Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Maternal behavior in transgenic mice with reduced fibroblast growth factor receptor function in gonadotropin-releasing hormone neurons

Maternal behavior in transgenic mice with reduced fibroblast growth factor receptor function in... Background: Fibroblast growth factors (FGFs) and their receptors (FGFRs) are necessary for the proper development of gonadotropin-releasing hormone (GnRH) neurons, which are key activators of the hypothalamo-pituitary-gonadal axis. Transgenic mice that have the targeted expression of a dominant negative FGFR (dnFGFR) in GnRH neurons (dnFGFR mice) have a 30% decrease of GnRH neurons. Additionally, only 30–40% of the pups born to the transgenic dams survive to weaning age. These data raised the possibility that FGFR defects in GnRH neurons could adversely affect maternal behavior via novel mechanisms. Methods: We first determined if defective maternal behavior in dnFGFR mothers may contribute to poor pup survival by measuring pup retrieval and a battery of maternal behaviors in primiparous control (n = 10–12) and dnFGFR (n = 13–14) mothers. Other endocrine correlates of maternal behaviors, including plasma estradiol levels and hypothalamic pro-oxyphysin and GnRH transcript levels were also determined using enzyme-linked immunoassay and quantitative reverse transcription polymerase chain reaction, respectively. Results: Maternal behaviors (% time crouching with pups, time off pups but not feeding, time feeding, and total number of nesting bouts) were not significantly different in dnFGFR mice. However, dnFGFR dams were more likely to leave their pups scattered and took significantly longer to retrieve each pup compared to control dams. Further, dnFGFR mothers had significantly lower GnRH transcripts and circulating E2, but normal pro-oxyphysin transcript levels. Conclusions: Overall, this study suggests a complex scenario in which a GnRH system compromised by reduced FGF signaling leads to not only suboptimal reproductive physiology, but also suboptimal maternal behavior. Keywords: GnRH, Maternal Behavior, Fibroblast Growth Factor, Estradiol, Pup Retrieval Background Neurons that synthesize gonadotropin-releasing hor- Maternal care is an essential component of offspring mone (GnRH) are the primary hormonal activators of survival in all mammals. In mice, pups are born hairless, the reproductive axis in all vertebrates. Reduced GnRH blind and incapable of regulating body temperature [1]. leads to profound fertility deficits in humans and other Without adequate nourishment and protection from the animals [4-6]. However, a role of GnRH neurons in ma- mother, these newborn pups would die. The critical ternal behavior, which is a critical facet of reproductive components of maternal care in mice include lactation success, has never been examined. Our laboratory has and behaviors such as nesting, pup retrieval, and crouch- generated a transgenic mouse line in which the expres- ing over the pups [2,3]. sion of a dominant-negative fibroblast growth factor re- ceptor (dnFGFR) has been targeted to GnRH neurons using a rat GnRH promoter [7]. Because GnRH neurons * Correspondence: leah.brooks@colorado.edu University of Colorado, Integrative Physiology and Center for Neuroscience, require FGF signaling for proper development [7,8], UCB 354, Clare Small Rm. 114, Boulder, CO 80309-0354, USA © 2012 Brooks et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Brooks et al. Behavioral and Brain Functions 2012, 8:47 Page 2 of 8 http://www.behavioralandbrainfunctions.com/content/8/1/47 these mice suffer a significant reduction in GnRH to weaning age. Percent pup survival on postnatal day neurons after birth [7]. A serendipitous discovery is the (PD) 21 (weaning) was calculated for each dam’s first difficulty involved in propagating the dnFGFR mice three litters. Pup survival to PD1 was calculated in a (Tsai, unpublished data). This is in part due to their separate cohort for control (n = 4) and dnFGFR (n = 6) documented smaller litter size and shorter reproductive litters. We also investigated pup weights on the day of lifespan [7], but may also be due to compromised mater- birth (PD0), PD1 and PD2 (n = 29 and n = 6 for pups nal behavior and offspring survival. These mice are born to control and dnFGFR dams, respectively). useful for examining the connection between the mater- nal behavior and the GnRH system since they harbor Maternal behavior and pup retrieval test only GnRH neuron-specific defects, thereby eliminating We performed a maternal behavior assay and the pup confounding effects originating from other tissues. In a retrieval test to determine if maternal behavior is sense, this model represents a condition in which the impacted by disruptions in the GnRH system. For all GnRH system is significantly compromised but not behavioral observations, primiparous control (n = 10–12) completely incapacitated. Another potential mouse or dnFGFR (n = 13–14) females at 3–6 months of age model with a specific loss of the GnRH system is the were mated to control males. This mating scheme gener- hpg mouse harboring a deletion mutation on the GnRH ated two offspring genotypes: heterozygous dnFGFR (by gene [5]. However, this mouse is sterile and cannot dnFGFR dams) and control pups (by control dams). Our undergo pregnancy or exhibit natural maternal behavior. observations showed that heterozygous dnFGFR and This study investigates maternal behavior of dnFGFR control pups did not survive differently under the care mice, a model characterized by reduced GnRH neuron of the same dam. When heterozygous females were number and difficult offspring propagation. We find mated with control males, 53.1 ± 7.05% (n = 3 dams, specific aspects of maternal behavior are in fact disrupted 9 ± 2.5 pups/litter) of the offspring that survived to in dnFGFR dams. We further examined if deficits in two weaning age were heterozygous dnFGFR pups, with the hormones involved in lactation and maternal behavior, remainder being control pups, a ratio consistent with oxytocin (OT) mRNA and circulating estradiol (E2) [9], Mendelian genetics. These data suggest differences in could contribute to these behavioral disruptions. Overall, pup survival would likely come from the dams, not the our studies suggest a novel scenario in which a GnRH pups themselves. The pregnant females were singly system compromised by reduced FGF signaling can lead housed 3–10 days prior to parturition. The maternal to not only suboptimal reproductive physiology, but also behavior assay and pup retrieval test were performed suboptimal maternal behavior. between the hours 2100 and 2300, and given the high mortality rate of pups born by dnFGFR mothers (see Methods Results section), were only performed within 24 hours of Subjects birth (PD0). Multiple days of testing were not possible dnFGFR mice were generated by Tsai et al. (2005). These due to the early mortality of some pups. During the mice have the expression of a dnFGFR cassette targeted maternal behavioral assay, the dam with her pups were specifically to GnRH neurons using a rat GnRH videotaped undisturbed in the dam’s home cage for an promoter, thereby compromising the ability of GnRH hour. The cage was illuminated by one 40-W red light neurons to respond to FGF signaling. As previously bulb suspended above the cage. These videotapes were described by Tsai et al. (2005), dnFGFR mice were gen- analyzed by an observer blind to the identity of the erated on a background of C57BL/6J × DBA/2JF1. These animals and scored for the following parameters: percent animals were then bred to homozygosity to maximize time crouching over pups (nursing/crouching/resting), dnFGFR expression. Non-transgenic animals resulting percent time off nest (not in contact with pups), percent from heterozygous crosses were used as controls to time feeding, total number of nesting bouts (moving ensure the same genetic background as the transgenic nest material towards nest or rearranging the current mice. All animals were kept on a 12 h light (from 0800 nest material) and the location of the pups in relation to to 2000), and 12 h dark cycle and fed water and rodent the nest immediately before and during testing. chow ad libitum. All animal procedures complied with Immediately after the maternal behavior assay, the pup the protocols approved by the Institutional Animal Care retrieval test was conducted for a total duration of and Use Committee at the University of Colorado. 15 minutes. In this test, the dam was removed from the cage and three of her pups were placed in three different Pup survival corners [10]. The remaining pups were counted and put To determine the breeding success of control or in a separate cage. The dam was then returned to the dnFGFR mice, we evaluated the percentage of pups born center of the home cage and the latencies to sniff one of by control (n = 6) or dnFGFR (n = 22) dams that survive the pups, retrieve each of the three pups, and crouch Brooks et al. Behavioral and Brain Functions 2012, 8:47 Page 3 of 8 http://www.behavioralandbrainfunctions.com/content/8/1/47 over them for longer than a minute were recorded. The E2 enzyme linked immunoassay (EIA) total duration of crouching over the pups and the num- To determine whether disruptions in the GnRH system ber of nesting bouts were also scored. If a dam failed to impact circulating E2, we performed E2 EIA on plasma complete the retrieval in 15 minutes, a score of 900 s samples. Following the pup retrieval test, dams were was assigned. Following the retrieval test, the pups were sacrificed and trunk blood collected into heparinized weighed and the presence of milk in the pups’ stomachs tubes for plasma isolation (n = 4 control and n = 6 was recorded. Dams were subsequently sacrificed by dnFGFR dams). Plasma E2 was measured using a decapitation and total RNA from their brains was isolated commercial EIA kit validated for the mouse (Cayman for quantitative reverse transcription polymerase chain Chemical Company, Ann Arbor, MI) according to man- reaction (qPCR). Trunk blood was also collected for an ufacturer’s instructions. Two serially diluted doses were TM E2 enzyme immunoassay (EIA). measured for each sample using a BioTek Synergy HT plate reader and Gen5 software. Samples with serial Reverse transcription quantitative polymerase chain dilutions not parallel to the standard were excluded from reaction (qPCR) the analysis. The intra- and inter-assay coefficients of In addition to adequate maternal care, pup survival also variation were 13% and 8.2%, respectively, and the limit depends on milk production and ejection, the latter of of detection was 19 pg/ml. which requires the presence of OT. As a control to verify that milk was available to pups born to dnFGFR Data analysis dams, we examined the presence of milk in the pups’ Fisher’s exact test was used to analyze the differences in stomach and quantified the levels of pro-oxyphysin the percentages of dams with scattered pups and dams transcript in the hypothalamus by qPCR. Because with pups scattered that were also non-retrievers. Chi- dnFGFR mice have fewer GnRH neurons, we also square analysis was used to analyze pups with milk in performed GnRH qPCR to determine whether GnRH their stomachs. Friedman’s test was used to determine transcript was reduced. Following the retrieval test, whether pup survival to weaning improved with succes- dams were sacrificed by decapitation and the brains sive litters within each genotype. Two-way repeated dissected and blocked (n = 6 control and n = 7 dnFGFR measures ANOVA followed by the Holm-Sidak multiple dams). The preoptic area (POA) represents the brain comparison test was used to analyze pup weights and region between the posterior borders of olfactory bulbs the latency to retrieve pups. All other data were analyzed and the optic chiasm. The hypothalamus (HYPO) repre- using the Student’s t-test or the Mann–Whitney Rank sents the brain region between the optic chiasm and Sum test. SigmaPlot v.11 (Systat Software Inc.) was used caudal mammillary body. These tissue blocks were for all statistical analyses. If subjects were two standard immediately placed on dry ice and kept frozen at −70°C deviations from the mean they were considered statistical until processing. Total RNA was isolated with TRIzol outliers for that test and were removed from that analysis. (Invitrogen, Carlsbad, CA) according to the manufac- Data were considered significant when p < 0.05. turer’s instructions. One μg of total RNA was used for the synthesis of cDNA using the Superscript III First- Results Strand cDNA Synthesis kit (Invitrogen). Real-time qPCR Pup survival of GnRH and pro-oxyphysin transcripts was performed dnFGFR dams have low pup survival compared to controls. using the Fast Start DNA Master SYBR Green I kit For pups born to control dams (n = 6 dams, 8.5 ± 0.63 (Roche Pharmaceuticals, Indianapolis, IN), as previously pups/litter), 100.0 ± 0.0, 97.2 ± 2.8, and 100.0 ± 0.0% survive described [11]. Absolute quantification was performed to weaning age for litters 1, 2, and 3, respectively. For pups using vectors containing the full-length mouse GnRH or born to dnFGFR dams (n = 22 dams, 6.6 ± 0.41 pups/litter), pro-oxyphysin cDNA as standards. Primer sequences 33.2 ± 9.1, 38 ± 9.7, and 39 ± 9.7% survive to weaning age were: 5′CTGCTGACTGTGTGTTTGGAAGG (forward) for litters 1, 2 and 3, respectively. Pup survival does not and 5′CCTGGCTTCCTCTTCAATCA (reverse) for improve or change with subsequent litters for either GnRH, and 5′-CAGGGCGAAGGCAGGTAGTT (for- genotype (p > 0.05). A separate cohort of mice was ward) and 5′-GTCTCGCTTGCTGCCTGCTT (reverse) analyzed for pup survival to PD1. In this cohort, for pro-oxyphysin. All amplifications were performed 20.8 ± 13.6% of pups born to dnFGFR dams (n = 6 dams, for 40 cycles with annealing temperature of 60°C. 6.2 ± 0.87 pups/litter) survive to PD1 compared to 100% Following data acquisition, data from the POA and survival in pups born to control dams (n = 4 dams, HYPO blocks were combined to determine the total 7.6 ± 1.5 pups/litter) (p = 0.01). There was a significant hypothalamic content of pro-oxyphysin or GnRH interaction between genotype and day (F = 8.33, 2,66 mRNA. These data were presented as “hypothalamic” p < 0.001) and a main effect of genotype (F = 5.77, 1,33 in the Results section. p = 0.022) on pup weight (Figure 1). Holm-Sidak multiple Brooks et al. Behavioral and Brain Functions 2012, 8:47 Page 4 of 8 http://www.behavioralandbrainfunctions.com/content/8/1/47 Figure 1 Pup weights from PD0 to PD2. Pups born to control but not dnFGFR dams gain weight from PD0 to PD2. On PD2, pups born by dnFGFR dams weigh significantly less than pups born to control dams. Control n = 29 and dnFGFR n = 6 pups. Bars represent the mean ± SEM. *p < 0.05 control PD0 vs. PD1; ***p < 0.001 control PD0 vs. PD2 and PD1 vs. PD2; #p < 0.001 PD2 control vs. dnFGFR. Figure 2 Maternal behaviors assessed in control and dnFGFR dams. There were no significant differences between the genotypes in percentage of time each dam spent crouching over pups, off comparison test revealed that pups born to control dams nest, and feeding. Control n = 11 and dnFGFR n = 14 dams. Bars gained weight from PD0 to PD2 (Figure 1). In contrast, represent the mean ± SEM. pups born to dnFGFR dams failed to gain weight and consequently weighed significantly less than pups born to control dams on PD2 (Figure 1; p < 0.001). There was not a main effect of pup or a genotype x pup interaction. main effect of day on pup weight. During the retrieval test, several behavioral parameters were also scored. There were no significant differences Maternal behavior and pup retrieval between genotypes in any of these retrieval test Given the high mortality of pups born to dnFGFR dams behaviors (Table 1). Interestingly, 67% of dams that by PD1 (see Results section), maternal behavior and the failed to retrieve pups during the pup retrieval test pup retrieval test were only performed on PD0. Maternal (compared to only 6% of dams that successfully retrieved behavior of each dam was recorded for one hour and pups) scattered their pups in the maternal behavior assay scored for the following parameters: time crouching (p < 0.001), suggesting dams that scattered pups were over pups in the nest, time off nest but not feeding, unlikely to retrieve their pups. time feeding, and total number of nesting bouts and position of pups in relation to the nest. No differences were found between maternal genotypes for any of the qPCR of pro-oxyphysin and GnRH transcripts maternal behaviors, including time spent crouching over In addition to adequate maternal care, pup survival their pups (Figure 2), time spent off the nest (Figure 2), also depends on milk production and ejection, the time spent feeding (Figure 2), and the total number of latter of which depends on OT. To examine if pups nesting bouts (4.2 ± 0.98, and 5.3 ± 0.98 for control and received milk from the mothers, we determined if dnFGFR dams, respectively). However, there was a pups born to dnFGFR dams had milk in their significant difference between genotypes in the location stomachs, and if OT transcript levels were similar of pups relative to the nest (p = 0.036). Of the 14 between control and dnFGFR dams. Because dnFGFR dnFGFR dams, seven of them had pups scattered outside mice had fewer GnRH neurons [7], we also performed the nest (Figure 3B, C). In comparison, only one of the GnRH qPCR to determine whether GnRH transcript twelve control dams exhibited this pup-scattering was also reduced. The percentages of pups with milk phenotype (Figure 3A, C). in their stomachs were similar between control and Two-way repeated ANOVA indicated a significant dnFGFR mothers (Figure 5A; p = 0.947). No difference main effect of genotype on pup retrieval (F = 5.036, in hypothalamic pro-oxyphysin transcript was found 1, 22 p = 0.035). Holm-Sidak post-hoc analysis revealed that between the control and dnFGFR mothers (Figure 5B; dnFGFR females took significantly longer to retrieve p = 0.628). In contrast, there was a significant effect of each pup to the nest than control (Figure 4; p = 0.036, genotype on the amount of hypothalamic GnRH transcript 0.034, 0.036 for Pup 1, 2, 3, respectively). There was no (Figure 5C; p = 0.007). Brooks et al. Behavioral and Brain Functions 2012, 8:47 Page 5 of 8 http://www.behavioralandbrainfunctions.com/content/8/1/47 Figure 4 The time required to retrieve each pup was assessed in control and dnFGFR dams during the pup retrieval test. It took dnFGFR females significantly longer to retrieve each pup. Control n = 10 and dnFGFR n = 14 dams. Bars represent the mean ± SEM. *p < 0.05 compared to control for each pup. through mechanisms unrelated to reduced fertility. Namely, a GnRH system compromised by FGF signaling deficiency disrupts important pup-gathering and retrieval behaviors, thereby contributing to reduced offspring care. Although a direct causal link has not been established, this reduced care may contribute to the reduced survival of pups born to dnFGFR dams. The basis of the behavioral defect is presently unclear, but two mechanisms are possible. The first is supported by indirect evidence and posits that a disrupted GnRH system may directly and adversely affect the maternal behavior neurocircuits upon which it impinges. The second is that the disrupted maternal behavior in dnFGFR mice may be secondary to reduced circulating E2. These two possibilities are discussed below. The first possibility is that the disruption of the GnRH system directly impacts the maternal circuits. GnRH neurons are predominantly found in the medial POA of the hypothalamus (MPA) [12-14]. This heterogeneous Figure 3 Illustration of pup scattering in the home cage during the maternal behavior assay. Significantly more dnFGFR dams had region rostral to the optic chiasm is central to rodent pups scattered around the cage during behavioral testing (B and C) reproductive behaviors, including maternal behavior. At than control dams (A and C). Control n = 12 and dnFGFR n = 14 present, the precise neural connections linking the dams. Bars represent percent of litters found in nest vs. out of nest GnRH system and maternal behavior neurocircuits are for each genotype. *p < 0.05 compared to control. unclear. What is clear is that a number of behavioral neurocircuits such as the dopaminergic, serotonergic, E2 EIA olfactory and oxytocinergic systems have all been found To determine whether disruptions in the GnRH system to play a role in maternal behaviors, and each of these impact the levels of estradiol, we performed an E2 EIA systems has projections to and from the MPA [3,15-19]. on plasma collected from post-partum control and Since GnRH neurons are located in the MPA and dnFGFR dams. dnFGFR mothers had significantly lower express receptors for dopamine, serotonin, and OT, it is circulating E2 than controls (Figure 5D; p = 0.038). possible that the GnRH system and the MPA neurocir- cuits mediating maternal behavior share a number of Discussion common input and output projections [17,20,21]. Sup- In this study, we provide novel evidence that defects in porting this notion, GnRH was shown to act as a neuro- the GnRH system may reduce reproductive success modulator by modifying the responses of cultured MPA Brooks et al. Behavioral and Brain Functions 2012, 8:47 Page 6 of 8 http://www.behavioralandbrainfunctions.com/content/8/1/47 Table 1 Other behavioral assessments during the pup retrieval test Latency Latency Crouch Nesting to sniff to crouch duration bouts (s) (s) (s) (#) Genotype (mean ± SEM) (mean ± SEM) (mean ± SEM) (mean ± SEM) Control 3.80 ± 0.83 236.3 ± 23.06 456.3 ± 54.77 6.3 ± 1.27 dnFGFR 4.92 ± 1.30 491.14 ± 93.10 351.8 ± 90.59 4.2 ± 0.80 Summary of other behaviors during the 15-min pup retrieval test. No differences between genotypes were found for any behavior. Control n = 10 and dnFGFR n = 13–14 dams. neurons to norepinephrine and serotonin [22]. Further, mapping studies with a transneuronal tracer expressed specifically in GnRH neurons reported connections between GnRH neurons and numerous brain regions important for maternal behavior, including the nucleus accumbens, bed nucleus of the stria terminalis, amyg- dala, septum and numerous hypothalamic nuclei [23]. These regions also express type I GnRH receptor [24], which is a G protein-coupled receptor acting primarily through the G protein, G [25]. Interestingly, fore- q/11 brain G knockout mothers failed to retrieve pups to q/11 the nest and had no pup survive to weaning age [26]. These results paralleled our current findings and suggest a decreased activation of the GnRH receptor may adversely impact maternal care through direct or trans- synaptic alterations of the maternal behavior circuits. In addition to having reduced GnRH neuron number, transcript and peptide, dnFGFR mice also have aberrant FGF signaling in GnRH neurons [7]. Because FGF signaling activates a variety of signal transduction path- ways which include phospholipase Cγ, extracellular signal-regulated kinase (ERK), and the phosphoinositide 3-kinase/Akt pathways, the consequent disruption in intracellular signaling can directly alter the biology of GnRH neurons [27]. This may render GnRH neurons less able to respond to afferents that rely upon them to convey signals to the maternal circuitries. For example, olfactory cues are important instigators for maternal behavior in mice [28-31]. Sensory afferents from the olfactory system have been shown to mediate maternal behaviors and also indirectly connect with GnRH neurons [23,32,33]. In this respect, the GnRH system may serve as an intermediary or modulator of olfactory Figure 5 Physiological and endocrine correlates of maternal projections to maternal circuitries in the MPA [23]. behavior in control and dnFGFR mothers. (A) Percent pups with Disruption of GnRH neuronal biology as the result of or without milk in their stomachs that are born by control or FGF signaling deficiency could then lead to defects in dnFGFR dams. N = 46 and 71 for pups born to control and dnFGFR dams, respectively. (B, C) Total hypothalamic pro-oxyphysin (B)or this modulatory or connective role. GnRH (C) transcript in post-partum dams. Control n = 6 and dnFGFR An alternate hypothesis is that a deficiency in E2 in n = 7 dams. (D) Plasma E2 in control and dnFGFR post-partum dams. dnFGFR mice might be the cause of maternal behavior Control n = 4 and dnFGFR n = 6 dams. Bars represent the deficits. The reduction of GnRH neurons, transcript and mean ± SEM. *p < 0.05; **p < 0.01. peptide content in dnFGFR mice may lead to reduced gonadotropins and ultimately circulating E2. Several Brooks et al. Behavioral and Brain Functions 2012, 8:47 Page 7 of 8 http://www.behavioralandbrainfunctions.com/content/8/1/47 lines of evidence support the importance of E2 in rat 2. Shoji H, Kato K: Maternal behavior of primiparous females in inbred strains of mice: a detailed descriptive analysis. Physiol Behav 2006, maternal behavior [34-36]. For example, direct infusions 89:320–328. of E2 into the MPA elicit rat maternal behaviors [37]. 3. Numan M, Insel TR: The neurobiology of parental behavior. New York: Additionally, MPA maternal behavior circuits express Springer; 2003. 4. Chan YM, de Guillebon A, Lang-Muritano M, Plummer L, Cerrato F, Tsiaras S, abundant estrogen receptor alpha (ERα), implicating a Gaspert A, Lavoie HB, Wu CH, Crowley WF Jr, et al: GNRH1 mutations in direct influence of E2. The story has been less clear in patients with idiopathic hypogonadotropic hypogonadism. Proc Natl mice. A study supports a direct link between maternal Acad Sci USA 2009, 106:11703–11708. 5. Mason AJ, Hayflick JS, Zoeller RT, Young WS 3rd, Phillips HS, Nikolics K, behaviors and estrogen signaling by demonstrating that Seeburg PH: A deletion truncating the gonadotropin-releasing hormone ERα knockout (KO) virgin female mice exhibit impaired gene is responsible for hypogonadism in the hpg mouse. Science 1986, pup retrieval and increased infanticide [38]. However, 234:1366–1371. 6. Bouligand J, Ghervan C, Tello JA, Brailly-Tabard S, Salenave S, Chanson P, other evidence suggests that pup-oriented maternal Lombes M, Millar RP, Guiochon-Mantel A, Young J: Isolated familial behaviors in virgin female mice are independent of hypogonadotropic hypogonadism and a GNRH1 mutation. N Engl J Med estrogens [3]. Further, Stolzenberg and Rissman (2011) 2009, 360:2742–2748. 7. Tsai PS, Moenter SM, Postigo HR, El Majdoubi M, Pak TR, Gill JC, Paruthiyil S, have shown repeated pup exposure is the most import- Werner S, Weiner RI: Targeted expression of a dominant-negative ant factor in maternal behavior and that estrogens play fibroblast growth factor (FGF) receptor in gonadotropin-releasing only a facilitatory role [39]. Given the controversial role hormone (GnRH) neurons reduces FGF responsiveness and the size of GnRH neuronal population. Mol Endocrinol 2005, 19:225–236. of E2 in mouse maternal behavior, we favor the hypoth- 8. Dode C, Levilliers J, Dupont JM, De Paepe A, Le Du N, Soussi-Yanicostas N, esis that deficient maternal behavior in dnFGFR mice is Coimbra RS, Delmaghani S, Compain-Nouaille S, Baverel F, et al: Loss-of- more causally linked to a compromised GnRH system function mutations in FGFR1 cause autosomal dominant Kallmann syndrome. Nat Genet 2003, 33:463–465. than reduced E2. 9. Pfaff D, Waters E, Khan Q, Zhang X, Numan M: Minireview: estrogen We describe here an interesting phenomenon in which receptor-initiated mechanisms causal to mammalian reproductive reduced GnRH is coupled to compromised maternal behaviors. Endocrinology 2011, 152:1209–1217. 10. Champagne FA, Curley JP, Keverne EB, Bateson PP: Natural variations in behaviors. A disrupted GnRH system thus adversely postpartum maternal care in inbred and outbred mice. Physiol Behav impacts not only fertility, but may also impact offspring 2007, 91:325–334. survival. Given that hypothalamic OT mRNA and milk 11. Brooks LR, Chung WC, Tsai PS: Abnormal hypothalamic oxytocin system in fibroblast growth factor 8-deficient mice. Endocrine 2010, 38:174–180. availability are normal in dnFGFR dams, lactational 12. Renaud LP, Day TA, Ferguson AV: CNS regulation of reproduction: defects are unlikely the cause of poor survival in pups peptidergic mechanisms. Brain Res Bull 1984, 12:181–186. born to dnFGFR dams. Rather, disrupted maternal 13. Witkin JW, Paden CM, Silverman AJ: The luteinizing hormone-releasing hormone (LHRH) systems in the rat brain. Neuroendocrinology 1982, behavior that reduces pup gathering into the nest is 35:429–438. more likely a contributor to poor pup survival. We have 14. Franklin KBJ, Paxinos G: The mouse brain in stereotaxic coordinates. 3rd proposed two mechanisms that could cause this edition. New York: Academic Press; 2007. disrupted maternal behavior in dnFGFR mice: (1) sub- 15. Leckman JF, Herman AE: Maternal behavior and developmental psychopathology. Biol Psychiatry 2002, 51:27–43. optimal GnRH connectivity with maternal neurocircuits 16. Flannelly KJ, Kemble ED, Blanchard DC, Blanchard RJ: Effects of septal- as a result of decreased FGF signaling and (2) reduced forebrain lesions on maternal aggression and maternal care. E2 in dnFGFR mice leading to impaired maternal neurocir- Behav Neural Biol 1986, 45:17–30. 17. Gammie SC: Current models and future directions for understanding the cuits. Regardless of the mechanism, this study establishes neural circuitries of maternal behaviors in rodents. Behav Cogn Neurosci that a functional GnRH system guided by FGF signaling is Rev 2005, 4:119–135. critical for maternal behaviors and potentially offspring 18. Calamandrei G, Keverne EB: Differential expression of Fos protein in the brain of female mice dependent on pup sensory cues and maternal survival. experience. Behav Neurosci 1994, 108:113–120. 19. Lerch-Haner JK, Frierson D, Crawford LK, Beck SG, Deneris ES: Serotonergic Competing interests transcriptional programming determines maternal behavior and The authors declare that they have no competing interests. offspring survival. Nat Neurosci 2008, 11:1001–1003. 20. Li S, Pelletier G: Involvement of serotonin in the regulation of GnRH gene Authors’ contributions expression in the male rat brain. Neuropeptides 1995, 29:21–25. LRB wrote the manuscript and designed, performed, and analyzed all of the 21. Numan M, Stolzenberg DS: Medial preoptic area interactions with experiments. CDVL participated in conducting the behavioral experiments. dopamine neural systems in the control of the onset and maintenance WCC contributed to the design. PST participated in the design, analysis, and of maternal behavior in rats. Front Neuroendocrinol 2009, 30:46–64. contributed to the manuscript. All authors read and approved the final 22. Pan JT, Kow LM, Pfaff DW: Modulatory actions of luteinizing hormone- manuscript. releasing hormone on electrical activity of preoptic neurons in brain slices. Neuroscience 1988, 27:623–628. Acknowledgements 23. Boehm U, Zou Z, Buck LB: Feedback loops link odor and pheromone This work was supported by NIH grant R01 HD042634 to PST and the signaling with reproduction. Cell 2005, 123:683–695. Endocrine Society Summer Fellowship to LRB. 24. Albertson AJ, Navratil A, Mignot M, Dufourny L, Cherrington B, Skinner DC: Immunoreactive GnRH type I receptors in the mouse and sheep brain. Received: 13 March 2012 Accepted: 2 September 2012 J Chem Neuroanat 2008, 35:326–333. Published: 5 September 2012 25. Millar RP, Lu Z-L, Pawson AJ, Flanagan CA, Morgan K, Maudsley SR: References Gonadotropin-Releasing Hormone Receptors. Endocr Rev 2004, 1. Crawley J: What’s wrong with my mouse. New York: Wiley-Liss; 2000. 25:235–275. Brooks et al. Behavioral and Brain Functions 2012, 8:47 Page 8 of 8 http://www.behavioralandbrainfunctions.com/content/8/1/47 26. Wettschureck N, Moers A, Hamalainen T, Lemberger T, Schutz G, Offermanns S: Heterotrimeric G proteins of the Gq/11 family are crucial for the induction of maternal behavior in mice. Mol Cell Biol 2004, 24:8048–8054. 27. Reuss B, von Bohlen und Halbach O: Fibroblast growth factors and their receptors in the central nervous system. Cell Tissue Res 2003, 313:139–157. 28. Belluscio L, Gold GH, Nemes A, Axel R: Mice deficient in G(olf) are anosmic. Neuron 1998, 20:69–81. 29. Gandelman R, Zarrow MX, Denenberg VH: Reproductive and maternal performance in the mouse following removal of the olfactory bulbs. J Reprod Fertil 1972, 28:453–456. 30. Gandelman R, Zarrow MX, Denenberg VH, Myers M: Olfactory bulb removal eliminates maternal behavior in the mouse. Science 1971, 171:210–211. 31. Zarrow MX, Gandelman R, Denenberg VH: Lack of nest building and maternal behavior in the mouse following olfactory bulb removal. Horm Behav 1971, 2:227–238. 32. Samuelsen CL, Meredith M: Categorization of biologically relevant chemical signals in the medial amygdala. Brain Res 2009, 1263:33–42. 33. Dulac C, Torello AT: Molecular detection of pheromone signals in mammals: from genes to behaviour. Nat Rev Neurosci 2003, 4:551–562. 34. Pedersen CA: Oxytocin control of maternal behavior. Regulation by sex steroids and offspring stimuli. Ann N Y Acad Sci 1997, 807:126–145. 35. Champagne FA, Weaver IC, Diorio J, Sharma S, Meaney MJ: Natural variations in maternal care are associated with estrogen receptor alpha expression and estrogen sensitivity in the medial preoptic area. Endocrinology 2003, 144:4720–4724. 36. Numan M, Rosenblatt JS, Komisaruk BR: Medial preoptic area and onset of maternal behavior in the rat. J Comp Physiol Psychol 1977, 91:146–164. 37. Champagne FA, Weaver IC, Diorio J, Dymov S, Szyf M, Meaney MJ: Maternal care associated with methylation of the estrogen receptor-alpha1b promoter and estrogen receptor-alpha expression in the medial preoptic area of female offspring. Endocrinology 2006, 147:2909–2915. 38. Ogawa S, Eng V, Taylor J, Lubahn DB, Korach KS, Pfaff DW: Roles of estrogen receptor-alpha gene expression in reproduction-related behaviors in female mice. Endocrinology 1998, 139:5070–5081. 39. Stolzenberg DS, Rissman EF: Oestrogen-independent, experience-induced maternal behaviour in female mice. J Neuroendocrinol 2011, 23:345–354. doi:10.1186/1744-9081-8-47 Cite this article as: Brooks et al.: Maternal behavior in transgenic mice with reduced fibroblast growth factor receptor function in gonadotropin-releasing hormone neurons. Behavioral and Brain Functions 2012 8:47. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Behavioral and Brain Functions Springer Journals

Maternal behavior in transgenic mice with reduced fibroblast growth factor receptor function in gonadotropin-releasing hormone neurons

Download PDF
8 pages

Loading next page...
 
/lp/springer-journals/maternal-behavior-in-transgenic-mice-with-reduced-fibroblast-growth-R2vBa01g0l

References (78)

Publisher
Springer Journals
Copyright
Copyright © 2012 by Brooks et al.; licensee BioMed Central Ltd.
Subject
Biomedicine; Neurosciences; Neurology; Behavioral Therapy; Psychiatry
eISSN
1744-9081
DOI
10.1186/1744-9081-8-47
pmid
22950531
Publisher site
See Article on Publisher Site

Abstract

Background: Fibroblast growth factors (FGFs) and their receptors (FGFRs) are necessary for the proper development of gonadotropin-releasing hormone (GnRH) neurons, which are key activators of the hypothalamo-pituitary-gonadal axis. Transgenic mice that have the targeted expression of a dominant negative FGFR (dnFGFR) in GnRH neurons (dnFGFR mice) have a 30% decrease of GnRH neurons. Additionally, only 30–40% of the pups born to the transgenic dams survive to weaning age. These data raised the possibility that FGFR defects in GnRH neurons could adversely affect maternal behavior via novel mechanisms. Methods: We first determined if defective maternal behavior in dnFGFR mothers may contribute to poor pup survival by measuring pup retrieval and a battery of maternal behaviors in primiparous control (n = 10–12) and dnFGFR (n = 13–14) mothers. Other endocrine correlates of maternal behaviors, including plasma estradiol levels and hypothalamic pro-oxyphysin and GnRH transcript levels were also determined using enzyme-linked immunoassay and quantitative reverse transcription polymerase chain reaction, respectively. Results: Maternal behaviors (% time crouching with pups, time off pups but not feeding, time feeding, and total number of nesting bouts) were not significantly different in dnFGFR mice. However, dnFGFR dams were more likely to leave their pups scattered and took significantly longer to retrieve each pup compared to control dams. Further, dnFGFR mothers had significantly lower GnRH transcripts and circulating E2, but normal pro-oxyphysin transcript levels. Conclusions: Overall, this study suggests a complex scenario in which a GnRH system compromised by reduced FGF signaling leads to not only suboptimal reproductive physiology, but also suboptimal maternal behavior. Keywords: GnRH, Maternal Behavior, Fibroblast Growth Factor, Estradiol, Pup Retrieval Background Neurons that synthesize gonadotropin-releasing hor- Maternal care is an essential component of offspring mone (GnRH) are the primary hormonal activators of survival in all mammals. In mice, pups are born hairless, the reproductive axis in all vertebrates. Reduced GnRH blind and incapable of regulating body temperature [1]. leads to profound fertility deficits in humans and other Without adequate nourishment and protection from the animals [4-6]. However, a role of GnRH neurons in ma- mother, these newborn pups would die. The critical ternal behavior, which is a critical facet of reproductive components of maternal care in mice include lactation success, has never been examined. Our laboratory has and behaviors such as nesting, pup retrieval, and crouch- generated a transgenic mouse line in which the expres- ing over the pups [2,3]. sion of a dominant-negative fibroblast growth factor re- ceptor (dnFGFR) has been targeted to GnRH neurons using a rat GnRH promoter [7]. Because GnRH neurons * Correspondence: leah.brooks@colorado.edu University of Colorado, Integrative Physiology and Center for Neuroscience, require FGF signaling for proper development [7,8], UCB 354, Clare Small Rm. 114, Boulder, CO 80309-0354, USA © 2012 Brooks et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Brooks et al. Behavioral and Brain Functions 2012, 8:47 Page 2 of 8 http://www.behavioralandbrainfunctions.com/content/8/1/47 these mice suffer a significant reduction in GnRH to weaning age. Percent pup survival on postnatal day neurons after birth [7]. A serendipitous discovery is the (PD) 21 (weaning) was calculated for each dam’s first difficulty involved in propagating the dnFGFR mice three litters. Pup survival to PD1 was calculated in a (Tsai, unpublished data). This is in part due to their separate cohort for control (n = 4) and dnFGFR (n = 6) documented smaller litter size and shorter reproductive litters. We also investigated pup weights on the day of lifespan [7], but may also be due to compromised mater- birth (PD0), PD1 and PD2 (n = 29 and n = 6 for pups nal behavior and offspring survival. These mice are born to control and dnFGFR dams, respectively). useful for examining the connection between the mater- nal behavior and the GnRH system since they harbor Maternal behavior and pup retrieval test only GnRH neuron-specific defects, thereby eliminating We performed a maternal behavior assay and the pup confounding effects originating from other tissues. In a retrieval test to determine if maternal behavior is sense, this model represents a condition in which the impacted by disruptions in the GnRH system. For all GnRH system is significantly compromised but not behavioral observations, primiparous control (n = 10–12) completely incapacitated. Another potential mouse or dnFGFR (n = 13–14) females at 3–6 months of age model with a specific loss of the GnRH system is the were mated to control males. This mating scheme gener- hpg mouse harboring a deletion mutation on the GnRH ated two offspring genotypes: heterozygous dnFGFR (by gene [5]. However, this mouse is sterile and cannot dnFGFR dams) and control pups (by control dams). Our undergo pregnancy or exhibit natural maternal behavior. observations showed that heterozygous dnFGFR and This study investigates maternal behavior of dnFGFR control pups did not survive differently under the care mice, a model characterized by reduced GnRH neuron of the same dam. When heterozygous females were number and difficult offspring propagation. We find mated with control males, 53.1 ± 7.05% (n = 3 dams, specific aspects of maternal behavior are in fact disrupted 9 ± 2.5 pups/litter) of the offspring that survived to in dnFGFR dams. We further examined if deficits in two weaning age were heterozygous dnFGFR pups, with the hormones involved in lactation and maternal behavior, remainder being control pups, a ratio consistent with oxytocin (OT) mRNA and circulating estradiol (E2) [9], Mendelian genetics. These data suggest differences in could contribute to these behavioral disruptions. Overall, pup survival would likely come from the dams, not the our studies suggest a novel scenario in which a GnRH pups themselves. The pregnant females were singly system compromised by reduced FGF signaling can lead housed 3–10 days prior to parturition. The maternal to not only suboptimal reproductive physiology, but also behavior assay and pup retrieval test were performed suboptimal maternal behavior. between the hours 2100 and 2300, and given the high mortality rate of pups born by dnFGFR mothers (see Methods Results section), were only performed within 24 hours of Subjects birth (PD0). Multiple days of testing were not possible dnFGFR mice were generated by Tsai et al. (2005). These due to the early mortality of some pups. During the mice have the expression of a dnFGFR cassette targeted maternal behavioral assay, the dam with her pups were specifically to GnRH neurons using a rat GnRH videotaped undisturbed in the dam’s home cage for an promoter, thereby compromising the ability of GnRH hour. The cage was illuminated by one 40-W red light neurons to respond to FGF signaling. As previously bulb suspended above the cage. These videotapes were described by Tsai et al. (2005), dnFGFR mice were gen- analyzed by an observer blind to the identity of the erated on a background of C57BL/6J × DBA/2JF1. These animals and scored for the following parameters: percent animals were then bred to homozygosity to maximize time crouching over pups (nursing/crouching/resting), dnFGFR expression. Non-transgenic animals resulting percent time off nest (not in contact with pups), percent from heterozygous crosses were used as controls to time feeding, total number of nesting bouts (moving ensure the same genetic background as the transgenic nest material towards nest or rearranging the current mice. All animals were kept on a 12 h light (from 0800 nest material) and the location of the pups in relation to to 2000), and 12 h dark cycle and fed water and rodent the nest immediately before and during testing. chow ad libitum. All animal procedures complied with Immediately after the maternal behavior assay, the pup the protocols approved by the Institutional Animal Care retrieval test was conducted for a total duration of and Use Committee at the University of Colorado. 15 minutes. In this test, the dam was removed from the cage and three of her pups were placed in three different Pup survival corners [10]. The remaining pups were counted and put To determine the breeding success of control or in a separate cage. The dam was then returned to the dnFGFR mice, we evaluated the percentage of pups born center of the home cage and the latencies to sniff one of by control (n = 6) or dnFGFR (n = 22) dams that survive the pups, retrieve each of the three pups, and crouch Brooks et al. Behavioral and Brain Functions 2012, 8:47 Page 3 of 8 http://www.behavioralandbrainfunctions.com/content/8/1/47 over them for longer than a minute were recorded. The E2 enzyme linked immunoassay (EIA) total duration of crouching over the pups and the num- To determine whether disruptions in the GnRH system ber of nesting bouts were also scored. If a dam failed to impact circulating E2, we performed E2 EIA on plasma complete the retrieval in 15 minutes, a score of 900 s samples. Following the pup retrieval test, dams were was assigned. Following the retrieval test, the pups were sacrificed and trunk blood collected into heparinized weighed and the presence of milk in the pups’ stomachs tubes for plasma isolation (n = 4 control and n = 6 was recorded. Dams were subsequently sacrificed by dnFGFR dams). Plasma E2 was measured using a decapitation and total RNA from their brains was isolated commercial EIA kit validated for the mouse (Cayman for quantitative reverse transcription polymerase chain Chemical Company, Ann Arbor, MI) according to man- reaction (qPCR). Trunk blood was also collected for an ufacturer’s instructions. Two serially diluted doses were TM E2 enzyme immunoassay (EIA). measured for each sample using a BioTek Synergy HT plate reader and Gen5 software. Samples with serial Reverse transcription quantitative polymerase chain dilutions not parallel to the standard were excluded from reaction (qPCR) the analysis. The intra- and inter-assay coefficients of In addition to adequate maternal care, pup survival also variation were 13% and 8.2%, respectively, and the limit depends on milk production and ejection, the latter of of detection was 19 pg/ml. which requires the presence of OT. As a control to verify that milk was available to pups born to dnFGFR Data analysis dams, we examined the presence of milk in the pups’ Fisher’s exact test was used to analyze the differences in stomach and quantified the levels of pro-oxyphysin the percentages of dams with scattered pups and dams transcript in the hypothalamus by qPCR. Because with pups scattered that were also non-retrievers. Chi- dnFGFR mice have fewer GnRH neurons, we also square analysis was used to analyze pups with milk in performed GnRH qPCR to determine whether GnRH their stomachs. Friedman’s test was used to determine transcript was reduced. Following the retrieval test, whether pup survival to weaning improved with succes- dams were sacrificed by decapitation and the brains sive litters within each genotype. Two-way repeated dissected and blocked (n = 6 control and n = 7 dnFGFR measures ANOVA followed by the Holm-Sidak multiple dams). The preoptic area (POA) represents the brain comparison test was used to analyze pup weights and region between the posterior borders of olfactory bulbs the latency to retrieve pups. All other data were analyzed and the optic chiasm. The hypothalamus (HYPO) repre- using the Student’s t-test or the Mann–Whitney Rank sents the brain region between the optic chiasm and Sum test. SigmaPlot v.11 (Systat Software Inc.) was used caudal mammillary body. These tissue blocks were for all statistical analyses. If subjects were two standard immediately placed on dry ice and kept frozen at −70°C deviations from the mean they were considered statistical until processing. Total RNA was isolated with TRIzol outliers for that test and were removed from that analysis. (Invitrogen, Carlsbad, CA) according to the manufac- Data were considered significant when p < 0.05. turer’s instructions. One μg of total RNA was used for the synthesis of cDNA using the Superscript III First- Results Strand cDNA Synthesis kit (Invitrogen). Real-time qPCR Pup survival of GnRH and pro-oxyphysin transcripts was performed dnFGFR dams have low pup survival compared to controls. using the Fast Start DNA Master SYBR Green I kit For pups born to control dams (n = 6 dams, 8.5 ± 0.63 (Roche Pharmaceuticals, Indianapolis, IN), as previously pups/litter), 100.0 ± 0.0, 97.2 ± 2.8, and 100.0 ± 0.0% survive described [11]. Absolute quantification was performed to weaning age for litters 1, 2, and 3, respectively. For pups using vectors containing the full-length mouse GnRH or born to dnFGFR dams (n = 22 dams, 6.6 ± 0.41 pups/litter), pro-oxyphysin cDNA as standards. Primer sequences 33.2 ± 9.1, 38 ± 9.7, and 39 ± 9.7% survive to weaning age were: 5′CTGCTGACTGTGTGTTTGGAAGG (forward) for litters 1, 2 and 3, respectively. Pup survival does not and 5′CCTGGCTTCCTCTTCAATCA (reverse) for improve or change with subsequent litters for either GnRH, and 5′-CAGGGCGAAGGCAGGTAGTT (for- genotype (p > 0.05). A separate cohort of mice was ward) and 5′-GTCTCGCTTGCTGCCTGCTT (reverse) analyzed for pup survival to PD1. In this cohort, for pro-oxyphysin. All amplifications were performed 20.8 ± 13.6% of pups born to dnFGFR dams (n = 6 dams, for 40 cycles with annealing temperature of 60°C. 6.2 ± 0.87 pups/litter) survive to PD1 compared to 100% Following data acquisition, data from the POA and survival in pups born to control dams (n = 4 dams, HYPO blocks were combined to determine the total 7.6 ± 1.5 pups/litter) (p = 0.01). There was a significant hypothalamic content of pro-oxyphysin or GnRH interaction between genotype and day (F = 8.33, 2,66 mRNA. These data were presented as “hypothalamic” p < 0.001) and a main effect of genotype (F = 5.77, 1,33 in the Results section. p = 0.022) on pup weight (Figure 1). Holm-Sidak multiple Brooks et al. Behavioral and Brain Functions 2012, 8:47 Page 4 of 8 http://www.behavioralandbrainfunctions.com/content/8/1/47 Figure 1 Pup weights from PD0 to PD2. Pups born to control but not dnFGFR dams gain weight from PD0 to PD2. On PD2, pups born by dnFGFR dams weigh significantly less than pups born to control dams. Control n = 29 and dnFGFR n = 6 pups. Bars represent the mean ± SEM. *p < 0.05 control PD0 vs. PD1; ***p < 0.001 control PD0 vs. PD2 and PD1 vs. PD2; #p < 0.001 PD2 control vs. dnFGFR. Figure 2 Maternal behaviors assessed in control and dnFGFR dams. There were no significant differences between the genotypes in percentage of time each dam spent crouching over pups, off comparison test revealed that pups born to control dams nest, and feeding. Control n = 11 and dnFGFR n = 14 dams. Bars gained weight from PD0 to PD2 (Figure 1). In contrast, represent the mean ± SEM. pups born to dnFGFR dams failed to gain weight and consequently weighed significantly less than pups born to control dams on PD2 (Figure 1; p < 0.001). There was not a main effect of pup or a genotype x pup interaction. main effect of day on pup weight. During the retrieval test, several behavioral parameters were also scored. There were no significant differences Maternal behavior and pup retrieval between genotypes in any of these retrieval test Given the high mortality of pups born to dnFGFR dams behaviors (Table 1). Interestingly, 67% of dams that by PD1 (see Results section), maternal behavior and the failed to retrieve pups during the pup retrieval test pup retrieval test were only performed on PD0. Maternal (compared to only 6% of dams that successfully retrieved behavior of each dam was recorded for one hour and pups) scattered their pups in the maternal behavior assay scored for the following parameters: time crouching (p < 0.001), suggesting dams that scattered pups were over pups in the nest, time off nest but not feeding, unlikely to retrieve their pups. time feeding, and total number of nesting bouts and position of pups in relation to the nest. No differences were found between maternal genotypes for any of the qPCR of pro-oxyphysin and GnRH transcripts maternal behaviors, including time spent crouching over In addition to adequate maternal care, pup survival their pups (Figure 2), time spent off the nest (Figure 2), also depends on milk production and ejection, the time spent feeding (Figure 2), and the total number of latter of which depends on OT. To examine if pups nesting bouts (4.2 ± 0.98, and 5.3 ± 0.98 for control and received milk from the mothers, we determined if dnFGFR dams, respectively). However, there was a pups born to dnFGFR dams had milk in their significant difference between genotypes in the location stomachs, and if OT transcript levels were similar of pups relative to the nest (p = 0.036). Of the 14 between control and dnFGFR dams. Because dnFGFR dnFGFR dams, seven of them had pups scattered outside mice had fewer GnRH neurons [7], we also performed the nest (Figure 3B, C). In comparison, only one of the GnRH qPCR to determine whether GnRH transcript twelve control dams exhibited this pup-scattering was also reduced. The percentages of pups with milk phenotype (Figure 3A, C). in their stomachs were similar between control and Two-way repeated ANOVA indicated a significant dnFGFR mothers (Figure 5A; p = 0.947). No difference main effect of genotype on pup retrieval (F = 5.036, in hypothalamic pro-oxyphysin transcript was found 1, 22 p = 0.035). Holm-Sidak post-hoc analysis revealed that between the control and dnFGFR mothers (Figure 5B; dnFGFR females took significantly longer to retrieve p = 0.628). In contrast, there was a significant effect of each pup to the nest than control (Figure 4; p = 0.036, genotype on the amount of hypothalamic GnRH transcript 0.034, 0.036 for Pup 1, 2, 3, respectively). There was no (Figure 5C; p = 0.007). Brooks et al. Behavioral and Brain Functions 2012, 8:47 Page 5 of 8 http://www.behavioralandbrainfunctions.com/content/8/1/47 Figure 4 The time required to retrieve each pup was assessed in control and dnFGFR dams during the pup retrieval test. It took dnFGFR females significantly longer to retrieve each pup. Control n = 10 and dnFGFR n = 14 dams. Bars represent the mean ± SEM. *p < 0.05 compared to control for each pup. through mechanisms unrelated to reduced fertility. Namely, a GnRH system compromised by FGF signaling deficiency disrupts important pup-gathering and retrieval behaviors, thereby contributing to reduced offspring care. Although a direct causal link has not been established, this reduced care may contribute to the reduced survival of pups born to dnFGFR dams. The basis of the behavioral defect is presently unclear, but two mechanisms are possible. The first is supported by indirect evidence and posits that a disrupted GnRH system may directly and adversely affect the maternal behavior neurocircuits upon which it impinges. The second is that the disrupted maternal behavior in dnFGFR mice may be secondary to reduced circulating E2. These two possibilities are discussed below. The first possibility is that the disruption of the GnRH system directly impacts the maternal circuits. GnRH neurons are predominantly found in the medial POA of the hypothalamus (MPA) [12-14]. This heterogeneous Figure 3 Illustration of pup scattering in the home cage during the maternal behavior assay. Significantly more dnFGFR dams had region rostral to the optic chiasm is central to rodent pups scattered around the cage during behavioral testing (B and C) reproductive behaviors, including maternal behavior. At than control dams (A and C). Control n = 12 and dnFGFR n = 14 present, the precise neural connections linking the dams. Bars represent percent of litters found in nest vs. out of nest GnRH system and maternal behavior neurocircuits are for each genotype. *p < 0.05 compared to control. unclear. What is clear is that a number of behavioral neurocircuits such as the dopaminergic, serotonergic, E2 EIA olfactory and oxytocinergic systems have all been found To determine whether disruptions in the GnRH system to play a role in maternal behaviors, and each of these impact the levels of estradiol, we performed an E2 EIA systems has projections to and from the MPA [3,15-19]. on plasma collected from post-partum control and Since GnRH neurons are located in the MPA and dnFGFR dams. dnFGFR mothers had significantly lower express receptors for dopamine, serotonin, and OT, it is circulating E2 than controls (Figure 5D; p = 0.038). possible that the GnRH system and the MPA neurocir- cuits mediating maternal behavior share a number of Discussion common input and output projections [17,20,21]. Sup- In this study, we provide novel evidence that defects in porting this notion, GnRH was shown to act as a neuro- the GnRH system may reduce reproductive success modulator by modifying the responses of cultured MPA Brooks et al. Behavioral and Brain Functions 2012, 8:47 Page 6 of 8 http://www.behavioralandbrainfunctions.com/content/8/1/47 Table 1 Other behavioral assessments during the pup retrieval test Latency Latency Crouch Nesting to sniff to crouch duration bouts (s) (s) (s) (#) Genotype (mean ± SEM) (mean ± SEM) (mean ± SEM) (mean ± SEM) Control 3.80 ± 0.83 236.3 ± 23.06 456.3 ± 54.77 6.3 ± 1.27 dnFGFR 4.92 ± 1.30 491.14 ± 93.10 351.8 ± 90.59 4.2 ± 0.80 Summary of other behaviors during the 15-min pup retrieval test. No differences between genotypes were found for any behavior. Control n = 10 and dnFGFR n = 13–14 dams. neurons to norepinephrine and serotonin [22]. Further, mapping studies with a transneuronal tracer expressed specifically in GnRH neurons reported connections between GnRH neurons and numerous brain regions important for maternal behavior, including the nucleus accumbens, bed nucleus of the stria terminalis, amyg- dala, septum and numerous hypothalamic nuclei [23]. These regions also express type I GnRH receptor [24], which is a G protein-coupled receptor acting primarily through the G protein, G [25]. Interestingly, fore- q/11 brain G knockout mothers failed to retrieve pups to q/11 the nest and had no pup survive to weaning age [26]. These results paralleled our current findings and suggest a decreased activation of the GnRH receptor may adversely impact maternal care through direct or trans- synaptic alterations of the maternal behavior circuits. In addition to having reduced GnRH neuron number, transcript and peptide, dnFGFR mice also have aberrant FGF signaling in GnRH neurons [7]. Because FGF signaling activates a variety of signal transduction path- ways which include phospholipase Cγ, extracellular signal-regulated kinase (ERK), and the phosphoinositide 3-kinase/Akt pathways, the consequent disruption in intracellular signaling can directly alter the biology of GnRH neurons [27]. This may render GnRH neurons less able to respond to afferents that rely upon them to convey signals to the maternal circuitries. For example, olfactory cues are important instigators for maternal behavior in mice [28-31]. Sensory afferents from the olfactory system have been shown to mediate maternal behaviors and also indirectly connect with GnRH neurons [23,32,33]. In this respect, the GnRH system may serve as an intermediary or modulator of olfactory Figure 5 Physiological and endocrine correlates of maternal projections to maternal circuitries in the MPA [23]. behavior in control and dnFGFR mothers. (A) Percent pups with Disruption of GnRH neuronal biology as the result of or without milk in their stomachs that are born by control or FGF signaling deficiency could then lead to defects in dnFGFR dams. N = 46 and 71 for pups born to control and dnFGFR dams, respectively. (B, C) Total hypothalamic pro-oxyphysin (B)or this modulatory or connective role. GnRH (C) transcript in post-partum dams. Control n = 6 and dnFGFR An alternate hypothesis is that a deficiency in E2 in n = 7 dams. (D) Plasma E2 in control and dnFGFR post-partum dams. dnFGFR mice might be the cause of maternal behavior Control n = 4 and dnFGFR n = 6 dams. Bars represent the deficits. The reduction of GnRH neurons, transcript and mean ± SEM. *p < 0.05; **p < 0.01. peptide content in dnFGFR mice may lead to reduced gonadotropins and ultimately circulating E2. Several Brooks et al. Behavioral and Brain Functions 2012, 8:47 Page 7 of 8 http://www.behavioralandbrainfunctions.com/content/8/1/47 lines of evidence support the importance of E2 in rat 2. Shoji H, Kato K: Maternal behavior of primiparous females in inbred strains of mice: a detailed descriptive analysis. Physiol Behav 2006, maternal behavior [34-36]. For example, direct infusions 89:320–328. of E2 into the MPA elicit rat maternal behaviors [37]. 3. Numan M, Insel TR: The neurobiology of parental behavior. New York: Additionally, MPA maternal behavior circuits express Springer; 2003. 4. Chan YM, de Guillebon A, Lang-Muritano M, Plummer L, Cerrato F, Tsiaras S, abundant estrogen receptor alpha (ERα), implicating a Gaspert A, Lavoie HB, Wu CH, Crowley WF Jr, et al: GNRH1 mutations in direct influence of E2. The story has been less clear in patients with idiopathic hypogonadotropic hypogonadism. Proc Natl mice. A study supports a direct link between maternal Acad Sci USA 2009, 106:11703–11708. 5. Mason AJ, Hayflick JS, Zoeller RT, Young WS 3rd, Phillips HS, Nikolics K, behaviors and estrogen signaling by demonstrating that Seeburg PH: A deletion truncating the gonadotropin-releasing hormone ERα knockout (KO) virgin female mice exhibit impaired gene is responsible for hypogonadism in the hpg mouse. Science 1986, pup retrieval and increased infanticide [38]. However, 234:1366–1371. 6. Bouligand J, Ghervan C, Tello JA, Brailly-Tabard S, Salenave S, Chanson P, other evidence suggests that pup-oriented maternal Lombes M, Millar RP, Guiochon-Mantel A, Young J: Isolated familial behaviors in virgin female mice are independent of hypogonadotropic hypogonadism and a GNRH1 mutation. N Engl J Med estrogens [3]. Further, Stolzenberg and Rissman (2011) 2009, 360:2742–2748. 7. Tsai PS, Moenter SM, Postigo HR, El Majdoubi M, Pak TR, Gill JC, Paruthiyil S, have shown repeated pup exposure is the most import- Werner S, Weiner RI: Targeted expression of a dominant-negative ant factor in maternal behavior and that estrogens play fibroblast growth factor (FGF) receptor in gonadotropin-releasing only a facilitatory role [39]. Given the controversial role hormone (GnRH) neurons reduces FGF responsiveness and the size of GnRH neuronal population. Mol Endocrinol 2005, 19:225–236. of E2 in mouse maternal behavior, we favor the hypoth- 8. Dode C, Levilliers J, Dupont JM, De Paepe A, Le Du N, Soussi-Yanicostas N, esis that deficient maternal behavior in dnFGFR mice is Coimbra RS, Delmaghani S, Compain-Nouaille S, Baverel F, et al: Loss-of- more causally linked to a compromised GnRH system function mutations in FGFR1 cause autosomal dominant Kallmann syndrome. Nat Genet 2003, 33:463–465. than reduced E2. 9. Pfaff D, Waters E, Khan Q, Zhang X, Numan M: Minireview: estrogen We describe here an interesting phenomenon in which receptor-initiated mechanisms causal to mammalian reproductive reduced GnRH is coupled to compromised maternal behaviors. Endocrinology 2011, 152:1209–1217. 10. Champagne FA, Curley JP, Keverne EB, Bateson PP: Natural variations in behaviors. A disrupted GnRH system thus adversely postpartum maternal care in inbred and outbred mice. Physiol Behav impacts not only fertility, but may also impact offspring 2007, 91:325–334. survival. Given that hypothalamic OT mRNA and milk 11. Brooks LR, Chung WC, Tsai PS: Abnormal hypothalamic oxytocin system in fibroblast growth factor 8-deficient mice. Endocrine 2010, 38:174–180. availability are normal in dnFGFR dams, lactational 12. Renaud LP, Day TA, Ferguson AV: CNS regulation of reproduction: defects are unlikely the cause of poor survival in pups peptidergic mechanisms. Brain Res Bull 1984, 12:181–186. born to dnFGFR dams. Rather, disrupted maternal 13. Witkin JW, Paden CM, Silverman AJ: The luteinizing hormone-releasing hormone (LHRH) systems in the rat brain. Neuroendocrinology 1982, behavior that reduces pup gathering into the nest is 35:429–438. more likely a contributor to poor pup survival. We have 14. Franklin KBJ, Paxinos G: The mouse brain in stereotaxic coordinates. 3rd proposed two mechanisms that could cause this edition. New York: Academic Press; 2007. disrupted maternal behavior in dnFGFR mice: (1) sub- 15. Leckman JF, Herman AE: Maternal behavior and developmental psychopathology. Biol Psychiatry 2002, 51:27–43. optimal GnRH connectivity with maternal neurocircuits 16. Flannelly KJ, Kemble ED, Blanchard DC, Blanchard RJ: Effects of septal- as a result of decreased FGF signaling and (2) reduced forebrain lesions on maternal aggression and maternal care. E2 in dnFGFR mice leading to impaired maternal neurocir- Behav Neural Biol 1986, 45:17–30. 17. Gammie SC: Current models and future directions for understanding the cuits. Regardless of the mechanism, this study establishes neural circuitries of maternal behaviors in rodents. Behav Cogn Neurosci that a functional GnRH system guided by FGF signaling is Rev 2005, 4:119–135. critical for maternal behaviors and potentially offspring 18. Calamandrei G, Keverne EB: Differential expression of Fos protein in the brain of female mice dependent on pup sensory cues and maternal survival. experience. Behav Neurosci 1994, 108:113–120. 19. Lerch-Haner JK, Frierson D, Crawford LK, Beck SG, Deneris ES: Serotonergic Competing interests transcriptional programming determines maternal behavior and The authors declare that they have no competing interests. offspring survival. Nat Neurosci 2008, 11:1001–1003. 20. Li S, Pelletier G: Involvement of serotonin in the regulation of GnRH gene Authors’ contributions expression in the male rat brain. Neuropeptides 1995, 29:21–25. LRB wrote the manuscript and designed, performed, and analyzed all of the 21. Numan M, Stolzenberg DS: Medial preoptic area interactions with experiments. CDVL participated in conducting the behavioral experiments. dopamine neural systems in the control of the onset and maintenance WCC contributed to the design. PST participated in the design, analysis, and of maternal behavior in rats. Front Neuroendocrinol 2009, 30:46–64. contributed to the manuscript. All authors read and approved the final 22. Pan JT, Kow LM, Pfaff DW: Modulatory actions of luteinizing hormone- manuscript. releasing hormone on electrical activity of preoptic neurons in brain slices. Neuroscience 1988, 27:623–628. Acknowledgements 23. Boehm U, Zou Z, Buck LB: Feedback loops link odor and pheromone This work was supported by NIH grant R01 HD042634 to PST and the signaling with reproduction. Cell 2005, 123:683–695. Endocrine Society Summer Fellowship to LRB. 24. Albertson AJ, Navratil A, Mignot M, Dufourny L, Cherrington B, Skinner DC: Immunoreactive GnRH type I receptors in the mouse and sheep brain. Received: 13 March 2012 Accepted: 2 September 2012 J Chem Neuroanat 2008, 35:326–333. Published: 5 September 2012 25. Millar RP, Lu Z-L, Pawson AJ, Flanagan CA, Morgan K, Maudsley SR: References Gonadotropin-Releasing Hormone Receptors. Endocr Rev 2004, 1. Crawley J: What’s wrong with my mouse. New York: Wiley-Liss; 2000. 25:235–275. Brooks et al. Behavioral and Brain Functions 2012, 8:47 Page 8 of 8 http://www.behavioralandbrainfunctions.com/content/8/1/47 26. Wettschureck N, Moers A, Hamalainen T, Lemberger T, Schutz G, Offermanns S: Heterotrimeric G proteins of the Gq/11 family are crucial for the induction of maternal behavior in mice. Mol Cell Biol 2004, 24:8048–8054. 27. Reuss B, von Bohlen und Halbach O: Fibroblast growth factors and their receptors in the central nervous system. Cell Tissue Res 2003, 313:139–157. 28. Belluscio L, Gold GH, Nemes A, Axel R: Mice deficient in G(olf) are anosmic. Neuron 1998, 20:69–81. 29. Gandelman R, Zarrow MX, Denenberg VH: Reproductive and maternal performance in the mouse following removal of the olfactory bulbs. J Reprod Fertil 1972, 28:453–456. 30. Gandelman R, Zarrow MX, Denenberg VH, Myers M: Olfactory bulb removal eliminates maternal behavior in the mouse. Science 1971, 171:210–211. 31. Zarrow MX, Gandelman R, Denenberg VH: Lack of nest building and maternal behavior in the mouse following olfactory bulb removal. Horm Behav 1971, 2:227–238. 32. Samuelsen CL, Meredith M: Categorization of biologically relevant chemical signals in the medial amygdala. Brain Res 2009, 1263:33–42. 33. Dulac C, Torello AT: Molecular detection of pheromone signals in mammals: from genes to behaviour. Nat Rev Neurosci 2003, 4:551–562. 34. Pedersen CA: Oxytocin control of maternal behavior. Regulation by sex steroids and offspring stimuli. Ann N Y Acad Sci 1997, 807:126–145. 35. Champagne FA, Weaver IC, Diorio J, Sharma S, Meaney MJ: Natural variations in maternal care are associated with estrogen receptor alpha expression and estrogen sensitivity in the medial preoptic area. Endocrinology 2003, 144:4720–4724. 36. Numan M, Rosenblatt JS, Komisaruk BR: Medial preoptic area and onset of maternal behavior in the rat. J Comp Physiol Psychol 1977, 91:146–164. 37. Champagne FA, Weaver IC, Diorio J, Dymov S, Szyf M, Meaney MJ: Maternal care associated with methylation of the estrogen receptor-alpha1b promoter and estrogen receptor-alpha expression in the medial preoptic area of female offspring. Endocrinology 2006, 147:2909–2915. 38. Ogawa S, Eng V, Taylor J, Lubahn DB, Korach KS, Pfaff DW: Roles of estrogen receptor-alpha gene expression in reproduction-related behaviors in female mice. Endocrinology 1998, 139:5070–5081. 39. Stolzenberg DS, Rissman EF: Oestrogen-independent, experience-induced maternal behaviour in female mice. J Neuroendocrinol 2011, 23:345–354. doi:10.1186/1744-9081-8-47 Cite this article as: Brooks et al.: Maternal behavior in transgenic mice with reduced fibroblast growth factor receptor function in gonadotropin-releasing hormone neurons. Behavioral and Brain Functions 2012 8:47. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit

Journal

Behavioral and Brain Functions – Springer Journals

Published: Sep 5, 2012

There are no references for this article.