-derived fibroblasts (TDF) and bone marrow-derived stromal cells (BMSC). RUNT-related transcription factor 2 (RUNX2) (A), SP7 (B), and BGLAP (C). See figure 3 for reminder of key. Page 9 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 different tissues can be induced to differentiate into vari- microruptures in tendinosis lesions [37], tendon cells ous connective tissue phenotypes [8]. It seems unlikely may experience an altered mechanical microenvironment, that the presence of vascular pericytes in tendon tissue, which in turn might influence chondrogenic, osteogenic, which might be another multipotent cell source in tendon or tenogenic differentiation [38]. tissue [28], can account for our findings. Not only is ten- don a poorly vascularized tissue, but also the tendon- Our findings demonstrate that an intrinsic differentiation derived fibroblasts remained negative for pericyte marker capacity is present in tendon tissue of adolescent individ- α-SMA through the first four passages. Furthermore, our uals. However, age plays an important role in the response explanted cell population was 98.5 +/- 0.7 % negative for of musculoskeletal tissues in response to environmental CD34 on FACS-analysis. It seems unlikely that the small changes. It has been demonstrated that adult but not juve- portion of 1.5% CD34-positive tendon-derived fibrob- nile cartilage has lost its ability to regenerate (cited by lasts accounts for the results of the immunohistochemical Hunter [39]) and BMSCs gradually loose their differentia- staining and the changes in gene expression pattern. tion potential as subjects grow older [40]. Therefore, the adolescent tendon samples used in this study might not A cell population with multilineage potential that might be representative of tendon tissue in adult tendinosis be present in tendon tissue, is likely involved in tendon lesions. Since tendon cell populations derived from adult repair. Such a population might also contribute to the and from late fetal equine tendons have demonstrated development of tendinosis, as this tendon disorder is similar levels of a weak progenitor cell ability [41], it associated with fatty degeneration, glycosaminoglycan might be justified to speculate that tendon-derived fibrob- accumulation, and calcifications. In addition to these lasts from older subjects may still have some differentia- internal multipotent cells other cells with multilineage tion capacity. However, this certainly needs further potential may arrive at the site of overuse or tendon dam- investigation. age through the vascular system and contribute to the development or repair of tendinosis: upregulation of A tendon-cell population with intrinsic differentiation VEGF was found in human achilles tendinosis lesions capacity might be used in vivo for repair of lesions and [29] and VEGF can act as a chemotactic stimulus for mes- might play a role in tendinosis. However, extrapolating enchymal cells [30]. In-vivo control of differentiation of results from in-vitro cultures to the in-vivo situation must cells with multilineage potential might prove useful in the be done with tremendous caution, particularly as the future for prevention of tendinosis lesions or induction of expansion-culture period prior to experimentation may in-situ repair of these lesions. have led to the loss of the original tendon fibroblast phe- notype (due to dedifferentiation): the latter being well The exact changes in the tendon microenvironment out- known in chondrocyte-cultures [42]. Whether cells in vivo side the cells that play a role in cellular differentiation are can be stimulated to display this differentiation potential still the subject of many investigations. First, the capabil- remains to be elucidated. ity of specific growth factors, cytokines, and other inflam- matory mediators to influence the cellular differentiation Conclusion process has been demonstrated. Changes in the concen- Obtaining insight in the cellular behaviour and pathogen- tration of various growth factors have also been found in esis in tendinosis is crucial in order to develop mecha- tendinosis lesions: for instance, a higher number of cells nism-based therapies. Our study suggests that adolescent expressing TGF-β2 and TGF-βRII (a TGF-β receptor) in tendon tissue has an intrinsic differentiation potential. chronic achilles tendinosis lesions [31] and increased This study conducted on human tenocytes corroborates expression of TGF-β1 in patellar tendinosis [32] have the findings that cells with mesenchymal stem-cell-like been reported. TGF-β molecules are also used in vitro to characteristics might exist in murine tendon tissue. Our induce chondrogenic differentiation of mesenchymal results support the hypothesis that altered tendon-cell dif- progenitor cells [21]. Second, changes in the degree of vas- ferentiation might play a role in the pathophysiology of cularization of the tissue, as reported in achilles tendino- tendinosis. sis lesions [33], might influence the tendon cell differentiation state in vivo. For instance, oxygen tension Abbreviations influences the redifferentiation potential of dedifferenti- AGC1 = aggrecan ated chondrocytes in vitro [34] and hypoxia not only pro- motes the differentiation of bone mesenchymal stem cells BGLAP = osteocalcin along a chondrocyte pathway [35], but can also promote the formation of an adipocyte-like phenotype with cyto- BMSC = bone marrow-derived stromal cell plasmic lipid inclusions in human MSCs [36]. Third, fol- lowing repetitive tendon overload and its resulting COL10A1 = collagen type 10, alpha 1 chain Page 10 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 COL2A1 = collagen type 2, alpha 1 chain the study, and helped to draft the manuscript. JANV was involved in the study design and conception and helped D7-FIB = 11-fibrau, fibroblast antibody to draft the manuscript. GJVMO was involved in the study design and conception, and helped to draft the manu- DMEM = Dulbecco's modified Eagle's medium script. All authors read and approved the manuscript. FABP4 = adipocyte fatty acid binding protein 4 Acknowledgements This research was supported by the Erasmus MC Translational Research Fund. The authors would like to thank the orthopedic surgeon Ad Diep- FACS = fluorescense activated cell sorter straten for providing the tendon tissue and Han van Neck and Aleko Chato- jev for their support and interest in this work. The antibody II-116B3 was FCS = fetal calf serum obtained from the Developmental Studies Hybridoma Bank, under contract N01-HD-6-2915 from the NICHD. HBN buffer = Hank's Balanced Salt Solution (HBSS; GIBCO, Breda, The Netherlands) + 0.5% (wt/vol) Bovine References Serum Albumin + 0.05% (wt/vol) sodium azide 1. Paavola M, Kannus P, Jarvinen TA, Khan K, Jozsa L, Jarvinen M: Achil- les tendinopathy. J Bone Joint Surg Am 2002, 84-A:2062-2076. 2. Maffulli N, Kader D: Tendinopathy of tendo achillis. J Bone Joint IHC = immunohistochemistry Surg Br 2002, 84:1-8. 3. Movin T, Gad A, Reinholt FP, Rolf C: Tendon pathology in long- standing achillodynia. Biopsy findings in 40 patients. Acta Ki-67 = a protein strictly associated with cell proliferation Orthop Scand 1997, 68:170-175. 4. Tallon C, Maffulli N, Ewen SW: Ruptured Achilles tendons are significantly more degenerated than tendinopathic tendons. MEC = medical ethical committee Med Sci Sports Exerc 2001, 33:1983-1990. 5. Jarvinen M, Jozsa L, Kannus P, Jarvinen TL, Kvist M, Leadbetter W: SOX9 = SRY-box 9 Histopathological findings in chronic tendon disorders. Scand J Med Sci Sports 1997, 7:86-95. 6. Caplan AI, Bruder SP: Mesenchymal stem cells: building blocks PPARG = peroxisome proliferative activated receptor for molecular medicine in the 21st century. Trends Mol Med 2001, 7:259-264. gamma 7. Roufosse CA, Direkze NC, Otto WR, Wright NA: Circulating mesenchymal stem cells. Int J Biochem Cell Biol 2004, 36:585-597. QPCR = quantitative polymerase chain reaction 8. Muschler GF, Midura RJ: Connective tissue progenitors: practi- cal concepts for clinical applications. Clin Orthop Relat Res 2002:66-80. RT-PCR = reverse transcriptase polymerase chain reaction 9. Gregory CA, Prockop DJ, Spees JL: Non-hematopoietic bone marrow stem cells: molecular control of expansion and dif- ferentiation. Exp Cell Res 2005, 306:330-335. RUNX2 = RUNT-related transcription factor 2 10. Morasso MI, Tomic-Canic M: Epidermal stem cells: the cradle of epidermal determination, differentiation and wound healing. Biol Cell 2005, 97:173-183. SP7 = Sp7 transcription factor/osterix 11. Nakahara H, Dennis JE, Bruder SP, Haynesworth SE, Lennon DP, Cap- lan AI: In vitro differentiation of bone and hypertrophic carti- TDF = tendon-derived fibroblast lage from periosteal-derived cells. Exp Cell Res 1991, 195:492-503. 12. Nakahara H, Goldberg VM, Caplan AI: Culture-expanded human α-SMA = alpha smooth muscle actin periosteal-derived cells exhibit osteochondral potential in vivo. J Orthop Res 1991, 9:465-476. 13. Bosch P, Musgrave DS, Lee JY, Cummins J, Shuler T, Ghivizzani TC, Competing interests Evans T, Robbins TD, Huard: Osteoprogenitor cells within skel- The author(s) declare that they have no competing inter- etal muscle. J Orthop Res 2000, 18:933-944. 14. Seale P, Rudnicki MA: A new look at the origin, function, and ests. "stem-cell" status of muscle satellite cells. Dev Biol 2000, 218:115-124. Authors' contributions 15. Rodriguez AM, Elabd C, Amri EZ, Ailhaud G, Dani C: The human adipose tissue is a source of multipotent stem cells. Biochimie MM performed the study, performed the statistical analy- 2005, 87:125-128. sis, and drafted the manuscript. JLK participated in the 16. Kahn AJ, Simmons DJ: Chondrocyte-to-osteocyte transforma- tion in grafts of perichondrium-free epiphyseal cartilage. Clin design of the study and in the culture work. HJ designed Orthop Relat Res 1977:299-304. primers and probes, helped with the molecular biology, 17. Barbero A, Ploegert S, Heberer M, Martin I: Plasticity of clonal and helped to draft the manuscript. MMAV: performed populations of dedifferentiated adult human articular chondrocytes. Arthritis Rheum 2003, 48:1315-1325. the FACS analysis. MPH was involved in the study design 18. Caterson EJ, Nesti LJ, Danielson KG, Tuan RS: Human marrow- and conception and helped to draft the manuscript. NK derived mesenchymal progenitor cells: isolation, culture participated in the culture work and immunohistological expansion, and analysis of differentiation. Mol Biotechnol 2002, 20:245-256. staining. JPTML participated in the design of the study and 19. van Osch GJ, van der Veen SW, Marijnissen WJ, Verhaar JA: Mono- helped to draft the manuscript. HW was involved in the clonal antibody 11-fibrau: a useful marker to characterize chondrocyte differentiation stage. Biochem Biophys Res Commun study design and conception, participated in the design of 2001, 280:806-812. Page 11 of 12 (page number not for citation purposes) BMC Musculoskeletal Disorders 2007, 8:16 http://www.biomedcentral.com/1471-2474/8/16 20. Shi S, Gronthos S: Perivascular niche of postnatal mesenchy- mesenchymal stem cells. In 52nd Annual Meeting Orthopaedic mal stem cells in human bone marrow and dental pulp. J Bone Research Society 2006; Chicago; 2006. Miner Res 2003, 18:696-704. 42. Mandl EW, Jahr H, Koevoet JL, van Leeuwen JP, Weinans H, Verhaar 21. Tuli R, Tuli S, Nandi S, Wang ML, Alexander PG, Haleem-Smith H, JA, van Osch GJ: Fibroblast growth factor-2 in serum-free Hozack WJ, Manner PA, Danielson KG, Tuan RS: Characterization medium is a potent mitogen and reduces dedifferentiation of of multipotential mesenchymal progenitor cells derived human ear chondrocytes in monolayer culture. Matrix Biol from human trabecular bone. Stem Cells 2003, 21:681-693. 2004, 23:231-241. 22. Zocchi MR, Poggi A: PECAM-1, apoptosis and CD34+ precur- sors. Leuk Lymphoma 2004, 45:2205-2213. Pre-publication history 23. Middleton J, Americh L, Gayon R, Julien D, Mansat M, Mansat P, The pre-publication history for this paper can be accessed Anract P, Cantagrel A, Cattan P, Reimund JM, Aguilar L, Amalric F, Girard JP: A comparative study of endothelial cell markers here: expressed in chronically inflamed human tissues: MECA-79, Duffy antigen receptor for chemokines, von Willebrand fac- tor, CD31, CD34, CD105 and CD146. J Pathol 2005, http://www.biomedcentral.com/1471-2474/8/16/prepub 206:260-268. 24. Howson KM, Aplin AC, Gelati M, Alessandri G, Parati EA, Nicosia RF: The postnatal rat aorta contains pericyte progenitor cells that form spheroidal colonies in suspension culture. Am J Phys- iol Cell Physiol 2005, 289:C1396-407. 25. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25:402-408. 26. Wang Y, Belflower RM, Dong YF, Schwarz EM, O'Keefe RJ, Drissi H: Runx1/AML1/Cbfa2 mediates onset of mesenchymal cell dif- ferentiation toward chondrogenesis. J Bone Miner Res 2005, 20:1624-1636. 27. Salingcarnboriboon R, Yoshitake H, Tsuji K, Obinata M, Amagasa T, Nifuji A, Noda M: Establishment of tendon-derived cell lines exhibiting pluripotent mesenchymal stem cell-like property. Exp Cell Res 2003, 287:289-300. 28. Katenkamp D, Stiller D, Schulze E: Ultrastructural cytology of regenerating tendon--an experimental study. Exp Pathol (Jena) 1976, 12:25-37. 29. Alfredson H, Lorentzon M, Backman S, Backman A, Lerner UH: cDNA-arrays and real-time quantitative PCR techniques in the investigation of chronic Achilles tendinosis. J Orthop Res 2003, 21:970-975. 30. Fiedler J, Leucht F, Waltenberger J, Dehio C, Brenner RE: VEGF-A and PlGF-1 stimulate chemotactic migration of human mes- enchymal progenitor cells. Biochem Biophys Res Commun 2005, 334:561-568. 31. Fenwick SA, Curry V, Harrall RL, Hazleman BL, Hackney R, Riley GP: Expression of transforming growth factor-beta isoforms and their receptors in chronic tendinosis. J Anat 2001, 199:231-240. 32. Fu SC, Wang W, Pau HM, Wong YP, Chan KM, Rolf CG: Increased expression of transforming growth factor-beta1 in patellar tendinosis. Clin Orthop Relat Res 2002:174-183. 33. Pufe T, Petersen WJ, Mentlein R, Tillmann BN: The role of vascu- lature and angiogenesis for the pathogenesis of degenerative tendons disease. Scand J Med Sci Sports 2005, 15:211-222. 34. Murphy CL, Polak JM: Control of human articular chondrocyte differentiation by reduced oxygen tension. J Cell Physiol 2004, 199:451-459. 35. Robins JC, Akeno N, Mukherjee A, Dalal RR, Aronow BJ, Koopman P, Clemens TL: Hypoxia induces chondrocyte-specific gene expression in mesenchymal cells in association with tran- scriptional activation of Sox9. Bone 2005, 37:313-322. 36. Fink T, Abildtrup L, Fogd K, Abdallah BM, Kassem M, Ebbesen P, Zachar V: Induction of adipocyte-like phenotype in human mesenchymal stem cells by hypoxia. Stem Cells 2004, Publish with Bio Med Central and every 22:1346-1355. scientist can read your work free of charge 37. Wang JH, Iosifidis MI, Fu FH: Biomechanical basis for tendinop- athy. Clin Orthop Relat Res 2006, 443:320-332. "BioMed Central will be the most significant development for 38. Forslund C, Aspenberg P: CDMP-2 induces bone or tendon-like disseminating the results of biomedical researc h in our lifetime." tissue depending on mechanical stimulation. J Orthop Res 2002, Sir Paul Nurse, Cancer Research UK 20:1170-1174. 39. Hunter W: Of the structure and disease of articulating carti- Your research papers will be: lages. 1743. Clin Orthop Relat Res 1995:3-6. available free of charge to the entire biomedical community 40. Muraglia A, Cancedda R, Quarto R: Clonal mesenchymal progen- itors from human bone marrow differentiate in vitro accord- peer reviewed and published immediately upon acceptance ing to a hierarchical model. J Cell Sci 2000, 113 ( Pt cited in PubMed and archived on PubMed Central 7):1161-1166. 41. Strassburg S, Goodship A, Hardingham T, Clegg P: Adult and late yours — you keep the copyright fetal equine tendons contain cell populations with weak pro- BioMedcentral genitor properties in comparison to bone marrow derived Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp Page 12 of 12 (page number not for citation purposes)

Journal

BMC Musculoskeletal Disorders – Springer Journals

Published: Feb 23, 2007

There are no references for this article.