Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/springer-journals/microencapsulated-essential-oils-combined-with-organic-acids-improves-9MqNYz8Kej
- Publisher
- Springer Journals
- Copyright
- Copyright © The Author(s) 2022
- eISSN
- 2049-1891
- DOI
- 10.1186/s40104-021-00670-3
- Publisher site
- See Article on Publisher Site
Abstract
Background: The objective of this experiment was to evaluate the effect of a combination of microencapsulated essential oils and organic acids (MOA) on growth performance, immuno-antioxidant status, intestinal barrier function and microbial structure of the hindgut in piglets. A total of 120 piglets (Duroc × [Landrace × Yorkshire]; weighted 7.66 ± 1.79 kg, weaned at d 28) were randomly selected and allocated to 3 treatments with 4 replicates per group and 10 piglets per replicate according to the initial body weight and gender. The dietary treatments were as follows: 1) basal diet (Ctrl); 2) Ctrl + chlortetracycline (75 mg/kg) (AGP); 3) Ctrl+ MOA (1500 mg/kg). The experiment period was lasted for 21 d. Results: Compared to the Ctrl group, dietary supplemented MOA alleviated (P < 0.05) the diarrhea rate from d 12 to 21, enhanced (P < 0.05) the concentration of serum interlukin-10 and glutathione peroxidase in piglets on d 11 after weaning and serum superoxide dismutase in 21-day piglets. The MOA group also improved (P < 0.05) the apparent digestibility of dry matter (DM), organic matter (OM) and gross energy (GE), up-regulated (P < 0.05) the mRNA expression level of occludin, claudin-1 and mucin-2 in ileum and increased (P < 0.05) the contents of propionic and butyric acids in the cecum of piglets. The MOA group modulated the cecal and colonic microbial community structure and increased (P < 0.05) the abundance of Faecalibacterium and Muribaculaceae in cecum and Streptococcus and Weissella in colon. Additionally, AGP group decreased (P < 0.05) apparent digestibility of DM, OM and GE as well as down-regulated (P < 0.05) relative gene expression level of claudin-1 in duodenum and jejunum, ZO-1 and mucin-1 in jejunum of piglets. * Correspondence: piaoxsh@cau.edu.cn State Key Laboratory of Animal Nutrition, College of Animal Science and Technology, China Agricultural University, Beijing 100193, China Full list of author information is available at the end of the article © The Author(s). 2022 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 2 of 17 Conclusion: In summary, dietary supplemented MOA alleviated diarrhea and improved nutrient apparent digestibility in piglets via enhancing immuno-antioxidant properties, increasing digestive enzyme activity, up- regulating the expression of intestinal barrier-related genes, and modifying the microbial community structure of the cecum and colon. Therefore, dietary supplementation with MOA as an alternative to antibiotics was feasible to improve intestinal health of piglets in practical production. Keywords: Essential oil, Gut microbiota, Intestinal barrier, Mixed organic acid, Piglets Introduction be the most hopeful way to decrease or substitute antibi- Stress triggered by early weaning affects the normal otics in animal feed. Also, the lowered pH value of the physiological course of intestinal microorganisms, result- gastrointestinal tract induced by organic acids favors the ing in an imbalance of intestinal microorganisms, which strengthening of the antibacterial effect of the essential induce the intestinal diseases [1]. For newborn piglets, oils, while weakening the strong odor of the oils them- the weaning period is characterized by impaired growth, selves [17, 18]. A combination of microencapsulated es- increased incidence of diarrhea and other diseases as sential oils and organic acids (MOA) is probably well as severe morphological alterations of the intestinal extraordinarily effective. Therefore, the purpose of the tissues [2, 3], which alleviated and improved by anti- experiment was to investigate the effect of the combin- biotic growth promoters (AGP) consequently. Due to ation of MOA on growth performance, immuno- the rapid proliferation of livestock production, feed anti- antioxidant properties and intestinal barrier function in biotics are extensively used in breeding production be- piglets, exceedingly focused on the microbial structure cause of their effectiveness in improving feed utilization, of the hindgut of piglets. promoting growth and maintaining health of livestock [4]. Nonetheless, the shortcomings of over-use of antibi- Materials and methods otics are increasingly prominent, such as lowering the Animal ethics immunity, strengthening the resistance of pathogenic All the programs performed in our animal experiment bacteria, disturbing the intestinal flora of livestock and were endorsed and authorized by the Institutional Ani- the antibiotic residues [5, 6], which have triggered the mal Care and Use Committee of China Agricultural Uni- extensive concern of consumers worldwide. The Euro- versity (No.AW10601202–1-2, Beijing, China). pean Union [7], the United States [8] and China [9] have prohibited and restricted the application of antibiotics in MOA product and antibiotic the breeding industry, which is undoubtedly a gigantic The product of MOA combination named PORCI- challenge for feed enterprises. Hence, there is an urgent NATTM was supplied by Jefo (Jefagro, Canada), which requirement for enterprises to develop a novel type of is a selected formulation of essential oils primarily con- green and safe products which contains the growth- taining thymol, vanillin and eugenol and organic acid promoting properties of antibiotics and the advantages mainly containing fumaric, citric, butyric and sorbic acid of pollution-free, residue-free as well as toxin-free. microencapsulated in the triglyceride matrix of hydroge- With the continuous attempts and explorations of nated vegetable oils. The chlortetracycline was sourced scholars, they found that organic acids, plant essential from Tongli Xingke (Beijing Tonglixingke, China). oils, enzymes and antimicrobial peptides could effect- ively improve performance with no side effects [10, 11]. Experimental design and diets Several studies demonstrated that plant essential oils A total of 120 piglets (Duroc × [Landrace × Yorkshire]; were useful in regulating animal intestinal microorgan- weighted 7.66 ± 1.79 kg, weaned at d 28) were selected isms, strengthening immuno-antioxidant properties, and and randomly allocated to 3 treatments with 4 replicates improving growth performance [12, 13]. Mixed organic per group and 10 piglets per replicate according to the acids are favored by feed and livestock enterprises for initial body weight and gender. The dietary treatment their benefits in improving performance and intestinal was as follows: 1) corn-soybean meal basal diets (Ctrl); health of livestock, which rendered mixed organic acids 2) Ctrl + 75 mg/kg chlortetracycline (AGP); 3) Ctrl + as the most promising green alternative to antibiotics 1500 mg/kg MOA (MOA). The experiment period was [14, 15]. However, there is no single feed additive avail- lasted for 21 d. Table 1 lists the composition and nutri- able in feed that can completely replace antibiotics. Xu tional levels of basal diets, which satisfied or excelled the et al. [16] evaluated the role of antibiotic alternatives by NRC (2012) [19] requirements. meta-analyses system and the findings indicated that a The experimental piglets were kept in pens of 1.2 m × combination of different alternatives to antibiotics may 2 m with leaky sprayed plastic floor. Each pen was placed Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 3 of 17 Table 1 Composition and nutrient profile of the basal diets (as fed basis), % Ingredients Content Nutritional level Content Corn, CP 7.6% 60.24 Calculated values Whey powder, CP 3.8% 10.00 Digestive energy, kcal/kg 3487 Soybean meal, CP 43.6% 13.90 Crude protein 18.50 Fermented soybean meal, CP 51% 5.00 Ether extract 4.20 Angel yeast, CP 51.3% 3.00 Lactose 8.00 Fish meal, CP 65.3% 3.00 Calcium 0.60 Soybean oil 1.00 Phosphorus 0.48 Salt 0.40 Sodium 0.31 Dicalcium phosphate 0.54 Lysine 1.54 Limestone 0.28 Methionine 0.56 L-Lysine HCl, 78% 0.71 Threonine 0.83 DL-Methionine, 98% 0.33 Tryptophan 0.27 Threonine, 98% 0.33 L-Tryptophan, 98% 0.11 Analyzed values Valine 0.18 Gross energy, kcal/kg 3867 Zinc oxide 0.20 Crude protein 18.42 10,000-IU Phytase 0.03 Ether extract 4.37 Chromic oxide 0.25 Dry matter 87.29 Non-antibiotic premix 0.50 Organic matter 94.80 Total 100.00 Non-antibiotic premix for per kilogram diet included: vitamin A, 12,000 IU; vitamin D , 2000 IU; vitamin E, 24 IU; vitamin K , 2.0 mg; vitamin B , 2.0 mg; riboflavin, 3 3 1 6.0 mg; vitamin B , 3 mg; vitamin B ,24 μg; nicotinic acid, 30 mg; pantothenic acid, 20 mg; folic acid, 3.6 mg; biotin, 0.1 mg; choline chloride, 0.4 mg; iron, 96 mg; 6 12 copper, 8.0 mg; zinc, 120 mg; manganese, 40 mg; iodine, 0.56 mg; selenium, 0.4 mg The analyzed values were the average of the 3 feed nutrient levels measured in the Ctrl antibiotic growth promoter (AGP) and microencapsulated essential oils and organic acids (MOA) groups with one 3-hole stainless steel adjustable trough and one a vacutainer, centrifuged at 3000 × g for 15 min, the nipple type waterer. The piglets were kept in “all-in, all- serum was separated and stored at − 20 °C in 0.5 mL out” feeding management, and the nursery was thor- centrifuge tubes for analysis of serum immune function oughly disinfected and cleaned before the piglets were and antioxidant characteristic. transferred. The nursery temperature (28 °C to 30 °C for On the d 18 of the experiment, feces of piglets in the the first week, then lowered by 1 to 2 °C weekly up to nursery were cleaned, and fecal samples in each replicate 23 °C to 25 °C), humidity (60 to 70%) and CO concen- were gathered from the d 19 to 21, the sample collection tration (below 0.15%) were controlled by an automatic twice per day without contamination, then stored at − monitoring system. The piglets were fed in the way of 20 °C for determination of the apparent digestibility of “frequent addition and less feeding”, and the transition nutrients. Moreover, approximately 1 kg of representa- was performed in the ratio of 1:3, 3:1 and 2:2 according tive feed samples were harvested weekly during the to the Creep feed:Experimental feed. Moreover, the experiment. weaned piglets were vaccinated on d 7, d 14 and d 21, On d 21 of the experiment, one piglet with mean respectively (highly pathogenic blue ear disease weak weight was sampled for slaughter per replicate, the liver vaccine, pseudorabies vaccine, swine fever weak freeze- was gathered and approximately 1 to 2 cm of intestinal dried vaccine) and dewormed regularly. Feeding and samples were collected from the duodenum, jejunum health conditions of piglets were observed and recorded and ileum at the 1/3 of the posterior segment respect- at all times. The piglets were fed with powder and ively, the intestinal contents were washed off with 0.9% allowed to feed and drink ad libitum overall. No mortal- saline gently, placed in 10-mL cryovials and pre-stored ity occurred for piglets during the experimental period. in a liquid nitrogen tank, then transferred to − 80 °C for determination of antioxidant enzyme properties, digest- Sampling collection and detection method ive enzyme activity and the expression of intestinal tight On d 11 and d 21 of the experiment, 10 mL of blood junction protein gene. Meanwhile, the tissues of approxi- was gathered from the anterior vena cava of piglets into mately 2 cm small intestine were gathered, washed with Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 4 of 17 sterile saline and fixed in 4% paraformaldehyde for de- Remover, 0.5 μL; Nuclease-free H O was added to 10 μL. termining intestinal morphology. Furthermore, the The reaction procedure: 42 °C for 15 min, 85 °C for 5 s. cecum and colon contents of piglets were collected for Addition of 90 μL Nuclease-free H O after reverse tran- volatile fatty acid analysis and 16srRNA gene sequen- scription, then held at − 20 °C. cing. The surgical trays, scalpel scissors and other instru- Real-time PCR was conducted by a LightCycler® 480 II ments used in the sample collection process and the Real-time PCR Instrument (Roche, Basel, Switzerland) operating table were disinfected with 75% alcohol. (PCR efficiency: 94 to 105%) with 10 μL of PCR reaction mixture, which included 1 μL of cDNA, 5 μL of 2 × Per- Growth performance measurement fectStartTM Green qPCR SuperMix, 0.2 μL of forward Piglets were weighed on d 11 and d 21 of the experiment primer, 0.2 μL of reverse primer and 3.6 μL of nuclease- as well as recorded the feed consumption to calculate free water. The reactions were incubated in 384-well op- average daily gain (ADG), average daily feed intake tical plates (Roche, Basel, Switzerland) for 30 s at 94 °C, (ADFI) and feed conversion ratio (FCR = ADFI/ADG). followed by 45 cycles of 5 s at 94 °C, 30 s at 60 °C. The The piglets’ anuses were checked one by one at 09:00 melting curve analysis was performed at the end of the and 17:00 daily during the experiment to observe and re- PCR cycle to verify the specific generation of the ex- corded any fecal contamination and redness. The num- pected PCR product. Triplicate analyses were performed ber of piglets with diarrhea per treatment was counted for each sample. The primer sequences shown in Table 2 at the end of the experiment and the diarrhea rate was were designed by Ouyi Biotech (Shanghai, China) and calculated with the following formulation: synthesized by TsingKe Biotech (Beijing, China) based Diarrhea rate (%) = 100% × total number of piglets with on the mRNA sequences available from the NCBI data- diarrhea/(total number of piglets × number of days). base. The expression levels of mRNAs were normalized to the glyceraldehyde-3-phosphate dehydrogenase -ΔΔCt Serum biochemical immunity and intestinal enzyme (GAPDH) and were calculated using the 2 method. activity The serum was defrosted at 4 °C and mixed well before Apparent total tract digestibility (ATTD) of nutrients analysis. The enzyme activities of malondialdehyde The fecal samples were thawed at 4 °C, then dried at (MDA), superoxide dismutase (SOD), glutathione perox- 65 °C for 72 h, the samples of feed and feces were idase (GSH-Px) and total antioxidant capacity (T-AOC) ground through a 40-mesh (425 μm) screen before ana- in serum were analyzed by automatic biochemical lysis. Dry matter (DM), crude protein (CP), ether extract analyzer (GF-D200, Gaomi Caihong Analytical Instru- (EE) and ash were analyzed in accordance with the Asso- ment, Co Ltd., Shandong, China). Immunoglobulins ciation of Official Analytical Chemists [20]; Neutral de- (IgA, IgG, IgM), interleukin-1β (IL-1β), interleukin-10 tergent fiber (NDF) and Acid detergent fiber (ADF) were (IL-10), gamma-interferon (IFN-γ) tumor necrosis determined with reference to the method of Vansoest factor-α (TNF-α), D-lactic acid (DLA) and diamine oxi- et al. [21] (A2000i fiber analyzer, Ankom, Macedon, dase (DAO) levels in serum were tested by ELISA with USA). The gross energy in feed and feces samples was enzyme marker (Multiskan Ascent, Thermo Scientific, analyzed using 6400-Automatic Isoperibol Calorimeter Waltham, USA). The activities of small intestinal amyl- Table 2 Primer sequences of housekeeping and target genes ase, lipase, trypsin and chymotrypsin were measured by concerned with intestinal barrier function Immunoturbidimetry. The commercial kits were sourced 1 2 Item Sequences (5′ to 3′) Length, bp T ,°C from Nanjing Jiancheng Institute of Biological Engineer- Occludin F: GTGGGACAAGGAACGTATT 115 60 ing (Nanjing, China). R: TCTCTCCGCATAGTCCGAA Claudin-1 F: ATACAGGAGGGAAGCCAT 89 60 RNA extraction and real-time PCR R: ATATATTTAAGGACCGCCCTCT The total RNA was extracted from small intestine of pig- ZO-1 F: GCTCAGCCCTATCCATCT 90 60 lets by means of TRizol method according to the manu- R: GGACGGGACCTGCTCATAA facture instruction (Thermo Fisher, Waltham, USA), the Mucin-1 F: GTGCCGCTGCCCACAACCTG 141 60 concentration and quality of RNA were detected by pro- R: AGCCGGGTACCCCAGACCCA tein nucleic acid assay (ND-2000UV, Thermo Fisher, Mucin-2 F: CAGACCTACTCAGAGTTCCT 84 60 Waltham, USA) and 1% agarose gel electrophoresis. The R: CTCGGGCTTGTTGATCTT RNA was reverse-transcribed into cDNA using the GAPDH F: CAGCAATGCCTCCTGTACCA 72 60 TransScript All-in-One First-Strand cDNA Synthesis R: ACGATGCCGAAGTTGTCATG SuperMIX for qPCR kit (QIAGEN, Frankfurt, Germany). ZO-1, zonula occludens-1; GAPDH, The reverse transcription system: total RNA, 0.5 μg; 5 × glyceraldehyde-3-phosphate dehydrogenase TransScript All-in-one SuperMix for qPCR, 5 μL; gDNA F, forward primer; R, Reverse primer Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 5 of 17 (PARR, Moline, USA). The chromium levels in feed and Biolabs, Herts Hitchin, UK), 0.2 μmol/L upstream and feces were analyzed by atomic absorption spectropho- downstream 1 μL each, 10 ng/μL genomic DNA 2 μLas tometer (Z-5000; Hitachi, Tokyo, Japan) based on the well as 10.5 μL of sterilized ultrapure water. The amplifi- methodology of Williams et al. [22] for calculating the cation procedure was performed as follows: 98 °C pre- ATTD with the following equation. denaturation for 1 min, 98 °C denaturation for 10 s, 50 °C Apparent total tract digestibility (ATTD, %) = 1 - (Cr annealing for 30 s, 72 °C extension for 30 s totaling 30 × Nutrient ) / (Cr × Nutrient ). cycles, 72 °C stable extension for 5 min, and lastly stored feed feces feces feed at 4 °C (PCR instrument: ABI GeneAmp® Model 9700, Intestinal morphology Applied Biosystems, Foster City, USA). After the small intestine samples were fixed in 4% para- The PCR products from the samples were mixed and formaldehyde solution for 48 h, the samples were rinsed, examined by 2% agarose gel electrophoresis; then quan- excised, and dehydrated with ethanol for 24 h, then tified by Quantus™ Fluor-ST Fluorescence Quantification paraffin-embedded, sliced in 4 cross-sections and stained System (Promega, Madison, USA). The PCR products with hematoxylin-eosin. Lastly, the samples were mor- were mixed in equal amounts following the concentra- phologically detected by light microscopy (Olympus tion of the obtained PCR products, re-electrophoresed CX31, Tokyo, Japan), and 10 intact, well-oriented villi- on 2% agarose gels, the target product bands were recov- crypt units were measured in each section. The villi ered using QIAquick Gel Extraction Kit (Axygen, Santa height (VH) was evaluated from the top of the villi to Clara Valley, USA). The library construction was per- the junction of the villi and crypt, the crypt depth (CD) formed by TruSeq® DNA PCR-Free DNA library kit was determined as the depth of the villi invagination, (Illumina, San Diego, USA), and sequenced by then calculated the ratio of villi height to crypt depth HiSeq2500 PE250 after Qubit and qPCR quality control. (VH:CD). The raw tags were obtained by splicing the sample reads with FLASH software (http://www.cbcb.umd.edu/ Cecal volatile fatty acids software/flash, V1.2.10); the raw tags were filtered and The cecal contents of piglets were thawed at 4 °C and processed to obtain the high-quality effective tags by fol- mixed, approximately 0.5 g of the sample was weighed lowing the tags quality control process of QIIME [23]. a) into a 10-mL centrifuge tube, adding 8 mL of ultrapure truncate the raw tags from the first low-quality site water, sonicated in an ice water bath for 30 min (mixing where the number of consecutive low-quality bases (≤ every 10 min), then centrifuged at 15,000 × g for 10 min. 19) reaches a set length of three; b) filter out the tags The supernatant was diluted 50 times with ultrapure with consecutive high-quality bases less than 75% of the water, filtered through a 0.22 mm membrane, transferred tags length from the intercepted tags dataset. The se- to the 2-mL injection vial and analyzed the volatile fatty quences were OTU (operational taxonomic unit) clus- acid using a high-performance ion chromatography tered and chimeras were removed based on 97% analyzer (ICS-3000, Thermo Scientific, USA). similarity [24]using UPARSE [25]software(http:// drive5.com/uparse/, V7.1) to generate OTU. The RDP Pyrosequencing of 16S rRNA amplicons classifier [26](http://sourceforge.net/projects/rdp- The cecum and colon contents were removed from the classifier/, V2.2) Bayesian algorithm was employed to an- − 80 °C refrigerator and the total bacterial DNA was ex- notate the OTU sequences against the Silva 16S rRNA tracted in accordance with the manufacturer’s instruc- database (http://www.arb-silva.de, V138) for species clas- tions of FastDNA® SPIN for soil kit (MP Biomedicals, sification (comparison threshold of 70%) and the com- Irvine, USA). The integrity and purity of the DNA was munity composition of each sample at each taxonomic determined using 1% agarose gel electrophoresis and a level was counted. NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, USA). The DNA concentration was quantified Statistical analysis precisely by Qubit Fluorometer (Thermo Scientific, Wal- All data were initially organized by Excel software and tham, USA), and the samples were diluted to 1 ng/μL then statistically analyzed using the GLM model data in with sterile water. The specific primers with marker se- SAS software (V9.2, 2008). The dietary treatment as a quences (338F: 5′-ACTCCTACGGGAGGCAGCAG-3′ fixed effect and the block as a random effect. The repli- and 806R: 5′-GGACTACHVGGGTWTCTAAT-3′) cate as a unit to analyze the data concerning growth per- were employed for PCR amplification of the variable re- formance and apparent digestibility of nutrients in gion of 16S rRNA gene V3-V4. The total volume of PCR piglets, the diarrhea rate of piglets was analyzed by the reaction system is 30 μL, consisting of Phusion® High- chi-square test. The data on piglet serum, digestive en- Fidelity PCR Master Mix with GC Buffer 15 μL, Phusion® zymes, intestinal morphology and so on were analyzed High-Fidelity DNA polymerase 0.5 μL (New England based on the individual as a unit. Multiple comparisons Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 6 of 17 and significance of differences among groups were per- Table 3 Growth performance of piglets as affected by dietary AGP and MOA supplementation formed using the Turkey method, means and standard errors were calculated using LSMEANS method; P < 0.05 Item Ctrl AGP MOA SEM P-value was regarded as statistically significant, 0.05 < P ≤ 0.10 Day 1 to 11 was indicative of a differential trend. ADG, g 373 385 369 18.47 0.82 For microbiota profiling, statistical analysis of α- ADFI, g 532 499 485 26.96 0.51 diversity, including the Shannon and Simpson indices FCR 1.42 1.28 1.32 0.06 0.28 reflecting microbial diversity and the Chao and ACE Diarrhea rate, % 30.53 28.11 23.56 3.18 0.38 indices indicating bacterial abundance [27], was per- Day 12 to 21 formed by mothur (http://www.mothur.org/wiki/, V1.30.1). The Circos-0.67-7 software (http://circos.ca/) ADG, g 417 455 452 19.01 0.38 was employed to analyze the relationship between ADFI, g 727 751 725 35.37 0.85 samples and species by visualizing circle plots. The FCR 1.74 1.64 1.61 0.05 0.21 Unifrac distance was computed based on the species a a b Diarrhea rate, % 16.88 16.04 9.79 0.71 0.01 differences between the sample sequences and calcu- Day 1 to 21 lated the β-diversity distance by QIIME (http://qiime. ADG, g 394 415 406 17.74 0.73 org/), the principal coordinates analysis (PCoA) and partial least squares discriminant analysis (PLS-DA) ADFI, g 614 605 586 29.52 0.80 were conducted using R software (V3.4.4). The ana- FCR 1.55 1.45 1.45 0.04 0.23 lysis of between-treatment variance (One-way Diarrhea rate, % 24.78 23.03 17.36 1.99 0.12 ANOVA) of α-diversity and β-diversity was performed ADG average daily gain, ADFI average daily feed intake, FCR feed using R software. The Analysis of similarities (ANO- conversion ratio a, b Means in the same row with different superscripts are significantly SIM) was used to compare the significance of differ- different (P < 0.05) ences in community structure between treatments. Control (Ctrl): a corn soybean meal-based diet. AGP: Ctrl + 75 mg/kg The LEfSe tool (Linear discriminant analysis [LDA] chlortetracycline. MOA: Ctrl + 1500 mg/kg MOA. n =4 and effect size) was applied to analyze the core flora (LDA score > 3.0) in the cecum and colon of piglets Apparent nutritional digestibility (http://huttenhower.sph.harvard.edu/galaxy/root?tool_ The apparent digestibility of DM, OM and GE in wean- id=lefse_upload). The intergroup species differences ing pig dietary supplementation with MOA was outper- were analyzed at each taxonomic level using R soft- form (P < 0.05) than Ctrl and AGP group. Nevertheless, ware based on the obtained bacterial community no significance differences were noticed among treat- abundance data and plotted with the “vegan” and ments on CP, EE, NDF and ADF (Table 5). “ggplot2” packages. Digestive enzyme activity An increased (P < 0.05) of trypsin and lipase activities in Results the pancreas of piglets supplemented with MOA were Growth performance observed compared to the AGP group (Fig. 1). Neverthe- No significant difference was noted on growth perform- less, compared to the Ctrl, no significant differences ance among treatments with exception of the improved were noticed in trypsin, lipase, amylase and chymotryp- (P < 0.05) diarrhea rate of piglets supplemented MOA sin activities in the pancreas, duodenum and jejunum of from d 12 to 21 (Table 3). piglets supplemented with MOA. Serum immune antioxidant status Antioxidant enzyme properties of liver and intestine Compared to the Ctrl and AGP group, dietary supple- Dietary supplementation with MOA enhanced (P < 0.05) mentation with MOA enhanced (P < 0.05) the concen- the level of GSH-Px in liver of piglets (Fig. 2). However, tration of serum IL-10 and GSH-Px of 11d-piglets Also, there were no significant differences in T-AOC, SOD, compared to the AGP, an increased (P < 0.05) content of MDA and CAT among the liver, duodenum, jejunum serum T-AOC was observed in 11-day piglets supple- and ileum of piglets supplemented with MOA compared mented with MOA (Table 4). to the ctrl and AGP groups. Compared to the Ctrl, the concentration of serum IgM (P = 0.07) and IL-10 (P = 0.06) in 21d-piglets supple- Relative mRNA expression involved in intestinal barrier mented with MOA showed a tendency to enhance and a function higher level (P < 0.05) of SOD was observed in 21- A down-regulated (P < 0.05) relative mRNA expression day piglets supplemented with MOA. level of claudin-1 in duodenum and jejunum, ZO-1 and Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 7 of 17 Table 4 Serum immune function and antioxidant status of mucin-1 in jejunum were noted in piglets supplemented piglets as affected by dietary AGP and MOA supplementation AGP compared to Ctrl and MOA group (Fig. 3). Also, Item Ctrl AGP MOA SEM P-value the relative mRNA expression levels of occludin, caudin- Day 11 1 and mucin-2 in ileum of piglets supplemented MOA IgA, μg/mL 19.58 19.51 19.74 0.72 0.97 were superior (P < 0.05) to Ctrl and AGP group, respectively. IgG, mg/mL 9.16 9.07 9.23 0.41 0.96 IgM, μg/mL 7.06 7.10 8.05 0.34 0.18 Intestinal morphology IL-1β, ng/L 92.68 94.21 92.86 1.71 0.80 There was no significant difference occurred on villus b b a IL-10, ng/L 17.71 17.83 21.69 0.61 0.02 height, crypt depth and VH/CD in duodenum, jejunum IFN-γ, pg/mL 196.74 197.34 195.90 6.75 0.98 and ileum of piglets among treatments (Table 6, Fig. 4). TNF-α, ng/L 56.78 58.79 56.88 1.02 0.38 b ab a GSH-Px, μmol/L 8.09 12.24 15.50 0.83 0.01 Volatile fatty acid SOD, U/mL 109.56 124.03 129.65 4.36 0.07 The 11-day weaning pig supplemented with MOA in- a b a T-AOC, U/mL 10.41 7.83 11.16 0.45 0.01 creased (P < 0.05) the cecal content of propionic acid MDA, nmol/mL 1.48 1.46 1.30 0.10 0.46 and butyric acid compared to the Ctrl group (Table 7). Day 21 Dietary supplementation with MOA enhanced (P < IgA, μg/mL 18.04 19.26 18.64 0.54 0.37 0.05) the cecal concentration of propionic acid and total volatile fatty acid. Also, a lowered (P < 0.05) concentra- IgG, ng/L 8.57 8.22 8.60 0.14 0.22 tion of isobutyric acid and isovaleric acid in cecum of IgM, μg/mL 7.17 7.91 8.07 0.21 0.07 21-day weaning pig dietary supplementation with MOA IL-1β, ng/L 102.81 101.70 103.90 2.19 0.79 and AGP compared to the Ctrl. IL-10, ng/L 17.19 18.62 19.57 0.47 0.06 IFN-γ, pg/mL 194.25 201.16 200.61 6.34 0.71 Cecal microbiota TNF-α, ng/L 50.63 50.88 48.65 1.05 0.36 The Venn diagram provided a visual representation of GSH-Px, μmol/L 13.05 15.46 17.00 1.05 0.13 the similarity and overlap of the OTU composition of b b a SOD, U/mL 125.66 143.28 169.51 5.08 0.01 samples by counting the number of OTU that are com- T-AOC, U/mL 10.46 10.62 10.93 0.72 0.90 mon and unique to samples. MDA, nmol/mL 1.37 1.53 1.27 0.11 0.32 From the Venn analysis (Fig. 5A) of OTU in cecum of IgA, IgG, IgM, immunoglobulin A, G, M; IL-1β, IL-10, interleukin-1β, 10; IFN-γ, piglets, which totally acquired 1412 OTU, and 318 were gamma-interferon; TNF-α, tumor necrosis factor-α; T-AOC, total antioxidant common OTU, the 56, 48 and 52 represented the capacity; MDA, malondialdehyde; GSH-Px, glutathione peroxidase; SOD, serum superoxide dismutase unique OTU of Ctrl, AGP and MOA, respectively. At a,b Means in the same row with different superscripts are significantly the phylum level (Fig. 5B, C), Firmicutes and Bacteroi- different (P < 0.05) Control (Ctrl): a corn soybean meal-based diet. AGP: Ctrl + 75 mg/kg detes were dominated phylum, which accounting in ex- chlortetracycline. MOA: Ctrl + 1500 mg/kg MOA. n =4 cess of 90%. The populations of Firmicutes in Ctrl, AGP and MOA group were 88.78%, 86.92% and 81.00%, re- spectively. The Bacteroidetes in Ctrl, AGP and MOA group were accounting for 8.58%, 4.83% and 18.21%, re- Table 5 Apparent total tract digestibility of dietary nutrients in spectively. At the Family level (Fig. 5E, F), the microor- piglets at 21 days of age as affected by dietary AGP and MOA ganisms that dominated the top five in the Ctrl group supplementation ,% were Lactobacillaceae (42.39%), Streptococcaceae Item Ctrl AGP MOA SEM P-value (7.49%), Clostridiaceae (7.80%), Ruminococcaceae b c a DM 81.25 78.30 83.09 0.29 0.01 (6.53%) and Lachnospiraceae (6.06%). In the AGP group, b c a OM 84.46 82.05 86.12 0.26 0.01 primarily dominated by Ruminococcaceae (18.42%), CP 74.40 70.72 75.79 1.66 0.20 Clostridiaceae (17.30%), Lachnospiraceae (10.18%), Eu- EE 68.93 58.57 68.68 3.86 0.21 bacterium_coprostanoligenes_group (9.56%) and PeptoS- b c a GE 79.18 76.52 81.02 0.35 0.01 treptococcaceae (8.76%). In the MOA group, mainly dominated by Streptococcaceae (24.89%), Lactobacilla- NDF 52.04 50.78 47.62 2.06 0.39 ceae (15.27%), Prevotellaceae (12.77%), norank_o_Clos- ADF 26.68 30.11 35.88 4.23 0.39 tridia UCG-014 (8.30%) and Eubacterium_ DM dry matter, OM organic matter, CP crude protein, EE ether extract, GE gross coprostanoligenes_group (8.14%). The Circos plots (Fig. energy, NDF neutral detergent fiber, ADF acid detergent fiber a,b Means in the same row with different superscripts are significantly 5D) reflect the proportional distribution of dominant different (P < 0.05) 1 species in cecum of piglets among the treatments as well Control (Ctrl): a corn soybean meal-based diet. AGP: Ctrl + 75 mg/kg chlortetracycline. MOA: Ctrl + 1500 mg/kg MOA. n =4 as the proportional distribution of each dominant Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 8 of 17 Fig. 1 The digestive enzyme activity of pancreas, duodenum and jejunum in piglets at 21 days of age as affected by dietary AGP and MOA supplementation. (A) Trypsin activity. (B) Lipase activity. (C) Amylase activity. (D) Chymotrypsin activity. Control (Ctrl): a corn soybean meal-based diet. AGP: a basic diet with 75 mg/kg of chlortetracycline. MOA: a basic diet with 1500 mg/kg of MOA. Values are indicated as means ± SEM. Bar with the asterisk (*) level suggested the degree of significant difference (* 0.01 < P < 0.05, ** 0.001 < P < 0.01). n =4 species in the different treatments at the family level. group as well as Faecalibacterium and Muribaculaceae From the PCoA based on Bray_curtis at OTU level (Fig. in MOA group were observed in the cecum of piglets. 5G), the contribution values of the two principal compo- Furthermore, the higher (P < 0.05) relative abundance of nents PC1 and PC2 were PC1 = 40.42% and PC2 = Actinobacteriota and Lactobacillaceae family in the Ctrl 23.06%, respectively, and the treatments differ in micro- group, Ruminococcaceae and Lachnospiraceae in AGP bial composition (P = 0.001, R = 0.98). Similar results group were noticed (Fig. 5L, M). were obtained from the PLS-DA plot (Fig. 5H). In α- diversity (Fig. 5I), the Sobs, Chao, and Ace indices were Colonic microbiota used to reflect the microbial community richness, the From the Venn analysis (Fig. 6A) of OTU in cecum of Shannon and Simpson indices were applied to mirror piglets, which totally acquired 1521 OTU, and 359 were the microbial community diversity. The Sobs, Ace and common OTU, the 52, 78 and 32 represented the Chao indices in cecum of piglets supplemented with unique OTU of Ctrl, AGP and MOA, respectively. At MOA were increased (P < 0.05). Also, dietary supple- the phylum level (Fig. 6B, C), Firmicutes and Bacteroi- mentation with AGP enhanced (P < 0.05) the Ace index detes were dominated phylum, which accounting in ex- in cecum of piglets. The microorganisms with significant cess of 98%. The populations of Firmicutes in Ctrl, AGP difference properties were identified by the non- and MOA group were 90.57%, 85.55% and 93.03%, re- parametric factorial Kruskal-Wallis sum-rank test. The spectively. The Bacteroidetes in Ctrl, AGP and MOA effect of microbial abundance of each species on the dif- group were accounting for 7.45%, 13.23% and 6.32%, re- ference effect was assessed by LDA (LDA threshold > spectively. At the Family level (Fig. 6E, F), the micro- 3.0). The results (Fig. 5J, K) indicated that the cecal organisms that dominated the top five in the Ctrl microbiota composition was affected by feeding modifi- group were Clostridiaceae (26.59%), Lactobacillaceae cation. An increased richness of Collinsella, Turicibacter (20.44%), Lachnospiraceae (12.04%), Ruminococcaceae and Olsenella in Ctrl group, Subdoligranulum in AGP (10.21%) and Streptococcaceae (7.35%). In the AGP Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 9 of 17 Fig. 2 The antioxidant enzyme properties of liver and small intestine in piglets at 21 days of age as affected by dietary AGP and MOA supplementation. (A) Total antioxidant capacity (T-AOC). (B) Glutathione peroxidase activity (GSH-Px). (C) Superoxide dismutase activity (SOD). (D) Malondialdehyde (MDA). (E) Catalase activity (CAT). Control (Ctrl): a corn soybean meal-based diet. AGP: Ctrl + 75 mg/kg chlortetracycline. MOA: Ctrl + 1500 mg/kg MOA. Values are indicated as means ± SEM. Bar with the asterisk (*) level suggested the degree of significant difference (* 0.01 < P < 0.05). n =4 Fig. 3 The gene expression involved in intestinal barrier function of small intestine in piglets at 21 days of age as affected by dietary AGP and MOA supplementation. (A) Occludin. (B) Claudin-1. (C) Zonula occludens-1 (ZO-1). (D) Mucin-1. (E) Mucin-2. Control (Ctrl): a corn soybean meal- based diet. AGP: Ctrl + 75 mg/kg chlortetracycline. MOA: Ctrl + 1500 mg/kg MOA. Values are indicated as means ± SEM. Bar with the asterisk (*) level suggested the degree of significant difference (* 0.01 < P < 0.05, ** 0.001 < P < 0.01, *** 0.0001 < P < 0.001, **** P < 0.0001). n =4 Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 10 of 17 Table 6 Intestinal morphology of piglets at 21 days of age as proportional distribution of each dominant species in affected by dietary AGP and MOA supplementation the different treatments at the family level. From the Item Ctrl AGP MOA SEM P-value PCoA based on Bray_curtis at OTU level (Fig. 6G), the contribution values of the two principal compo- Duodenum nents PC1 and PC2 were PC1 = 45.72% and PC2 = VH, μm 310.18 288.90 325.98 17.76 0.48 24.20%, respectively, and the treatments differ in mi- CD, μm 209.37 188.79 199.91 5.76 0.24 crobial composition (P = 0.001, R = 0.68). Similar find- VH:CD 1.49 1.53 1.64 0.13 0.75 ings were acquired by the PLS-DA (Fig. 6H). The Jejunum Sobs, Ace and Chao indices in colon of piglets sup- VH, μm 332.93 330.83 349.62 13.94 0.65 plemented with MOA were increased (P <0.05). Also, dietary supplementation with AGP enhanced (P < CD, μm 202.92 204.89 208.05 7.05 0.88 0.05) the Sobs, Simpson and Ace indices in colon of VH:CD 1.64 1.61 1.68 0.02 0.16 piglets (Fig. 6I). The findings (Fig. 6J, K) of LDA indi- Ileum cated that the colonic microbiota composition was af- VH, μm 235.49 234.18 256.52 6.16 0.19 fected by feeding modification. An enhanced richness CD, μm 145.10 149.68 159.82 5.59 0.36 of Lactobacillus, Olsenella and Mogibacterium in Ctrl VH:CD 1.63 1.57 1.61 0.10 0.92 group, Terrisporobacter and Anaerovibrio in AGP VH Villus height, CD Crypt depth, VH:CD Villus height to crypt depth ratio group as well as Streptococcus, Weissella,and Muriba- a,b Means in the same row with different superscripts are significantly culaceae in MOA group were noticed in the colon of different (P < 0.05) piglets. Moreover, the higher (P < 0.05) relative abun- Control (Ctrl): a corn soybean meal-based diet. AGP: Ctrl + 75 mg/kg chlortetracycline. MOA: Ctrl + 1500 mg/kg MOA. n =4 dance of Proteobacteria and PeptoStreptococcaceae and Clostridiaceae in the AGP group, Streptococca- group, primarily dominated by Clostridiaceae ceae and norank_o_Clostridia UCG-014 in MOA (43.95%), Ruminococcaceae (13.73%), PeptoStreptococ- group were noticed (Fig. 6L, M). caceae (10.59%), Tannerellaceae (8.29%) and Lachnos- piraceae (4.49%). In the MOA group, mainly Discussion dominated by Clostridiaceae (29.28%), Streptococca- Recently, with the rapid advancement of new feed addi- ceae (21.75%), norank_o_Clostridia UCG-014 tives as an alternative to antibiotics, the findings con- (10.07%), Lachnospiraceae (9.51%) and Ruminococca- cerning the effects of mixed organic acids and essential ceae (5.05%). The Circos plots (Fig. 6D) reflect the oils on the growth performance and health status in pig- proportional distribution of dominant species in colon lets have been increasing [14, 28]. Also, the mechanisms of pigletsamong thetreatmentsaswellasthe and potential of organic acids and essential oils to Fig. 4 The photomicrograph of small intestinal segments from piglets at 21 days of age. Intestinal morphology in duodenum, jejunum and ileum of piglets as affected by dietary AGP and MOA supplementation. Picutures were observed at 100 × magnification. Control (Ctrl): a corn soybean meal-based diet. AGP: Ctrl + 75 mg/kg chlortetracycline. MOA: Ctrl + 1500 mg/kg MOA. n =4 Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 11 of 17 Table 7 Volatile fatty acid of cecal contents in piglets at 21 that dietary supplementation with the mixed essential oil days of age as affected by dietary AGP and MOA and organic acid in piglets respectively, could reduce the supplementation , mg/kg diarrhea rate and increased the ADG of piglets. The Items Ctrl AGP MOA SEM P-value mechanism might be associated with the mixed organic Day 11 acids lowering the intestinal pH and inhibiting the pro- liferation of harmful bacteria in the intestine. Interest- Lactic acid 0.05 0.30 0.16 0.06 0.10 ingly, the inconsistent result was documented by Yang Acetic acid 2.39 2.13 1.53 0.22 0.11 et al. [35] and Xu et al. [36], who supplemented the mix- b ab a Propionic acid 1.62 2.31 2.76 0.17 0.02 ture of essential oils and organic acids to diets of piglets Isobutyric acid 0.10 0.11 0.13 0.02 0.64 and found that a positive effect on ADG, but no signifi- b b a Butyric acid 1.31 1.62 2.61 0.18 0.01 cant difference on diarrhea rate. It may be associated Isovaleric acid 0.09 0.09 0.13 0.03 0.47 with the environment and the composition and propor- tions as well as the processing of essential oils and or- Valeric acid 0.17 0.17 0.13 0.04 0.65 ganic acids. Total volatile fatty acid 5.74 6.73 7.44 0.48 0.15 The immune antioxidant capacity of serum can be a Day 21 reliable indicator of the health status of weaned piglets. Lactic acid 0.31 0.54 0.47 0.13 0.50 IgG, IgA and IgM were the three necessary immuno- Acetic acid 3.69 3.20 3.94 0.30 0.32 globulins to mirror the immune status of piglets [37]. b b a Propionic acid 2.00 1.55 2.66 0.13 0.01 The IL-10 is a cytokine, which could enhance the B-cell a b b survival, proliferation and antibody production, block Isobutyric acid 0.25 0.03 0.04 0.01 0.01 the NF-κB activity and reduce paracellular permeability, Butyric acid 1.39 1.42 1.90 0.16 0.15 exerting the essential functions in immune regulation a b b Isovaleric acid 0.21 0.13 0.13 0.01 0.02 and inflammatory responses [38, 39]. In the current Valeric acid 0.38 0.23 0.22 0.07 0.28 study, dietary supplementation with MOA enhanced the ab b a Total volatile fatty acid 8.24 7.10 9.36 0.30 0.02 level of IL-10 on d 11 and have a tendency to increase a,b Means in the same row with different superscripts are significantly the level of IgM and IL-10 on d 21, which was in accord- different (P < 0.05) ance with our previous findings in broilers that dietary Control (Ctrl): a corn soybean meal-based diet. AGP: Ctrl + 75 mg/kg supplemented 6000 mg/kg of mixed organic acids in- chlortetracycline. MOA: Ctrl + 1500 mg/kg MOA. n =4 creased the concentration of IgA and IL-10 [40]. Also, replace antibiotics were elucidated in detail by Suiryan- the similar result was observed in piglets by Pu et al. rayna and Ramana[29] and Zeng et al. [30], thus several [41]. Mechanistically, organic acids increased the level of studies were conducted on the effects of the combin- IL-10 primarily by differentially moderating Th1 and ation of the two additives in weaned piglets [31, 32] and Th17 cell differentiation [42] or increase the concentra- revealed that the combination of the essential oil and or- tion of IL-10 in T cells and regulatory B cells by inhibit- ganic acid was superior to any single additive, which was ing histone deacetylases and regulating the mammalian in line with the results of the meta-analysis concerning target of rapamycin [43, 44], thus improved the immune antibiotic replacement products by Xu et al. [16]. None- status in piglets. theless, the powerful volatility of essential oils consider- After weaning, piglets are stimulated by factors such ably weakens the antioxidant and antimicrobial effects of as environment and feed, causing disturbance of redox essential oils in weaned piglets [33]. Consequently, the system of the body and a large accumulation of free rad- present experiment combined the results of previous icals or reduced scavenging ability in piglets could lead studies to address the volatility of essential oils by mi- to a decrease in feed intake and slow growth, especially croencapsulation process, then comprehensively evalu- affect smaller piglets more severely [45]. Therefore, in- ated the effects of the combination of MOA in weaned creasing the level of antioxidant enzyme such as T- piglets, including growth performance, immuno- AOC, SOD, GSH-Px and reducing the level of serum antioxidant properties, digestive enzyme activity, intes- MDA of piglets (an indicator reflecting the degree of tis- tinal morphology, and intestinal microbial structure. sue peroxidation) contributed to the alleviation of wean- Diarrhea in post-weaning is one of the major contribu- ing stress [46]. In the current study, piglets fed MOA tors to mortality and growth retardation in weaned pig- improved the level of serum T-AOC and GSH-Px on d lets [1]. In the current study, no significant difference 11 and enhanced the level of SOD in serum and GSH- was occurred on ADG and ADFI of piglets, but a low- Px in liver on d 21. The essential oils used in the present ered diarrhea rate was observed in piglets supplementing experiment were primarily thymol and eugenol, which of MOA from d 12 to 21, which was in agreement with have extremely powerful antioxidant capacity due to the Tian et al. [34] and Long et al. [14], who indicated their phenolic hydroxyl groups, serving as hydrogen Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 12 of 17 Fig. 5 The microbial composition and structure of the cecal contents in piglets as affected by dietary AGP and MOA supplementation. (A) Venn diagram. (B, E) Barplot analysis of microbial community compositions at phylum and family levels. (C, F) Heatmap analysis of microbial community compositions at phylum and family levels. (D) Circos diagram at family level. (G) Principal coordinate analysis (PCoA) based on bray-Curtis distance calculated from OTU abundance matrix (R = 0.98, P = 0.001). (H) Partial least squares discriminant analysis (PLS-DA) on OTU level, the analysis of similarities (ANOSIM) was used to exam the significant difference between treatments. (I) The α-diversity of microbial community, bar with the asterisk (*) level suggested the degree of significant difference and the values were indicated as means ± SEM (* 0.01 < P < 0.05, ** 0.001 < P < 0.01). (J) The discriminant analysis of LEfSe multi-level species difference from phylum to genus level. (K) Histogram of linear discriminant analysis (LDA) from phylum to genus level; the values were checked by a non-parametric factorial Kruskal-Wallis rank sum test to identify the microbes with the significant differential characteristics and a linear discriminant analysis was used to assess the degree of impact of abundance on the differences for each species. (L, M) Significance test of difference between treatments at phylum and family levels. Control (Ctrl): a corn soybean meal-based diet. AGP: Ctrl + 75 mg/kg chlortetracycline. MOA: Ctrl + 1500 mg/kg MOA. n =4 donors to peroxyl radicals in the first step of the oxida- [34], who supplemented essential oil (13.5% thymol and tion reaction, thus effectively preventing and delaying 4.5% cinnamaldehyde) to the diets enhanced the level of lipid oxidation [47]. It was also confirmed by Tian et al. serum SOD, T-AOC and catalase on d 14, lowered the Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 13 of 17 Fig. 6 The microbial composition and structure of the colonic contents in piglets at 21 days of age as affected by dietary AGP and MOA supplementation. (A) Venn diagram. (B, E) Barplot analysis of microbial community compositions at phylum and family levels. (C, F) Heatmap analysis of microbial community compositions at phylum and family levels. (D) Circos diagram at family level. (G) Principal coordinate analysis (PCoA) based on bray-Curtis distance calculated from OTU abundance matrix (R = 0.68, P = 0.001). (H) Partial least squares discriminant analysis (PLS-DA) on OTU level, the analysis of similarities (ANOSIM) was used to exam the significant difference between treatments. (I) The α-diversity of microbial community, bar with the asterisk (*) level suggested the degree of significant difference and the values were indicated as means ± SEM (* 0.01 < P < 0.05, ** 0.001 < P < 0.01, *** 0.0001 < P < 0.001, **** P < 0.0001). (J) The discriminant analysis of LEfSe multi-level species difference from phylum to genus level. (K) Histogram of linear discriminant analysis (LDA) from phylum to genus level; the values were checked by a non- parametric factorial Kruskal-Wallis rank sum test to identify the microbes with the significant differential characteristics and a linear discriminant analysis was used to assess the degree of impact of abundance on the differences for each species. (L, M) Significance test of difference between treatments at phylum and family levels. Control (Ctrl): a corn soybean meal-based diet. AGP: Ctrl + 75 mg/kg chlortetracycline. MOA: Ctrl + 1500 mg/kg MOA. n =4 Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 14 of 17 content of MDA in serum and improved the level of inflammation [57], were usually applied to assess the in- GSH-Px in liver on d 28. Also, Xu et al. [36] supple- tegrity of the intestinal barrier [58]. In the current study, mented MOA to the diets also reduced the level of dietary supplemented MOA showed a positive effect on serum MDA. Therefore, the improvement of the antioxi- the relative gene expression of claudin-1 and mucin-2 in dant properties in serum piglet was mainly attributed to ileum of piglets. Also, compared to the AGP, a beneficial the action of essential oils. The different types and con- effect in duodenum (claudin-1), jejunum (claudin-1, ZO-1, centrations of essential oils maybe the principal reasons mucin-1) and ileum (occludin, claudin-1, mucin-2) were for the differences in results. observed in piglets fed MOA, which was accordance with The integrity of the morphological structure of the in- the findings by Pu et al. [41], who dietary supplemented testine is paramount for maintaining the normal intes- 3000 mg/kg of benzoic acid, 400 mg/kg of Bacillus coagu- tinal function [48]. An atrophied intestinal villus or an lans and 400 mg/kg of oregano oil improved the relative elevated crypt depth demonstrated a reduced ability of gene expression of claudin-1, occluding and mucin-2 in the small intestine to absorb nutrients [49]. Additionally, jejunum of piglets. It indicated that the enhanced nutrient lowered digestive enzyme activity was not conducive to digestibility and reduced diarrhea rates in piglets were nutrient absorption, causing reduced nutrient digestibil- probably associated with the improved intestinal mechan- ity in piglets [50]. In the current study, dietary supple- ical and chemical barriers. mented MOA enhanced the trypsin and lipase activities It is emerging that the intestinal microbiota occupied in pancreas compared to the AGP and improved the a decisive role in the physiological and health status of ATTD of DM, OM and GE in piglets. However, a bene- the host [59]. The mixed organic acids were considered ficial effect on intestinal morphology in piglets dietary to be effective ways to act in the distal intestine and supplemented MOA was not noticed, which was similar regulate intestinal health, especially by altering the struc- with Xu et al. [36]. Mechanistically, mixed organic acids ture of bacterial cells through the action of essential oil, improved the absorption of nutrients in piglets by lower- allowing organic acid to easily enter bacterial cell mem- ing the pH of the gastrointestinal tract to the optimum branes and causing the death of some pathogenic bac- pH of pepsin (2.0–3.5), trypsin (7.8–8.5), and lipase (4– teria [33]. Studies have documented that the higher the 5.4) and increasing the activity of digestive enzymes [51]. diversity and abundance of microorganisms, the stronger However, one study suggested that the addition of essen- the organism’s ability to resist colonization by foreign tial oil and lactic acid to the diet did not notice any pathogens. The diversity and abundance of intestinal mi- changes in digestive enzymes in the pancreas and small croorganisms decreases when the organism is stressed intestine of broilers [52], which might be connected with [60]. In current research, dietary supplemented MOA the low concentration of lactic acid, resulting in the in- enhanced the Sobs, Ace and Chao indices of microbiota ability to stimulate digestive enzyme activity. In addition, in cecum, increased the Sobs, Ace and Chao indices of the improvement of intestinal morphology in piglets microorganism in colon, which was similar to our previ- may be associated with the concentration of MOA prod- ous research [40]. Additionally, our study observed that ucts supplemented. dietary supplemented AGP increased the Simpson index Weaning affects the number of intestinal bacteria, with of microorganisms in cecum of piglets, which was incon- a significant increase in the number of total aerobic bac- sistent with Yu et al. [61], who reported that AGP de- teria, enterobacteria and enterococcus of piglets at the first creased the richness and diversity in ileum of suckling week after weaning [53, 54]. The damage to the intestinal pigs. The differences occurred probably related to the mucosa during weaning provided a substrate for patho- type of antibiotic and the growth stage of the piglets. genic bacteria to reproduce, increasing the possibility of Nonetheless, Adewole et al. [62] and Ma et al. [37] re- pathogenic bacteria adhesion and invasion. Also, the ported that no significance difference was noticed on α- toxins and metabolites generated by pathogenic bacteria diversity in cecum of broilers. The probable reasons for also destroyed the intestinal mucosal barrier (character- this finding were attributed to the type of animal, age, ized by increased intestinal permeability), which affected diet composition and health status [63]. Similar to previ- the nutrient absorption and caused diarrhea in weaned ous study in cecum of piglets [37], the Firmicutes and piglets [55]. Hence, an intact intestinal mucosal barrier is Bacteroidetes were dominated phylum. crucial to guarantee the provision of adequate dietary nu- Further analysis by β-diversity of microbiota, the mi- trition to the whole body. The mechanical barrier, such as crobial composition in the cecum and ileum of piglets claudin-1, occludin, ZO-1, which regarded as principal differed between treatments, which was in agreement constitution of tight junction and essential regulators in with the findings of Dai et al. [15] in broilers. Faecali- paracellular permeability [56], and chemical barriers, such bacterium was the paramount short chain fatty acid- as mucin-1, mucin-2, which were secreted by goblet cell producing bacterium in the human hindgut, also benefi- and played crucial roles in modulating intestinal cial in improving diseases such as inflammatory bowel Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 15 of 17 disease and colorectal cancer, which further explained γ: Gamma-interferon; IgA, IgG, IgM: Immunoglobulins A, G, M; IL- 1β: Interleukin-1β; IL-10: Interleukin-10; MDA: Malondialdehyde; the improvement of intestinal barriers and the increased MOA: Microencapsulated essential oils and organic acids; OM: Organic concentration of volatile fatty acids (propionic acid and matter; OTU: Operational taxonomic unit; SOD: Superoxide dismutase; T- butyric acid) in the cecum [64]. Muribaculaceae are cor- AOC: Total antioxidant capacity; TNF-α: Tumor necrosis factor-α; VH: Villi height; ZO-1: Zonula occludens-1 related with up-regulation of expression of genes related to carbohydrate metabolism [65]. Streptococcus were Acknowledgements useful for reducing intestinal pathogen load [66]. Weis- We acknowledge Jefagro Company (St-Hyacinthe, Canada) for providing the sella, a species of lactic acid bacteria, were members of commercial products and Tongli XingKe Agricultural Technology Co Ltd. (Beijing, China). for offering the antibiotic. the autochthonous microorganism in livestock primarily, which was available as microbial products applied in dir- Authors’ contributions ect feeding for livestock [67]. In addition, our present re- JYM: Conceptualization, Software, Data Curation, Writhing-Original Draft Prep- search noticed that dietary supplemented MOA aration, and Visualization; JYM, SFL, JW, JG: Methodology, Investigation; XSP: Supervision; Validation; XSP, SFL, JW, JG: Writing- Reviewing and Editing. All increased the abundance of Streptococcaceae in colon of authors reviewed and endorsed the final manuscript. The authors read and piglets, which include the essential species Lactococcus approved the final manuscript. lactis (usually used in fermentative food) and the disease-causing Streptococcus pneumoniae [68], which Funding This research was supported by the National Natural Science Foundation of was inconsistent with Xu et al. [32], who observed that China (31772612) and Beijing Municipal Natural Science Foundation dietary supplemented the essential oil and organic acid (6202019). increased the abundance of Lactobacillus and Bacilli in the ileum after ETEC F4 (K88 ) challenge. The reason Availability of data and materials Not applicable. maybe relevant to differences in piglets (challenged or not) as well as intestinal segments (ileum or cecum). Yu Declarations et al. [61] founded that early antibiotic exposure changes the microbial composition of suckling piglets, leaving Ethics approval and consent to participate All the programs performed in our animal experiment were endorsed and them in a vulnerable and unhealthy intestinal environ- authorized by the Institutional Animal Care and Use Committee of China ment, which was also analogous to our research on pig- Agricultural University (No.AW10601202–1-2, Beijing, China). lets. Therefore, the improvement of microbial community in the cecum and colon of piglets contrib- Consent for publication Not applicable. uted to the increased content of volatile fatty acids and modulated the relevant gene expression of intestinal bar- Competing interests rier, improving intestinal health. The author declares that there is no conflict of interest. Author details Conclusions State Key Laboratory of Animal Nutrition, College of Animal Science and In conclusion, dietary supplemented 1500 mg/kg of 2 Technology, China Agricultural University, Beijing 100193, China. Institute of MOA alleviate diarrhea and improve nutrient apparent Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100193, China. digestibility in piglets presumably by enhancing immuno-antioxidant properties, increasing digestive en- Received: 11 September 2021 Accepted: 14 December 2021 zyme activity, up-regulating the expression of intestinal barrier-related genes, and modifying the microbial com- References munity structure of the cecum and colon. Compared to 1. Li Y, Guo Y, Wen Z, Jiang X, Ma X, Han X. Weaning stress perturbs gut conventional single organic acid or essential oil prod- microbiome and its metabolic profile in piglets. Sci Rep. 2018;8(1):18068. ucts, MOA are capable of improving the health of piglets https://doi.org/10.1038/s41598-018-33649-8. 2. Moeser AJ, Pohl CS, Rajput M. Weaning stress and gastrointestinal barrier by avoiding absorption into the foregut segment and en- development: implications for lifelong gut health in pigs. Anim Nutr. 2017; tering the hindgut to modulate the microbial structure. 3(4):313–21. https://doi.org/10.1016/j.aninu.2017.06.003. Nonetheless, the increased abundance of some poten- 3. Xiang Q, Wu X, Pan Y, Wang L, Cui C, Guo Y, et al. Early-life intervention using fecal microbiota combined with probiotics promotes gut microbiota tially pathogenic bacteria (Streptococcaceae) could be at- maturation, regulates immune system development, and alleviates weaning tributed to the antimicrobial properties or concentration stress in piglets. Int J Mol Sci. 2020;21(2):503. https://doi.org/10.3390/ijms21 of the product, which remains to be further validated. 020503. 4. Dibner JJ, Richards JD. Antibiotic growth promoters in agriculture: history Abbreviation and mode of action. Poult Sci. 2005;84(4):634–43. https://doi.org/10.1093/ps/ ADF: Acid detergent fiber; ADFI: Average daily feed intake; ADG: Average 84.4.634. daily gain; AGP: Antibiotic growth promoters; ATTD: Apparent total tract 5. Hershberg R. Antibiotic-independent adaptive effects of antibiotic resistance digestibility; CD: Crypt depth; CP: Crude protein; DAO: Diamine oxidase; mutations. Trends Genet. 2017;33(8):521–8. https://doi.org/10.1016/j.tig.2017. DLA: D-lactic acid; DM: Dry matter; EE: Ether extract; NDF: Neutral detergent 05.003. fiber; FCR: Feed conversion ratio; GAPDH: Glyceraldehyde-3-phosphate 6. Lundborg CS, Tamhankar A. Antibiotic residues in the environment of South dehydrogenase; GE: Gross energy; GSH-Px: Glutathione peroxidase; IFN- East Asia. BMJ-Brit Med J. 2017;358:42–5. https://doi.org/10.1136/bmj.j2440. Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 16 of 17 7. Union, E. Ban on antibiotics as growth promoters in animal feed enters into 29. Suiryanrayna MVAN, Ramana JV. A review of the effects of dietary organic effect 2006. https://ec.europa.eu/commission/presscorner/detail/en/IP_05_1 acids fed to swine. J Anim Sci Biotechnol. 2015;6:45. https://doi.org/10.1186/ 687. Accessed May 2021. s40104-015-0042-z. 8. AccessScience. U.S. bans antibiotics use for enhancing growth in livestock. 30. Zeng Z, Zhang S, Wang H, Piao X. Essential oil and aromatic plants as feed 2017. https://www.accessscience.com/content/u-s-bans-antibiotics-use-for- additives in non-ruminant nutrition: a review. J Anim Sci Biotechnol. 2015;6: enhancing-growth-in-livestock/BR0125171. Accessed Apr 2021. 7. https://doi.org/10.1186/s40104-015-0004-5. 9. Echemi. The feed prohibition order came into effect in July. 2020. https:// 31. Rodrigues LM, TOdAL N, CAP G, CCdS M, Garcez D, LKS A, et al. Benzoic www.echemi.com/cms/110309.html. Accessed Mar 2021. acid combined with essential oils can be an alternative to the use of 10. Gadde U, Kim WH, Oh ST, Lillehoj HS. Alternatives to antibiotics for antibiotic growth promoters for piglets challenged with E. coli F4. Animals. maximizing growth performance and feed efficiency in poultry: a review. 2020;10(11):1978. https://doi.org/10.3390/ani10111978. Anim Health Res Rev. 2017;18(1):26–45. https://doi.org/10.1017/s146625231 32. Xu Y, Lahaye L, He Z, Zhang J, Yang C, Piao X. Micro-encapsulated essential 6000207. oils and organic acids combination improves intestinal barrier function, 11. Liu Y, Espinosa CD, Abelilla JJ, Casas GA, Lagos LV, Lee SA, et al. Non- inflammatory responses and microbiota of weaned piglets challenged with (+) antibiotic feed additives in diets for pigs: a review. Anim Nutr. 2018;4(2): enterotoxigenic Escherichia coli F4 (K88 ). Anim Nutr. 2020;6(3):269–77. 113–25. https://doi.org/10.1016/j.aninu.2018.01.007. https://doi.org/10.1016/j.aninu.2020.04.004. 12. Zeng Z, Xu X, Zhang Q, Li P, Zhao P, Li Q, et al. Effects of essential oil 33. Omonijo FA, Ni L, Gong J, Wang Q, Lahaye L, Yang C. Essential oils as supplementation of a low-energy diet on performance, intestinal morphology alternatives to antibiotics in swine production. Anim Nutr. 2018;4(2):126–36. and microflora, immune properties and antioxidant activities in weaned pigs. https://doi.org/10.1016/j.aninu.2017.09.001. Anim Sci J. 2015;86(3):279–85. https://doi.org/10.1111/asj.12277. 34. Tian Q, Piao X. Essential oil blend could decrease diarrhea prevalence by improving antioxidative capability for weaned pigs. Animals. 2019;9(10):847. 13. Alipour F, Hassanabadi A, Golian A, Nassiri-Moghaddam H. Effect of plant https://doi.org/10.3390/ani9100847. extracts derived from thyme on male broiler performance. Poult Sci. 2015; 94(11):2630–4. https://doi.org/10.3382/ps/pev220. 35. Yang C, Zhang L, Cao G, Feng J, Yue M, Xu Y, et al. Effects of dietary 14. Long SF, Xu YT, Pan L, Wang QQ, Wang CL, Wu JY, et al. Mixed organic supplementation with essential oils and organic acids on the growth acids as antibiotic substitutes improve performance, serum immunity, performance, immune system, fecal volatile fatty acids, and microflora intestinal morphology and microbiota for weaned piglets. Anim Feed Sci community in weaned piglets. J Anim Sci. 2019;97(1):133–43. https://doi. Tech. 2018;235:23–32. https://doi.org/10.1016/j.anifeedsci.2017.08.018. org/10.1093/jas/sky426. 15. Dai D, Qiu K, Zhang H-J, Wu S-G, Han Y-M, Wu Y-Y, et al. Organic acids as 36. Xu YT, Liu L, Long SF, Pan L, Piao XS. Effect of organic acids and essential alternatives for antibiotic growth promoters alter the intestinal structure oils on performance, intestinal health and digestive enzyme activities of and microbiota and improve the growth performance in broilers. Front weaned pigs. Anim Feed Sci Tech. 2018;235:110–9. https://doi.org/10.1016/ Microbiol. 2021;11:618144. https://doi.org/10.3389/fmicb.2020.618144. j.anifeedsci.2017.10.012. 37. Ma J, Mahfuz S, Wang J, Piao X. Effect of dietary supplementation with 16. Xu B, Fu J, Zhu L, Li Z, Jin M, Wang Y. Overall assessment of antibiotic mixed organic acids on immune function, antioxidative characteristics, substitutes for pigs: a set of meta-analyses. J Anim Sci Biotechnol. 2021;12:3. digestive enzymes activity, and intestinal health in broiler chickens. Front https://doi.org/10.1186/s40104-020-00534-2. Nutr. 2021;8:673316. https://doi.org/10.3389/fnut.2021.673316. 17. Gutierrez J, Barry-Ryan C, Bourke P. The antimicrobial efficacy of plant essential oil combinations and interactions with food ingredients. Int J Food 38. Dohgu S, Yamauchi A, Takata F, Naito M, Tsuruo T, Higuchi S, et al. Microbiol. 2008;124(1):91–7. https://doi.org/10.1016/j.ijfoodmicro.2008.02.028. Transforming growth factor-beta 1 upregulates the tight junction and P- 18. Angienda PO, Hill D. The effect of sodium chloride and pH on the glycoprotein of brain microvascular endothelial cells. Cell Mol Neurobiol. antimicrobial effectiveness of essential oils against pathogenic and food 2004;24(3):491–7. https://doi.org/10.1023/B:CEMN.0000022776.47302.ce. spoilage bacteria: implications in food safety. World Acad Sci Eng Technol. 39. Saraiva M, O'Garra A. The regulation of IL-10 production by immune cells. 2011;57:1033–8. Nat Rev Immunol. 2010;10(3):170–81. https://doi.org/10.1038/nri2711. 19. NRC. Nutrient requirements of swine. 11th rev ed. Washington, DC: National 40. Ma J, Piao X, Shang Q, Long S, Liu S, Mahfuz S. Mixed organic acids as an Academy Press; 2012. alternative to antibiotics improve serum biochemical parameters and intestinal health of weaned piglets. Anim Nutr. 2021;7(3):737–49. https://doi. 20. AOAC. Association of Official Analytical Chemists: Official Methods of org/10.1016/j.aninu.2020.11.018. Analysis. AOAC: Off Methods Anal. 1990;1:69–90. 21. Vansoest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral 41. Pu J, Chen D, Tian G, He J, Zheng P, Mao X, et al. Effects of benzoic acid, detergent fiber, and nonstarch polysaccharides in relation to animal Bacillus coagulans and oregano oil combined supplementation on growth nutrition. J Dairy Sci. 1991;74(10):3583–97. https://doi.org/10.3168/jds.S0022- performance, immune status and intestinal barrier integrity of weaned piglets. 0302(91)78551-2. Anim Nutr. 2020;6(2):152–9. https://doi.org/10.1016/j.aninu.2020.02.004. 22. Williams CH, Iismaa O, David DJ. Determination of chromic oxide in faeces 42. Chen L, Sun M, Wu W, Yang W, Huang X, Xiao Y, et al. Microbiota samples by atomic absorption spectrophotometry. J Agr Sci-Cambridge. metabolite butyrate differentially regulates th1 and th17 cells' differentiation 1962;59(3):381–5. https://doi.org/10.1017/s002185960001546x. and function in induction of colitis. Inflamm Bowel Dis. 2019;25(9):1450–61. https://doi.org/10.1093/ibd/izz046. 23. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello 43. Sun M, Wu W, Chen L, Yang W, Huang X, Ma C, et al. Microbiota-derived EK, et al. QIIME allows analysis of high-throughput community sequencing short-chain fatty acids promote Th1 cell IL-10 production to maintain data. Nat Methods. 2010;7(5):335–6. https://doi.org/10.1038/nmeth.f.303. intestinal homeostasis. Nat Commun. 2018;9(1):3555. https://doi.org/10.103 24. Stackebrandt E, Goebel BM. A place for dna-dna reassociation and 16s 8/s41467-018-05901-2. ribosomal-RNA sequence-analysis in the present species definition in 44. Luu M, Visekruna A. Short-chain fatty acids: bacterial messengers bacteriology. Int J Syst Bacteriol. 1994;44(4):846–9. https://doi.org/10.1099/ modulating the immunometabolism of T cells. Eur J Immunol. 2019;49(6): 00207713-44-4-846. 842–8. https://doi.org/10.1002/eji.201848009. 25. Edgar RC. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat Methods. 2013;10(10):996–8. https://doi.org/10.1038/nmeth.2604. 45. Novais AK, Deschene K, Martel-Kennes Y, Roy C, Laforest J-P, Lessard M, 26. Wang Q, Garrity GM, Tiedje JM, Cole JR. Naive Bayesian classifier for rapid et al. Weaning differentially affects mitochondrial function, oxidative stress, assignment of rRNA sequences into the new bacterial taxonomy. Appl inflammation and apoptosis in normal and low birth weight piglets. PLoS Environ Microb. 2007;73(16):5261–7. https://doi.org/10.1128/aem.00062-07. One. 2021;16(2):e0247188. https://doi.org/10.1371/journal.pone.0247188. 46. Lei XG, Zhu J-H, Cheng W-H, Bao Y, Ho Y-S, Reddi AR, et al. Paradoxical roles 27. Zhang Z, Chen Y, Xiang L, Wang Z, Xiao GG, Hu J. Effect of curcumin on the of antioxidant enzymes: basic mechanisms and health implications. Physiol diversity of gut microbiota in ovariectomized rats. Nutrients. 2017;9(10):1146. Rev. 2016;96(1):307–64. https://doi.org/10.1152/physrev.00010.2014. https://doi.org/10.3390/nu9101146. 47. Miguel MG. Antioxidant and anti-inflammatory activities of essential oils: a 28. Papadopoulos GA, Poutahidis T, Tallarico N, Hardas A, Teliousis K, Arsenos G, short review. Molecules. 2010;15(12):9252–87. https://doi.org/10.3390/ et al. Dietary supplementation of encapsulated organic acids enhances molecules15129252. performance and modulates immune regulation and morphology of jejunal mucosa in piglets. Res Vet Sci. 2017;115:174–82. https://doi.org/10.1016/j. 48. Diao H, Zheng P, Yu B, He J, Mao XB, Yu J, et al. Effects of dietary rvsc.2017.04.014. supplementation with benzoic acid on intestinal morphological structure Ma et al. Journal of Animal Science and Biotechnology (2022) 13:16 Page 17 of 17 and microflora in weaned piglets. Livest Sci. 2014;167:249–56. https://doi. 67. Sturino JM. Literature-based safety assessment of an agriculture- and org/10.1016/j.livsci.2014.05.029. animal-associated microorganism: Weissella confusa. Regul Toxicol 49. Moeser AJ, Borst LB, Overman BL, Pittman JS. Defects in small intestinal Pharmacol. 2018;95:142–52. https://doi.org/10.1016/j.yrtph.2018.03.013. epithelial barrier function and morphology associated with peri-weaning 68. Price CE, Zeyniyev A, Kuipers OP, Kok J. From meadows to milk to mucosa - failure to thrive syndrome (PFTS) in swine. Res Vet Sci. 2012;93(2):975–82. adaptation of Streptococcus and Lactococcus species to their nutritional https://doi.org/10.1016/j.rvsc.2012.01.003. environments. FEMS Microbiol Rev. 2012;36(5):949–71. https://doi.org/1 0.1111/j.1574-6976.2011.00323.x. 50. Rideau N, Nitzan Z, Mongin P. Activities of amylase, trypsin and lipase in the pancreas and small-intestine of the laying hen during egg formation. Brit Poultry Sci. 1983;24(1):1–9. https://doi.org/10.1080/00071668308416707. 51. Sams L, Paume J, Giallo J, Carriere F. Relevant pH and lipase for in vitro models of gastric digestion. Food Funct. 2016;7(1):30–45. https://doi.org/1 0.1039/c5fo00930h. 52. Jang IS, Ko YH, Yang HY, Ha JS, Kim JY, Kim JY, et al. Influence of essential oil components on growth performance and the functional activity of the pancreas and small intestine in broiler chickens. Asian Austral J Anim Sci. 2004;17(3):394–400. https://doi.org/10.5713/ajas.2004.394. 53. Urubschurov V, Janczyk P, Souffrant W-B, Freyer G, Zeyner A. Establishment of intestinal microbiota with focus on yeasts of unweaned and weaned piglets kept under different farm conditions. FEMS Microbiol Ecol. 2011; 77(3):493–502. https://doi.org/10.1111/j.1574-6941.2011.01129.x. 54. Montagne L, Boudry G, Favier C, Le Huerou-Luron I, Lalles J-P, Seve B. Main intestinal markers associated with the changes in gut architecture and function in piglets after weaning. Brit J Nutr. 2007;97(1):45–57. https://doi. org/10.1017/s000711450720580x. 55. Moeser AJ, Vander Klok C, Ryan KA, Wooten JG, Little D, Cook VL, et al. Stress signaling pathways activated by weaning mediate intestinal dysfunction in the pig. Am J Physiol-Gastr L. 2007;292(1):G173–G81. https:// doi.org/10.1152/ajpgi.00197.2006. 56. Slifer ZM, Blikslager AT. The integral role of tight junction proteins in the repair of injured intestinal epithelium. Int J Mol Sci. 2020;21(3):972. https:// doi.org/10.3390/ijms21030972. 57. Moughan PJ, Rutherfurd SM, Balan P. Kiwifruit, mucins, and the gut barrier. In: Boland M, Moughan PJ, editors. Nutritional benefits of kiwifruit. Advances in food and nutrition research, vol. 68; 2013. p. 169–85. https://doi.org/10.1 016/B978-0-12-394294-4.00009-2. 58. Mao X, Zeng X, Qiao S, Wu G, Li D. Specific roles of threonine in intestinal mucosal integrity and barrier function. Front Biosci-Landmrk. 2011;3:1192–200. 59. Wang H, Xu R, Zhang H, Su Y, Zhu W. Swine gut microbiota and its interaction with host nutrient metabolism. Anim Nutr. 2020;6(4):410–20. https://doi.org/10.1016/j.aninu.2020.10.002. 60. Lin HV, Frassetto A, Kowalik EJ Jr, Nawrocki AR, Lu MM, Kosinski JR, et al. Butyrate and propionate protect against diet-induced obesity and regulate gut hormones via free fatty acid receptor 3-independent mechanisms. PLoS One. 2012;7(4):e35240. https://doi.org/10.1371/journal.pone.0035240. 61. Yu M, Mu C, Zhang C, Yang Y, Su Y, Zhu W. Marked response in microbial community and metabolism in the ileum and cecum of suckling piglets after early antibiotics exposure. Front Microbiol. 2018;9:1166. https://doi. org/10.3389/fmicb.2018.01166. 62. Adewole DI, Oladokun S, Santin E. Effect of organic acids-essential oils blend and oat fiber combination on broiler chicken growth performance, blood parameters, and intestinal health. Anim Nutr. 2021;7(4):1039–51. https://doi. org/10.1016/j.aninu.2021.02.001. 63. Wang X, Tsai T, Deng F, Wei X, Chai J, Knapp J, et al. Longitudinal investigation of the swine gut microbiome from birth to market reveals stage and growth performance associated bacteria. Microbiome. 2019;7(1): 109. https://doi.org/10.1186/s40168-019-0721-7. 64. Ferreira-Halder CV, de Sousa Faria AV, Andrade SS. Action and function of Faecalibacterium prausnitzii in health and disease. Best Pract Res Cl Ga. 2017;31(6):643–8. https://doi.org/10.1016/j.bpg.2017.09.011. 65. Chung YW, Gwak H-J, Moon S, Rho M, Ryu J-H. Functional dynamics of bacterial species in the mouse gut microbiome revealed by metagenomic and metatranscriptomic analyses. PLoS One. 2020;15(1):e0227886. https:// doi.org/10.1371/journal.pone.0227886. 66. Roto SM, Rubinelli PM, Ricke SC. An introduction to the avian gut microbiota and the effects of yeast-based prebiotic-type compounds as potential feed additives. Front Vet Sci. 2015;2:28. https://doi.org/10.3389/ fvets.2015.00028.
Journal
Journal of Animal Science and Biotechnology – Springer Journals
Published: Feb 11, 2022
Keywords: Essential oil; Gut microbiota; Intestinal barrier; Mixed organic acid; Piglets