Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Lapatinib sensitivity in nasopharyngeal carcinoma is modulated by SIRT2-mediated FOXO3 deacetylation

Lapatinib sensitivity in nasopharyngeal carcinoma is modulated by SIRT2-mediated FOXO3 deacetylation Background: Chemoresistance is an obstacle to the successful treatment of nasopharyngeal carcinoma (NPC). Lapatinib is a targeted tyrosine kinase inhibitor therapeutic drug also used to treat NPC, but high doses are often required to achieve a result. To investigate the mechanism for the development of Lapatinib resistance, we characterised a number of NPC cell lines to determine the role of FOXO3 and sirtuins in regulating NPC resistance. Methods: Sulforhodamine B (SRB) assays, Clonogenic assays, Protein extraction, quantification and western blotting, RT qPCR, Co-immunoprecipitation assay. Results: To explore novel treatment strategies, we first characterized the Lapatinib-sensitivity of a panel of NPC cell lines by SRB and clonogenic cytotoxic assays and found that the metastatic NPC (C666–1 and 5-8F) cells are highly resistant whereas the poorly metastatic lines (6-10B, TW01 and HK-1) are sensitive to Lapatinib. Western blot analysis of the Lapatinib-sensitive 6-10B and resistant 5-8F NPC cells showed that the expression of phosphorylated/inactive FOXO3 (P-FOXO3;T32), its target FOXM1 and its regulator SIRT2 correlate negatively with Lapatinib response and sensitivity, suggesting that SIRT2 mediates FOXO3 deacetylation to promote Lapatinib resistance. In agreement, −/− clonogenic cytotoxic assays using wild-type and foxo1/3/4 mouse embryonic fibroblasts (MEFs) showed that FOXO1/3/4-deletion significantly attenuates Lapatinib-induced cytotoxicity, confirming that FOXO proteins are essential for mediating Lapatinib response. SRB cell viability assays using chemical SIRT inhibitors (i.e. sirtinol, Ex527, AGK2 and AK1) revealed that all SIRT inhibitors can reduce NPC cell viability, but only the SIRT2-specific inhibitors AK1 and AGK2 further enhance the Lapatinib cytotoxicity. Consistently, clonogenic assays demonstrated that the SIRT2 inhibitors AK1 and AGK2 as well as SIRT2-knockdown increase Lapatinib cytotoxicity further in both the sensitive and resistant NPC cells. Co-immunoprecipitation studies showed that besides Lapatinib treatment, SIRT2- pharmaceutical inhibition and silencing also led to an increase in FOXO3 acetylation. Importantly, SIRT2 inhibition and depletion further enhanced Lapatinib-mediated FOXO3-acetylation in NPC cells. Conclusion: Collectively, our results suggest the involvement of SIRT2-mediated FOXO3 deacetylation in Lapatinib response and sensitivity, and that SIRT2 can specifically antagonise the cytotoxicity of Lapatinib through mediating FOXO3 deacetylation in both sensitive and resistant NPC cells. The present findings also propose that SIRT2 can be an important biomarker for metastatic and Lapatinib resistant NPC and that targeting the SIRT2-FOXO3 axis may provide novel strategies for treating NPC and for overcoming chemoresistance. Keywords: Nasopharyngeal carcinoma, Sirtuin, FOXO3, Chemoresistance, Lapatinib, Acetylation * Correspondence: eric.lam@imperial.ac.uk Sathid Aimjongjun and Zimam Mahmud are contributed equally and should be recognised as co-first authors. Department of Surgery and Cancer, Imperial College London, Hammersmith Hospital Campus, London W12 0NN, UK Full list of author information is available at the end of the article © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 2 of 17 Background promote or inhibit the transcription of target genes Nasopharyngeal carcinoma (NPC) is a malignancy of [14]. Furthermore, FOXO3 has also be shown to be head and neck epithelial cells that originates from regulated by post-translational modifications, such the nasopharyngeal cavity. NPC is an important as phosphorylation, methylation, ubiquitination, gly- health problem in Southern China and Southeast cosylation and acetylation. The reversible acetyl- Asia [1], with about 86,500 NPC new cases recorded ation/deacetylation of FOXO3 is regulated by class I annually, and over 40,000 die from the disease every histone deacetylases (HDACs) as well as class III year in Asia alone [2]. The most common treatment HDACs named sirtuins (SIRT 1–7) and histone for NPC is the combination of radiotherapy and acetyl transferases (HATs e.g. p300/CBP) [15]. The chemotherapy. Radiotherapy is a mainstay for treat- function of SIRT proteins is to reverse the acetyl- ment for early NPC, while chemotherapy is fre- ation of FOXO3 to induce the cell cycle arrest, pro- quently used for the advanced locoregionally NPC. It tection from oxidative stress and to repress the has been shown that the combination of chemother- expression of apoptotic genes [16]. In NPC cells, apy and radiation enhances the survival rates [3]. FOXM1 is overexpressed and it is associated with However, advanced NPCs usually fail to respond to cancer metastasis and chemoresistance [17, 18]. In chemotherapy treatment because of the development NPC patients, low FOXO3 and high HIF-1 expres- of drug resistance that leads to metastasis and re- sion has been found to be correlated with poor lapse, resulting in poor prognosis [4]. In conse- prognosis in NPC [19]. However, the role and regu- quence, there is an urgent need for the identification lation of FOXO3 and FOXM1 in NPC have not of novel therapeutic strategies as well as the mecha- been not fully investigated. nisms of chemotherapeutic resistance for NPC. To In this study, we investigated the mechanism of action date, the mechanisms for the development of resist- of a dual tyrosine kinase inhibitor Lapatinib using high ance to conventional therapeutics, such as cisplatin and low metastatic NPC cells and found that the deace- (CDDP), paclitaxel (PTX), 5-fluorouracil (5-FU), and tylation of FOXO3 by SIRT2 plays an important role in vincristine (VCR), for NPC have been extensively the regulation of Lapatinib response and resistance in studied [5–8]. These include overexpression of NPCs. multidrug-resistant genes, enhanced DNA repair, de- regulation of apoptosis, and/or modifications of drug Methods targets [5–8]. Cell culture Both the epidermal growth factor receptor (EGFR) The NPC cell line TW01 is an established cell line and HER2 (human epidermal growth factor receptor derived from moderately differentiated keratinising 2; ERRB2) are commonly overexpressed in NPC [9, NPC tissues, and was kindly provided by Prof. Chin- 10]. Moreover, activation of EGFR/HER2 pathway Tarng Lin, National Taiwan University, Taipei [20]. has also been shown to promote NPC progression TW01 cells were cultured with DMEM supple- and invasion [11]. Previous studies have demon- mented with 10% v/v foetal bovine serum (FBS), 100 strated that the dual EGFR/HER2 tyrosine kinase in- U/mL penicillin, and 100 μg/mL streptomycin. Poorly hibitor, Lapatinib, can restrict cell proliferation and differentiated human NPC cell lines SUNE 5–8F invasion, and promote anoikis in NPC cells [12, 13]. (highly tumorigenic and metastatic) and 6-10B Despite its promising efficacy, Lapatinib has a half (highly tumorigenic, but poorly metastatic) derived maximal inhibitory concentration (IC )inthe mi- from the parental line SUNE-1, were obtained from cromolar range in most cell lines [13], and strategies the Prof. Qingling Zhang, Southern Medical Univer- to sensitize NPC to Lapatinib are currently under sity, Guangzhou China [21, 22]. HK1, a well- investigation. differentiated squamous carcinoma line was obtained FOXO3 and FOXM1 are members of the forkhead from the Queen Elizabeth Hospital, University of box transcription factor family which play opposite Hong Kong [23]. C666–1 is an undifferentiated NPC roles in tumorigenesis, drug resistance and cancer cell line obtained from Prof. Maria L. Lung, Center progression. FOXO3 is a key tumour suppressor for Nasopharyngeal Carcinoma Research, University which functions downstream of the PI3K/AKT (pro- of Hong Kong [24]. These last four NPC cell lines tein kinase B) signalling pathway. Conversely, were cultured in RPMI supplemented with 10% FBS, FOXM1 is an important oncogene that promotes 100 U/mL penicillin, and 100 μg/mL streptomycin. cell transformation, cancer progression and resist- All NPC cells were maintained in a humidified incu- ance to chemotherapy. In addition, FOXM1 and bator with 10% CO at 37 °C. Wild type mouse em- FOXO3 negatively regulate the expression of one bryonic fibroblasts (MEFs) and triple knock-out −/− another and compete for same binding sites to foxo1/3/4 MEFs were kind gifts from Prof. Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 3 of 17 Boudewijn Burgering, UMC, Utrecht, the and the absorbance was measured at 592 nm using Netherlands, and have been described previously Tecan Microplate reader. [25]. MEF cells were cultured in Dulbecco’s modified eagle’s medium (DMEM) (Sigma Aldrich, Poole, UK) Western blotting and antibodies and supplemented with 10% (v/v) foetal calf serum Western blotting was performed with whole cell ex- (FCS)(FirstLinkLtd., Birmingham,UK),100 Unit/ tracts prepared by lysing cells with NP40 lysis buffer ml penicillin/streptomycin(Sigma-Aldrich, UK)and [1% NP40, 100 mmol/L NaCl, 20 mmol/L Tris-HCl 2 mM glutamine and maintained at 37 °C in a hu- (pH 7.4), 10 mmol/L NaF, 1 mmol/L Na orthovana- midified atmosphere containing 10% CO . All cell date, 30 mmol/L Na β-glycerophosphate, and prote- lines were subjected to DNA fingerprinting analysis ase inhibitors (“Complete” protease inhibitor using the AmpF/STR Identifiler PCR Amplification mixture, as instructed by the manufacturer, Roche Kit (Applied Biosystems, Foster City, USA) and are Applied Science)] on ice for 15 min. After incuba- free from mycoplasma contamination. tion, the lysates were centrifuged at 13,000×g for 10 min, and the supernatant was collected. Protein siRNA mediated gene knockdown concentrations were determined using a BCA pro- For gene knockdown, cells were plated in at 60–70% tein assay kit (ThermoFisher Scientific, Waltham, confluency. The following day, cells were transfected MA, USA). Ten micrograms of protein were size with ON-TARGET plus siRNA smart pools (GE fractionated using SDS-PAGE and electro- − 004826 Dharmacon) targeting SIRT2 (L -00-0005) using transferred onto nitrocellulose membranes (BioRad, oligofectamine (Invitrogen, UK) according to the San Diego, CA, USA). Membranes were blocked in manufacturer’s protocol. Non-Targeting siRNA pool 5% (w/v) bovine serum albumin (BSA) in TBS plus (GE Dharmacon; D-001210-01-05) was used as trans- 0.5% (v/v) Tween for 1 h at room temperature and fection control. then incubated with specific antibodies overnight at 4 °C. The antibodies against EGFR, P-EGFR, ERBB2, P-ERBB2, ERBB3, P-ERBB3, JNK, P-JNK, p38, P-p38, Sulforhodamine B colorimetric assay Kip1 c-Myc, p27 , P-FOXO3 (T32), FOXO3, cyclin B1, A total of 1000 NPC cells per well were seeded in a 96- P-AKT (S473), AKT and β-Tubulin were purchased wells plate. One day after seeding, NPC cells were from Cell Signalling Technology (New England Bio- treated with increasing concentrations of Lapatinib for labs Ltd., Hitchin, UK). The antibody against 24 and 48 h. The cells were fixed with 40% − 20 FOXM1 (C ) was purchased from Santa Cruz Bio- trichloroacetic acid at 4 °C for 1 h, washed 3 times with technology (Santa Cruz, CA, USA). Primary anti- PBS and stained with 0.4% (w/v) sulforhodamine B bodies were detected using horseradish peroxidase- (SRB) solution at room temperature for 1 h. Following linked anti-mouse or anti-rabbit conjugates (Dako, the staining, the cells were washed 5 times with 1% Glostrup, Denmark) and visualized using the ECL acetic acid and air-dried overnight. The protein bound detection system (Perkin Elmer, Beaconsfield, UK). dye was dissolved in 10 mM Tris base solution and the absorbance was measured at 492 nm using a microplate reader (Sunrise, Tecan; Männedorf, Switzerland). Co-Immunoprecipitation assay NPC cell lysates were prepared in IP buffer (1% − 40 Clonogenic assay Nonidet P , 150 mM NaCl, 50 mM Tris-HCl [pH A total of 2000–10,000 cells were seeded into 6-well 7.4], 10 mM NaF, 1 mM Na VO ,10mMN-ethyl- 3 4 plates and incubated overnight. The cells were then amide (NEM) and protease inhibitors [Complete pro- treated for 72 h with varying concentrations of tease inhibitor cocktail; Roche, Lewes, UK]). The Lapatinib and SIRT inhibitor (SIRT-i). DMSO pre-cleared lysate was immunoprecipitated with the (Sigma-Aldrich,) was used as a vehicle and blank. indicated antibodies and with protein A/G-sepharose The drug was removed and surviving cells were left for 4 h. After that, the fractionated supernatant was to form colonies. After 1–2 weeks of incubation, transferred to the new tube. Samples and incubated colonies were fixed with 4% paraformaldehyde for overnight with 0.5 μg of primary antibody-FOXO3 15 min at room temperature and then washed with (sc-11,351, Santa Cruz) [1, 26], Anti-acetyl lysine PBS three times. Crystal violet (0.5% w/v) was used (Cell-Signalling technology) or IgG negative control to stain the fixed cells for 30 min, following which (2729, Cell-Signalling technology) (1500) at 4 °C on a the plates were washed with tap water. Plates were rotator. The supernatant was discarded on the fol- then left to dry overnight. Quantification was lowing day and beads were washed three times with achieved by solubilising dye with 33% acetic acid PBS. Samples were boiled with 2 × SDS sample buffer Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 4 of 17 for 5 min at 100 °C and were analysed by SDS-PAGE Results followed by western blotting. Effects of Lapatinib on cell viability of different nasopharyngeal carcinoma (NPC) cell lines In order to identify the cellular mechanisms which Gene expression analysis by RT-qPCR modulate Lapatinib sensitivity, we first analysed its effect Total mRNA was extracted from cell pellets using the on the proliferation of NPC cell lines with distinct meta- RNeasy Mini Kit (Qiagen, UK) according to manufac- static status. To this end, two highly metastatic (C666–1 turer’s instructions. The purity and concentration of and 5-8F) and three poorly metastatic (6-10B, TW01 mRNA samples were determined by measuring the spec- and HK-1) NPC cell lines were treated with increasing trophotometric absorption at 260 nm and 280 nm using concentrations of Lapatinib (from 0 μMto20 μM) for a NanoDrop ND-1000. Then, 2 μg of the extracted total 48 h and their viability measured by the sulforhodamine RNA was used as a template for first strand cDNA syn- B (SRB) assay. The results showed that Lapatinib caused thesis reaction, The resulting first-strand cDNA was a dose-dependent reduction of cell proliferation in all then used as template in the real-time PCR. Real time NPC cells. The results also indicated that there were sig- quantitative PCR (RT-qPCR) was performed on 100 ng nificant differences in Lapatinib sensitivity between the of cDNA with SYBER-Green Master Mix (Applied Bio- NPC cell lines at 48 h (Fig. 1a) (2-way ANOVA, ****P < Systems). All RT-qPCR assays were assayed in 96-well 0.0001). Moreover, the highly metastatic (C666–1 and 5- plates in the ABI PRISM® 7900 HT Fast Real-time PCR 8F) lines were significantly more resistant to Lapatinib System (Applied BioSystems) on a cycling program of than the three poorly metastatic lines (6-10B, TW01 and 90 °C for 10 min for enzyme activation followed by 40 HK-1) (Fig. 1b). These results were further confirmed by cycles of denaturation and primer annealing/extension clonogenic assays, in which the surviving cells were consisting of 95 °C for 3 s and 60 °C for 30s respectively. allowed to further proliferate and form clones. The The nonregulated ribosomal housekeeping gene, RPL19 highly metastatic C666–1 and 5-8F lines were also sig- was used as an internal control to normalize gene ex- nificantly more resistant to Lapatinib than the three pression between samples. All samples were done in poorly metastatic lines (6-10B, TW01 and HK-1) in lon- triplicates. Primer sequences used for RT-qPCR are, ger term assays (Fig. 1c, d). RPL19-F: 5’GGTGCTTCCGATTCCAGAGT3’, RPL19-R: 5’CCCATTCCCTGATCGCTTGA3’, Effects of Lapatinib on the expression and activity of Erbb2-F: 5’GCTCTTTGAGGACAAGTATG3’, proteins involved in EGFR/ERBB2 signalling in the SUNE Erbb2-R: 5’AAGATCTCTGTGAGACTTCG3’, 5-8F and 6-10B NPC cells Egfr-F: 5’CTGTCGCAAAGTTTGTAATG3’, In order to identify the potential mechanisms in- Egfr-R: 5’GAATTTCTAGTTCTCGTGGG3’, volved in modulating Lapatinib sensitivity, we ana- Foxo3-F: 5’CCGGACAAACGGCTCACT3’, lysed by Western blotting the effects of Lapatinib on Foxo3-R: 5’GGCACACAGCGCACCAT3’, the expression of molecules implicated in Lapatinib Foxo4-F:5’AGGACAAGGGTGACAGCAAC3’, signalling and sensitivity. To this end, the two NPC Foxo4-R: 5’GGTTCAGCATCCACCAAGAG3’, cell lines, SUNE 5-8F (highly metastatic) and 6-10B Foxo1-F: 5’AAGAGCGTGCCCTACTT-CAA3’, (poorly metastatic) with differential Lapatinib sensitiv- Foxo1-R: 5’TCCTTCA-TTCTGCACTCGAA 3′. ity (low and high, respectively) were treated with 5 μM Lapatinib for 0 to 48 h (Fig. 2). Western blot results showed a reduction in P-ERBB1 and P-ERBB2 Statistical data analysis upon Lapatinib treatment (Fig. 2), indicating the drug The results were represented as the means ± SEM of at is effective in inhibiting ERBB1/ERBB2 activity in least 3 separate experiments. For categorical variables, both NPC lines. Notably, both total ERBB1 and we used the analysis of variance (ANOVA) which was ERBB2, but not ERBB3, were expressed at high levels followed by a Bonferroni’s post-hoc test for multiple in both NPC lines and their expression remained at comparisons. Student’s t test was used to analyse the high levels after Lapatinib treatment. FOXO3 has pre- statistical significance of differences between the control viously been shown to mediate the cytotoxic function groups and the experimental groups. The differences of Lapatinib through repressing FOXM1 expression. were considered as significant at p < 0.05. The GraphPad The p38 and Jun N-terminal kinase (JNK) MAPKs Prism 5.0 software (version 5.00 for Windows, GraphPad have also been demonstrated to phosphorylate and Software; San Diego, California, USA) was used for the activate FOXO3 in response to Lapatinib, while AKT statistical analyses. ImageJ software was used to analyse has been reported to be repressed by Lapatinib, lead- and compare the intensity of the protein bands obtained ing to FOXO3 dephosphorylation (T32) and derepres- from Western blots. sion. In agreement, western blot analysis showed that Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 5 of 17 Fig. 1 (See legend on next page.) Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 6 of 17 (See figure on previous page.) Fig. 1 Effects of Lapatinib on cell growth and proliferation of NPC cells. a Lapatinib sensitivity curves in NPC cells was determined by sulforhodamine B staining. Cells (3 × 10 / well) were seeded in 96-well plates and treated with increasing concentrations of Lapatinib for 72 h before SRB staining and measurement of optical density at 492 nm. b Best-fit curves were generated to determine IC for each NPC cell lines against Lapatinib. c NPC cells were seeded into 6-well plates (1 × 10 cells / well) and treated with Lapatinib for 72 h. Colony formation was monitored after 15 days, stained with crystal violet (representative images are shown) and absorbance at 592 nm determined (right panel). d Best- fit curves were generated to determine IC for each NPC cells against Lapatinib in terms of clonogenic assay. Numerical data represent the average ± SEM of three independent experiments (**** P < 0.0001) FOXO3 became dephoshorylated (T32) and activated another [27]. To verify the role of FOXO3 in mediat- upon Lapatinib treatment in the sensitive 6-10B, but ing the cytotoxic response of Lapatinib, the effects of remained phosphorylated (T32) and inactivated in the Lapatinib treatment were investigated in wild-type −/− resistant 5-8F cells. FOXO3 dephosphorylation was (WT) and foxo1/3/4 MEFs. Western blot and also correlated with downregulation of FOXM1 ex- RTq-PCR analyses confirmed the Foxo1/3/4 knockout −/− pression in 6-10B but not in 5-8F cells, further con- in the foxo1/3/4 MEFs and demonstrated EGFR/ firming the role of FOXO3 in mediating Lapatinib HER2 overexpression in both wild-type (WT) and −/− action. Interestingly, the induction of p38 and JNK foxo1/3/4 MEFs (Fig. 3a, b), implying that they are phosphorylation was not observed in the sensitive 6- potentially sensitive to Lapatinib inhibition. Clono- 10B cells upon Lapatinib treatment, suggesting p38 genic assays showed that both wild-type (WT) and −/− and JNK are unlikely to be instrumental in activating foxo1/3/4 MEFs are indeed sensitive to the anti- FOXO3 in response to Lapatinib. FOXO3 activity can proliferative functions of Lapatinib (Fig. 3c). Clono- also be enhanced by acetylation, which have been genic assays also revealed that foxo1/3/4-deficient shown to be promoted by EP300 and repressed by MEFs displayed higher self-renewal ability and was the nuclear sirtuins, SIRT1, −2and − 6. Western blot significantly less sensitive to the antiproliferative ef- analysis showed EP300 was at low levels in the resist- fects of Lapatinib compared with the WT MEFs (2- ant, metastatic 5-8F cells but was induced upon Lapa- way ANOVA, ****P < 0.0001) (Fig. 3cand d),confirm- tinib treatment, whereas EP300 was expressed at high ing the key role of FOXOs in mediating the cytotoxic levels in 6-10B and was downregulated in response to functions of Lapatinib. Lapatinib. The results also showed SIRT1 and − 6 were expressed at comparable levels in both 5-8F and The clonogenic survival of NPC cells is sensitive to 6-10B cells, and their expression was not substantially chemical inhibitors of SIRTs affected by Lapatinib treatment. The observed expres- The anti-proliferative activity of FOXO3 is promoted by sion patterns of EP300, SIRT1 and SIRT6 suggested acetylation which can be attenuated by nuclear SIRTs. that they are unlikely to be responsible for FOXO3 In order to investigate if the viability of the NPC cells activation by Lapatinib, even though EP300, SIRT1 are also modulated by SIRTs, we subjected both the and SIRT6 could still modulate FOXO3 acetylation Lapatinib resistant 5-8F and sensitive 6-10B NPC cells and activity in these NPC cells. By contrast, upon to treatment with the SIRT1-specific (ie. EX527), SIRT2- Lapatinib treatment the expression levels of SIRT2 specific (ie. AK1 and AGK2) and pan-SIRT (ie. Sirtinol) remained constitutively high in the resistant 5-8F inhibitors individually for 72 h and their subsequent cells, but were downregulated by Lapatinib in the sen- long-term survival examined by clonogenic assays (Fig. 4a sitive 6-10B cells, suggesting that SIRT2 can poten- and b). The results showed that all four SIRT-inhibitors tially mediate Lapatinib response through modulating decreased the clonogenic survival of both NPC cell lines, FOXO3 acetylation and activity in these NPC cells. with EX527, AK1 and AGK2 being more effective com- These results suggest that highly metastatic and EBV pared to Sirtinol, suggesting that the activity of SIRT1 (Epstein Barr virus)-positive cell lines are more resist- and − 2 might have a role in modulating the long-term ant to Lapatinib, probably due to their high levels of viability of NPC cells. FOXM1 and P-FOXO3 expression, suggesting that SIRT2 induces Lapatinib resistance through FOXO3 SIRT2 inhibitors AK1 and AGK2 function cooperatively acetylation and activity, which in turn led to reduc- with Lapatinib in NPC cells tion in FOXO3 activity. Next, we tested if the SIRT inhibitors can act co- operatively with Lapatinib and enhance its antiprolif- FOXOs mediate the cytotoxic function of Lapatinib erative functions. To this end, the resistant 5-8F and FOXO proteins have previously been shown to be sensitive 6-10B NPC cells were cultured with sub- functionally redundant and can compensate for one optimal levels of SIRT inhibitors (Fig. 2)orvehicle Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 7 of 17 Lapatinib treatment alone (2 way-ANOVA, ****P < 0.0001). Similarly, EX527 increased the viability of the Lapatinib-treated 6-10B cells (2 way-ANOVA, **P = 0.0011) but had no significant effects on the viability of the Lapatinib-treated 5-8F cells (2 way-ANOVA, non-significant, P = 0.3667). By contrast, the SIRT2 inhibitor AGK2 demonstrated additive effects on the cytotoxicity of Lapatinib (2 way-ANOVA, ****P < 0.0001, respectively) in both the sensitive 6-10B (IC : 1.88 ± 0.26 to 5.94 ± 0.86 μM) and the resistant 5-8F (10.55 ± 1.52 to 1.88 ± 0.26 μM) NPC lines (Fig. 5b). Similarly, the SIRT2-inhibitor AK1 also functioned additively with Lapatinib in the 5-8F cells (2 way- ANOVA, *P = 0.0331, IC , 11.77 ± 2.43 to 2.88 ± 0.57 μM) but had no significant positive effects on Lapatinib in the sensitive 6-10F cells (2 way-ANOVA, non-significant P = 0.3667, IC , 5.80 ± 1.15 to = 6.50 ± 0.66 μM). AK1 did not demonstrate any additive ef- fects with Lapatinib in 6-10B cells, probably because of the predominant anti-proliferative function of Lapatinib in the Lapatinib-sensitive cells. Moreover, Lapatinib also functions to downregulate SIRT2 ex- pression in 6-10B, and therefore, AK1 might be re- dundant in inhibiting SIRT2 after the downregulation of SIRT2 in these cells by Lapatinib. However, overall the SIRT2 inhibitors AGK2 and AK1, but not the SIRT1 and pan-SIRT inhibitors, demonstrated additive antiproliferative effects on Lapatinib in SRB cell pro- liferative assays, suggesting that SIRT2 plays a specific role in limiting Lapatinib cytotoxicity and in promot- ing Lapatinib resistance in NPC cells. To ascertain further the role of SIRT2 in enhancing Lapatinib resistance in NPC cells, we performed clono- genic survival assays on the two NPC cell lines to study the long-term antiproliferative effects of the two SIRT2 inhibitors AGK2 and AK1 on Lapatinib (Fig. 6a). In clo- nogenic assays, both SIRT2-inhibitors displayed additive Fig. 2 Effects of Lapatinib on the expression and activity of proteins effects on Lapatinib in NPC cell lines (2 way-ANOVA, involved in EGFR/ERBB2 signalling pathways in high and low ****P < 0.0001, for all except **P < 0.0033 for AK1 in 6- metastasis NPC cell lines. The high 5-8F and low 6-10B metastatic NPC cells were treated with 5 μM Lapatinib for 0. 4, 8, 24, 48 h. 10B), further reducing the overall clonogenic survival of Protein lysates from whole-cell extracts were collected and then Lapatinib-treated cells (Fig. 6b). When combined with analysed by western blotting using the antibodies against ERBB1, P- Lapatinib, AGK2 showed additive effects on the anti- ERBB1, ERBB2, P-ERBB2, ERBB3, P-ERBB3, AKT, P-AKT, SIRT1, SIRT2, proliferative functions of Lapatinib in both the Lapatinib SIRT6, p300, JNK, P-JNK, p38, P-p38, FOXO3, P-FOXO3(T32), FOXM1, resistant 5-8F (IC : 2.31 ± 1.06 to 0.21 ± 0.07 μM) and and β-tubulin. Molecular markers are shown on the right panel of each blot. Representative results of three repeats are shown. Protein sensitive 6-10B (IC : 0.66 ± 0.08 to 0.21 ± 0.02 μM) NPC levels were determined by using ImageJ and the protein levels cells (Fig. 6c). The SIRT2-inhibitor AK1 also functioned relative to β-tubulin are shown below protein bands as ratios to the additively with Lapatinib in both the resistant 5-8F and 0 h Lapatinib controls (IC : 1.07 ± 0.15 to 0.28 ± 0.03 μM) and sensitive 6-10B (IC : 0.66 ± 0.10 to 0.28 ± 0.05 μM) cells (Fig. 6c). controls in the presence of increasing doses of Lapati- nib and their cell viability examined by SRB assays Silencing of SIRT2 enhances Lapatinib sensitivity of NPC (Fig. 5a). Surprisingly, combining the pan-SIRT inhibi- cells tor Sirtinol with Lapatinib significantly increased the To confirmfurther theroleofSIRT2 in promoting overall viability of both NPC cell lines compared to Lapatinib resistance, we next examined if siRNA- Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 8 of 17 Fig. 3 (See legend on next page.) Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 9 of 17 (See figure on previous page.) Fig. 3 FOXOs regulate Lapatinib sensitivity in mouse embryonic fibroblasts. a Western blot analysis was performed to analyse the protein levels −/− of P-EGFR, EGFR, P-ERBB2, ERBB2, FOXO3, FOXO1 in MEFs and Foxo1,3,4 MEFs. Representative western blot results are shown. Tubulin was used as a protein loading control. b The mRNA levels of EGFR, ERBB2, FOXO3, FOXO1 and FOXO4 were assessed by real-time qPCR. The RPL19 −/− housekeeping gene transcript was used as a control to normalise gene expression. c Wild-type (WT) MEFs and Foxo1,3,4 MEFs were treated with increasing concentrations of Lapatinib for 3 days and colony formation was observed for 1 week. Cells were then stained with crystal violet and absorbance measured at 592 nm (right panel). The colony formation capacity was analysed by two-way ANOVA and found to be significantly different (***p < 0.00001) from one another. d Best-fit curves were generated to determine IC for each cell line against Lapatinib in terms of clonogenicity. Numerical data represent the average ± SEM of three different experiments (**** P < 0.0001) Fig. 4 SIRT inhibitors limit long-term cell growth and colony formation capacity of high and low metastatic NPC cells. a 5-8F and 6-10B cells were seeded in 6-well plates and treated with the drug concentration indicated for 72 h. Then, cell culture media was removed and colony formation observed for 15 days. At the end of this time period, cells were fixed with 4% paraformaldehyde and stained with crystal violet. Representative pictures from triplicate experiments are shown. b The stain was solubilised with 33% acetic acid and absorbance at 592 nm were obtained. Best fit-curves were generated to determine the IC of each drug in 5-8F and 6-10B cells 50 Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 10 of 17 Fig. 5 NPC cells show increased Lapatinib sensitivity when combined with AGK2 or AK1 but not Sirtinol or Ex527. a Cells (3 × 10 / well) were seeded in 96-well plates and treated with increasing concentrations of Lapatinib for 48 h before staining and measurement of optical density at 492 nm. Data were analysed by generating curves using Graph-pad Prism. b Best-fit curves were generated to determine the effect of AGK2 or AK1 on reducing the IC of Lapatinib for each NPC cells. Data represent the average ± SEM of three different experiments (**** P < 0.0001) depletion of SIRT2 can enhance the antiproliferative cytotoxic and cytostatic functions of Lapatinib in effects of Lapatinib in the 5-8F and 6-10B NPC cells both the sensitive and resistant NPC cells, consistent using clonogenic assays. Knock-down of SIRT2 was with the findings from the SIRT2 pharmaceutical in- confirmed by western blotting analysis before the hibitors, AK1 and AGK2. Collectively, these results NPC cells were subjects to clonogenic assays demonstrated that selective inhibition of SIRT2 can (Fig. 7a). The results showed that despite the subtle promote Lapatinib sensitivity, indicating SIRT2 is a effects, depleting SIRT2 has additive effects on Lapa- potential target for overcoming Lapatinib resistance tinib when compared with the non-silencing siRNA in NPCs. controls in both the NPC cell lines (2 way-ANOVA, ****P < 0.0001, respectively) (Fig. 7b). Significantly, Inhibition and silencing of SIRT2 can combine with the SIRT2-siRNA enhanced the anti-proliferative Lapatinib to promote FOXO3 acetylation functions of Lapatinib in both the resistant 5-8F and To confirm that SIRT2 can modulate the ability of (IC : 4.64 ± 0.38 to 2.85 ± 0.41 μM) and sensitive 6- Lapatinib to mediate FOXO3 acetylation, we next 10B (IC : 1.12 ± 0.10 to 0.90 ± 0.10 μM) cells determined if chemical inhibition or silencing of (Fig. 7c). In consequence, the results suggest that SIRT2 can affect FOXO3 acetylation in the absence SIRT2 knockdown can significantly enhance the or presence of Lapatinib treatment using co- Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 11 of 17 Fig. 6 (See legend on next page.) Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 12 of 17 (See figure on previous page.) Fig. 6 Lapatinib in combination with AGK2/AK1 increase long term cell sensitivity compared to Lapatinib alone. a 5-8F and 6-10B cells were seeded in 6-well plates and treated with the Lapatinib concentration indicated for 72 h. Five micromolar AGK2 and AK1 was used for combination treatment. Cell culture media was then removed and colony formation observed for 15 days. At the end of this time period, cells were fixed with 4% paraformaldehyde and stained with crystal violet. Representative pictures from triplicate experiments are shown. b The stain was solubilised with 33% acetic acid and absorbance at 592 nm were obtained. Graphs were generated to show the effect of combination treatment. c Best fit-curves were generated to determine the effect of AGK2/AK1 on the IC of Lapatinib in 5-8F and 6-10B cells. immunoprecipitation (IP) assays (Fig. 8). Relative cell carcinoma [28]; however, not all patients benefit FOXO3 acetylation levels were then determined by from Lapatinib-based treatments [29, 30]. In the comparing the ratio of acetylated to total FOXO3 present study, we found that the highly metastatic co-precipitated. The computed results showed that (C666–1 and 5-8F) NPC lines are significantly more SIRT2-depletion by siRNA or -inhibition by AGK2 Lapatinib resistant compared to poorly metastatic can induce FOXO3 acetylation in both the Lapatinib lines (6-10B, TW01 and HK-1), suggesting that the resistant 5-8F and the sensitive 6-10B cell lines molecular mechanisms involved in metastasis in NPC (Fig. 8a and b). The chemical inhibitor AGK2 is may overlap with those responsible for the develop- more effective in inducing FOXO3 acetylation than ment of Lapatinib resistance. SIRT2 siRNA probably because it is more effective FOXO3 is a tumour suppressive transcription factor in inhibiting SIRT2 activity. Importantly, both chem- and an important modulator of sensitivity to chemo- ical inhibition and siRNA-depletion of SIRT2 en- therapy [31, 32]. FOXO3 inhibits cell growth by driv- hanced the FOXO3 acetylation induced by Lapatinib ing the transcription of genes, such as Bim, FasL, Kip1 in both the Lapatinib resistant 5-8F and sensitive 6- p27 , p130 (RB2), essential for cell proliferative ar- 10B cell lines, except for the 6-10B cells treated with rest, cell death and differentiation [31, 32]. Con- SIRT2 siRNA. The low levels of acetylated FOXO3 versely, inactivation of FOXO3 is a crucial step for precipitated from the sensitive 6-10B following com- oncogenic transformation and the development of bined Lapatinib and SIRT2-siRNA treatment is likely cytotoxic drug resistance [31, 32]. Previous work has to be due to the high levels of global protein degrad- also suggested that FOXO3 mediates the cytotoxicity ation as a result of cell death caused by the combin- of Lapatinib in breast cancer [33, 34]. In here, we ation of SIRT2-depletion and Lapatinib treatment. have shown definitively using foxo1/3/4-deficient fi- Moreover, Lapatinib also downregulates SIRT2 in the broblasts that FOXO3 along with FOXO1 and −4are sensitive 6-10B cell line, rendering the effects of involved in mediating the cytotoxic functions of Lapa- SIRT2-siRNA redundant. Overall, these IP results tinib. Consistent with this, recent evidence has suggestthatSIRT2 restricts the Lapatinib-mediated showed that natural products, such as curcumin, in- FOXO3 acetylation in NPCs. In summary, our col- hibits the growth and induces apoptosis in NPC cell lective results reveal that SIRT2 has a role in modu- by increasing FOXO3 expression [35]. In addition, the lating FOXO3 acetylation and Lapatinib response in G-quadruplex ligand SYUIQ-5 also induces NPC au- NPCs and that targeting SIRT2 can enhance the sen- tophagy by down-regulating Akt phosphorylation and sitivity of NPCs to Lapatinib and to overcome promoting FOXO3 nuclear translocation [36]. Lapatinib-resistance in NPC. The activity, expression and subcellular localization of FOXO3 are regulated by a diverse range of post- Discussion translational modifications [37]. Phosphorylation by ki- Metastasis and drug resistance are the characteristics nases, particularly Akt (also called PKB) FOXO3, ERK, of aggressive cancers and the major causes for poor IKB kinase (IKK) and serum and glucocorticoid- survival in nasopharyngeal carcinoma (NPC) [12, 13]. regulated kinase (SGK) can enhance FOXO3 nuclear to An understanding of the mechanisms involved in the cytoplasmic shuttling and its degradation [32, 37]. Con- development of NPC metastasis and drug resistance versely, other kinases, such as p38 MAPK [38], stress ac- will aid the development of early diagnostic bio- tivated c-Jun-NH2-kinase (JNK) [39] have also been markers and the identification of potential therapeutic demonstrated to promote FOXO3 activity and expres- targets. Previous studies have reported Lapatinib sion. Consistent with previous studies with EGFR1/ could effectively induce cell death and autophagy in HER2(ERBB2)-targeted tyrosine kinase inhibitors (TKIs) NPC cells [12, 13]. Clinical studies also suggest that [34, 40], we found that Lapatinib can cause FOXO3- Lapatinib alone or combined with standard chemo- dephosphorylation (T32) and the downregulation of its therapies are well-tolerated and promote patient sur- target FOXM1 in Lapatinib-sensitive NPC cells. How- vival in metastatic/recurrent head and neck squamous ever, although EGFR1/HER2 inhibitors have previously Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 13 of 17 Fig. 7 (See legend on next page.) Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 14 of 17 (See figure on previous page.) Fig. 7 Silencing of SIRT2 increases long-term Lapatinib cytotoxicity in NPC cells. a NPC cells were transfected with siNSC and siSIRT2 smartpools. After 24 h both siNSC and siSIRT2-transfected cells were treated with DMSO or 5 μM Lapatinib for another 24 h. Forty-eight h after transfection, cells were harvested and SIRT2 protein knockdown was confirmed by western blot analysis. Protein levels were determined by using ImageJ and the protein levels relative to β-tubulin are shown below protein bands as ratios to the 0 h Lapatinib controls. b Forty-eight h after transfection, 1000 cells were seeded per well, into 6-well plates and then treated with the Lapatinib concentrations of 0, 0.01, 0.05, 0.1, 1 and 5 μM for 72 h and colony formation observed for 15 days. At the end of this time period, cells were fixed with 4% paraformaldehyde and stained with crystal violet. The stain was solubilised with 33% acetic acid and absorbance at 592 nm were obtained. Graphs were generated to show the effect of silencing SIRT2 on Lapatinib sensitivity. c Best fit-curves were generated to determine the effect of SIRT2 knock down on the IC of Lapatinib in 5-8F and 6-10B cells. Numerical data represent the average ± SEM of three different experiments (**** P < 0.0001) been shown to modulate p38 and JNK activity [41, 42], The pan-SIRT inhibitor sirtinol has previously been we did not observe any substantial changes in p38 and shown to induce p53 acetylation and cell death JNK phosphorylation/activity in NPC cells in response through targeting both SIRT1 and SIRT2 [50]. How- to Lapatinib treatment, suggesting it is unlikely that ever, like EX527, the sirtinol concentrations Lapatinib modulates FOXO3 activity via p38 and JNK in employed here preferentially inhibit SIRT1 and have these NPC cells. FOXM1 is a potent oncogene negatively limited activities towards SIRT2 [50]. Therefore, regulated by FOXO3 [32] and contributes to cancer drug these observations support further the notion that resistance through controlling many genes involved in SIRT2 specifically moderates the cytotoxic action of cell proliferation, survival, DNA repair, and tubulin Lapatinib and mediates Lapatinib resistance, inde- destabilization [32, 43, 44]. Consistent with a role for pendently of SIRT1. The reason for the finding that FOXO3 in Lapatinib action in NPC cells, we found that both the SIRT inhibitors sirtinol and EX527 oppose FOXM1 expression is repressed by Lapatinib in the sen- the cytotoxic functions of Lapatinib is unclear. How- sitive cells but remains constitutively high in the resist- ever, a context dependent tumour suppressive role ant NPC cells, suggesting a role of FOXM1 in NPC for SIRT1 has previously been proposed [26]. In Lapatinib resistance. In agreement, FOXM1 has been concordance, SIRT1-deficient cells have been shown shown to be able to mediate paclitaxel resistance by to be defective in the ability to normally upregulate regulating the gene transcription of the ABCC5 drug ef- the p19(ARF) senescence mediator and its potent flux transporter in NPC [18]. In addition, overexpression downstream tumour suppressor p53 [26], and this of FOXM1 is directly associated with metastasis in NPC, might account for the ability of sirtinol and EX527 and targeting FOXM1 with inhibitors or siRNA knock- to attenuate the antiproliferative function of Lapati- down can effectively restrict the cell proliferation, migra- nib. Inhibition of SIRT2 by chemical inhibitor or si- tion, angiogenesis and survival of NPC cells [29, 45]. lencing significantly enhances the cytotoxicity of Besides phosphorylation, FOXO3 is also regulated Lapatinib not only in the sensitive but also in the re- by other post-translational modifications such as sistant NPC cells, suggesting that SIRT2 not only acetylation, methylation, ubiquitination and glycosyl- modulates the cytotoxic functions of Lapatinib in the ation (Zhao et al., 2011). The nuclear sirtuins SIRT1, sensitive NPC cells, but it also mediates Lapatinib SIRT2 and SIRT6 have been shown to negatively resistance. This implies that targeting SIRT2 can en- regulate FOXO3 acetylation and its activity [46–48]. hance the cytotoxicity of Lapatinib and may repre- In the present study, we found that SIRT2 specific- sent a novel strategy for overcoming Lapatinib ally modulates the cytotoxicity of Lapatinib and is resistance in NPC. This role of SIRT2 in modulating linked to Lapatinib resistance using specific chemical Lapatinib response and sensitivity is confirmed by inhibitors and SIRT2 siRNAs. Although our findings SIRT2 depletion experiments showing silencing show that all four SIRT inhibitors (i.e. sirtinol, SIRT2 can enhance the cytotoxicity in both Lapati- EX527, AGK2 and AK1) can limit NPC cell prolifer- nib sensitive and resistant NPC cells. Although the ation, only the SIRT2 specific inhibitors AGK2 and siRNA depletion approach has less off-target effects, AK1 function cooperatively with Lapatinib, support- it also relies on high delivery efficiencies; the incom- ing the idea that SIRT2 specifically modulates Lapa- plete SIRT2 depletion might account for the small tinib response and resistance. Nevertheless, all four additional effects on Lapatinib. SIRT inhibitors can restrict normal NPC cell viability In agreement, overexpression of SIRT2 has been shown and clonogenicity, and this suggests that the nuclear to essentially lengthen the M phase and defer mitotic exit sirtuins SIRT1, −2and − 6 detected in NPC are all [15]. Moreover, SIRT2 can induce the cell proliferation of potential oncogenes. In agreement, SIRT1 upregula- leukaemia and resistance to apoptosis [51]. Conversely, tion has been shown to be associated with tumour decreased SIRT2 activity can reduce glioma cell survival progression and metastasis in NPC biopsies [49]. by induced both necrosis and apoptosis [52] and limit Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 15 of 17 Fig. 8 Inhibition of SIRT2 by AGK2 as well as silencing of SIRT2 in combination with Lapatinib upregulates acetylated FOXO3 levels in 5-8F and 6- 10B cells. a NPC were treated with AGK2 alone or in combination with Lapatinib for 48 h. Proteins were obtained from whole cell extracts and assessed by co-immunoprecipitation (co-IP) with an anti-FOXO3 antibody. Subsequent immunoblotting was performed using antibodies against Ac-Lys and FOXO3. The anti-IgG was used as a negative control. Acetylated FOXO3 levels were determined by using ImageJ analysis and representative bar diagram are shown (bottom panel after the blot). b NPC cells were transiently transfected with siNSC and siSIRT2 and treated with 5 μM Lapatinib for 24 h. Proteins were obtained from whole cell extracts and assessed by Co-immunoprecipitation (Co-IP) with an anti- FOXO3 antibody. Subsequent immunoblotting was performed using antibodies against Ac-Lys and FOXO3. Acetylated and total FOXO3 levels were determined by using ImageJ analysis and representative bar diagrams demonstrating relative acetylated to total FOXO3 ratios are shown (bottom panel after the blot). Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 16 of 17 melanoma cell growth and clonogenicity [53]. Further- Ethics approval and consent to participate Not applicable. more, overexpression of SIRT1 and SIRT2 can also confer resistance to chemotherapy such as paclitaxel [54]. Consent for publication Furthermore, our co-IP experiments also show that Not applicable the Lapatinib induces FOXO3 acetylation and that in- Competing interests hibition of SIRT2 by chemical inhibitor or silencing also The authors declare that they have no competing interests. promotes FOXO3 acetylation in NPC cells. Importantly, SIRT2 inhibition or silencing can combine with Lapati- Author details Department of Surgery and Cancer, Imperial College London, Hammersmith nib to cause further enhancement of FOXO3 acetylation Hospital Campus, London W12 0NN, UK. Graduate Program in Molecular than Lapatinib treatment alone in both sensitive and re- Medicine, Multidisciplinary Unit, Faculty of Science, Mahidol University, sistant NPC cells, suggesting that SIRT2 can moderate Bangkok, Thailand. Department of Biochemistry, Faculty of Science, Mahidol University, Bangkok, Thailand. the cytotoxic functions of Lapatinib and promote resist- ance through limiting FOXO3 acetylation. In agreement, Received: 24 June 2019 Accepted: 29 October 2019 FOXO3 deacetylation by SIRT2 has previously been re- ported to enhance FOXO3 ubiquitination and proteaso- References mal degradation [55]. 1. Wei WI, Sham JST. Nasopharyngeal carcinoma. Lancet. 2005;365(9476):2041–54. 2. Mahdavifar N, Ghoncheh M, Mohammadian-Hafshejani A, Khosravi B, Salehiniya H. Epidemiology and inequality in the incidence and mortality of Conclusion nasopharynx cancer in Asia. Osong Public Health Res Perspect. 2016;7(6): Collectively, these data suggest that the cytotoxic func- 360–72. 3. Ma BBY, Chan ATC. Recent perspectives in the role of chemotherapy in the tions of Lapatinib are mediated through the acetylation management of advanced nasopharyngeal carcinoma. Cancer. 2005;103(1): and activation of FOXO3, and that SIRT2 can specific- 22–31. ally antagonise the cytotoxicity of Lapatinib through me- 4. Hsu CH, Chen CL, Hong RL, Chen KL, Lin JF, Cheng AL. Prognostic value of multidrug resistance 1, glutathione-<i>S</i>−transferase-π and p53 in diating FOXO3 deacetylation in both sensitive and advanced nasopharyngeal carcinoma treated with systemic chemotherapy. resistant NPC cells. The present findings also suggest Oncology. 2002;62(4):305–12. that SIRT2 can be an important biomarker for meta- 5. Jiang R-D, Zhang L-X, Yue W, Zhu Y-F, Lu H-J, Liu X, et al. Establishment of a human nasopharyngeal carcinoma drug-resistant cell line CNE2/DDP and static and Lapatinib resistant NPC and that targeting the screening of drug-resistant genes; 2003. p. 337–45. SIRT2-FOXO3 axis may provide a means to treat NPC 6. Cheung HW, Jin D-Y, Ling M-t, Wong YC, Wang Q, Tsao SW, et al. Mitotic and to overcome NPC chemoresistance. arrest deficient 2 expression induces chemosensitization to a DNA- damaging agent, cisplatin, in nasopharyngeal carcinoma cells. Cancer Res. 2005;65(4):1450. Abbreviations 7. Wang J, Wang H, Zhao L, Fan S, Yang Z, Gao F, et al. Down-regulation of P- EGFR: Epidermal growth factor receptor; FOX: Forkhead box; glycoprotein is associated with resistance to cisplatin and VP-16 in human NPC: Nasopharyngeal carcinoma; SIRT2: Sirtuin-2 lung cancer cell lines. Anticancer Res. 2010;30(9):3593–8. 8. Pan Y, Zhou F, Zhang R, Claret FX. Stat3 inhibitor stattic exhibits potent Acknowledgements antitumor activity and induces chemo- and radio-sensitivity in Not Applicable nasopharyngeal carcinoma. PLoS One. 2013;8(1):e54565. 9. Ma BB, Poon TC, To KF, Zee B, Mo FK, Chan CM, et al. Prognostic significance of tumor angiogenesis, Ki 67, p53 oncoprotein, epidermal Authors’ contributions growth factor receptor and HER2 receptor protein expression in Conceptualization, EW-FL, TJ, SA and ZM; Methodology, EW-FL, ZM and SA; undifferentiated nasopharyngeal carcinoma--a prospective study. Head Validation, SA, ZM and EW-FL; Formal Analysis, SA and ZM; Investigation, SA, Neck. 2003;25(10):864–72. ZM and EW-FL; Resources, EW-FL and TJ; Data Curation, ZM, SY, SA, YJ and 10. Jin O, Chen S, Li G, Yao K. Expression of CerbB-2 and EGFR mRNA in human GA; Writing – Original Draft Preparation, EW-FL, SA and ZM; Writing – Review nasopharyngeal carcinomas and pericarcinomatous tissues. Hunan Yi Ke Da & Editing, ZM, SY and GA; Supervision, EW-FL, TJ and EY; Project Administra- Xue Xue Bao. 1997;22(6):487–90. tion, EW-FL and TJ. All authors read and approved the final manuscript. 11. Ma BB, Lui VW, Poon FF, Wong SC, To KF, Wong E, et al. Preclinical activity of gefitinib in non-keratinizing nasopharyngeal carcinoma cell lines and Funding biomarkers of response. Investig New Drugs. 2010;28(3):326–33. Eric W.-F. Lam’s work is supported by MRC (MR/N012097/1), CRUK (C37/ 12. Liu L, Huang P, Wang Z, Chen N, Tang C, Lin Z, et al. Inhibition of eEF- A12011), Breast Cancer Now (2012MayPR070, 2012NovPhD016, 2 kinase sensitizes human nasopharyngeal carcinoma cells to Lapatinib- 2014NovPhD326), the Cancer Research UK Imperial Centre, Imperial ECMC induced apoptosis through the Src and Erk pathways. BMC Cancer. and NIHR Imperial BRC. Tavan Janvilisri was supported by Thailand Research 2016;16:813. Fund (BRG5980003). Glowi Alasiri is a recipient of a scholarship from the 13. Lui VWY, Lau CPY, Ho K, Ng MHL, Cheng SH, Tsao S-W, et al. Anti-invasion, Saudi Arabian Cultural Bureau in London (MSU434). Sathid Aimjongjun’s anti-proliferation and anoikis-sensitization activities of Lapatinib in work was supported by Newton Fund, Ph. D placement programme and The nasopharyngeal carcinoma cells. Investig New Drugs. 2011;29(6):1241–52. Royal Golden Jubilee Ph.D. Program. Zimam Mahmud was supported by a 14. Wilson MSC, Brosens JJ, Schwenen HDC, Lam EW-F. FOXO and FOXM1 in fellowship from the Commonwealth Scholarship Commission (BDCS-2015- cancer: the FOXO-FOXM1 axis shapes the outcome of cancer 63). The funding bodies had no role on the design, data collection, analysis chemotherapy. Curr Drug Targets. 2011;12(9):1256–66. and manuscript writing of this study. 15. Olmos Y, Brosens JJ, Lam EW. Interplay between SIRT proteins and tumour suppressor transcription factors in chemotherapeutic resistance of cancer. Availability of data and materials Drug Resist Updat. 2011;14(1):35–44. Data sharing is not applicable to this article as no datasets were generated 16. Daitoku H, Sakamaki J-i, Fukamizu A. Regulation of FoxO transcription factors by or analysed during the current study. acetylation and protein–protein interactions. Mol Cell Res. 2011;1813(11):1954–60. Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 17 of 17 17. Jiang L, Wang P, Chen H. Overexpression of FOXM1 is associated with 40. McGovern UB, Francis RE, Peck B, Guest SK, Wang J, Myatt SS, et al. Gefitinib metastases of nasopharyngeal carcinoma. Ups J Med Sci. 2014;119(4):324–32. (Iressa) represses FOXM1 expression via FOXO3a in breast cancer. Mol 18. Hou Y, Zhu Q, Li Z, Peng Y, Yu X, Yuan B, et al. The FOXM1–ABCC5 axis Cancer Ther. 2009;8(3):582–91. contributes to paclitaxel resistance in nasopharyngeal carcinoma cells. Cell 41. Mora Vidal R, Regufe da Mota S, Hayden A, Markham H, Douglas J, Packham Death Dis. 2017;8(3):e2659. G, et al. Epidermal growth factor receptor family inhibition identifies P38 mitogen-activated protein kinase as a potential therapeutic target in 19. Shou Z, Lin L, Liang J, Li J-L, Chen H-Y. Expression and prognosis of FOXO3a and bladder cancer. Urology. 2018;112:225 e1–7. HIF-1α in nasopharyngeal carcinoma. J Cancer Res Clin Oncol. 2012;138(4):585–93. 42. Gschwantler-Kaulich D, Grunt TW, Muhr D, Wagner R, Kolbl H, Singer CF. 20. Shu CH, Yang WK, Shih YL, Kuo ML, Huang TS. Cell cycle G2/M arrest and HER specific TKIs exert their antineoplastic effects on breast cancer cell lines activation of cyclin-dependent kinases associated with low-dose paclitaxel- through the involvement of STAT5 and JNK. PLoS One. 2016;11(1):e0146311. induced sub-G1 apoptosis. Apoptosis. 1997;2(5):463–70. 43. Carr JR, Park HJ, Wang Z, Kiefer MM, Raychaudhuri P. FoxM1 mediates 21. Song LB, Yan J, Jian SW, Zhang L, Li MZ, Li D, et al. Molecular mechanisms resistance to herceptin and paclitaxel. Cancer Res. 2010;70(12):5054–63. of tumorgenesis and metastasis in nasopharyngeal carcinoma cell sublines. 44. Miranda SCW, Jan JB, Helma DCS, Eric WFL. FOXO and FOXM1 in cancer: Ai Zheng. 2002;21(2):158–62. the FOXO-FOXM1 axis shapes the outcome of cancer chemotherapy. Curr 22. Huang PY, Hong MH, Zhang X, Mai HQ, Luo DH, Zhang L. C-KIT Drug Targets. 2011;12(9):1256–66. overexpression and mutation in nasopharyngeal carcinoma cell lines and 45. Jiang L, Wang P, Chen L, Chen H. Down-regulation of FoxM1 by reactivity of Imatinib on these cell lines. Chin J Cancer. 2010;29(2):131–5. thiostrepton or small interfering RNA inhibits proliferation, transformation 23. Huang DP, Ho JH, Poon YF, Chew EC, Saw D, Lui M, et al. Establishment of a ability and angiogenesis, and induces apoptosis of nasopharyngeal cell line (NPC/HK1) from a differentiated squamous carcinoma of the carcinoma cells. Int J Clin Exp Pathol. 2014;7(9):5450–60. nasopharynx. Int J Cancer. 1980;26(2):127–32. 46. Wang F, Nguyen M, Qin FX-F, Tong Q. SIRT2 deacetylates FOXO3a in response 24. Cheung ST, Huang DP, Hui AB, Lo KW, Ko CW, Tsang YS, et al. to oxidative stress and caloric restriction. Aging Cell. 2007;6(4):505–14. Nasopharyngeal carcinoma cell line (C666-1) consistently harbouring 47. Brunet A, Sweeney LB, Sturgill JF, Chua KF, Greer PL, Lin Y, et al. Stress- Epstein-Barr virus. Int J Cancer. 1999;83(1):121–6. dependent regulation of FOXO transcription factors by the SIRT1 25. van der Vos KE, Coffer PJ. The extending network of FOXO transcriptional deacetylase. Science. 2004;303(5666):2011. target genes. Antioxid Redox Signal. 2011;14(4):579–92. 48. Khongkow M, Olmos Y, Gong C, Gomes AR, Monteiro LJ, Yague E, et al. 26. Chua KF, Mostoslavsky R, Lombard DB, Pang WW, Saito S, Franco S, et al. SIRT6 modulates paclitaxel and epirubicin resistance and survival in breast Mammalian SIRT1 limits replicative life span in response to chronic cancer. Carcinogenesis. 2013;34(7):1476–86. genotoxic stress. Cell Metab. 2005;2(1):67–76. 49. Hu C, Wei W, Chen X, Woodman CB, Yao Y, Nicholls JM, et al. A global view 27. Paik JH, Kollipara R, Chu G, Ji H, Xiao Y, Ding Z, et al. FoxOs are lineage- of the oncogenic landscape in nasopharyngeal carcinoma: an integrated restricted redundant tumor suppressors and regulate endothelial cell analysis at the genetic and expression levels. PLoS One. 2012;7(7):e41055. homeostasis. Cell. 2007;128(2):309–23. 50. Peck B, Chen CY, Ho KK, Di Fruscia P, Myatt SS, Coombes RC, et al. SIRT 28. Weiss JM, Bagley S, Hwang W-T, Bauml J, Olson JG, Cohen RB, et al. inhibitors induce cell death and p53 acetylation through targeting both Capecitabine and Lapatinib for the first-line treatment of metastatic/recurrent SIRT1 and SIRT2. Mol Cancer Ther. 2010;9(4):844–55. head and neck squamous cell carcinoma. Cancer. 2016;122(15):2350–5. 51. Dan L, Klimenkova O, Klimiankou M, Klusman J-H, van den Heuvel-Eibrink 29. Machiels J-PH, Haddad RI, Fayette J, Licitra LF, Tahara M, Vermorken MM, Reinhardt D, et al. The role of sirtuin 2 activation by nicotinamide JB, et al. Afatinib versus methotrexate as second-line treatment in phosphoribosyltransferase in the aberrant proliferation and survival of patients with recurrent or metastatic squamous-cell carcinoma of the myeloid leukemia cells. Haematologica. 2012;97(4):551–9. head and neck progressing on or afterplatinum-basedtherapy (LUX- 52. He X, Nie H, Hong Y, Sheng C, Xia W, Ying W. SIRT2 activity is required for the Head & Neck 1): an open-label, randomised phase 3 trial. Lancet survival of C6 glioma cells. Biochem Biophys Res Commun. 2012;417(1):468–72. Oncol. 2015;16(5):583–94. 53. Wilking-Busch MJ, Ndiaye MA, Liu X, Ahmad N. RNA interference-mediated 30. Harrington KJ, Temam S, D'Cruz A, Jain MM, D'Onofrio I, Manikhas GM, et al. knockdown of SIRT1 and/or SIRT2 in melanoma: identification of Final analysis: a randomized, blinded, placebo (P)-controlled phase III study of downstream targets by large-scale proteomics analysis. J Proteome. 2018; adjuvant postoperative Lapatinib (L) with concurrent chemotherapy and 170:99–109. radiation therapy (CH-RT) in high-risk patients with squamous cell carcinoma 54. Matsushita N, Takami Y, Kimura M, Tachiiri S, Ishiai M, Nakayama T, et al. Role of of the head and neck (SCCHN). J Clin Oncol. 2014;32(15_suppl):6005. NAD-dependent deacetylases SIRT1 and SIRT2 in radiation and cisplatin- 31. Yao S, Fan LY, Lam EW. The FOXO3-FOXM1 axis: a key cancer drug target and induced cell death in vertebrate cells. Genes Cells. 2005;10(4):321–32. a modulator of cancer drug resistance. Semin Cancer Biol. 2018;50:77–89. 55. Wang F, Chan CH, Chen K, Guan X, Lin HK, Tong Q. Deacetylation of FOXO3 32. Myatt SS, Lam EW. The emerging roles of forkhead box (Fox) proteins in by SIRT1 or SIRT2 leads to Skp2-mediated FOXO3 ubiquitination and cancer. Nat Rev Cancer. 2007;7(11):847–59. degradation. Oncogene. 2011;31:1546. 33. Xia W, Bacus S, Hegde P, Husain I, Strum J, Liu L, et al. A model of acquired autoresistance to a potent ErbB2 tyrosine kinase inhibitor and a therapeutic strategy to prevent its onset in breast cancer. Proc Natl Acad Sci U S A. Publisher’sNote 2006;103(20):7795–800. Springer Nature remains neutral with regard to jurisdictional claims in 34. Karadedou CT, Gomes AR, Chen J, Petkovic M, Ho KK, Zwolinska AK, et al. published maps and institutional affiliations. FOXO3a represses VEGF expression through FOXM1-dependent and -independent mechanisms in breast cancer. Oncogene. 2012;31(14):1845–58. 35. Wu J, Tang QIN, Zhao S, Zheng F, Wu YAN, Tang GE, et al. Extracellular signal-regulated kinase signaling-mediated induction and interaction of FOXO3a and p53 contribute to the inhibition of nasopharyngeal carcinoma cell growth by curcumin. Int J Oncol. 2014;45(1):95–103. 36. Zhou W-J, Deng R, Feng G-K, Zhu X-F. A G-quadruplex ligand SYUIQ-5 induces autophagy by inhibiting the Akt-FOXO3a pathway in nasopharyngeal cancer cells; 2009. p. 1049–53. 37. Lam EW, Brosens JJ, Gomes AR, Koo CY. Forkhead box proteins: tuning forks for transcriptional harmony. Nat Rev Cancer. 2013;13(7):482–95. 38. Ho KK, McGuire VA, Koo CY, Muir KW, de Olano N, Maifoshie E, et al. Phosphorylation of FOXO3a on Ser-7 by p38 promotes its nuclear localization in response to doxorubicin. J Biol Chem. 2012;287(2):1545–55. 39. Sunters A, Madureira PA, Pomeranz KM, Aubert M, Brosens JJ, Cook SJ, et al. Paclitaxel-induced nuclear translocation of FOXO3a in breast cancer cells is mediated by c-Jun NH2-terminal kinase and Akt. Cancer Res. 2006;66(1):212–20. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png BMC Cancer Springer Journals

Lapatinib sensitivity in nasopharyngeal carcinoma is modulated by SIRT2-mediated FOXO3 deacetylation

Download PDF
17 pages

Loading next page...
 
/lp/springer-journals/lapatinib-sensitivity-in-nasopharyngeal-carcinoma-is-modulated-by-p7qogq4USe

References (69)

Publisher
Springer Journals
Copyright
Copyright © 2019 by The Author(s).
Subject
Biomedicine; Cancer Research; Oncology; Surgical Oncology; Health Promotion and Disease Prevention; Biomedicine, general; Medicine/Public Health, general
eISSN
1471-2407
DOI
10.1186/s12885-019-6308-7
Publisher site
See Article on Publisher Site

Abstract

Background: Chemoresistance is an obstacle to the successful treatment of nasopharyngeal carcinoma (NPC). Lapatinib is a targeted tyrosine kinase inhibitor therapeutic drug also used to treat NPC, but high doses are often required to achieve a result. To investigate the mechanism for the development of Lapatinib resistance, we characterised a number of NPC cell lines to determine the role of FOXO3 and sirtuins in regulating NPC resistance. Methods: Sulforhodamine B (SRB) assays, Clonogenic assays, Protein extraction, quantification and western blotting, RT qPCR, Co-immunoprecipitation assay. Results: To explore novel treatment strategies, we first characterized the Lapatinib-sensitivity of a panel of NPC cell lines by SRB and clonogenic cytotoxic assays and found that the metastatic NPC (C666–1 and 5-8F) cells are highly resistant whereas the poorly metastatic lines (6-10B, TW01 and HK-1) are sensitive to Lapatinib. Western blot analysis of the Lapatinib-sensitive 6-10B and resistant 5-8F NPC cells showed that the expression of phosphorylated/inactive FOXO3 (P-FOXO3;T32), its target FOXM1 and its regulator SIRT2 correlate negatively with Lapatinib response and sensitivity, suggesting that SIRT2 mediates FOXO3 deacetylation to promote Lapatinib resistance. In agreement, −/− clonogenic cytotoxic assays using wild-type and foxo1/3/4 mouse embryonic fibroblasts (MEFs) showed that FOXO1/3/4-deletion significantly attenuates Lapatinib-induced cytotoxicity, confirming that FOXO proteins are essential for mediating Lapatinib response. SRB cell viability assays using chemical SIRT inhibitors (i.e. sirtinol, Ex527, AGK2 and AK1) revealed that all SIRT inhibitors can reduce NPC cell viability, but only the SIRT2-specific inhibitors AK1 and AGK2 further enhance the Lapatinib cytotoxicity. Consistently, clonogenic assays demonstrated that the SIRT2 inhibitors AK1 and AGK2 as well as SIRT2-knockdown increase Lapatinib cytotoxicity further in both the sensitive and resistant NPC cells. Co-immunoprecipitation studies showed that besides Lapatinib treatment, SIRT2- pharmaceutical inhibition and silencing also led to an increase in FOXO3 acetylation. Importantly, SIRT2 inhibition and depletion further enhanced Lapatinib-mediated FOXO3-acetylation in NPC cells. Conclusion: Collectively, our results suggest the involvement of SIRT2-mediated FOXO3 deacetylation in Lapatinib response and sensitivity, and that SIRT2 can specifically antagonise the cytotoxicity of Lapatinib through mediating FOXO3 deacetylation in both sensitive and resistant NPC cells. The present findings also propose that SIRT2 can be an important biomarker for metastatic and Lapatinib resistant NPC and that targeting the SIRT2-FOXO3 axis may provide novel strategies for treating NPC and for overcoming chemoresistance. Keywords: Nasopharyngeal carcinoma, Sirtuin, FOXO3, Chemoresistance, Lapatinib, Acetylation * Correspondence: eric.lam@imperial.ac.uk Sathid Aimjongjun and Zimam Mahmud are contributed equally and should be recognised as co-first authors. Department of Surgery and Cancer, Imperial College London, Hammersmith Hospital Campus, London W12 0NN, UK Full list of author information is available at the end of the article © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 2 of 17 Background promote or inhibit the transcription of target genes Nasopharyngeal carcinoma (NPC) is a malignancy of [14]. Furthermore, FOXO3 has also be shown to be head and neck epithelial cells that originates from regulated by post-translational modifications, such the nasopharyngeal cavity. NPC is an important as phosphorylation, methylation, ubiquitination, gly- health problem in Southern China and Southeast cosylation and acetylation. The reversible acetyl- Asia [1], with about 86,500 NPC new cases recorded ation/deacetylation of FOXO3 is regulated by class I annually, and over 40,000 die from the disease every histone deacetylases (HDACs) as well as class III year in Asia alone [2]. The most common treatment HDACs named sirtuins (SIRT 1–7) and histone for NPC is the combination of radiotherapy and acetyl transferases (HATs e.g. p300/CBP) [15]. The chemotherapy. Radiotherapy is a mainstay for treat- function of SIRT proteins is to reverse the acetyl- ment for early NPC, while chemotherapy is fre- ation of FOXO3 to induce the cell cycle arrest, pro- quently used for the advanced locoregionally NPC. It tection from oxidative stress and to repress the has been shown that the combination of chemother- expression of apoptotic genes [16]. In NPC cells, apy and radiation enhances the survival rates [3]. FOXM1 is overexpressed and it is associated with However, advanced NPCs usually fail to respond to cancer metastasis and chemoresistance [17, 18]. In chemotherapy treatment because of the development NPC patients, low FOXO3 and high HIF-1 expres- of drug resistance that leads to metastasis and re- sion has been found to be correlated with poor lapse, resulting in poor prognosis [4]. In conse- prognosis in NPC [19]. However, the role and regu- quence, there is an urgent need for the identification lation of FOXO3 and FOXM1 in NPC have not of novel therapeutic strategies as well as the mecha- been not fully investigated. nisms of chemotherapeutic resistance for NPC. To In this study, we investigated the mechanism of action date, the mechanisms for the development of resist- of a dual tyrosine kinase inhibitor Lapatinib using high ance to conventional therapeutics, such as cisplatin and low metastatic NPC cells and found that the deace- (CDDP), paclitaxel (PTX), 5-fluorouracil (5-FU), and tylation of FOXO3 by SIRT2 plays an important role in vincristine (VCR), for NPC have been extensively the regulation of Lapatinib response and resistance in studied [5–8]. These include overexpression of NPCs. multidrug-resistant genes, enhanced DNA repair, de- regulation of apoptosis, and/or modifications of drug Methods targets [5–8]. Cell culture Both the epidermal growth factor receptor (EGFR) The NPC cell line TW01 is an established cell line and HER2 (human epidermal growth factor receptor derived from moderately differentiated keratinising 2; ERRB2) are commonly overexpressed in NPC [9, NPC tissues, and was kindly provided by Prof. Chin- 10]. Moreover, activation of EGFR/HER2 pathway Tarng Lin, National Taiwan University, Taipei [20]. has also been shown to promote NPC progression TW01 cells were cultured with DMEM supple- and invasion [11]. Previous studies have demon- mented with 10% v/v foetal bovine serum (FBS), 100 strated that the dual EGFR/HER2 tyrosine kinase in- U/mL penicillin, and 100 μg/mL streptomycin. Poorly hibitor, Lapatinib, can restrict cell proliferation and differentiated human NPC cell lines SUNE 5–8F invasion, and promote anoikis in NPC cells [12, 13]. (highly tumorigenic and metastatic) and 6-10B Despite its promising efficacy, Lapatinib has a half (highly tumorigenic, but poorly metastatic) derived maximal inhibitory concentration (IC )inthe mi- from the parental line SUNE-1, were obtained from cromolar range in most cell lines [13], and strategies the Prof. Qingling Zhang, Southern Medical Univer- to sensitize NPC to Lapatinib are currently under sity, Guangzhou China [21, 22]. HK1, a well- investigation. differentiated squamous carcinoma line was obtained FOXO3 and FOXM1 are members of the forkhead from the Queen Elizabeth Hospital, University of box transcription factor family which play opposite Hong Kong [23]. C666–1 is an undifferentiated NPC roles in tumorigenesis, drug resistance and cancer cell line obtained from Prof. Maria L. Lung, Center progression. FOXO3 is a key tumour suppressor for Nasopharyngeal Carcinoma Research, University which functions downstream of the PI3K/AKT (pro- of Hong Kong [24]. These last four NPC cell lines tein kinase B) signalling pathway. Conversely, were cultured in RPMI supplemented with 10% FBS, FOXM1 is an important oncogene that promotes 100 U/mL penicillin, and 100 μg/mL streptomycin. cell transformation, cancer progression and resist- All NPC cells were maintained in a humidified incu- ance to chemotherapy. In addition, FOXM1 and bator with 10% CO at 37 °C. Wild type mouse em- FOXO3 negatively regulate the expression of one bryonic fibroblasts (MEFs) and triple knock-out −/− another and compete for same binding sites to foxo1/3/4 MEFs were kind gifts from Prof. Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 3 of 17 Boudewijn Burgering, UMC, Utrecht, the and the absorbance was measured at 592 nm using Netherlands, and have been described previously Tecan Microplate reader. [25]. MEF cells were cultured in Dulbecco’s modified eagle’s medium (DMEM) (Sigma Aldrich, Poole, UK) Western blotting and antibodies and supplemented with 10% (v/v) foetal calf serum Western blotting was performed with whole cell ex- (FCS)(FirstLinkLtd., Birmingham,UK),100 Unit/ tracts prepared by lysing cells with NP40 lysis buffer ml penicillin/streptomycin(Sigma-Aldrich, UK)and [1% NP40, 100 mmol/L NaCl, 20 mmol/L Tris-HCl 2 mM glutamine and maintained at 37 °C in a hu- (pH 7.4), 10 mmol/L NaF, 1 mmol/L Na orthovana- midified atmosphere containing 10% CO . All cell date, 30 mmol/L Na β-glycerophosphate, and prote- lines were subjected to DNA fingerprinting analysis ase inhibitors (“Complete” protease inhibitor using the AmpF/STR Identifiler PCR Amplification mixture, as instructed by the manufacturer, Roche Kit (Applied Biosystems, Foster City, USA) and are Applied Science)] on ice for 15 min. After incuba- free from mycoplasma contamination. tion, the lysates were centrifuged at 13,000×g for 10 min, and the supernatant was collected. Protein siRNA mediated gene knockdown concentrations were determined using a BCA pro- For gene knockdown, cells were plated in at 60–70% tein assay kit (ThermoFisher Scientific, Waltham, confluency. The following day, cells were transfected MA, USA). Ten micrograms of protein were size with ON-TARGET plus siRNA smart pools (GE fractionated using SDS-PAGE and electro- − 004826 Dharmacon) targeting SIRT2 (L -00-0005) using transferred onto nitrocellulose membranes (BioRad, oligofectamine (Invitrogen, UK) according to the San Diego, CA, USA). Membranes were blocked in manufacturer’s protocol. Non-Targeting siRNA pool 5% (w/v) bovine serum albumin (BSA) in TBS plus (GE Dharmacon; D-001210-01-05) was used as trans- 0.5% (v/v) Tween for 1 h at room temperature and fection control. then incubated with specific antibodies overnight at 4 °C. The antibodies against EGFR, P-EGFR, ERBB2, P-ERBB2, ERBB3, P-ERBB3, JNK, P-JNK, p38, P-p38, Sulforhodamine B colorimetric assay Kip1 c-Myc, p27 , P-FOXO3 (T32), FOXO3, cyclin B1, A total of 1000 NPC cells per well were seeded in a 96- P-AKT (S473), AKT and β-Tubulin were purchased wells plate. One day after seeding, NPC cells were from Cell Signalling Technology (New England Bio- treated with increasing concentrations of Lapatinib for labs Ltd., Hitchin, UK). The antibody against 24 and 48 h. The cells were fixed with 40% − 20 FOXM1 (C ) was purchased from Santa Cruz Bio- trichloroacetic acid at 4 °C for 1 h, washed 3 times with technology (Santa Cruz, CA, USA). Primary anti- PBS and stained with 0.4% (w/v) sulforhodamine B bodies were detected using horseradish peroxidase- (SRB) solution at room temperature for 1 h. Following linked anti-mouse or anti-rabbit conjugates (Dako, the staining, the cells were washed 5 times with 1% Glostrup, Denmark) and visualized using the ECL acetic acid and air-dried overnight. The protein bound detection system (Perkin Elmer, Beaconsfield, UK). dye was dissolved in 10 mM Tris base solution and the absorbance was measured at 492 nm using a microplate reader (Sunrise, Tecan; Männedorf, Switzerland). Co-Immunoprecipitation assay NPC cell lysates were prepared in IP buffer (1% − 40 Clonogenic assay Nonidet P , 150 mM NaCl, 50 mM Tris-HCl [pH A total of 2000–10,000 cells were seeded into 6-well 7.4], 10 mM NaF, 1 mM Na VO ,10mMN-ethyl- 3 4 plates and incubated overnight. The cells were then amide (NEM) and protease inhibitors [Complete pro- treated for 72 h with varying concentrations of tease inhibitor cocktail; Roche, Lewes, UK]). The Lapatinib and SIRT inhibitor (SIRT-i). DMSO pre-cleared lysate was immunoprecipitated with the (Sigma-Aldrich,) was used as a vehicle and blank. indicated antibodies and with protein A/G-sepharose The drug was removed and surviving cells were left for 4 h. After that, the fractionated supernatant was to form colonies. After 1–2 weeks of incubation, transferred to the new tube. Samples and incubated colonies were fixed with 4% paraformaldehyde for overnight with 0.5 μg of primary antibody-FOXO3 15 min at room temperature and then washed with (sc-11,351, Santa Cruz) [1, 26], Anti-acetyl lysine PBS three times. Crystal violet (0.5% w/v) was used (Cell-Signalling technology) or IgG negative control to stain the fixed cells for 30 min, following which (2729, Cell-Signalling technology) (1500) at 4 °C on a the plates were washed with tap water. Plates were rotator. The supernatant was discarded on the fol- then left to dry overnight. Quantification was lowing day and beads were washed three times with achieved by solubilising dye with 33% acetic acid PBS. Samples were boiled with 2 × SDS sample buffer Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 4 of 17 for 5 min at 100 °C and were analysed by SDS-PAGE Results followed by western blotting. Effects of Lapatinib on cell viability of different nasopharyngeal carcinoma (NPC) cell lines In order to identify the cellular mechanisms which Gene expression analysis by RT-qPCR modulate Lapatinib sensitivity, we first analysed its effect Total mRNA was extracted from cell pellets using the on the proliferation of NPC cell lines with distinct meta- RNeasy Mini Kit (Qiagen, UK) according to manufac- static status. To this end, two highly metastatic (C666–1 turer’s instructions. The purity and concentration of and 5-8F) and three poorly metastatic (6-10B, TW01 mRNA samples were determined by measuring the spec- and HK-1) NPC cell lines were treated with increasing trophotometric absorption at 260 nm and 280 nm using concentrations of Lapatinib (from 0 μMto20 μM) for a NanoDrop ND-1000. Then, 2 μg of the extracted total 48 h and their viability measured by the sulforhodamine RNA was used as a template for first strand cDNA syn- B (SRB) assay. The results showed that Lapatinib caused thesis reaction, The resulting first-strand cDNA was a dose-dependent reduction of cell proliferation in all then used as template in the real-time PCR. Real time NPC cells. The results also indicated that there were sig- quantitative PCR (RT-qPCR) was performed on 100 ng nificant differences in Lapatinib sensitivity between the of cDNA with SYBER-Green Master Mix (Applied Bio- NPC cell lines at 48 h (Fig. 1a) (2-way ANOVA, ****P < Systems). All RT-qPCR assays were assayed in 96-well 0.0001). Moreover, the highly metastatic (C666–1 and 5- plates in the ABI PRISM® 7900 HT Fast Real-time PCR 8F) lines were significantly more resistant to Lapatinib System (Applied BioSystems) on a cycling program of than the three poorly metastatic lines (6-10B, TW01 and 90 °C for 10 min for enzyme activation followed by 40 HK-1) (Fig. 1b). These results were further confirmed by cycles of denaturation and primer annealing/extension clonogenic assays, in which the surviving cells were consisting of 95 °C for 3 s and 60 °C for 30s respectively. allowed to further proliferate and form clones. The The nonregulated ribosomal housekeeping gene, RPL19 highly metastatic C666–1 and 5-8F lines were also sig- was used as an internal control to normalize gene ex- nificantly more resistant to Lapatinib than the three pression between samples. All samples were done in poorly metastatic lines (6-10B, TW01 and HK-1) in lon- triplicates. Primer sequences used for RT-qPCR are, ger term assays (Fig. 1c, d). RPL19-F: 5’GGTGCTTCCGATTCCAGAGT3’, RPL19-R: 5’CCCATTCCCTGATCGCTTGA3’, Effects of Lapatinib on the expression and activity of Erbb2-F: 5’GCTCTTTGAGGACAAGTATG3’, proteins involved in EGFR/ERBB2 signalling in the SUNE Erbb2-R: 5’AAGATCTCTGTGAGACTTCG3’, 5-8F and 6-10B NPC cells Egfr-F: 5’CTGTCGCAAAGTTTGTAATG3’, In order to identify the potential mechanisms in- Egfr-R: 5’GAATTTCTAGTTCTCGTGGG3’, volved in modulating Lapatinib sensitivity, we ana- Foxo3-F: 5’CCGGACAAACGGCTCACT3’, lysed by Western blotting the effects of Lapatinib on Foxo3-R: 5’GGCACACAGCGCACCAT3’, the expression of molecules implicated in Lapatinib Foxo4-F:5’AGGACAAGGGTGACAGCAAC3’, signalling and sensitivity. To this end, the two NPC Foxo4-R: 5’GGTTCAGCATCCACCAAGAG3’, cell lines, SUNE 5-8F (highly metastatic) and 6-10B Foxo1-F: 5’AAGAGCGTGCCCTACTT-CAA3’, (poorly metastatic) with differential Lapatinib sensitiv- Foxo1-R: 5’TCCTTCA-TTCTGCACTCGAA 3′. ity (low and high, respectively) were treated with 5 μM Lapatinib for 0 to 48 h (Fig. 2). Western blot results showed a reduction in P-ERBB1 and P-ERBB2 Statistical data analysis upon Lapatinib treatment (Fig. 2), indicating the drug The results were represented as the means ± SEM of at is effective in inhibiting ERBB1/ERBB2 activity in least 3 separate experiments. For categorical variables, both NPC lines. Notably, both total ERBB1 and we used the analysis of variance (ANOVA) which was ERBB2, but not ERBB3, were expressed at high levels followed by a Bonferroni’s post-hoc test for multiple in both NPC lines and their expression remained at comparisons. Student’s t test was used to analyse the high levels after Lapatinib treatment. FOXO3 has pre- statistical significance of differences between the control viously been shown to mediate the cytotoxic function groups and the experimental groups. The differences of Lapatinib through repressing FOXM1 expression. were considered as significant at p < 0.05. The GraphPad The p38 and Jun N-terminal kinase (JNK) MAPKs Prism 5.0 software (version 5.00 for Windows, GraphPad have also been demonstrated to phosphorylate and Software; San Diego, California, USA) was used for the activate FOXO3 in response to Lapatinib, while AKT statistical analyses. ImageJ software was used to analyse has been reported to be repressed by Lapatinib, lead- and compare the intensity of the protein bands obtained ing to FOXO3 dephosphorylation (T32) and derepres- from Western blots. sion. In agreement, western blot analysis showed that Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 5 of 17 Fig. 1 (See legend on next page.) Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 6 of 17 (See figure on previous page.) Fig. 1 Effects of Lapatinib on cell growth and proliferation of NPC cells. a Lapatinib sensitivity curves in NPC cells was determined by sulforhodamine B staining. Cells (3 × 10 / well) were seeded in 96-well plates and treated with increasing concentrations of Lapatinib for 72 h before SRB staining and measurement of optical density at 492 nm. b Best-fit curves were generated to determine IC for each NPC cell lines against Lapatinib. c NPC cells were seeded into 6-well plates (1 × 10 cells / well) and treated with Lapatinib for 72 h. Colony formation was monitored after 15 days, stained with crystal violet (representative images are shown) and absorbance at 592 nm determined (right panel). d Best- fit curves were generated to determine IC for each NPC cells against Lapatinib in terms of clonogenic assay. Numerical data represent the average ± SEM of three independent experiments (**** P < 0.0001) FOXO3 became dephoshorylated (T32) and activated another [27]. To verify the role of FOXO3 in mediat- upon Lapatinib treatment in the sensitive 6-10B, but ing the cytotoxic response of Lapatinib, the effects of remained phosphorylated (T32) and inactivated in the Lapatinib treatment were investigated in wild-type −/− resistant 5-8F cells. FOXO3 dephosphorylation was (WT) and foxo1/3/4 MEFs. Western blot and also correlated with downregulation of FOXM1 ex- RTq-PCR analyses confirmed the Foxo1/3/4 knockout −/− pression in 6-10B but not in 5-8F cells, further con- in the foxo1/3/4 MEFs and demonstrated EGFR/ firming the role of FOXO3 in mediating Lapatinib HER2 overexpression in both wild-type (WT) and −/− action. Interestingly, the induction of p38 and JNK foxo1/3/4 MEFs (Fig. 3a, b), implying that they are phosphorylation was not observed in the sensitive 6- potentially sensitive to Lapatinib inhibition. Clono- 10B cells upon Lapatinib treatment, suggesting p38 genic assays showed that both wild-type (WT) and −/− and JNK are unlikely to be instrumental in activating foxo1/3/4 MEFs are indeed sensitive to the anti- FOXO3 in response to Lapatinib. FOXO3 activity can proliferative functions of Lapatinib (Fig. 3c). Clono- also be enhanced by acetylation, which have been genic assays also revealed that foxo1/3/4-deficient shown to be promoted by EP300 and repressed by MEFs displayed higher self-renewal ability and was the nuclear sirtuins, SIRT1, −2and − 6. Western blot significantly less sensitive to the antiproliferative ef- analysis showed EP300 was at low levels in the resist- fects of Lapatinib compared with the WT MEFs (2- ant, metastatic 5-8F cells but was induced upon Lapa- way ANOVA, ****P < 0.0001) (Fig. 3cand d),confirm- tinib treatment, whereas EP300 was expressed at high ing the key role of FOXOs in mediating the cytotoxic levels in 6-10B and was downregulated in response to functions of Lapatinib. Lapatinib. The results also showed SIRT1 and − 6 were expressed at comparable levels in both 5-8F and The clonogenic survival of NPC cells is sensitive to 6-10B cells, and their expression was not substantially chemical inhibitors of SIRTs affected by Lapatinib treatment. The observed expres- The anti-proliferative activity of FOXO3 is promoted by sion patterns of EP300, SIRT1 and SIRT6 suggested acetylation which can be attenuated by nuclear SIRTs. that they are unlikely to be responsible for FOXO3 In order to investigate if the viability of the NPC cells activation by Lapatinib, even though EP300, SIRT1 are also modulated by SIRTs, we subjected both the and SIRT6 could still modulate FOXO3 acetylation Lapatinib resistant 5-8F and sensitive 6-10B NPC cells and activity in these NPC cells. By contrast, upon to treatment with the SIRT1-specific (ie. EX527), SIRT2- Lapatinib treatment the expression levels of SIRT2 specific (ie. AK1 and AGK2) and pan-SIRT (ie. Sirtinol) remained constitutively high in the resistant 5-8F inhibitors individually for 72 h and their subsequent cells, but were downregulated by Lapatinib in the sen- long-term survival examined by clonogenic assays (Fig. 4a sitive 6-10B cells, suggesting that SIRT2 can poten- and b). The results showed that all four SIRT-inhibitors tially mediate Lapatinib response through modulating decreased the clonogenic survival of both NPC cell lines, FOXO3 acetylation and activity in these NPC cells. with EX527, AK1 and AGK2 being more effective com- These results suggest that highly metastatic and EBV pared to Sirtinol, suggesting that the activity of SIRT1 (Epstein Barr virus)-positive cell lines are more resist- and − 2 might have a role in modulating the long-term ant to Lapatinib, probably due to their high levels of viability of NPC cells. FOXM1 and P-FOXO3 expression, suggesting that SIRT2 induces Lapatinib resistance through FOXO3 SIRT2 inhibitors AK1 and AGK2 function cooperatively acetylation and activity, which in turn led to reduc- with Lapatinib in NPC cells tion in FOXO3 activity. Next, we tested if the SIRT inhibitors can act co- operatively with Lapatinib and enhance its antiprolif- FOXOs mediate the cytotoxic function of Lapatinib erative functions. To this end, the resistant 5-8F and FOXO proteins have previously been shown to be sensitive 6-10B NPC cells were cultured with sub- functionally redundant and can compensate for one optimal levels of SIRT inhibitors (Fig. 2)orvehicle Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 7 of 17 Lapatinib treatment alone (2 way-ANOVA, ****P < 0.0001). Similarly, EX527 increased the viability of the Lapatinib-treated 6-10B cells (2 way-ANOVA, **P = 0.0011) but had no significant effects on the viability of the Lapatinib-treated 5-8F cells (2 way-ANOVA, non-significant, P = 0.3667). By contrast, the SIRT2 inhibitor AGK2 demonstrated additive effects on the cytotoxicity of Lapatinib (2 way-ANOVA, ****P < 0.0001, respectively) in both the sensitive 6-10B (IC : 1.88 ± 0.26 to 5.94 ± 0.86 μM) and the resistant 5-8F (10.55 ± 1.52 to 1.88 ± 0.26 μM) NPC lines (Fig. 5b). Similarly, the SIRT2-inhibitor AK1 also functioned additively with Lapatinib in the 5-8F cells (2 way- ANOVA, *P = 0.0331, IC , 11.77 ± 2.43 to 2.88 ± 0.57 μM) but had no significant positive effects on Lapatinib in the sensitive 6-10F cells (2 way-ANOVA, non-significant P = 0.3667, IC , 5.80 ± 1.15 to = 6.50 ± 0.66 μM). AK1 did not demonstrate any additive ef- fects with Lapatinib in 6-10B cells, probably because of the predominant anti-proliferative function of Lapatinib in the Lapatinib-sensitive cells. Moreover, Lapatinib also functions to downregulate SIRT2 ex- pression in 6-10B, and therefore, AK1 might be re- dundant in inhibiting SIRT2 after the downregulation of SIRT2 in these cells by Lapatinib. However, overall the SIRT2 inhibitors AGK2 and AK1, but not the SIRT1 and pan-SIRT inhibitors, demonstrated additive antiproliferative effects on Lapatinib in SRB cell pro- liferative assays, suggesting that SIRT2 plays a specific role in limiting Lapatinib cytotoxicity and in promot- ing Lapatinib resistance in NPC cells. To ascertain further the role of SIRT2 in enhancing Lapatinib resistance in NPC cells, we performed clono- genic survival assays on the two NPC cell lines to study the long-term antiproliferative effects of the two SIRT2 inhibitors AGK2 and AK1 on Lapatinib (Fig. 6a). In clo- nogenic assays, both SIRT2-inhibitors displayed additive Fig. 2 Effects of Lapatinib on the expression and activity of proteins effects on Lapatinib in NPC cell lines (2 way-ANOVA, involved in EGFR/ERBB2 signalling pathways in high and low ****P < 0.0001, for all except **P < 0.0033 for AK1 in 6- metastasis NPC cell lines. The high 5-8F and low 6-10B metastatic NPC cells were treated with 5 μM Lapatinib for 0. 4, 8, 24, 48 h. 10B), further reducing the overall clonogenic survival of Protein lysates from whole-cell extracts were collected and then Lapatinib-treated cells (Fig. 6b). When combined with analysed by western blotting using the antibodies against ERBB1, P- Lapatinib, AGK2 showed additive effects on the anti- ERBB1, ERBB2, P-ERBB2, ERBB3, P-ERBB3, AKT, P-AKT, SIRT1, SIRT2, proliferative functions of Lapatinib in both the Lapatinib SIRT6, p300, JNK, P-JNK, p38, P-p38, FOXO3, P-FOXO3(T32), FOXM1, resistant 5-8F (IC : 2.31 ± 1.06 to 0.21 ± 0.07 μM) and and β-tubulin. Molecular markers are shown on the right panel of each blot. Representative results of three repeats are shown. Protein sensitive 6-10B (IC : 0.66 ± 0.08 to 0.21 ± 0.02 μM) NPC levels were determined by using ImageJ and the protein levels cells (Fig. 6c). The SIRT2-inhibitor AK1 also functioned relative to β-tubulin are shown below protein bands as ratios to the additively with Lapatinib in both the resistant 5-8F and 0 h Lapatinib controls (IC : 1.07 ± 0.15 to 0.28 ± 0.03 μM) and sensitive 6-10B (IC : 0.66 ± 0.10 to 0.28 ± 0.05 μM) cells (Fig. 6c). controls in the presence of increasing doses of Lapati- nib and their cell viability examined by SRB assays Silencing of SIRT2 enhances Lapatinib sensitivity of NPC (Fig. 5a). Surprisingly, combining the pan-SIRT inhibi- cells tor Sirtinol with Lapatinib significantly increased the To confirmfurther theroleofSIRT2 in promoting overall viability of both NPC cell lines compared to Lapatinib resistance, we next examined if siRNA- Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 8 of 17 Fig. 3 (See legend on next page.) Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 9 of 17 (See figure on previous page.) Fig. 3 FOXOs regulate Lapatinib sensitivity in mouse embryonic fibroblasts. a Western blot analysis was performed to analyse the protein levels −/− of P-EGFR, EGFR, P-ERBB2, ERBB2, FOXO3, FOXO1 in MEFs and Foxo1,3,4 MEFs. Representative western blot results are shown. Tubulin was used as a protein loading control. b The mRNA levels of EGFR, ERBB2, FOXO3, FOXO1 and FOXO4 were assessed by real-time qPCR. The RPL19 −/− housekeeping gene transcript was used as a control to normalise gene expression. c Wild-type (WT) MEFs and Foxo1,3,4 MEFs were treated with increasing concentrations of Lapatinib for 3 days and colony formation was observed for 1 week. Cells were then stained with crystal violet and absorbance measured at 592 nm (right panel). The colony formation capacity was analysed by two-way ANOVA and found to be significantly different (***p < 0.00001) from one another. d Best-fit curves were generated to determine IC for each cell line against Lapatinib in terms of clonogenicity. Numerical data represent the average ± SEM of three different experiments (**** P < 0.0001) Fig. 4 SIRT inhibitors limit long-term cell growth and colony formation capacity of high and low metastatic NPC cells. a 5-8F and 6-10B cells were seeded in 6-well plates and treated with the drug concentration indicated for 72 h. Then, cell culture media was removed and colony formation observed for 15 days. At the end of this time period, cells were fixed with 4% paraformaldehyde and stained with crystal violet. Representative pictures from triplicate experiments are shown. b The stain was solubilised with 33% acetic acid and absorbance at 592 nm were obtained. Best fit-curves were generated to determine the IC of each drug in 5-8F and 6-10B cells 50 Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 10 of 17 Fig. 5 NPC cells show increased Lapatinib sensitivity when combined with AGK2 or AK1 but not Sirtinol or Ex527. a Cells (3 × 10 / well) were seeded in 96-well plates and treated with increasing concentrations of Lapatinib for 48 h before staining and measurement of optical density at 492 nm. Data were analysed by generating curves using Graph-pad Prism. b Best-fit curves were generated to determine the effect of AGK2 or AK1 on reducing the IC of Lapatinib for each NPC cells. Data represent the average ± SEM of three different experiments (**** P < 0.0001) depletion of SIRT2 can enhance the antiproliferative cytotoxic and cytostatic functions of Lapatinib in effects of Lapatinib in the 5-8F and 6-10B NPC cells both the sensitive and resistant NPC cells, consistent using clonogenic assays. Knock-down of SIRT2 was with the findings from the SIRT2 pharmaceutical in- confirmed by western blotting analysis before the hibitors, AK1 and AGK2. Collectively, these results NPC cells were subjects to clonogenic assays demonstrated that selective inhibition of SIRT2 can (Fig. 7a). The results showed that despite the subtle promote Lapatinib sensitivity, indicating SIRT2 is a effects, depleting SIRT2 has additive effects on Lapa- potential target for overcoming Lapatinib resistance tinib when compared with the non-silencing siRNA in NPCs. controls in both the NPC cell lines (2 way-ANOVA, ****P < 0.0001, respectively) (Fig. 7b). Significantly, Inhibition and silencing of SIRT2 can combine with the SIRT2-siRNA enhanced the anti-proliferative Lapatinib to promote FOXO3 acetylation functions of Lapatinib in both the resistant 5-8F and To confirm that SIRT2 can modulate the ability of (IC : 4.64 ± 0.38 to 2.85 ± 0.41 μM) and sensitive 6- Lapatinib to mediate FOXO3 acetylation, we next 10B (IC : 1.12 ± 0.10 to 0.90 ± 0.10 μM) cells determined if chemical inhibition or silencing of (Fig. 7c). In consequence, the results suggest that SIRT2 can affect FOXO3 acetylation in the absence SIRT2 knockdown can significantly enhance the or presence of Lapatinib treatment using co- Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 11 of 17 Fig. 6 (See legend on next page.) Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 12 of 17 (See figure on previous page.) Fig. 6 Lapatinib in combination with AGK2/AK1 increase long term cell sensitivity compared to Lapatinib alone. a 5-8F and 6-10B cells were seeded in 6-well plates and treated with the Lapatinib concentration indicated for 72 h. Five micromolar AGK2 and AK1 was used for combination treatment. Cell culture media was then removed and colony formation observed for 15 days. At the end of this time period, cells were fixed with 4% paraformaldehyde and stained with crystal violet. Representative pictures from triplicate experiments are shown. b The stain was solubilised with 33% acetic acid and absorbance at 592 nm were obtained. Graphs were generated to show the effect of combination treatment. c Best fit-curves were generated to determine the effect of AGK2/AK1 on the IC of Lapatinib in 5-8F and 6-10B cells. immunoprecipitation (IP) assays (Fig. 8). Relative cell carcinoma [28]; however, not all patients benefit FOXO3 acetylation levels were then determined by from Lapatinib-based treatments [29, 30]. In the comparing the ratio of acetylated to total FOXO3 present study, we found that the highly metastatic co-precipitated. The computed results showed that (C666–1 and 5-8F) NPC lines are significantly more SIRT2-depletion by siRNA or -inhibition by AGK2 Lapatinib resistant compared to poorly metastatic can induce FOXO3 acetylation in both the Lapatinib lines (6-10B, TW01 and HK-1), suggesting that the resistant 5-8F and the sensitive 6-10B cell lines molecular mechanisms involved in metastasis in NPC (Fig. 8a and b). The chemical inhibitor AGK2 is may overlap with those responsible for the develop- more effective in inducing FOXO3 acetylation than ment of Lapatinib resistance. SIRT2 siRNA probably because it is more effective FOXO3 is a tumour suppressive transcription factor in inhibiting SIRT2 activity. Importantly, both chem- and an important modulator of sensitivity to chemo- ical inhibition and siRNA-depletion of SIRT2 en- therapy [31, 32]. FOXO3 inhibits cell growth by driv- hanced the FOXO3 acetylation induced by Lapatinib ing the transcription of genes, such as Bim, FasL, Kip1 in both the Lapatinib resistant 5-8F and sensitive 6- p27 , p130 (RB2), essential for cell proliferative ar- 10B cell lines, except for the 6-10B cells treated with rest, cell death and differentiation [31, 32]. Con- SIRT2 siRNA. The low levels of acetylated FOXO3 versely, inactivation of FOXO3 is a crucial step for precipitated from the sensitive 6-10B following com- oncogenic transformation and the development of bined Lapatinib and SIRT2-siRNA treatment is likely cytotoxic drug resistance [31, 32]. Previous work has to be due to the high levels of global protein degrad- also suggested that FOXO3 mediates the cytotoxicity ation as a result of cell death caused by the combin- of Lapatinib in breast cancer [33, 34]. In here, we ation of SIRT2-depletion and Lapatinib treatment. have shown definitively using foxo1/3/4-deficient fi- Moreover, Lapatinib also downregulates SIRT2 in the broblasts that FOXO3 along with FOXO1 and −4are sensitive 6-10B cell line, rendering the effects of involved in mediating the cytotoxic functions of Lapa- SIRT2-siRNA redundant. Overall, these IP results tinib. Consistent with this, recent evidence has suggestthatSIRT2 restricts the Lapatinib-mediated showed that natural products, such as curcumin, in- FOXO3 acetylation in NPCs. In summary, our col- hibits the growth and induces apoptosis in NPC cell lective results reveal that SIRT2 has a role in modu- by increasing FOXO3 expression [35]. In addition, the lating FOXO3 acetylation and Lapatinib response in G-quadruplex ligand SYUIQ-5 also induces NPC au- NPCs and that targeting SIRT2 can enhance the sen- tophagy by down-regulating Akt phosphorylation and sitivity of NPCs to Lapatinib and to overcome promoting FOXO3 nuclear translocation [36]. Lapatinib-resistance in NPC. The activity, expression and subcellular localization of FOXO3 are regulated by a diverse range of post- Discussion translational modifications [37]. Phosphorylation by ki- Metastasis and drug resistance are the characteristics nases, particularly Akt (also called PKB) FOXO3, ERK, of aggressive cancers and the major causes for poor IKB kinase (IKK) and serum and glucocorticoid- survival in nasopharyngeal carcinoma (NPC) [12, 13]. regulated kinase (SGK) can enhance FOXO3 nuclear to An understanding of the mechanisms involved in the cytoplasmic shuttling and its degradation [32, 37]. Con- development of NPC metastasis and drug resistance versely, other kinases, such as p38 MAPK [38], stress ac- will aid the development of early diagnostic bio- tivated c-Jun-NH2-kinase (JNK) [39] have also been markers and the identification of potential therapeutic demonstrated to promote FOXO3 activity and expres- targets. Previous studies have reported Lapatinib sion. Consistent with previous studies with EGFR1/ could effectively induce cell death and autophagy in HER2(ERBB2)-targeted tyrosine kinase inhibitors (TKIs) NPC cells [12, 13]. Clinical studies also suggest that [34, 40], we found that Lapatinib can cause FOXO3- Lapatinib alone or combined with standard chemo- dephosphorylation (T32) and the downregulation of its therapies are well-tolerated and promote patient sur- target FOXM1 in Lapatinib-sensitive NPC cells. How- vival in metastatic/recurrent head and neck squamous ever, although EGFR1/HER2 inhibitors have previously Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 13 of 17 Fig. 7 (See legend on next page.) Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 14 of 17 (See figure on previous page.) Fig. 7 Silencing of SIRT2 increases long-term Lapatinib cytotoxicity in NPC cells. a NPC cells were transfected with siNSC and siSIRT2 smartpools. After 24 h both siNSC and siSIRT2-transfected cells were treated with DMSO or 5 μM Lapatinib for another 24 h. Forty-eight h after transfection, cells were harvested and SIRT2 protein knockdown was confirmed by western blot analysis. Protein levels were determined by using ImageJ and the protein levels relative to β-tubulin are shown below protein bands as ratios to the 0 h Lapatinib controls. b Forty-eight h after transfection, 1000 cells were seeded per well, into 6-well plates and then treated with the Lapatinib concentrations of 0, 0.01, 0.05, 0.1, 1 and 5 μM for 72 h and colony formation observed for 15 days. At the end of this time period, cells were fixed with 4% paraformaldehyde and stained with crystal violet. The stain was solubilised with 33% acetic acid and absorbance at 592 nm were obtained. Graphs were generated to show the effect of silencing SIRT2 on Lapatinib sensitivity. c Best fit-curves were generated to determine the effect of SIRT2 knock down on the IC of Lapatinib in 5-8F and 6-10B cells. Numerical data represent the average ± SEM of three different experiments (**** P < 0.0001) been shown to modulate p38 and JNK activity [41, 42], The pan-SIRT inhibitor sirtinol has previously been we did not observe any substantial changes in p38 and shown to induce p53 acetylation and cell death JNK phosphorylation/activity in NPC cells in response through targeting both SIRT1 and SIRT2 [50]. How- to Lapatinib treatment, suggesting it is unlikely that ever, like EX527, the sirtinol concentrations Lapatinib modulates FOXO3 activity via p38 and JNK in employed here preferentially inhibit SIRT1 and have these NPC cells. FOXM1 is a potent oncogene negatively limited activities towards SIRT2 [50]. Therefore, regulated by FOXO3 [32] and contributes to cancer drug these observations support further the notion that resistance through controlling many genes involved in SIRT2 specifically moderates the cytotoxic action of cell proliferation, survival, DNA repair, and tubulin Lapatinib and mediates Lapatinib resistance, inde- destabilization [32, 43, 44]. Consistent with a role for pendently of SIRT1. The reason for the finding that FOXO3 in Lapatinib action in NPC cells, we found that both the SIRT inhibitors sirtinol and EX527 oppose FOXM1 expression is repressed by Lapatinib in the sen- the cytotoxic functions of Lapatinib is unclear. How- sitive cells but remains constitutively high in the resist- ever, a context dependent tumour suppressive role ant NPC cells, suggesting a role of FOXM1 in NPC for SIRT1 has previously been proposed [26]. In Lapatinib resistance. In agreement, FOXM1 has been concordance, SIRT1-deficient cells have been shown shown to be able to mediate paclitaxel resistance by to be defective in the ability to normally upregulate regulating the gene transcription of the ABCC5 drug ef- the p19(ARF) senescence mediator and its potent flux transporter in NPC [18]. In addition, overexpression downstream tumour suppressor p53 [26], and this of FOXM1 is directly associated with metastasis in NPC, might account for the ability of sirtinol and EX527 and targeting FOXM1 with inhibitors or siRNA knock- to attenuate the antiproliferative function of Lapati- down can effectively restrict the cell proliferation, migra- nib. Inhibition of SIRT2 by chemical inhibitor or si- tion, angiogenesis and survival of NPC cells [29, 45]. lencing significantly enhances the cytotoxicity of Besides phosphorylation, FOXO3 is also regulated Lapatinib not only in the sensitive but also in the re- by other post-translational modifications such as sistant NPC cells, suggesting that SIRT2 not only acetylation, methylation, ubiquitination and glycosyl- modulates the cytotoxic functions of Lapatinib in the ation (Zhao et al., 2011). The nuclear sirtuins SIRT1, sensitive NPC cells, but it also mediates Lapatinib SIRT2 and SIRT6 have been shown to negatively resistance. This implies that targeting SIRT2 can en- regulate FOXO3 acetylation and its activity [46–48]. hance the cytotoxicity of Lapatinib and may repre- In the present study, we found that SIRT2 specific- sent a novel strategy for overcoming Lapatinib ally modulates the cytotoxicity of Lapatinib and is resistance in NPC. This role of SIRT2 in modulating linked to Lapatinib resistance using specific chemical Lapatinib response and sensitivity is confirmed by inhibitors and SIRT2 siRNAs. Although our findings SIRT2 depletion experiments showing silencing show that all four SIRT inhibitors (i.e. sirtinol, SIRT2 can enhance the cytotoxicity in both Lapati- EX527, AGK2 and AK1) can limit NPC cell prolifer- nib sensitive and resistant NPC cells. Although the ation, only the SIRT2 specific inhibitors AGK2 and siRNA depletion approach has less off-target effects, AK1 function cooperatively with Lapatinib, support- it also relies on high delivery efficiencies; the incom- ing the idea that SIRT2 specifically modulates Lapa- plete SIRT2 depletion might account for the small tinib response and resistance. Nevertheless, all four additional effects on Lapatinib. SIRT inhibitors can restrict normal NPC cell viability In agreement, overexpression of SIRT2 has been shown and clonogenicity, and this suggests that the nuclear to essentially lengthen the M phase and defer mitotic exit sirtuins SIRT1, −2and − 6 detected in NPC are all [15]. Moreover, SIRT2 can induce the cell proliferation of potential oncogenes. In agreement, SIRT1 upregula- leukaemia and resistance to apoptosis [51]. Conversely, tion has been shown to be associated with tumour decreased SIRT2 activity can reduce glioma cell survival progression and metastasis in NPC biopsies [49]. by induced both necrosis and apoptosis [52] and limit Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 15 of 17 Fig. 8 Inhibition of SIRT2 by AGK2 as well as silencing of SIRT2 in combination with Lapatinib upregulates acetylated FOXO3 levels in 5-8F and 6- 10B cells. a NPC were treated with AGK2 alone or in combination with Lapatinib for 48 h. Proteins were obtained from whole cell extracts and assessed by co-immunoprecipitation (co-IP) with an anti-FOXO3 antibody. Subsequent immunoblotting was performed using antibodies against Ac-Lys and FOXO3. The anti-IgG was used as a negative control. Acetylated FOXO3 levels were determined by using ImageJ analysis and representative bar diagram are shown (bottom panel after the blot). b NPC cells were transiently transfected with siNSC and siSIRT2 and treated with 5 μM Lapatinib for 24 h. Proteins were obtained from whole cell extracts and assessed by Co-immunoprecipitation (Co-IP) with an anti- FOXO3 antibody. Subsequent immunoblotting was performed using antibodies against Ac-Lys and FOXO3. Acetylated and total FOXO3 levels were determined by using ImageJ analysis and representative bar diagrams demonstrating relative acetylated to total FOXO3 ratios are shown (bottom panel after the blot). Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 16 of 17 melanoma cell growth and clonogenicity [53]. Further- Ethics approval and consent to participate Not applicable. more, overexpression of SIRT1 and SIRT2 can also confer resistance to chemotherapy such as paclitaxel [54]. Consent for publication Furthermore, our co-IP experiments also show that Not applicable the Lapatinib induces FOXO3 acetylation and that in- Competing interests hibition of SIRT2 by chemical inhibitor or silencing also The authors declare that they have no competing interests. promotes FOXO3 acetylation in NPC cells. Importantly, SIRT2 inhibition or silencing can combine with Lapati- Author details Department of Surgery and Cancer, Imperial College London, Hammersmith nib to cause further enhancement of FOXO3 acetylation Hospital Campus, London W12 0NN, UK. Graduate Program in Molecular than Lapatinib treatment alone in both sensitive and re- Medicine, Multidisciplinary Unit, Faculty of Science, Mahidol University, sistant NPC cells, suggesting that SIRT2 can moderate Bangkok, Thailand. Department of Biochemistry, Faculty of Science, Mahidol University, Bangkok, Thailand. the cytotoxic functions of Lapatinib and promote resist- ance through limiting FOXO3 acetylation. In agreement, Received: 24 June 2019 Accepted: 29 October 2019 FOXO3 deacetylation by SIRT2 has previously been re- ported to enhance FOXO3 ubiquitination and proteaso- References mal degradation [55]. 1. Wei WI, Sham JST. Nasopharyngeal carcinoma. Lancet. 2005;365(9476):2041–54. 2. Mahdavifar N, Ghoncheh M, Mohammadian-Hafshejani A, Khosravi B, Salehiniya H. Epidemiology and inequality in the incidence and mortality of Conclusion nasopharynx cancer in Asia. Osong Public Health Res Perspect. 2016;7(6): Collectively, these data suggest that the cytotoxic func- 360–72. 3. Ma BBY, Chan ATC. Recent perspectives in the role of chemotherapy in the tions of Lapatinib are mediated through the acetylation management of advanced nasopharyngeal carcinoma. Cancer. 2005;103(1): and activation of FOXO3, and that SIRT2 can specific- 22–31. ally antagonise the cytotoxicity of Lapatinib through me- 4. Hsu CH, Chen CL, Hong RL, Chen KL, Lin JF, Cheng AL. Prognostic value of multidrug resistance 1, glutathione-<i>S</i>−transferase-π and p53 in diating FOXO3 deacetylation in both sensitive and advanced nasopharyngeal carcinoma treated with systemic chemotherapy. resistant NPC cells. The present findings also suggest Oncology. 2002;62(4):305–12. that SIRT2 can be an important biomarker for meta- 5. Jiang R-D, Zhang L-X, Yue W, Zhu Y-F, Lu H-J, Liu X, et al. Establishment of a human nasopharyngeal carcinoma drug-resistant cell line CNE2/DDP and static and Lapatinib resistant NPC and that targeting the screening of drug-resistant genes; 2003. p. 337–45. SIRT2-FOXO3 axis may provide a means to treat NPC 6. Cheung HW, Jin D-Y, Ling M-t, Wong YC, Wang Q, Tsao SW, et al. Mitotic and to overcome NPC chemoresistance. arrest deficient 2 expression induces chemosensitization to a DNA- damaging agent, cisplatin, in nasopharyngeal carcinoma cells. Cancer Res. 2005;65(4):1450. Abbreviations 7. Wang J, Wang H, Zhao L, Fan S, Yang Z, Gao F, et al. Down-regulation of P- EGFR: Epidermal growth factor receptor; FOX: Forkhead box; glycoprotein is associated with resistance to cisplatin and VP-16 in human NPC: Nasopharyngeal carcinoma; SIRT2: Sirtuin-2 lung cancer cell lines. Anticancer Res. 2010;30(9):3593–8. 8. Pan Y, Zhou F, Zhang R, Claret FX. Stat3 inhibitor stattic exhibits potent Acknowledgements antitumor activity and induces chemo- and radio-sensitivity in Not Applicable nasopharyngeal carcinoma. PLoS One. 2013;8(1):e54565. 9. Ma BB, Poon TC, To KF, Zee B, Mo FK, Chan CM, et al. Prognostic significance of tumor angiogenesis, Ki 67, p53 oncoprotein, epidermal Authors’ contributions growth factor receptor and HER2 receptor protein expression in Conceptualization, EW-FL, TJ, SA and ZM; Methodology, EW-FL, ZM and SA; undifferentiated nasopharyngeal carcinoma--a prospective study. Head Validation, SA, ZM and EW-FL; Formal Analysis, SA and ZM; Investigation, SA, Neck. 2003;25(10):864–72. ZM and EW-FL; Resources, EW-FL and TJ; Data Curation, ZM, SY, SA, YJ and 10. Jin O, Chen S, Li G, Yao K. Expression of CerbB-2 and EGFR mRNA in human GA; Writing – Original Draft Preparation, EW-FL, SA and ZM; Writing – Review nasopharyngeal carcinomas and pericarcinomatous tissues. Hunan Yi Ke Da & Editing, ZM, SY and GA; Supervision, EW-FL, TJ and EY; Project Administra- Xue Xue Bao. 1997;22(6):487–90. tion, EW-FL and TJ. All authors read and approved the final manuscript. 11. Ma BB, Lui VW, Poon FF, Wong SC, To KF, Wong E, et al. Preclinical activity of gefitinib in non-keratinizing nasopharyngeal carcinoma cell lines and Funding biomarkers of response. Investig New Drugs. 2010;28(3):326–33. Eric W.-F. Lam’s work is supported by MRC (MR/N012097/1), CRUK (C37/ 12. Liu L, Huang P, Wang Z, Chen N, Tang C, Lin Z, et al. Inhibition of eEF- A12011), Breast Cancer Now (2012MayPR070, 2012NovPhD016, 2 kinase sensitizes human nasopharyngeal carcinoma cells to Lapatinib- 2014NovPhD326), the Cancer Research UK Imperial Centre, Imperial ECMC induced apoptosis through the Src and Erk pathways. BMC Cancer. and NIHR Imperial BRC. Tavan Janvilisri was supported by Thailand Research 2016;16:813. Fund (BRG5980003). Glowi Alasiri is a recipient of a scholarship from the 13. Lui VWY, Lau CPY, Ho K, Ng MHL, Cheng SH, Tsao S-W, et al. Anti-invasion, Saudi Arabian Cultural Bureau in London (MSU434). Sathid Aimjongjun’s anti-proliferation and anoikis-sensitization activities of Lapatinib in work was supported by Newton Fund, Ph. D placement programme and The nasopharyngeal carcinoma cells. Investig New Drugs. 2011;29(6):1241–52. Royal Golden Jubilee Ph.D. Program. Zimam Mahmud was supported by a 14. Wilson MSC, Brosens JJ, Schwenen HDC, Lam EW-F. FOXO and FOXM1 in fellowship from the Commonwealth Scholarship Commission (BDCS-2015- cancer: the FOXO-FOXM1 axis shapes the outcome of cancer 63). The funding bodies had no role on the design, data collection, analysis chemotherapy. Curr Drug Targets. 2011;12(9):1256–66. and manuscript writing of this study. 15. Olmos Y, Brosens JJ, Lam EW. Interplay between SIRT proteins and tumour suppressor transcription factors in chemotherapeutic resistance of cancer. Availability of data and materials Drug Resist Updat. 2011;14(1):35–44. Data sharing is not applicable to this article as no datasets were generated 16. Daitoku H, Sakamaki J-i, Fukamizu A. Regulation of FoxO transcription factors by or analysed during the current study. acetylation and protein–protein interactions. Mol Cell Res. 2011;1813(11):1954–60. Aimjongjun et al. BMC Cancer (2019) 19:1106 Page 17 of 17 17. Jiang L, Wang P, Chen H. Overexpression of FOXM1 is associated with 40. McGovern UB, Francis RE, Peck B, Guest SK, Wang J, Myatt SS, et al. Gefitinib metastases of nasopharyngeal carcinoma. Ups J Med Sci. 2014;119(4):324–32. (Iressa) represses FOXM1 expression via FOXO3a in breast cancer. Mol 18. Hou Y, Zhu Q, Li Z, Peng Y, Yu X, Yuan B, et al. The FOXM1–ABCC5 axis Cancer Ther. 2009;8(3):582–91. contributes to paclitaxel resistance in nasopharyngeal carcinoma cells. Cell 41. Mora Vidal R, Regufe da Mota S, Hayden A, Markham H, Douglas J, Packham Death Dis. 2017;8(3):e2659. G, et al. Epidermal growth factor receptor family inhibition identifies P38 mitogen-activated protein kinase as a potential therapeutic target in 19. Shou Z, Lin L, Liang J, Li J-L, Chen H-Y. Expression and prognosis of FOXO3a and bladder cancer. Urology. 2018;112:225 e1–7. HIF-1α in nasopharyngeal carcinoma. J Cancer Res Clin Oncol. 2012;138(4):585–93. 42. Gschwantler-Kaulich D, Grunt TW, Muhr D, Wagner R, Kolbl H, Singer CF. 20. Shu CH, Yang WK, Shih YL, Kuo ML, Huang TS. Cell cycle G2/M arrest and HER specific TKIs exert their antineoplastic effects on breast cancer cell lines activation of cyclin-dependent kinases associated with low-dose paclitaxel- through the involvement of STAT5 and JNK. PLoS One. 2016;11(1):e0146311. induced sub-G1 apoptosis. Apoptosis. 1997;2(5):463–70. 43. Carr JR, Park HJ, Wang Z, Kiefer MM, Raychaudhuri P. FoxM1 mediates 21. Song LB, Yan J, Jian SW, Zhang L, Li MZ, Li D, et al. Molecular mechanisms resistance to herceptin and paclitaxel. Cancer Res. 2010;70(12):5054–63. of tumorgenesis and metastasis in nasopharyngeal carcinoma cell sublines. 44. Miranda SCW, Jan JB, Helma DCS, Eric WFL. FOXO and FOXM1 in cancer: Ai Zheng. 2002;21(2):158–62. the FOXO-FOXM1 axis shapes the outcome of cancer chemotherapy. Curr 22. Huang PY, Hong MH, Zhang X, Mai HQ, Luo DH, Zhang L. C-KIT Drug Targets. 2011;12(9):1256–66. overexpression and mutation in nasopharyngeal carcinoma cell lines and 45. Jiang L, Wang P, Chen L, Chen H. Down-regulation of FoxM1 by reactivity of Imatinib on these cell lines. Chin J Cancer. 2010;29(2):131–5. thiostrepton or small interfering RNA inhibits proliferation, transformation 23. Huang DP, Ho JH, Poon YF, Chew EC, Saw D, Lui M, et al. Establishment of a ability and angiogenesis, and induces apoptosis of nasopharyngeal cell line (NPC/HK1) from a differentiated squamous carcinoma of the carcinoma cells. Int J Clin Exp Pathol. 2014;7(9):5450–60. nasopharynx. Int J Cancer. 1980;26(2):127–32. 46. Wang F, Nguyen M, Qin FX-F, Tong Q. SIRT2 deacetylates FOXO3a in response 24. Cheung ST, Huang DP, Hui AB, Lo KW, Ko CW, Tsang YS, et al. to oxidative stress and caloric restriction. Aging Cell. 2007;6(4):505–14. Nasopharyngeal carcinoma cell line (C666-1) consistently harbouring 47. Brunet A, Sweeney LB, Sturgill JF, Chua KF, Greer PL, Lin Y, et al. Stress- Epstein-Barr virus. Int J Cancer. 1999;83(1):121–6. dependent regulation of FOXO transcription factors by the SIRT1 25. van der Vos KE, Coffer PJ. The extending network of FOXO transcriptional deacetylase. Science. 2004;303(5666):2011. target genes. Antioxid Redox Signal. 2011;14(4):579–92. 48. Khongkow M, Olmos Y, Gong C, Gomes AR, Monteiro LJ, Yague E, et al. 26. Chua KF, Mostoslavsky R, Lombard DB, Pang WW, Saito S, Franco S, et al. SIRT6 modulates paclitaxel and epirubicin resistance and survival in breast Mammalian SIRT1 limits replicative life span in response to chronic cancer. Carcinogenesis. 2013;34(7):1476–86. genotoxic stress. Cell Metab. 2005;2(1):67–76. 49. Hu C, Wei W, Chen X, Woodman CB, Yao Y, Nicholls JM, et al. A global view 27. Paik JH, Kollipara R, Chu G, Ji H, Xiao Y, Ding Z, et al. FoxOs are lineage- of the oncogenic landscape in nasopharyngeal carcinoma: an integrated restricted redundant tumor suppressors and regulate endothelial cell analysis at the genetic and expression levels. PLoS One. 2012;7(7):e41055. homeostasis. Cell. 2007;128(2):309–23. 50. Peck B, Chen CY, Ho KK, Di Fruscia P, Myatt SS, Coombes RC, et al. SIRT 28. Weiss JM, Bagley S, Hwang W-T, Bauml J, Olson JG, Cohen RB, et al. inhibitors induce cell death and p53 acetylation through targeting both Capecitabine and Lapatinib for the first-line treatment of metastatic/recurrent SIRT1 and SIRT2. Mol Cancer Ther. 2010;9(4):844–55. head and neck squamous cell carcinoma. Cancer. 2016;122(15):2350–5. 51. Dan L, Klimenkova O, Klimiankou M, Klusman J-H, van den Heuvel-Eibrink 29. Machiels J-PH, Haddad RI, Fayette J, Licitra LF, Tahara M, Vermorken MM, Reinhardt D, et al. The role of sirtuin 2 activation by nicotinamide JB, et al. Afatinib versus methotrexate as second-line treatment in phosphoribosyltransferase in the aberrant proliferation and survival of patients with recurrent or metastatic squamous-cell carcinoma of the myeloid leukemia cells. Haematologica. 2012;97(4):551–9. head and neck progressing on or afterplatinum-basedtherapy (LUX- 52. He X, Nie H, Hong Y, Sheng C, Xia W, Ying W. SIRT2 activity is required for the Head & Neck 1): an open-label, randomised phase 3 trial. Lancet survival of C6 glioma cells. Biochem Biophys Res Commun. 2012;417(1):468–72. Oncol. 2015;16(5):583–94. 53. Wilking-Busch MJ, Ndiaye MA, Liu X, Ahmad N. RNA interference-mediated 30. Harrington KJ, Temam S, D'Cruz A, Jain MM, D'Onofrio I, Manikhas GM, et al. knockdown of SIRT1 and/or SIRT2 in melanoma: identification of Final analysis: a randomized, blinded, placebo (P)-controlled phase III study of downstream targets by large-scale proteomics analysis. J Proteome. 2018; adjuvant postoperative Lapatinib (L) with concurrent chemotherapy and 170:99–109. radiation therapy (CH-RT) in high-risk patients with squamous cell carcinoma 54. Matsushita N, Takami Y, Kimura M, Tachiiri S, Ishiai M, Nakayama T, et al. Role of of the head and neck (SCCHN). J Clin Oncol. 2014;32(15_suppl):6005. NAD-dependent deacetylases SIRT1 and SIRT2 in radiation and cisplatin- 31. Yao S, Fan LY, Lam EW. The FOXO3-FOXM1 axis: a key cancer drug target and induced cell death in vertebrate cells. Genes Cells. 2005;10(4):321–32. a modulator of cancer drug resistance. Semin Cancer Biol. 2018;50:77–89. 55. Wang F, Chan CH, Chen K, Guan X, Lin HK, Tong Q. Deacetylation of FOXO3 32. Myatt SS, Lam EW. The emerging roles of forkhead box (Fox) proteins in by SIRT1 or SIRT2 leads to Skp2-mediated FOXO3 ubiquitination and cancer. Nat Rev Cancer. 2007;7(11):847–59. degradation. Oncogene. 2011;31:1546. 33. Xia W, Bacus S, Hegde P, Husain I, Strum J, Liu L, et al. A model of acquired autoresistance to a potent ErbB2 tyrosine kinase inhibitor and a therapeutic strategy to prevent its onset in breast cancer. Proc Natl Acad Sci U S A. Publisher’sNote 2006;103(20):7795–800. Springer Nature remains neutral with regard to jurisdictional claims in 34. Karadedou CT, Gomes AR, Chen J, Petkovic M, Ho KK, Zwolinska AK, et al. published maps and institutional affiliations. FOXO3a represses VEGF expression through FOXM1-dependent and -independent mechanisms in breast cancer. Oncogene. 2012;31(14):1845–58. 35. Wu J, Tang QIN, Zhao S, Zheng F, Wu YAN, Tang GE, et al. Extracellular signal-regulated kinase signaling-mediated induction and interaction of FOXO3a and p53 contribute to the inhibition of nasopharyngeal carcinoma cell growth by curcumin. Int J Oncol. 2014;45(1):95–103. 36. Zhou W-J, Deng R, Feng G-K, Zhu X-F. A G-quadruplex ligand SYUIQ-5 induces autophagy by inhibiting the Akt-FOXO3a pathway in nasopharyngeal cancer cells; 2009. p. 1049–53. 37. Lam EW, Brosens JJ, Gomes AR, Koo CY. Forkhead box proteins: tuning forks for transcriptional harmony. Nat Rev Cancer. 2013;13(7):482–95. 38. Ho KK, McGuire VA, Koo CY, Muir KW, de Olano N, Maifoshie E, et al. Phosphorylation of FOXO3a on Ser-7 by p38 promotes its nuclear localization in response to doxorubicin. J Biol Chem. 2012;287(2):1545–55. 39. Sunters A, Madureira PA, Pomeranz KM, Aubert M, Brosens JJ, Cook SJ, et al. Paclitaxel-induced nuclear translocation of FOXO3a in breast cancer cells is mediated by c-Jun NH2-terminal kinase and Akt. Cancer Res. 2006;66(1):212–20.

Journal

BMC Cancer – Springer Journals

Published: Nov 14, 2019

There are no references for this article.