Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Mitochondrial dynamics regulates Drosophila intestinal stem cell differentiation

Mitochondrial dynamics regulates Drosophila intestinal stem cell differentiation Differentiation of stem/progenitor cells is associated with a substantial increase in mitochondrial mass and complexity. Mitochondrial dynamics, including the processes of fusion and fission, plays an important role for somatic cell reprogramming and pluripotency maintenance in induced pluripotent cells (iPSCs). However, the role of mitochondrial dynamics during stem/progenitor cell differentiation in vivo remains elusive. Here we found differentiation of Drosophila intestinal stem cell is accompanied with continuous mitochondrial fusion. Mitochondrial fusion defective(opa1RNAi) ISCs contain less mitochondrial membrane potential, reduced ATP, and increased ROS level. Surprisingly, suppressing fusion also resulted in the failure of progenitor cells to differentiate. Cells did not switch on the expression of differentiation markers, and instead continued to show characteristics of progenitor cells. Meanwhile, proliferation or apoptosis was unaffected. The differentiation defect could be rescued by concomitant inhibition of Drp1, a mitochondrial fission molecule. Moreover, ROS scavenger also partially rescues opa1RNAi- associated differentiation defects via down-regulating JNK activity. We propose that mitochondrial fusion plays a pivotal role in controlling the developmental switch of stem cell fate. Introduction For instance, cardio-myocyte differentiation in the Stem differentiation is accompanied by pronounced embryonic heart is tightly linked to mitochondrial changes in mitochondria. In embryonic stem cells (ESCs) or maturation . Mouse hearts at embryonic day (E) 9.5 contain induced pluripotent stem cells (iPSCs), mitochondria are relatively few and immature mitochondria, characterized by few in number, small and globular in shape, have fewer rare and disorganized cristae. In E13.5 hearts the mito- cristae, and are distributed as perinuclear clusters. During chondrial mass increases substantially, accompanied by differentiation, mitochondria increase dramatically in mass maturation of the organelle as indicated by abundant 1–5 7,8 and form an extensive tubular network , while somatic laminar cristae . Accordingly, one of the major obstacles cell reprogramming is accompanied by depletion of mito- for somatic reprogramming induced cardiomyocytes is to 6 8 chondria through mitophagy (mitochondrial autophagy) . obtain functional mitochondria .How thesemitochondrial changes are regulated remains unexplored in vivo. Mitochondrial morphology is regulated by continuous fusion and fission events. These dynamics processes are Correspondence: Hansong Deng (hdeng@tongji.edu.cn)or Ming Guo (mingfly@ucla.edu) or Volker Hartenstein (volkerh@mcdb.ucla.edu) controlled by a group of GTPase proteins conserved from Shanghai East Hospital, School of Life Sciences and Technology, Tongji yeast to human. Mitofusins and opa1 are involved in outer University, Shanghai 20092, China and inner membrane fusion, respectively. Dynamin- Department of Neurology, Department of Molecular and Medical Pharmacology, California Nanosystems Institute at UCLA David Geffen School related protein 1 (Drp1) is responsible for mitochondrial of Medicine, University of California, Los Angeles, CA 90095, USA fission. Previous results from our lab and others showed Full list of author information is available at the end of the article. These authors contributed equally Hansong Deng, Shigeo Takashima Edited by I. Lavrik © 2018 The Author(s). Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to theCreativeCommons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Official journal of the Cell Death Differentiation Association 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Deng et al. Cell Death Discovery (2019) 5:17 Page 2 of 13 that Drosophila homologs of fusion (MARF/mfn, opa1) layer on the apical membrane facing the gut lumen; apical and fission (drp1) are functionally conserved and are membranes are deeply invaginated, and mitochondria are involved in pathogenesis of neuro-degeneration located in between membrane invaginations (Fig. 1c and c 9–12 diseases . Recent findings indicated that mitochon- ′). Mitochondria are densely packed, elongated apico- drial fission is required for stem cell pluripotency main- basally, and often highly branched (Fig. 1c and c′). The tenance in iPSCs and ESCs . Aside from affecting energy size of mitochondria in these areas varies from 200 to 500 nm in diameter, and often several microns in length. metabolism, mitochondrial fusion and fission has many other effects on developing and mature cells, in particular Differentiated midgut enterocytes do not form cuticle, but in regard to mitochondrial DNA (mtDNA) distribution, a dense array of microvilli was formed at their apical pole. 14–16 ROS production, calcium overload, and apoptosis . Mitochondria take up most of the cytoplasm of these However, the role of mitochondrial dynamics on stem cell cells; as in the hindgut, individual mitochondria are much differentiation in developing context is largely unknown. larger, elongated, and often branched (Fig.S2D). The Drosophila adult gut and its stem cell populations derive from gut progenitors of the larval stage. In the Inhibiting mitochondrial fusion through opa1 or mfn midgut, these cells form small clusters (adult midgut knockdown causes hindgut stem/progenitor cells failed to progenitors or AMPs) scattered over the outer surface of differentiate 17,18 the midgut epithelium ; in the hindgut, adult pro- To manipulate mitochondrial dynamics, we took genitors form a narrow domain, the hindgut proliferation advantage of RNA interference (RNAi) and of over- zone (HPZ) also known as imaginal ring, located near the expression of the responsible genes, using the UAS-GAL4 19,20 anterior hindgut boundary (Fig. 1a). During early system and the temperature-sensitive GAL80 repressor ts metamorphosis, these progenitor populations expand (GAL80 ). Byn-Gal4-directed expression of an opa1- over the larval gut which undergoes programmed cell RNAi construct was able to block mitochondrial fusion death. Subsequently, most progenitors differentiate into in the hindgut. Mitochondria in opa1-RNAi-expressing adult enterocytes, whereas a small subpopulation of pro- hindgut enterocytes are ellipsoid in shape (Fig. 1d–d′ and genitors is held back and gives rise to adult progenitor/ Fig. S1C), a similar phenomenon was observed in marf stem cells (Fig. 1a). These cells are quiescent in nature but RNAi hindguts (Fig. S1B). Aside from the expected defect 19,21 are highly inducible upon tissue damage . We specu- in mitochondrial fusion, opa1-RNAi severely affected lated that mitochondrial dynamics and the functional hindgut development. Byn-Gal4 > opa-1 RNAi animals die changes they engender controls the switch from gut within 2 days after eclosion (Fig. 2a), although the eclo- progenitor to differentiated enterocytes. sion rate is comparable with the sibling controls (data not shown). Similar result was obtained when opa1RNAi was ts Results knocked down from the L1 stage using the GAL80 sys- Mitochondria undergo a dramatic increase in volume and tem, ruling out the possibility of embryogenesis mis- complexity during differentiation of Drosophila intestinal patterning. The hindgut is significantly shorter and cells slightly “fatter” compared with control flies (Fig. 2b, c). Mitochondria of hindgut cells were labeled by the UAS- Stat92E-GFP (stat-GFP in short), a reporter for mito-GFP transgene driven by byn-GAL4, a hindgut- JAK–STAT pathway activity whose expression is restric- 22,23 specific driver (Fig. 1e–i and Fig. S1A). For the mid- ted to the HPZ in wild-type hindguts (Fig. 2d), remains gut, the esg-Gal4 driver was used (Fig. S2A and S2B). In strongly expressed throughout the entire hindgut of opa-1 the HPZ domain, the GFP-labeled mitochondria are few, RNAi animals (Fig. 2e). Enterocytes is surrounded by basal small in volume, and perinuclear in location (Fig. 1e, f and circular muscles in the hindgut. The apical membrane h–h′). AMPs of the larva also possess small, granular inviginations and cuticles of enterocytes can be densely mitochondria (Fig. S2A). Mitochondria of the differ- stained by Toluidine blue (Fig. 2i). However, the prospective entiated hindgut and midgut enterocytes have strongly enterocytes in opa1 RNAi are highly dilated and no apical increased in volume and number (Fig. 1e, g, i–i′ and membrane invaginations or cuticle was formed inside Fig. S2B). Transmission electron microscopy (TEM) was (Fig. 1d, d′ and 2j). The acute lethality of opa1-RNA flies used to resolve mitochondrial morphology and structure after eclosion and cellular structural abnormality in enter- at a higher-level resolution. The adult progenitor/stem ocytes suggested the lack of functionally differentiated cells. cells in the HPZ domain located adjacent to the mal- Indeed, opa-1(RNAi) hindguts lack signs of differentiation. pighian tubes and the mitochondria in these cells are By in situ hybridization, we found that FSH (CG7665), small and round in shape and cristae is rarely observed which is highly expressed in differentiated hindgut enter- (Fig. 1c). Mitochondria of midgut progenitors have similar ocytes of wild-type flies, is reduced or absent in opa-1 dimensions (Fig. S2C). Differentiated adult hindgut (RNAi) flies (Fig. 2n, o). Similar phenomena were found in enterocytes have enlarged in size and form a thick cuticle byn-GAL4>marf RNAi flies (Fig. 2h, m and r).Totest Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 3 of 13 Fig. 1 Extensive mitochondrial fusion during hindgut differentiation and opa-1 RNAi inhibit the fusion process. a Schematic representation of gut development in Drosophila. Progenitors in the larvae stage give rise to the adult gut including its stem cell/progenitor populations. Midgut and hindgut are connected through Malpighian tubes (MT). During early metamorphosis, the progenitor populations expand over the larval gut, which undergoes programmed cell death. For instance, in the midgut, adult midgut progenitors (AMPs, denoted in red dots) in the larvae stage generate adult gut and stem cells (red dots). Similarly, hindgut proliferative zone (HPZ) cells (also called as hindgut imaginal ring, denoted in green) in the larvae stage generates the whole adult hindgut (green), including a subset of progenitors in the anterior hindgut (adult HPZ/Pylorus) and the differentiated hindgut (also called as ileum). Please refer to the main text for details. Mitochondria morphology of hindgut cells in different regions was observed by TEM from b to d and by confocal microscopy from e to i. b Mitochondria in adult HPZ cells. Note that the HPZ cells identity was based on the physical location and their unique morphology. c Mitochondria in adult differentiated cells. The matured enterocytes form a thick layer of cuticle structure (“cu” in brief) toward the lumen. Mitochondria aligned with membrane invigination (“invg” in brief). d Mitochondria in BynGal4>opa1 RNAi adult differentiated cells. For b–d, higher magnification of rectangle area shown on the right in b′–d′. Mitochondrial borders are marked with dashed lines. Cu cuticle, invg invigination, dHg differentiated hindgut, MT Malpighian tubes. e–i Mitochondria morphology visualized by byn-GAL4 > UAS-mito-GFP under confocal microscopy. f (HPZ domain) and g (differentiation hindgut, dHg) are higher magnification of e. h–h′ and i–i′ are cross-sectional view of HPZ and dHg cells, respectively. From e to i, TOTO3 labels nuclei in blue. Scale bars: 200 µm in b–d, 100 µm for e, 20 µm for f–i whether an increase in mitochondrial fusion also causes change in the mito-GFP signal, suggesting irregular and hindgut dysfunction, we knocked down Drp1, an essential enlarged mitochondria (Fig. S1D). However, the viability of 25,26 component of the mitochondrial fission machinery . drp1-RNAi animals is comparable to wild type (Fig. 2a). Expression of drp1-RNAi in the hindgut elicited a definitive Cellular structure such as apical membrane invagination Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 4 of 13 Fig. 2 Enterocytes mis-differentiation induced by inhibiting mitochondrial fusion through opa1 or marf RNAi in the hindgut can be rescued by drp1 RNAi. a Survival curve of adult flies through knock down opa-1 (red), drp1 (green), both opa-1 and drp1 (yellow) or ctrl (blue) specifically in the hindgut by byn-GAL4. Y-axis is the survival percentage. X-axis is days after hatching out, at least 100 mated females counted for each genotype. b, c Short hindgut caused by opa1 RNAi. Hindguts are highlighted between the arrow and arrowhead. Arrow marks the boundary of the midgut and the hindgut and the arrowhead marks the boundary of the hindgut and the rectum. Green signal is Stat-GFP. d–h The Opa1RNAi hindgut shows extensive expansion of a progenitor marker, Stat-GFP (green), cell membrane labeled by myr-RFP (red). The boundary between the midgut and the hindgut are outlined by dashed lines. Nuclei stained by TOTO3 in blue in all images. i–m Cellular structure of hindgut enterocytes stained by Toluidine blue. Circular muscle (“cm” in short) and cuticle (“cu” in short) are pointed in arrows. n–r In situ hybridization of FSH, a gene specifically transcribed in normal differentiated cells, as shown in n, dramatically decreased in opa1 RNAi (o)or marf RNAi (r). FSH signal is largely restored by drp1 RNAi (p). Scale bar for b, c and n–r is 200 µm, 40 µm for d–m and cuticle as well as Stat-GFP expression are not sig- of opa1-RNAi flies can be fully rescued by drp1 knockdown nificantly altered (Fig. 2g, l). Over-expression of the fusion (Fig. 2a and data not shown). Importantly, the hindguts of gene Marf also produced no obvious defect on hindgut thedoubleknockdownswere properlyelongated and marker expression or cellular structure, although the expressed nearly normal pattern of Stat-GFP (Fig. 2f, k). mitochondria are more elongated than in control flies (data Furthermore, enterocyte differentiation failure in the not shown). These results suggested that loss of fission or opa1RNAi hindgut can be restored by drp1RNAi: the over-activation of fusion is dispensable for hindgut function. hindgut of the double knockdowns expressed nearly normal Next, we wanted to test if defects caused by opa-1 RNAi level of FSH (Fig. 2p, q). Similar results were obtained by and marf RNAi can be rescued by reduced fission (drp1 simultaneously knocking down Marf and drp1 (data not RNAi) or over-fusion (marf OE). Indeed, the acute lethality shown). Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 5 of 13 Fig. 3 Stem/progenitor cell proliferation is largely unaffected by opa1RNAi. a–c Replication rate was measured by BrdU feeding in stage- matched third larvae. Representative images are shown as a (ctrl) and b (opa1 RNAi). The HPZ zone is outlined with a white bracket. Quantification shown in c. No statistical significance was found, n = 5. d–h Proliferation rate was indicated by pH3-positive nuclei in larvae hindgut in 24 h APF (d, e) and 30 h APF (f, g). d and f are the Controls; e and g are opa-1 RNAi larvae. Quantification shown in h. No statistical significance was found, n = 6. Error bars represent standard deviation (STDEV) in c and h. Arrows pointed to the boundary of the midgut and the hindgut, and TOTO3 stained nuclei in blue. Scale bar for 100 µm Stem/progenitor cell proliferation is largely unaffected by same number of mitotic cells as controls (Fig. 3d, e and h). opa1RNAi Likewise, at 30 h apf, opa1-RNAi guts were devoid of As described above, the progenitor cell maker, Stat- mitotic cells, similar to controls (Fig. 3f–h). Wg acts as an GFP, expanded in the whole hindgut in opa-1(RNAi) and essential signal to stimulate proliferation of the HPZ and marf (RNAi) flies. We hypothesized that loss of mito- at the same time inhibits differentiation . Over- chondrial fusion may trigger stem cell over-proliferation expression of Wg in the HPZ results in a hindgut phe- and form a stem cell like tumor. As a result, stem cells notype that, in regard to lack of enterocyte differentiation, could fail to differentiate properly. To test this hypothesis, resembles the opa1-RNAi phenotype. To investigate we analyzed proliferation by applying BrdU, which is whether knock down of opa1 affects wg expression, we specifically incorporated in DNA of S phase cells. Adult used a Wg-lacZ reporter construct in the background of opa-1(RNAi) flies were fed BrdU-containing food for 24 h. byn-Gal4-driven opa1-RNAi. No significant change in the After staining, we did not find a significant difference in pattern of Wg-lacZ expression is evident (Fig. S3A and the number of BrdU-containing cells between control and S3B). Furthermore, CG31607, which normally transcribed opa-1(RNAi) flies (data not shown). Proliferation was also only in HPZ cells, has no or slight expansion in opa-1 tested during the larval stage. Mid-third instar larvae were (RNAi) flies (Fig. S3C and S3D). Taken together, these raised on BrdU-containing food for 24 h. We found an results suggest that the block of mitochondrial fusion by average of 55 BrdU-positive cells in control larvae, and 50 opa1-RNAi did not affect proliferation in the developing in opa1-RNAi larvae; the difference is not significant (n = intestine. 6; Fig. 3a–c). Proliferation of the adult hindgut progeni- tors normally ceases around 24 h after puparium forma- The hindgut defects in opa-1(RNAi) flies are not caused by tion (apf) . To rule out that the phase of proliferation is apoptosis of differentiated enterocytes extended in opa1-RNAi, we monitored pupae 24 h apf and Mitochondrial dynamics is closely related to apopto- 30 h apf, using an antibody against phosphorylated his- sis , and we wondered whether the opa1 and marf tone 3 (pH3). At 24 h, opa1-RNAi hindguts showed the knockdown phenotype is due to excessive cell death of Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 6 of 13 enterocytes. Our findings speak against this hypothesis. higher in differentiated cells in control hindguts (Figs. 5a No obvious increase of apoptotic cells was found in the and a′). However, in opa1-RNAi hindguts, all hindgut opa-1 RNAi hindgut by TUNEL staining (terminal cells have a relatively higher ROS level (Note: ‘black holes’ deoxynucleotidyl transferase dUTP nick end labeling) likely due to non-apoptotic cell death in opa1RNAi (Fig. S4A and S4B). As a control, we found excessive hindguts, shown as asterisk in Fig. 5b and b′). It implies TUNEL-positive cells when an rpr; hid over-expression that elevated ROS production may cause differentiation defects in opa1RNAi hindguts. As expected, over- construct was induced in the hindgut (Fig. S4C). Fur- thermore, over-expression of p35 and Diap, two caspase expressing Jafrac1, a thioredoxin peroxidase 1, led to a inhibitors , failed to rescue the opa-1(RNAi) defects in significantly reduction of ROS level and suppressed non- terms of lethality or ectopic stat-GFP in the hindgut apoptotic cell death phenotype in opa1RNAi hindguts (Figures S4D–F and data not shown). These data suggest (Fig.5c and c′). that the absence of differentiated cells in opa-1(RNAi) JNK mediated multiple downstream effects of ROS 31,33 flies is due to a failure of differentiation, rather than signaling . Puc-LacZ was used as a reporter for JNK apoptosis of differentiated cells. activity . We found that opa1RNAi hindguts have much higher Puc-LacZ staining than controls and can be fully Mitochondrial defects induced by inhibiting mitochondrial suppressed by overexpressing a dominant-negative form DN DN fusion in hindgut of JNK, UASBsk (Fig. 5d, f). Moreover, UASBsk can The functional output of mitochondria can be mon- partially suppress opa1RNAi-associated differentiation itored by the mitochondrial membrane potential, which defects, such as StatGFP expansion and gut length (Fig. reflects the proton gradient generated by oxidative 5g–i). phosphorylation across the inner membrane. Tetra- All these results indicated that the ROS–JNK pathway methylrhodamine ethyl ester (TMRE) is a commonly used participated in opa1RNAi hindgut defects. dye to monitor mitochondria membrane potential in live cells . We found that the increase in mitochondrial Inhibit mitochondrial fission also inhibit midgut enterocyte number and volume during enterocyte differentiation is differentiation accompanied by an increase in mitochondrial membrane Next, we examined the requirement of fusion for adult potential. Hindgut enterocyte progenitors exhibit low midgut differentiation. Larvae expressing opa1 RNAi TMRE signal, compared with the differentiated adult cells under the esg-GAL4 driver from the early (L1) stage (Fig. 4a/a′/a″ and Fig. S5A–C). Knocking-down opa1 onward fail to reach the pupal stage and arrest at the third caused a reduced functional output of mitochondria. The instar or pre-pupal stage (data not shown), probably membrane potential dropped to a level that, quantita- because of the multiple-tissue expression of esg-GAL4 tively, corresponded to that of enterocyte progenitors which may cause pleiotropic defects in development . (compare panels Fig. 4a′/a″ and b′/b″). Significant Differentiation defects was observed in the midgut pro- decrease of membrane potential was also found in opa1 genitors of these animals as well. In wild type, midgut RNAi clones (Fig. 4c/c′/c″). Mitochondrial ATP produc- progenitors split into two cell types. The center of each tion is coupled with membrane potential . As expected, progenitor cluster is occupied by small, rounded midgut opa1 RNAi hindguts have significantly lower ATP level progenitors which will form the adult midgut. These cells than controls. Although drp1 knocking down also are surrounded by large, flattened peripheral cells which decrease ATP production slightly, drp1 RNAi significantly during early metamorphosis differentiate into a transient 35,36 restores ATP level production of opa1 RNAi hindguts pupal midgut (Fig. S6A and B). Following opa1-RNAi (Fig. 4d). expression in midgut progenitors, peripheral cells did not differentiate (Fig. S6C). However, drp1 knocking down Excessive ROS induced JNK activity contributes to mis- fully suppressed the differentiation defects (Fig. S6D and differentiation in opa1RNAi hindgut E). To overcome the early lethality, we expressed opa1 We and others previously showed that ROS function as RNAi from the late third instar stage. Under these con- a signal molecule controls stem cell proliferation in ditions, larvae can pupate and eclose. Examination of Drosophila ISCs and mammalian airway basal stem cells midguts of freshly eclosed adults revealed a phenotype 31,32 (ABSCs) . Since most of ROS are produced by mito- that resembled in many aspects of the above described chondria and are closely regulated by mitochondrial fis- hindgut phenotype. A large proportion of midgut cells sion . We sought to test whether ROS is involved in shows signs of immaturity, in terms of small size, con- hindgut defects of opa1RNAi flies. tinued expression of esg, and Stat-GFP, another ISC/EB 35,37 Dihydroethidium (DHE) was used as a specific dye to marker (Fig. 6a–e). Moreover, the expression of Delta measure the ROS level in freshly dissected guts. DHE also showed massive expansion along with Esg in opa1 fluorescence is relatively lower in the HPZ zone, while RNAi flies (Fig. S7A, B). On the other hand, Pdm-1, a Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 7 of 13 Fig. 4 Mitochondrial defects induced by inhibiting mitochondrial fusion through opa1RNAi in hindgut. a, b TMRE staining in freshly dissected adult hindgut. Note wild-type enterocytes (“En” in short) have much higher fluorescent staining than cells in the HPZ domain. a′ and b′ are separate TMRE channels. a‴ and b‴ are higher magnified image of rectangle area in a′ and b′, respectively. The arrows point to the boundary of midgut and hindgut. The arrowheads denote the boundary of the hindgut and the rectum. c Opa1 RNAi clones in the adult hindgut have much lower membrane potential by TMRE staining. Clones are marked by dashed lines. c′ and c″ are separate GFP and TMRE channel, respectively. Genotype: hsFLP; UASGFP; Tub < tub80 > GAL4/opa1 RNAi. d Quantification of a relative ATP level of isolated hindguts with different genotypes: Ctrl, opa1 RNAi, and opa1 RNAi; drp1 RNAi. Error bars represent standard deviation (STDEV). Scale bar is 20 µm 38,39 differentiation marker for enterocyte , was normally the apical gut lumen and form actin enriched microvilli, expressed in most of these cells (data not shown). We which was stained by phalloidin. In control GFP-positive speculated that the relatively late onset of opa1 RNAi clones, enterocytes are adjacent to the phalloidin-stained expression (see above) may in part be responsible for the structure (Fig. 6h); however, the enterocytes retained in weak differentiation phenotype, compared to the hindgut. the basal side in opa1 RNAi clones (Fig. 6i). Finally, the We therefore examined the effect of opa1 knock-down cell size in the opa1RNAi clones is much smaller com- FLP-out clones. First instar larvae, with the genotype of pared with the adjacent non-labeled differentiated cells hsFLP; tub > GAL80 > GAL4, UAS-GFP/UAS-opa1RNAi, (Fig. 6j), indicating the immature differentiation. Again, were heat-shocked at 37 °C for 1 h to induce opa1 RNAi- this defect can be rescued by drp1 knock-down (Fig. 6k, l). expressing clones and the phenotype was examined at the adult stage. Clones of cells knocked-down for opa1 had no Discussion or decreased level of the differentiation marker Pdm-1, Our results here indicated that mitochondrial fusion, compared with clones without opa-1 RNAi (Fig. 6f–f‴). followed by increased functional output, forms part of the Meanwhile, clones bearing multiple copies of opa1RNAi causal chain that switches the cells state from stem/pro- induced in adult by another lineage tracing stock genitor cell towards differentiation. Thus, preventing fusion ts (esg GFP; UAS-FLP, tub < CD2 > GAL4) also showed by knock-down of opa-1 or marf can block enterocyte dif- smaller and significantly weaker expression of Pdm1 ferentiation in intestinal stem/progenitor cells. On the other (Fig. 6g–g‴). Matured enterocytes often migrated toward hand, blocking fission by over-expression of marf or knock Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 8 of 13 Fig. 5 ROS–JNK pathway contribute to differentiation defects in opa1RNAi hindguts. a–c DHE staining of freshly dissected hindgut. a′–c′ are DHE channel. Asterisk denotes potentially non-apoptotic cell death in opa1RNAi hindguts. d–f Anti-beta Gal staining against Puc-LacZ in different genotypes. g–i Differentiation index, such as Stat::GFP and gut length, was compared in different conditions. Gut length was delineated out by white lines. Scale bar is 20 µm down drp1 did not cause obvious defects in differentiation. low to moderate ROS levels is required for stem cell self- Moreover, blocking fissionbyknockingdownofdrp-1 renewal and proliferation . Similarly, Drosophila midgut rescued the defects of opa-1 RNAi. We then demonstrated stem cells have relatively lower ROS level compared with that mitochondria in the opa1 RNAi hindgut have lower differentiated enterocytes and increasing ROS level pro- membrane potential, less ATP production, and higher ROS. motes proliferation rate . Here, we showed that ROS- We then showed that a high ROS level contribute to mis- mediated JNK pathway contributed to opa1RNAi hindgut differentiation in opa1RNAi hindgut by increasing JNK mis-differentiation, indicating intrinsic difference of stem activity. These findings indicate that mitochondrial fusion is cells in response to ROS signaling. Besides ROS, mito- critical for enterocyte differentiation (Fig. 7). chondrial fusion could also trigger retrograde signaling ROS, in conjunction with the JNK pathway, affects stem pathways such as calcium , which we recently described cell activity, cell fate transition and cell survival . Our to capable to alter stem cell activity in Drosophila midgut previous results showed that in mouse and human ABSCs, ISCs Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 9 of 13 Fig. 6 (See legend on next page.) Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 10 of 13 (see figure on previous page) Fig. 6 Inhibiting mitochondrial fission also impairs midgut enterocyte differentiation. a Schematic view of cell types in the adult posterior midgut. Basal located progenitor cells (green) are Esg and Stat-GFP positive. Enlarged enterocytes can be labeled by differentiation marker Pdm1. CM is the brief for circular muscle. Both circular muscle and actin enriched microvilli in enterocytes can be stained by Phalloidin. b, c Ectopic Stat-GFP- positive cells (green) in the opa-1 RNAi midgut. The progenitor cells in the normal midgut are labeled with membrane-bound UAS-myr-RFP driven by Esg-GAL4. d, e Massive enterocyte-like cells are Esg positive (green) in the opa-1 RNAi midgut. In normal midgut, Esg-positive diploid cells are labeled by esg-GAL4; UASGFP (d). f Opa-1 RNAi Flp-out clones induced in the larvae stage have less Pdm-1 expression in the adult midgut. GFP-positive clones are outlined with dashed lines. f, f′, f″, and f‴ are GFP, Pdm1, TOTO3, and Merged channel, respectively. g Opa-1 RNAi clones induced in the adult stage have less Pdm-1 expression in the adult midgut. GFP-positive clones are marked with dashed lines. g, g′, g″, and g‴ are GFP, Pdm1, TOTO3, and Merged channel, respectively. h, i Mis-differentiation of enterocytes in opa1 RNAi clones. Circular muscle is “CM” in short. Actin enriched microvilli and circular muscles are stained with phalloidin in red. h′ and i′ are GFP channel of h and i, respectively. j–l Enterocytes in opa1 RNAi clones are smaller in size. GFP-positive clones are labeled with dashed lines. The cell boundary was stained with Dlg in red. TOTO3 labels nuclei in blue. Scale ts bar is 20 µm. Genotype for f and i: hsFLP; UASGFP; Tub < tub80 > GAL4/opa1 RNAi. Genotype for g: hsFLP; esg-GAL4, UASGFP, TubGAL80; Tub < tub80 > GAL4/opa1 RNAi Genotype for h: hsFLP; UASGFP; Tub < tub80 > GAL4 Genotype for k: hsFLP; UASGFP; Tub < tub80 > GAL4/drp1 RNAi Genotype for l: hsFLP; UASGFP; Tub < tub80 > GAL4/drp1 RNAi, opa1 RNAi genetically and pharmacologically augment of cellular ATP level fail to rescue the mis-differentiation in opa1 RNAi flies (data not shown), we cannot exclude the possibility that optimal cellular level of ATP regulates stem cell differentiation. Takentogether, we describedthatthe neteffect of mitochondrial dynamics in Drosophila intestine stem cell lineage is a progressive fusion process and this process is essential for stem cell differentiation. Considering mito- chondrial maturation is also crucial for iPSCs differentia- tion, our results suggested that boosting mitochondrial fusion could produce more functionally differentiated cells and can be targeted for regenerative medicine. Materials and methods Fly stocks and genetics Flies used in this study were (donors in parentheses) byn-Gal4 (J. Lengyel), hh-Gal4 (K. Basler), esg-GAL4 (N. ts Perrimon) UAS-P35, UAS-Diap (B. Hay), Esg GFP (B. Edgar), 10xStat92E-GFP (E. Bach), UASJafrac1(H. Jasper) Fig. 7 Model on mitochondrial fission-mediated differentiation failure in Drosophila intestine stem cells. Proliferative cells, and the following stocks were obtained from Bloomington ts including Drosophila intestine stem cells in this scenario, bearing stock center: tub-GAL80 , Ser-GAL4, UAS-mito-GFP, hypo-active, smaller and fewer mitochondria with having a relative HsFLP, Aygal4, UASGFP or from the National Institute of lower membrane potential (marked in purple). Hence, self-renewal is Genetics, Japan: Wg-lacZ/CyO. All flies were reared with largely independent on mitochondria function. During differentiation, normal fly food at room temperature or in incubators at mitochondria continuously undergo fusion and biogenesis to cope with the energy demand. Correspondingly, mitochondria became 18 °C, 25 °C, or 29 °C. FLP-OUT clones were induced at more active (marked in bright red). Meanwhile, mitochondria may late second instar or early third instar larvae by heat shock send some retrograde signals, such as ROS, ATP, and/or some 1 h at 37 °C water bath. Clones are marked with GFP. For unknown molecules back to nucleus to program the differentiation hindgut differentiation experiments, early second instar process. On the other hand, loss of fusion by opa-1 RNAi or marf RNAi larvae were shift from 18 °C –22 °C to 29 °C. The hindguts causes mis-differentiation of progenitor cells. The “prospective” differentiated cells are much smaller and still express progenitor were dissected 2 days after hatching out. marker (statGFP) but not differentiated marker (FSH). Loss of fusion can block production Transgene construct UASsmDRP1: To silence DRP1, coding region in the DRP1 was targeted using a microRNA-based technol- In addition to these retrograde signaling processes, ogy . PCR products of an microRNA precursor was mitochondrial fusion might also cause energetic changes cloned into pUAST. All cloned PCR products were con- (ATP level) that affect differentiation. Although firmed by DNA sequencing . Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 11 of 13 Survival assay sequence of FSH is: CACGGGGCTGAAGGTCTACG Around 100 mated female flies for each genotype were GAT and TGCAGCCAAGCCCGTACTGCCAA. counted, which were raised and kept in 29 °C from first CG31607 is now called CG43394 according to the Fly- larvae on. Dead flies were scored each day in 2 weeks. Base and its probe was synthesized from a plasmid Three independent experiments were performed. obtained from DGRC and the plasmid # is RE17733. BrdU incorporation assay Antibody staining Labelling proliferative cells with BrdU was performed by Hindguts and midgut were fixed with 4% for- feeding adult flies or larvae with BrdU. Adult flies of maldehyde/PBT for 45 min at room temperature and 1 week after eclosion or older were reared with normal fly then treated with primary antibody overnight at 4 °C. food containing BrdU (1 mg/ml, Sigma) for 3 or 7 days After treatment with secondary antibody conjugated consecutively. Third instar larvae were fed with the same with fluorescent dye, hindguts and midguts were food containing BrdU for 2–4 h. Hindguts of adults or mounted with Vectashield (Sigma). A nuclear indicator larvae were dissected and fixed immediately after BrdU (TOTO3) was added to the mounting medium if labelling or subsequently reared with normal fly food necessary (1:2000 dilutions). Antibodies used in this without BrdU for another 7–14 days before dissection, study were: mouse anti-Arm (1:10; DSHB, University of and then treated with 2 N HCl for 30 min on ice, before Iowa), mouse anti-β-gal (1:100; Promega), Mouse anti- being processed for antibody staining. CycA, mouse anti-CycB (1:5; DSHB), mouse anti- LaminC (1:50; DSHB), Rabbit Phosho-H3 (1:100; Toluidine blue staining and TEM Molecular Probes), Mouse anti-Delta (1:50; DSHB), and The hindgut was excised under a dissection microscope, rabbit anti-Pdm1 (gift from Xiaohang Yang, Institute of fixed with 2.5% glutaraldehyde in 0.05 M phosphate buffer Molecular and Cell Biology, Singapore). (pH 7.4) for 1.5 h at 4 °C, and washed three times with 0.05 M phosphate buffer at 4 °C, post-fixed with 1.0% OsO for Mitochondria membrane potential measurement 1 h at 4 °C, washed with phosphate buffer, dehydrated in For membrane potential, whole gut was dissected in ethanol, and embedded in Spurr resin. Thick section was Schneider solution at room temperature, then stained in stained with Toluidine blue and ultra-thin sections of the Schneider solution containing 1 μM TMRE (dissolved in embedded guts were double-stained with uranyl acetate and 100% ethanol, from Molecular Probes) for 20 min, washed lead citrate and examined with a JEOL 100C transmission in Schneider 2 × 5 min, and then, directly imaged under a electron microscope (TEM). confocal microscope. For ROS staining, DHE staining was followed as described . In brief, fresh guts were dissected In situ hybridization and incubated in Schneider medium containing 50 μM In situ hybridization of FSH is followed as described . DHE (dissolved in DMSO, from Molecular Probes) for 20 Briefly, dissected hindguts were fixed with 4% for- min, washed in Schneider 2 × 5 min, and then, directly maldehyde and stored in 100% methanol at −20 °C until imaged under a confocal microscope. All these experiments use. The hindguts were rehydrated with a descending were carried out in dark. methanol series and treated with PBS containing 0.1% Tween 20 (PBS-tw). They were then reacted with 10 μg/ ATP measurement mL of proteinase K diluted with PBS-tw; the reaction was The hindgut ATP level was measured using a luciferase- stopped with 2 mg/mL of glycine dissolved in PBS-tw. based bioluminescence assay (ATP Bioluminescence After being fixed with 4% formaldehyde again and washed Assay Kit HS II; Roche Applied Science). For each mea- with PBS-tw, hindguts were hybridized with a surement, ten hindguts were freshly dissected out (with digoxygenin-labeled RNA probe prepared against FSH or midgut removed) and immediately homogenized in 50 µl CG31607 cDNA diluted with hybridization buffer at 60 °C lysis buffer. The lysate was boiled for 5 min and cleared by for overnight. After washing out non-hybridized probes centrifugation at 20,000 g for 1 min. Five microliters of with 50% formamide diluted with 10× SSCT, 2× SSCT, cleared lysate was added to 90 µl dilution buffer and 5 µl and 0.2× SSCT (performed at 60 °C) and then briefly luciferase, and the luminescence was immediately mea- washed with PBS-tw, they were blocked with 0.2% sured using a 96-well plate luminometer. Each reading Blocking reagent (Roche, Indianapolis, IN) diluted with was converted to the amount of ATP per hindgut based PBS-tw and then treated with anti-Digoxygenin antibody on the standard curve generated with ATP standards. The labeled with alkaline-phosphatase (Roche) overnight. readings will then be normalized with the protein level After washing with PBS-tw, the hybridized probe was measured by BCA Bradford assay. Three measurements detected by NBT/BCIP (tablet, Roche). The primer were made for each genotype. Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 12 of 13 Acknowledgements 12. Yang, Y. et al. Pink1 regulates mitochondrial dynamics through interaction We thank Dr. Haixia Huang in Dr. Bruce Hay’s lab for generating UASsmDRP1 with the fission/fusion machinery. Proc. Natl Acad. Sci. USA 105,7070–7075 construct. We also thank Bruce Edgar, Utpal Banerjee, Erika Bach, Norbert (2008). Perrimon, Bruce Hay, Konrad Basler, Henri Jasper, and NIG (Japan), 13. Wang, L. et al. Fatty acid synthesis is critical for stem cell pluripotency via Bloomington (USA) Drosophila Stock Centers for fly stocks; Xiaohang Yang for promoting mitochondrial fission. EMBO J. 36, 1330–1347 (2017). anti-Pdm-1 antibody. This work was supported by National Key R&D 14. Suen, D. F., Norris, K. L. & Youle, R. J. Mitochondrial dynamics and apoptosis. Projects (2018YFA0107100), Youth 1000 Talent Plan of China and Tongji Genes Dev. 22, 1577–1590 (2008). University Basic Scientific Research-Interdisciplinary Fund to H.D., NIH grant R01 15. Chen, H. & Chan, D. C. Mitochondrial dynamics in mammals. Curr.Top.Dev. NS054814 To V.H., and funds of NIH AG033410 and NINDS EUREKA award, the Biol. 59,119–144 (2004). Glenn Family Foundation, Natalie R. and Eugene S. Jones Fund in Aging and 16. Chen, H. et al. Mitochondrial fusion is required for mtDNA stability in skeletal Neurodegenerative Disease Research, Louis B. Mayer Foundation and muscle and tolerance of mtDNA mutations. Cell 141,280–289 (2010). McKnight Neuroscience Foundation to M.G. 17. Micchelli, C. A. & Perrimon, N. Evidence that stem cells reside in the adult Drosophila midgut epithelium. Nature 439,475–479 (2006). 18. Ohlstein, B. & Spradling, A. The adult Drosophila posterior midgut is main- Author details tained by pluripotent stem cells. Nature 439,470–474 (2006). Shanghai East Hospital, School of Life Sciences and Technology, Tongji 19. Fox,D.T.&Spradling, A. C. The Drosophila hindgut lacks constitutively active University, Shanghai 20092, China. Department of Neurology, Department of adult stem cells but proliferates in response to tissue damage. Cell Stem Cell 5, Molecular and Medical Pharmacology, California Nanosystems Institute at 290–297 (2009). UCLA David Geffen School of Medicine, University of California, Los Angeles, 20. Takashima,S., Mkrtchyan, M., Younossi-Hartenstein,A., Merriam,J.R.& Har- CA 90095, USA. Department of Molecular Cell and Developmental Biology, tenstein, V. The behaviour of Drosophila adult hindgut stem cells is controlled University of California Los Angeles, Los Angeles, CA 90095, USA. Present by Wnt and Hh signalling. Nature 454,651–655 (2008). address: Life Science Research Center, Gifu University, Gifu 501-1194, Japan. 21. Takashima, S., Paul, M., Aghajanian, P., Younossi-Hartenstein, A. & Hartenstein, V. Present address: Division of Pulmonary and Critical Care Medicine, David Migration of Drosophila intestinal stem cells across organ boundaries. Devel- Geffen School of Medicine, University of California, Los Angeles, CA 90095, USA opment 140, 1903–1911 (2013). 22. Johansen, K. A.,Green,R.B., Iwaki, D. D.,Hernandez,J.B.& Lengyel, J. A. The Conflict of interest Drm-Bowl-Lin relief-of-repression hierarchy controls fore- and hindgut pat- The authors declare that they have no conflict of interest. terning and morphogenesis. Mech. Dev. 120,1139–1151 (2003). 23. Takashima, S., Yoshimori, H., Yamasaki, N., Matsuno, K. & Murakami, R. Cell-fate choice and boundary formation by combined action of Notch and engrailed Publisher's note in the Drosophila hindgut. Dev. Genes Evol. 212,534–541 (2002). Springer Nature remains neutral with regard to jurisdictional claims in 24. Bach, E. A. et al. GFP reporters detect the activation of the Drosophila JAK/ published maps and institutional affiliations. STAT pathway in vivo. Gene. Expr. Patterns 7,323–331 (2007). 25. Verstreken, P. et al. Synaptic mitochondria are critical for mobilization of The online version of this article (https://doi.org/10.1038/s41420-018-0083-0) reserve pool vesicles at Drosophila neuromuscular junctions. Neuron 47, contains supplementary material, which is available to authorized users. 365–378 (2005). 26. Cerveny, K. L., Tamura, Y., Zhang, Z., Jensen, R. E. & Sesaki, H. Regulation of Received: 16 April 2018 Revised: 21 May 2018 Accepted: 22 June 2018 mitochondrial fusion and division. Trends Cell Biol. 17,563–569 (2007). 27. Aghajanian, P., Takashima, S., Paul, M., Younossi-Hartenstein, A. & Hartenstein, V. Metamorphosis of the Drosophila visceral musculature and its role in intestinal morphogenesis and stem cell formation. Dev. Biol. 420,43–59 (2016). 28. Hay, B. A. & Guo, M. Caspase-dependent cell death in Drosophila. Annu. Rev. Cell Dev. Biol. 22, 623–650 (2006). References 29. Scaduto,R.C.Jr&Grotyohann,L.W.Measurement of mitochondrialmem- 1. Schieke, S. M. et al. Mitochondrial metabolism modulates differentiation and brane potential using fluorescent rhodamine derivatives. Biophys. J. 76, teratoma formation capacity in mouse embryonic stem cells. J. Biol. Chem. 469–477 (1999). 283, 28506–28512 (2008). 30. Dimroth,P., Kaim,G.&Matthey,U.Crucial role of the membranepotential for 2. Varum, S. et al. Enhancement of human embryonic stem cell pluripotency ATP synthesis by F(1)F(o) ATP synthases. J. Exp. Biol. 203,51–59 (2000). through inhibition of the mitochondrial respiratory chain. Stem Cell Res. 3, 31. Paul, M. K. et al. Dynamic changes in intracellular ROS levels regulate airway 142–156 (2009). basal stem cell homeostasis through Nrf2-dependent Notch signaling. Cell 3. Prigione, A., Fauler, B., Lurz, R., Lehrach, H. & Adjaye, J. The senescence-related Stem Cell 15, 199–214 (2014). mitochondrial/oxidative stress pathway is repressed in human induced plur- 32. Hochmuth, C. E.,Biteau, B., Bohmann,D. & Jasper,H.Redox regulation by ipotent stem cells. Stem Cells 28, 721–733 (2010). Keap1 and Nrf2 controls intestinal stem cell proliferation in Drosophila. Cell 4. Rehman, J. Empowering self-renewal and differentiation: the role of mito- Stem Cell 8,188–199 (2011). chondria in stem cells. J. Mol. Med. (Berl.) 88,981–986 (2010). 5. Prieto, J. et al. Dysfunctional mitochondrial fission impairs cell reprogramming. 33. Biteau, B., Hochmuth, C. E. & Jasper, H. JNK activity in somatic stem cells causes Cell Cycle 15, 3240–3250 (2016). loss of tissue homeostasis in the aging Drosophila gut. Cell Stem Cell 3, 6. Xiang, G. et al. BNIP3L-dependent mitophagy accounts for mitochondrial 442–455 (2008). clearance during 3 factors-induced somatic cell reprogramming. Autophagy 34. Voog, J. et al. Escargot restricts niche cell to stem cell conversion in the 13, 1543–1555 (2017). Drosophila testis. Cell Rep. 7, 722–734 (2014). 7. Hom, J. R. et al. The permeability transition pore controls cardiac mitochon- 35. Mathur, D., Bost, A., Driver, I. & Ohlstein, B. A transient niche regulates the drial maturation and myocyte differentiation. Dev. Cell 21, 469–478 (2011). specification of Drosophila intestinal stem cells. Science 327,210–213 (2010). 8. Dai, D. F.,Danoviz,M.E., Wiczer,B., Laflamme,M.A.&Tian,R. Mitochondrial 36. Takashima,S., Younossi-Hartenstein, A.,Ortiz,P.A.& Hartenstein, V. A novel maturation in human pluripotent stem cell derived cardiomyocytes. Stem Cells tissue in an established model system: the Drosophila pupal midgut. Dev. Int. 2017, 5153625 (2017). Genes Evol. 221,69–81 (2011). 9. McQuibban, G. A.,Lee, J. R.,Zheng,L., Juusola, M. & Freeman,M.Normal 37. Jiang, H. et al. Cytokine/Jak/Stat signaling mediates regeneration and home- mitochondrial dynamics requires rhomboid-7 and affects Drosophila lifespan ostasis in the Drosophila midgut. Cell 137, 1343–1355 (2009). and neuronal function. Curr. Biol. 16,982–989 (2006). 38. Affolter, M., Walldorf, U., Kloter, U.,Schier, A. F. &Gehring, W.J.Regional 10. Deng, H., Dodson, M. W., Huang, H. & Guo, M. The Parkinson’sdisease genes repression of a Drosophila POU box gene in the endoderm involves inductive pink1 and parkin promote mitochondrial fission and/or inhibit fusion in interactions between germ layers. Development 117,1199–1210 (1993). 39. Jiang, H., Grenley, M. O., Bravo, M. J., Blumhagen, R. Z. & Edgar, B. A. EGFR/Ras/ Drosophila. Proc. Natl Acad. Sci. USA 105,14503–14508 (2008). MAPK signaling mediates adult midgut epithelial homeostasis and regen- 11. Poole,A.C.etal. ThePINK1/Parkinpathway regulates mitochondrial mor- eration in Drosophila. Cell Stem Cell 8,84–95 (2011). phology. Proc. Natl Acad. Sci. USA 105, 1638–1643 (2008). Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 13 of 13 40. Hernandez-Garcia, D., Wood, C. D., Castro-Obregon, S. & Covarrubias, L. 43. Chen, C. H. et al. A synthetic maternal-effect selfish genetic element drives Reactive oxygen species: a radical role in development? Free Radic. Biol. Med. population replacement in Drosophila. Science 316,597–600 (2007). 49,130–143 (2010). 44. Takashima, S. et al. Development of the Drosophila entero-endocrine lineage 41. Szabadkai, G. et al. Mitochondrial dynamics and Ca2+signaling. Biochim. and its specification by the Notch signaling pathway. Dev. Biol. 353,161–172 Biophys. Acta 1763,442–449 (2006). (2011). 42. Deng, H.,Gerencser,A.A.&Jasper,H.Signalintegration by Ca(2+) regulates intestinal stem-cell activity. Nature 528, 212–217 (2015). Official journal of the Cell Death Differentiation Association http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Cell Death Discovery Springer Journals

Mitochondrial dynamics regulates Drosophila intestinal stem cell differentiation

Download PDF
13 pages

Loading next page...
 
/lp/springer-journals/mitochondrial-dynamics-regulates-drosophila-intestinal-stem-cell-0xogf0tVpm

References (49)

Publisher
Springer Journals
Copyright
Copyright © 2018 by The Author(s)
Subject
Life Sciences; Life Sciences, general; Biochemistry, general; Cell Biology; Stem Cells; Apoptosis; Cell Cycle Analysis
eISSN
2058-7716
DOI
10.1038/s41420-018-0083-0
Publisher site
See Article on Publisher Site

Abstract

Differentiation of stem/progenitor cells is associated with a substantial increase in mitochondrial mass and complexity. Mitochondrial dynamics, including the processes of fusion and fission, plays an important role for somatic cell reprogramming and pluripotency maintenance in induced pluripotent cells (iPSCs). However, the role of mitochondrial dynamics during stem/progenitor cell differentiation in vivo remains elusive. Here we found differentiation of Drosophila intestinal stem cell is accompanied with continuous mitochondrial fusion. Mitochondrial fusion defective(opa1RNAi) ISCs contain less mitochondrial membrane potential, reduced ATP, and increased ROS level. Surprisingly, suppressing fusion also resulted in the failure of progenitor cells to differentiate. Cells did not switch on the expression of differentiation markers, and instead continued to show characteristics of progenitor cells. Meanwhile, proliferation or apoptosis was unaffected. The differentiation defect could be rescued by concomitant inhibition of Drp1, a mitochondrial fission molecule. Moreover, ROS scavenger also partially rescues opa1RNAi- associated differentiation defects via down-regulating JNK activity. We propose that mitochondrial fusion plays a pivotal role in controlling the developmental switch of stem cell fate. Introduction For instance, cardio-myocyte differentiation in the Stem differentiation is accompanied by pronounced embryonic heart is tightly linked to mitochondrial changes in mitochondria. In embryonic stem cells (ESCs) or maturation . Mouse hearts at embryonic day (E) 9.5 contain induced pluripotent stem cells (iPSCs), mitochondria are relatively few and immature mitochondria, characterized by few in number, small and globular in shape, have fewer rare and disorganized cristae. In E13.5 hearts the mito- cristae, and are distributed as perinuclear clusters. During chondrial mass increases substantially, accompanied by differentiation, mitochondria increase dramatically in mass maturation of the organelle as indicated by abundant 1–5 7,8 and form an extensive tubular network , while somatic laminar cristae . Accordingly, one of the major obstacles cell reprogramming is accompanied by depletion of mito- for somatic reprogramming induced cardiomyocytes is to 6 8 chondria through mitophagy (mitochondrial autophagy) . obtain functional mitochondria .How thesemitochondrial changes are regulated remains unexplored in vivo. Mitochondrial morphology is regulated by continuous fusion and fission events. These dynamics processes are Correspondence: Hansong Deng (hdeng@tongji.edu.cn)or Ming Guo (mingfly@ucla.edu) or Volker Hartenstein (volkerh@mcdb.ucla.edu) controlled by a group of GTPase proteins conserved from Shanghai East Hospital, School of Life Sciences and Technology, Tongji yeast to human. Mitofusins and opa1 are involved in outer University, Shanghai 20092, China and inner membrane fusion, respectively. Dynamin- Department of Neurology, Department of Molecular and Medical Pharmacology, California Nanosystems Institute at UCLA David Geffen School related protein 1 (Drp1) is responsible for mitochondrial of Medicine, University of California, Los Angeles, CA 90095, USA fission. Previous results from our lab and others showed Full list of author information is available at the end of the article. These authors contributed equally Hansong Deng, Shigeo Takashima Edited by I. Lavrik © 2018 The Author(s). Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to theCreativeCommons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Official journal of the Cell Death Differentiation Association 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Deng et al. Cell Death Discovery (2019) 5:17 Page 2 of 13 that Drosophila homologs of fusion (MARF/mfn, opa1) layer on the apical membrane facing the gut lumen; apical and fission (drp1) are functionally conserved and are membranes are deeply invaginated, and mitochondria are involved in pathogenesis of neuro-degeneration located in between membrane invaginations (Fig. 1c and c 9–12 diseases . Recent findings indicated that mitochon- ′). Mitochondria are densely packed, elongated apico- drial fission is required for stem cell pluripotency main- basally, and often highly branched (Fig. 1c and c′). The tenance in iPSCs and ESCs . Aside from affecting energy size of mitochondria in these areas varies from 200 to 500 nm in diameter, and often several microns in length. metabolism, mitochondrial fusion and fission has many other effects on developing and mature cells, in particular Differentiated midgut enterocytes do not form cuticle, but in regard to mitochondrial DNA (mtDNA) distribution, a dense array of microvilli was formed at their apical pole. 14–16 ROS production, calcium overload, and apoptosis . Mitochondria take up most of the cytoplasm of these However, the role of mitochondrial dynamics on stem cell cells; as in the hindgut, individual mitochondria are much differentiation in developing context is largely unknown. larger, elongated, and often branched (Fig.S2D). The Drosophila adult gut and its stem cell populations derive from gut progenitors of the larval stage. In the Inhibiting mitochondrial fusion through opa1 or mfn midgut, these cells form small clusters (adult midgut knockdown causes hindgut stem/progenitor cells failed to progenitors or AMPs) scattered over the outer surface of differentiate 17,18 the midgut epithelium ; in the hindgut, adult pro- To manipulate mitochondrial dynamics, we took genitors form a narrow domain, the hindgut proliferation advantage of RNA interference (RNAi) and of over- zone (HPZ) also known as imaginal ring, located near the expression of the responsible genes, using the UAS-GAL4 19,20 anterior hindgut boundary (Fig. 1a). During early system and the temperature-sensitive GAL80 repressor ts metamorphosis, these progenitor populations expand (GAL80 ). Byn-Gal4-directed expression of an opa1- over the larval gut which undergoes programmed cell RNAi construct was able to block mitochondrial fusion death. Subsequently, most progenitors differentiate into in the hindgut. Mitochondria in opa1-RNAi-expressing adult enterocytes, whereas a small subpopulation of pro- hindgut enterocytes are ellipsoid in shape (Fig. 1d–d′ and genitors is held back and gives rise to adult progenitor/ Fig. S1C), a similar phenomenon was observed in marf stem cells (Fig. 1a). These cells are quiescent in nature but RNAi hindguts (Fig. S1B). Aside from the expected defect 19,21 are highly inducible upon tissue damage . We specu- in mitochondrial fusion, opa1-RNAi severely affected lated that mitochondrial dynamics and the functional hindgut development. Byn-Gal4 > opa-1 RNAi animals die changes they engender controls the switch from gut within 2 days after eclosion (Fig. 2a), although the eclo- progenitor to differentiated enterocytes. sion rate is comparable with the sibling controls (data not shown). Similar result was obtained when opa1RNAi was ts Results knocked down from the L1 stage using the GAL80 sys- Mitochondria undergo a dramatic increase in volume and tem, ruling out the possibility of embryogenesis mis- complexity during differentiation of Drosophila intestinal patterning. The hindgut is significantly shorter and cells slightly “fatter” compared with control flies (Fig. 2b, c). Mitochondria of hindgut cells were labeled by the UAS- Stat92E-GFP (stat-GFP in short), a reporter for mito-GFP transgene driven by byn-GAL4, a hindgut- JAK–STAT pathway activity whose expression is restric- 22,23 specific driver (Fig. 1e–i and Fig. S1A). For the mid- ted to the HPZ in wild-type hindguts (Fig. 2d), remains gut, the esg-Gal4 driver was used (Fig. S2A and S2B). In strongly expressed throughout the entire hindgut of opa-1 the HPZ domain, the GFP-labeled mitochondria are few, RNAi animals (Fig. 2e). Enterocytes is surrounded by basal small in volume, and perinuclear in location (Fig. 1e, f and circular muscles in the hindgut. The apical membrane h–h′). AMPs of the larva also possess small, granular inviginations and cuticles of enterocytes can be densely mitochondria (Fig. S2A). Mitochondria of the differ- stained by Toluidine blue (Fig. 2i). However, the prospective entiated hindgut and midgut enterocytes have strongly enterocytes in opa1 RNAi are highly dilated and no apical increased in volume and number (Fig. 1e, g, i–i′ and membrane invaginations or cuticle was formed inside Fig. S2B). Transmission electron microscopy (TEM) was (Fig. 1d, d′ and 2j). The acute lethality of opa1-RNA flies used to resolve mitochondrial morphology and structure after eclosion and cellular structural abnormality in enter- at a higher-level resolution. The adult progenitor/stem ocytes suggested the lack of functionally differentiated cells. cells in the HPZ domain located adjacent to the mal- Indeed, opa-1(RNAi) hindguts lack signs of differentiation. pighian tubes and the mitochondria in these cells are By in situ hybridization, we found that FSH (CG7665), small and round in shape and cristae is rarely observed which is highly expressed in differentiated hindgut enter- (Fig. 1c). Mitochondria of midgut progenitors have similar ocytes of wild-type flies, is reduced or absent in opa-1 dimensions (Fig. S2C). Differentiated adult hindgut (RNAi) flies (Fig. 2n, o). Similar phenomena were found in enterocytes have enlarged in size and form a thick cuticle byn-GAL4>marf RNAi flies (Fig. 2h, m and r).Totest Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 3 of 13 Fig. 1 Extensive mitochondrial fusion during hindgut differentiation and opa-1 RNAi inhibit the fusion process. a Schematic representation of gut development in Drosophila. Progenitors in the larvae stage give rise to the adult gut including its stem cell/progenitor populations. Midgut and hindgut are connected through Malpighian tubes (MT). During early metamorphosis, the progenitor populations expand over the larval gut, which undergoes programmed cell death. For instance, in the midgut, adult midgut progenitors (AMPs, denoted in red dots) in the larvae stage generate adult gut and stem cells (red dots). Similarly, hindgut proliferative zone (HPZ) cells (also called as hindgut imaginal ring, denoted in green) in the larvae stage generates the whole adult hindgut (green), including a subset of progenitors in the anterior hindgut (adult HPZ/Pylorus) and the differentiated hindgut (also called as ileum). Please refer to the main text for details. Mitochondria morphology of hindgut cells in different regions was observed by TEM from b to d and by confocal microscopy from e to i. b Mitochondria in adult HPZ cells. Note that the HPZ cells identity was based on the physical location and their unique morphology. c Mitochondria in adult differentiated cells. The matured enterocytes form a thick layer of cuticle structure (“cu” in brief) toward the lumen. Mitochondria aligned with membrane invigination (“invg” in brief). d Mitochondria in BynGal4>opa1 RNAi adult differentiated cells. For b–d, higher magnification of rectangle area shown on the right in b′–d′. Mitochondrial borders are marked with dashed lines. Cu cuticle, invg invigination, dHg differentiated hindgut, MT Malpighian tubes. e–i Mitochondria morphology visualized by byn-GAL4 > UAS-mito-GFP under confocal microscopy. f (HPZ domain) and g (differentiation hindgut, dHg) are higher magnification of e. h–h′ and i–i′ are cross-sectional view of HPZ and dHg cells, respectively. From e to i, TOTO3 labels nuclei in blue. Scale bars: 200 µm in b–d, 100 µm for e, 20 µm for f–i whether an increase in mitochondrial fusion also causes change in the mito-GFP signal, suggesting irregular and hindgut dysfunction, we knocked down Drp1, an essential enlarged mitochondria (Fig. S1D). However, the viability of 25,26 component of the mitochondrial fission machinery . drp1-RNAi animals is comparable to wild type (Fig. 2a). Expression of drp1-RNAi in the hindgut elicited a definitive Cellular structure such as apical membrane invagination Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 4 of 13 Fig. 2 Enterocytes mis-differentiation induced by inhibiting mitochondrial fusion through opa1 or marf RNAi in the hindgut can be rescued by drp1 RNAi. a Survival curve of adult flies through knock down opa-1 (red), drp1 (green), both opa-1 and drp1 (yellow) or ctrl (blue) specifically in the hindgut by byn-GAL4. Y-axis is the survival percentage. X-axis is days after hatching out, at least 100 mated females counted for each genotype. b, c Short hindgut caused by opa1 RNAi. Hindguts are highlighted between the arrow and arrowhead. Arrow marks the boundary of the midgut and the hindgut and the arrowhead marks the boundary of the hindgut and the rectum. Green signal is Stat-GFP. d–h The Opa1RNAi hindgut shows extensive expansion of a progenitor marker, Stat-GFP (green), cell membrane labeled by myr-RFP (red). The boundary between the midgut and the hindgut are outlined by dashed lines. Nuclei stained by TOTO3 in blue in all images. i–m Cellular structure of hindgut enterocytes stained by Toluidine blue. Circular muscle (“cm” in short) and cuticle (“cu” in short) are pointed in arrows. n–r In situ hybridization of FSH, a gene specifically transcribed in normal differentiated cells, as shown in n, dramatically decreased in opa1 RNAi (o)or marf RNAi (r). FSH signal is largely restored by drp1 RNAi (p). Scale bar for b, c and n–r is 200 µm, 40 µm for d–m and cuticle as well as Stat-GFP expression are not sig- of opa1-RNAi flies can be fully rescued by drp1 knockdown nificantly altered (Fig. 2g, l). Over-expression of the fusion (Fig. 2a and data not shown). Importantly, the hindguts of gene Marf also produced no obvious defect on hindgut thedoubleknockdownswere properlyelongated and marker expression or cellular structure, although the expressed nearly normal pattern of Stat-GFP (Fig. 2f, k). mitochondria are more elongated than in control flies (data Furthermore, enterocyte differentiation failure in the not shown). These results suggested that loss of fission or opa1RNAi hindgut can be restored by drp1RNAi: the over-activation of fusion is dispensable for hindgut function. hindgut of the double knockdowns expressed nearly normal Next, we wanted to test if defects caused by opa-1 RNAi level of FSH (Fig. 2p, q). Similar results were obtained by and marf RNAi can be rescued by reduced fission (drp1 simultaneously knocking down Marf and drp1 (data not RNAi) or over-fusion (marf OE). Indeed, the acute lethality shown). Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 5 of 13 Fig. 3 Stem/progenitor cell proliferation is largely unaffected by opa1RNAi. a–c Replication rate was measured by BrdU feeding in stage- matched third larvae. Representative images are shown as a (ctrl) and b (opa1 RNAi). The HPZ zone is outlined with a white bracket. Quantification shown in c. No statistical significance was found, n = 5. d–h Proliferation rate was indicated by pH3-positive nuclei in larvae hindgut in 24 h APF (d, e) and 30 h APF (f, g). d and f are the Controls; e and g are opa-1 RNAi larvae. Quantification shown in h. No statistical significance was found, n = 6. Error bars represent standard deviation (STDEV) in c and h. Arrows pointed to the boundary of the midgut and the hindgut, and TOTO3 stained nuclei in blue. Scale bar for 100 µm Stem/progenitor cell proliferation is largely unaffected by same number of mitotic cells as controls (Fig. 3d, e and h). opa1RNAi Likewise, at 30 h apf, opa1-RNAi guts were devoid of As described above, the progenitor cell maker, Stat- mitotic cells, similar to controls (Fig. 3f–h). Wg acts as an GFP, expanded in the whole hindgut in opa-1(RNAi) and essential signal to stimulate proliferation of the HPZ and marf (RNAi) flies. We hypothesized that loss of mito- at the same time inhibits differentiation . Over- chondrial fusion may trigger stem cell over-proliferation expression of Wg in the HPZ results in a hindgut phe- and form a stem cell like tumor. As a result, stem cells notype that, in regard to lack of enterocyte differentiation, could fail to differentiate properly. To test this hypothesis, resembles the opa1-RNAi phenotype. To investigate we analyzed proliferation by applying BrdU, which is whether knock down of opa1 affects wg expression, we specifically incorporated in DNA of S phase cells. Adult used a Wg-lacZ reporter construct in the background of opa-1(RNAi) flies were fed BrdU-containing food for 24 h. byn-Gal4-driven opa1-RNAi. No significant change in the After staining, we did not find a significant difference in pattern of Wg-lacZ expression is evident (Fig. S3A and the number of BrdU-containing cells between control and S3B). Furthermore, CG31607, which normally transcribed opa-1(RNAi) flies (data not shown). Proliferation was also only in HPZ cells, has no or slight expansion in opa-1 tested during the larval stage. Mid-third instar larvae were (RNAi) flies (Fig. S3C and S3D). Taken together, these raised on BrdU-containing food for 24 h. We found an results suggest that the block of mitochondrial fusion by average of 55 BrdU-positive cells in control larvae, and 50 opa1-RNAi did not affect proliferation in the developing in opa1-RNAi larvae; the difference is not significant (n = intestine. 6; Fig. 3a–c). Proliferation of the adult hindgut progeni- tors normally ceases around 24 h after puparium forma- The hindgut defects in opa-1(RNAi) flies are not caused by tion (apf) . To rule out that the phase of proliferation is apoptosis of differentiated enterocytes extended in opa1-RNAi, we monitored pupae 24 h apf and Mitochondrial dynamics is closely related to apopto- 30 h apf, using an antibody against phosphorylated his- sis , and we wondered whether the opa1 and marf tone 3 (pH3). At 24 h, opa1-RNAi hindguts showed the knockdown phenotype is due to excessive cell death of Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 6 of 13 enterocytes. Our findings speak against this hypothesis. higher in differentiated cells in control hindguts (Figs. 5a No obvious increase of apoptotic cells was found in the and a′). However, in opa1-RNAi hindguts, all hindgut opa-1 RNAi hindgut by TUNEL staining (terminal cells have a relatively higher ROS level (Note: ‘black holes’ deoxynucleotidyl transferase dUTP nick end labeling) likely due to non-apoptotic cell death in opa1RNAi (Fig. S4A and S4B). As a control, we found excessive hindguts, shown as asterisk in Fig. 5b and b′). It implies TUNEL-positive cells when an rpr; hid over-expression that elevated ROS production may cause differentiation defects in opa1RNAi hindguts. As expected, over- construct was induced in the hindgut (Fig. S4C). Fur- thermore, over-expression of p35 and Diap, two caspase expressing Jafrac1, a thioredoxin peroxidase 1, led to a inhibitors , failed to rescue the opa-1(RNAi) defects in significantly reduction of ROS level and suppressed non- terms of lethality or ectopic stat-GFP in the hindgut apoptotic cell death phenotype in opa1RNAi hindguts (Figures S4D–F and data not shown). These data suggest (Fig.5c and c′). that the absence of differentiated cells in opa-1(RNAi) JNK mediated multiple downstream effects of ROS 31,33 flies is due to a failure of differentiation, rather than signaling . Puc-LacZ was used as a reporter for JNK apoptosis of differentiated cells. activity . We found that opa1RNAi hindguts have much higher Puc-LacZ staining than controls and can be fully Mitochondrial defects induced by inhibiting mitochondrial suppressed by overexpressing a dominant-negative form DN DN fusion in hindgut of JNK, UASBsk (Fig. 5d, f). Moreover, UASBsk can The functional output of mitochondria can be mon- partially suppress opa1RNAi-associated differentiation itored by the mitochondrial membrane potential, which defects, such as StatGFP expansion and gut length (Fig. reflects the proton gradient generated by oxidative 5g–i). phosphorylation across the inner membrane. Tetra- All these results indicated that the ROS–JNK pathway methylrhodamine ethyl ester (TMRE) is a commonly used participated in opa1RNAi hindgut defects. dye to monitor mitochondria membrane potential in live cells . We found that the increase in mitochondrial Inhibit mitochondrial fission also inhibit midgut enterocyte number and volume during enterocyte differentiation is differentiation accompanied by an increase in mitochondrial membrane Next, we examined the requirement of fusion for adult potential. Hindgut enterocyte progenitors exhibit low midgut differentiation. Larvae expressing opa1 RNAi TMRE signal, compared with the differentiated adult cells under the esg-GAL4 driver from the early (L1) stage (Fig. 4a/a′/a″ and Fig. S5A–C). Knocking-down opa1 onward fail to reach the pupal stage and arrest at the third caused a reduced functional output of mitochondria. The instar or pre-pupal stage (data not shown), probably membrane potential dropped to a level that, quantita- because of the multiple-tissue expression of esg-GAL4 tively, corresponded to that of enterocyte progenitors which may cause pleiotropic defects in development . (compare panels Fig. 4a′/a″ and b′/b″). Significant Differentiation defects was observed in the midgut pro- decrease of membrane potential was also found in opa1 genitors of these animals as well. In wild type, midgut RNAi clones (Fig. 4c/c′/c″). Mitochondrial ATP produc- progenitors split into two cell types. The center of each tion is coupled with membrane potential . As expected, progenitor cluster is occupied by small, rounded midgut opa1 RNAi hindguts have significantly lower ATP level progenitors which will form the adult midgut. These cells than controls. Although drp1 knocking down also are surrounded by large, flattened peripheral cells which decrease ATP production slightly, drp1 RNAi significantly during early metamorphosis differentiate into a transient 35,36 restores ATP level production of opa1 RNAi hindguts pupal midgut (Fig. S6A and B). Following opa1-RNAi (Fig. 4d). expression in midgut progenitors, peripheral cells did not differentiate (Fig. S6C). However, drp1 knocking down Excessive ROS induced JNK activity contributes to mis- fully suppressed the differentiation defects (Fig. S6D and differentiation in opa1RNAi hindgut E). To overcome the early lethality, we expressed opa1 We and others previously showed that ROS function as RNAi from the late third instar stage. Under these con- a signal molecule controls stem cell proliferation in ditions, larvae can pupate and eclose. Examination of Drosophila ISCs and mammalian airway basal stem cells midguts of freshly eclosed adults revealed a phenotype 31,32 (ABSCs) . Since most of ROS are produced by mito- that resembled in many aspects of the above described chondria and are closely regulated by mitochondrial fis- hindgut phenotype. A large proportion of midgut cells sion . We sought to test whether ROS is involved in shows signs of immaturity, in terms of small size, con- hindgut defects of opa1RNAi flies. tinued expression of esg, and Stat-GFP, another ISC/EB 35,37 Dihydroethidium (DHE) was used as a specific dye to marker (Fig. 6a–e). Moreover, the expression of Delta measure the ROS level in freshly dissected guts. DHE also showed massive expansion along with Esg in opa1 fluorescence is relatively lower in the HPZ zone, while RNAi flies (Fig. S7A, B). On the other hand, Pdm-1, a Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 7 of 13 Fig. 4 Mitochondrial defects induced by inhibiting mitochondrial fusion through opa1RNAi in hindgut. a, b TMRE staining in freshly dissected adult hindgut. Note wild-type enterocytes (“En” in short) have much higher fluorescent staining than cells in the HPZ domain. a′ and b′ are separate TMRE channels. a‴ and b‴ are higher magnified image of rectangle area in a′ and b′, respectively. The arrows point to the boundary of midgut and hindgut. The arrowheads denote the boundary of the hindgut and the rectum. c Opa1 RNAi clones in the adult hindgut have much lower membrane potential by TMRE staining. Clones are marked by dashed lines. c′ and c″ are separate GFP and TMRE channel, respectively. Genotype: hsFLP; UASGFP; Tub < tub80 > GAL4/opa1 RNAi. d Quantification of a relative ATP level of isolated hindguts with different genotypes: Ctrl, opa1 RNAi, and opa1 RNAi; drp1 RNAi. Error bars represent standard deviation (STDEV). Scale bar is 20 µm 38,39 differentiation marker for enterocyte , was normally the apical gut lumen and form actin enriched microvilli, expressed in most of these cells (data not shown). We which was stained by phalloidin. In control GFP-positive speculated that the relatively late onset of opa1 RNAi clones, enterocytes are adjacent to the phalloidin-stained expression (see above) may in part be responsible for the structure (Fig. 6h); however, the enterocytes retained in weak differentiation phenotype, compared to the hindgut. the basal side in opa1 RNAi clones (Fig. 6i). Finally, the We therefore examined the effect of opa1 knock-down cell size in the opa1RNAi clones is much smaller com- FLP-out clones. First instar larvae, with the genotype of pared with the adjacent non-labeled differentiated cells hsFLP; tub > GAL80 > GAL4, UAS-GFP/UAS-opa1RNAi, (Fig. 6j), indicating the immature differentiation. Again, were heat-shocked at 37 °C for 1 h to induce opa1 RNAi- this defect can be rescued by drp1 knock-down (Fig. 6k, l). expressing clones and the phenotype was examined at the adult stage. Clones of cells knocked-down for opa1 had no Discussion or decreased level of the differentiation marker Pdm-1, Our results here indicated that mitochondrial fusion, compared with clones without opa-1 RNAi (Fig. 6f–f‴). followed by increased functional output, forms part of the Meanwhile, clones bearing multiple copies of opa1RNAi causal chain that switches the cells state from stem/pro- induced in adult by another lineage tracing stock genitor cell towards differentiation. Thus, preventing fusion ts (esg GFP; UAS-FLP, tub < CD2 > GAL4) also showed by knock-down of opa-1 or marf can block enterocyte dif- smaller and significantly weaker expression of Pdm1 ferentiation in intestinal stem/progenitor cells. On the other (Fig. 6g–g‴). Matured enterocytes often migrated toward hand, blocking fission by over-expression of marf or knock Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 8 of 13 Fig. 5 ROS–JNK pathway contribute to differentiation defects in opa1RNAi hindguts. a–c DHE staining of freshly dissected hindgut. a′–c′ are DHE channel. Asterisk denotes potentially non-apoptotic cell death in opa1RNAi hindguts. d–f Anti-beta Gal staining against Puc-LacZ in different genotypes. g–i Differentiation index, such as Stat::GFP and gut length, was compared in different conditions. Gut length was delineated out by white lines. Scale bar is 20 µm down drp1 did not cause obvious defects in differentiation. low to moderate ROS levels is required for stem cell self- Moreover, blocking fissionbyknockingdownofdrp-1 renewal and proliferation . Similarly, Drosophila midgut rescued the defects of opa-1 RNAi. We then demonstrated stem cells have relatively lower ROS level compared with that mitochondria in the opa1 RNAi hindgut have lower differentiated enterocytes and increasing ROS level pro- membrane potential, less ATP production, and higher ROS. motes proliferation rate . Here, we showed that ROS- We then showed that a high ROS level contribute to mis- mediated JNK pathway contributed to opa1RNAi hindgut differentiation in opa1RNAi hindgut by increasing JNK mis-differentiation, indicating intrinsic difference of stem activity. These findings indicate that mitochondrial fusion is cells in response to ROS signaling. Besides ROS, mito- critical for enterocyte differentiation (Fig. 7). chondrial fusion could also trigger retrograde signaling ROS, in conjunction with the JNK pathway, affects stem pathways such as calcium , which we recently described cell activity, cell fate transition and cell survival . Our to capable to alter stem cell activity in Drosophila midgut previous results showed that in mouse and human ABSCs, ISCs Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 9 of 13 Fig. 6 (See legend on next page.) Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 10 of 13 (see figure on previous page) Fig. 6 Inhibiting mitochondrial fission also impairs midgut enterocyte differentiation. a Schematic view of cell types in the adult posterior midgut. Basal located progenitor cells (green) are Esg and Stat-GFP positive. Enlarged enterocytes can be labeled by differentiation marker Pdm1. CM is the brief for circular muscle. Both circular muscle and actin enriched microvilli in enterocytes can be stained by Phalloidin. b, c Ectopic Stat-GFP- positive cells (green) in the opa-1 RNAi midgut. The progenitor cells in the normal midgut are labeled with membrane-bound UAS-myr-RFP driven by Esg-GAL4. d, e Massive enterocyte-like cells are Esg positive (green) in the opa-1 RNAi midgut. In normal midgut, Esg-positive diploid cells are labeled by esg-GAL4; UASGFP (d). f Opa-1 RNAi Flp-out clones induced in the larvae stage have less Pdm-1 expression in the adult midgut. GFP-positive clones are outlined with dashed lines. f, f′, f″, and f‴ are GFP, Pdm1, TOTO3, and Merged channel, respectively. g Opa-1 RNAi clones induced in the adult stage have less Pdm-1 expression in the adult midgut. GFP-positive clones are marked with dashed lines. g, g′, g″, and g‴ are GFP, Pdm1, TOTO3, and Merged channel, respectively. h, i Mis-differentiation of enterocytes in opa1 RNAi clones. Circular muscle is “CM” in short. Actin enriched microvilli and circular muscles are stained with phalloidin in red. h′ and i′ are GFP channel of h and i, respectively. j–l Enterocytes in opa1 RNAi clones are smaller in size. GFP-positive clones are labeled with dashed lines. The cell boundary was stained with Dlg in red. TOTO3 labels nuclei in blue. Scale ts bar is 20 µm. Genotype for f and i: hsFLP; UASGFP; Tub < tub80 > GAL4/opa1 RNAi. Genotype for g: hsFLP; esg-GAL4, UASGFP, TubGAL80; Tub < tub80 > GAL4/opa1 RNAi Genotype for h: hsFLP; UASGFP; Tub < tub80 > GAL4 Genotype for k: hsFLP; UASGFP; Tub < tub80 > GAL4/drp1 RNAi Genotype for l: hsFLP; UASGFP; Tub < tub80 > GAL4/drp1 RNAi, opa1 RNAi genetically and pharmacologically augment of cellular ATP level fail to rescue the mis-differentiation in opa1 RNAi flies (data not shown), we cannot exclude the possibility that optimal cellular level of ATP regulates stem cell differentiation. Takentogether, we describedthatthe neteffect of mitochondrial dynamics in Drosophila intestine stem cell lineage is a progressive fusion process and this process is essential for stem cell differentiation. Considering mito- chondrial maturation is also crucial for iPSCs differentia- tion, our results suggested that boosting mitochondrial fusion could produce more functionally differentiated cells and can be targeted for regenerative medicine. Materials and methods Fly stocks and genetics Flies used in this study were (donors in parentheses) byn-Gal4 (J. Lengyel), hh-Gal4 (K. Basler), esg-GAL4 (N. ts Perrimon) UAS-P35, UAS-Diap (B. Hay), Esg GFP (B. Edgar), 10xStat92E-GFP (E. Bach), UASJafrac1(H. Jasper) Fig. 7 Model on mitochondrial fission-mediated differentiation failure in Drosophila intestine stem cells. Proliferative cells, and the following stocks were obtained from Bloomington ts including Drosophila intestine stem cells in this scenario, bearing stock center: tub-GAL80 , Ser-GAL4, UAS-mito-GFP, hypo-active, smaller and fewer mitochondria with having a relative HsFLP, Aygal4, UASGFP or from the National Institute of lower membrane potential (marked in purple). Hence, self-renewal is Genetics, Japan: Wg-lacZ/CyO. All flies were reared with largely independent on mitochondria function. During differentiation, normal fly food at room temperature or in incubators at mitochondria continuously undergo fusion and biogenesis to cope with the energy demand. Correspondingly, mitochondria became 18 °C, 25 °C, or 29 °C. FLP-OUT clones were induced at more active (marked in bright red). Meanwhile, mitochondria may late second instar or early third instar larvae by heat shock send some retrograde signals, such as ROS, ATP, and/or some 1 h at 37 °C water bath. Clones are marked with GFP. For unknown molecules back to nucleus to program the differentiation hindgut differentiation experiments, early second instar process. On the other hand, loss of fusion by opa-1 RNAi or marf RNAi larvae were shift from 18 °C –22 °C to 29 °C. The hindguts causes mis-differentiation of progenitor cells. The “prospective” differentiated cells are much smaller and still express progenitor were dissected 2 days after hatching out. marker (statGFP) but not differentiated marker (FSH). Loss of fusion can block production Transgene construct UASsmDRP1: To silence DRP1, coding region in the DRP1 was targeted using a microRNA-based technol- In addition to these retrograde signaling processes, ogy . PCR products of an microRNA precursor was mitochondrial fusion might also cause energetic changes cloned into pUAST. All cloned PCR products were con- (ATP level) that affect differentiation. Although firmed by DNA sequencing . Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 11 of 13 Survival assay sequence of FSH is: CACGGGGCTGAAGGTCTACG Around 100 mated female flies for each genotype were GAT and TGCAGCCAAGCCCGTACTGCCAA. counted, which were raised and kept in 29 °C from first CG31607 is now called CG43394 according to the Fly- larvae on. Dead flies were scored each day in 2 weeks. Base and its probe was synthesized from a plasmid Three independent experiments were performed. obtained from DGRC and the plasmid # is RE17733. BrdU incorporation assay Antibody staining Labelling proliferative cells with BrdU was performed by Hindguts and midgut were fixed with 4% for- feeding adult flies or larvae with BrdU. Adult flies of maldehyde/PBT for 45 min at room temperature and 1 week after eclosion or older were reared with normal fly then treated with primary antibody overnight at 4 °C. food containing BrdU (1 mg/ml, Sigma) for 3 or 7 days After treatment with secondary antibody conjugated consecutively. Third instar larvae were fed with the same with fluorescent dye, hindguts and midguts were food containing BrdU for 2–4 h. Hindguts of adults or mounted with Vectashield (Sigma). A nuclear indicator larvae were dissected and fixed immediately after BrdU (TOTO3) was added to the mounting medium if labelling or subsequently reared with normal fly food necessary (1:2000 dilutions). Antibodies used in this without BrdU for another 7–14 days before dissection, study were: mouse anti-Arm (1:10; DSHB, University of and then treated with 2 N HCl for 30 min on ice, before Iowa), mouse anti-β-gal (1:100; Promega), Mouse anti- being processed for antibody staining. CycA, mouse anti-CycB (1:5; DSHB), mouse anti- LaminC (1:50; DSHB), Rabbit Phosho-H3 (1:100; Toluidine blue staining and TEM Molecular Probes), Mouse anti-Delta (1:50; DSHB), and The hindgut was excised under a dissection microscope, rabbit anti-Pdm1 (gift from Xiaohang Yang, Institute of fixed with 2.5% glutaraldehyde in 0.05 M phosphate buffer Molecular and Cell Biology, Singapore). (pH 7.4) for 1.5 h at 4 °C, and washed three times with 0.05 M phosphate buffer at 4 °C, post-fixed with 1.0% OsO for Mitochondria membrane potential measurement 1 h at 4 °C, washed with phosphate buffer, dehydrated in For membrane potential, whole gut was dissected in ethanol, and embedded in Spurr resin. Thick section was Schneider solution at room temperature, then stained in stained with Toluidine blue and ultra-thin sections of the Schneider solution containing 1 μM TMRE (dissolved in embedded guts were double-stained with uranyl acetate and 100% ethanol, from Molecular Probes) for 20 min, washed lead citrate and examined with a JEOL 100C transmission in Schneider 2 × 5 min, and then, directly imaged under a electron microscope (TEM). confocal microscope. For ROS staining, DHE staining was followed as described . In brief, fresh guts were dissected In situ hybridization and incubated in Schneider medium containing 50 μM In situ hybridization of FSH is followed as described . DHE (dissolved in DMSO, from Molecular Probes) for 20 Briefly, dissected hindguts were fixed with 4% for- min, washed in Schneider 2 × 5 min, and then, directly maldehyde and stored in 100% methanol at −20 °C until imaged under a confocal microscope. All these experiments use. The hindguts were rehydrated with a descending were carried out in dark. methanol series and treated with PBS containing 0.1% Tween 20 (PBS-tw). They were then reacted with 10 μg/ ATP measurement mL of proteinase K diluted with PBS-tw; the reaction was The hindgut ATP level was measured using a luciferase- stopped with 2 mg/mL of glycine dissolved in PBS-tw. based bioluminescence assay (ATP Bioluminescence After being fixed with 4% formaldehyde again and washed Assay Kit HS II; Roche Applied Science). For each mea- with PBS-tw, hindguts were hybridized with a surement, ten hindguts were freshly dissected out (with digoxygenin-labeled RNA probe prepared against FSH or midgut removed) and immediately homogenized in 50 µl CG31607 cDNA diluted with hybridization buffer at 60 °C lysis buffer. The lysate was boiled for 5 min and cleared by for overnight. After washing out non-hybridized probes centrifugation at 20,000 g for 1 min. Five microliters of with 50% formamide diluted with 10× SSCT, 2× SSCT, cleared lysate was added to 90 µl dilution buffer and 5 µl and 0.2× SSCT (performed at 60 °C) and then briefly luciferase, and the luminescence was immediately mea- washed with PBS-tw, they were blocked with 0.2% sured using a 96-well plate luminometer. Each reading Blocking reagent (Roche, Indianapolis, IN) diluted with was converted to the amount of ATP per hindgut based PBS-tw and then treated with anti-Digoxygenin antibody on the standard curve generated with ATP standards. The labeled with alkaline-phosphatase (Roche) overnight. readings will then be normalized with the protein level After washing with PBS-tw, the hybridized probe was measured by BCA Bradford assay. Three measurements detected by NBT/BCIP (tablet, Roche). The primer were made for each genotype. Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 12 of 13 Acknowledgements 12. Yang, Y. et al. Pink1 regulates mitochondrial dynamics through interaction We thank Dr. Haixia Huang in Dr. Bruce Hay’s lab for generating UASsmDRP1 with the fission/fusion machinery. Proc. Natl Acad. Sci. USA 105,7070–7075 construct. We also thank Bruce Edgar, Utpal Banerjee, Erika Bach, Norbert (2008). Perrimon, Bruce Hay, Konrad Basler, Henri Jasper, and NIG (Japan), 13. Wang, L. et al. Fatty acid synthesis is critical for stem cell pluripotency via Bloomington (USA) Drosophila Stock Centers for fly stocks; Xiaohang Yang for promoting mitochondrial fission. EMBO J. 36, 1330–1347 (2017). anti-Pdm-1 antibody. This work was supported by National Key R&D 14. Suen, D. F., Norris, K. L. & Youle, R. J. Mitochondrial dynamics and apoptosis. Projects (2018YFA0107100), Youth 1000 Talent Plan of China and Tongji Genes Dev. 22, 1577–1590 (2008). University Basic Scientific Research-Interdisciplinary Fund to H.D., NIH grant R01 15. Chen, H. & Chan, D. C. Mitochondrial dynamics in mammals. Curr.Top.Dev. NS054814 To V.H., and funds of NIH AG033410 and NINDS EUREKA award, the Biol. 59,119–144 (2004). Glenn Family Foundation, Natalie R. and Eugene S. Jones Fund in Aging and 16. Chen, H. et al. Mitochondrial fusion is required for mtDNA stability in skeletal Neurodegenerative Disease Research, Louis B. Mayer Foundation and muscle and tolerance of mtDNA mutations. Cell 141,280–289 (2010). McKnight Neuroscience Foundation to M.G. 17. Micchelli, C. A. & Perrimon, N. Evidence that stem cells reside in the adult Drosophila midgut epithelium. Nature 439,475–479 (2006). 18. Ohlstein, B. & Spradling, A. The adult Drosophila posterior midgut is main- Author details tained by pluripotent stem cells. Nature 439,470–474 (2006). Shanghai East Hospital, School of Life Sciences and Technology, Tongji 19. Fox,D.T.&Spradling, A. C. The Drosophila hindgut lacks constitutively active University, Shanghai 20092, China. Department of Neurology, Department of adult stem cells but proliferates in response to tissue damage. Cell Stem Cell 5, Molecular and Medical Pharmacology, California Nanosystems Institute at 290–297 (2009). UCLA David Geffen School of Medicine, University of California, Los Angeles, 20. Takashima,S., Mkrtchyan, M., Younossi-Hartenstein,A., Merriam,J.R.& Har- CA 90095, USA. Department of Molecular Cell and Developmental Biology, tenstein, V. The behaviour of Drosophila adult hindgut stem cells is controlled University of California Los Angeles, Los Angeles, CA 90095, USA. Present by Wnt and Hh signalling. Nature 454,651–655 (2008). address: Life Science Research Center, Gifu University, Gifu 501-1194, Japan. 21. Takashima, S., Paul, M., Aghajanian, P., Younossi-Hartenstein, A. & Hartenstein, V. Present address: Division of Pulmonary and Critical Care Medicine, David Migration of Drosophila intestinal stem cells across organ boundaries. Devel- Geffen School of Medicine, University of California, Los Angeles, CA 90095, USA opment 140, 1903–1911 (2013). 22. Johansen, K. A.,Green,R.B., Iwaki, D. D.,Hernandez,J.B.& Lengyel, J. A. The Conflict of interest Drm-Bowl-Lin relief-of-repression hierarchy controls fore- and hindgut pat- The authors declare that they have no conflict of interest. terning and morphogenesis. Mech. Dev. 120,1139–1151 (2003). 23. Takashima, S., Yoshimori, H., Yamasaki, N., Matsuno, K. & Murakami, R. Cell-fate choice and boundary formation by combined action of Notch and engrailed Publisher's note in the Drosophila hindgut. Dev. Genes Evol. 212,534–541 (2002). Springer Nature remains neutral with regard to jurisdictional claims in 24. Bach, E. A. et al. GFP reporters detect the activation of the Drosophila JAK/ published maps and institutional affiliations. STAT pathway in vivo. Gene. Expr. Patterns 7,323–331 (2007). 25. Verstreken, P. et al. Synaptic mitochondria are critical for mobilization of The online version of this article (https://doi.org/10.1038/s41420-018-0083-0) reserve pool vesicles at Drosophila neuromuscular junctions. Neuron 47, contains supplementary material, which is available to authorized users. 365–378 (2005). 26. Cerveny, K. L., Tamura, Y., Zhang, Z., Jensen, R. E. & Sesaki, H. Regulation of Received: 16 April 2018 Revised: 21 May 2018 Accepted: 22 June 2018 mitochondrial fusion and division. Trends Cell Biol. 17,563–569 (2007). 27. Aghajanian, P., Takashima, S., Paul, M., Younossi-Hartenstein, A. & Hartenstein, V. Metamorphosis of the Drosophila visceral musculature and its role in intestinal morphogenesis and stem cell formation. Dev. Biol. 420,43–59 (2016). 28. Hay, B. A. & Guo, M. Caspase-dependent cell death in Drosophila. Annu. Rev. Cell Dev. Biol. 22, 623–650 (2006). References 29. Scaduto,R.C.Jr&Grotyohann,L.W.Measurement of mitochondrialmem- 1. Schieke, S. M. et al. Mitochondrial metabolism modulates differentiation and brane potential using fluorescent rhodamine derivatives. Biophys. J. 76, teratoma formation capacity in mouse embryonic stem cells. J. Biol. Chem. 469–477 (1999). 283, 28506–28512 (2008). 30. Dimroth,P., Kaim,G.&Matthey,U.Crucial role of the membranepotential for 2. Varum, S. et al. Enhancement of human embryonic stem cell pluripotency ATP synthesis by F(1)F(o) ATP synthases. J. Exp. Biol. 203,51–59 (2000). through inhibition of the mitochondrial respiratory chain. Stem Cell Res. 3, 31. Paul, M. K. et al. Dynamic changes in intracellular ROS levels regulate airway 142–156 (2009). basal stem cell homeostasis through Nrf2-dependent Notch signaling. Cell 3. Prigione, A., Fauler, B., Lurz, R., Lehrach, H. & Adjaye, J. The senescence-related Stem Cell 15, 199–214 (2014). mitochondrial/oxidative stress pathway is repressed in human induced plur- 32. Hochmuth, C. E.,Biteau, B., Bohmann,D. & Jasper,H.Redox regulation by ipotent stem cells. Stem Cells 28, 721–733 (2010). Keap1 and Nrf2 controls intestinal stem cell proliferation in Drosophila. Cell 4. Rehman, J. Empowering self-renewal and differentiation: the role of mito- Stem Cell 8,188–199 (2011). chondria in stem cells. J. Mol. Med. (Berl.) 88,981–986 (2010). 5. Prieto, J. et al. Dysfunctional mitochondrial fission impairs cell reprogramming. 33. Biteau, B., Hochmuth, C. E. & Jasper, H. JNK activity in somatic stem cells causes Cell Cycle 15, 3240–3250 (2016). loss of tissue homeostasis in the aging Drosophila gut. Cell Stem Cell 3, 6. Xiang, G. et al. BNIP3L-dependent mitophagy accounts for mitochondrial 442–455 (2008). clearance during 3 factors-induced somatic cell reprogramming. Autophagy 34. Voog, J. et al. Escargot restricts niche cell to stem cell conversion in the 13, 1543–1555 (2017). Drosophila testis. Cell Rep. 7, 722–734 (2014). 7. Hom, J. R. et al. The permeability transition pore controls cardiac mitochon- 35. Mathur, D., Bost, A., Driver, I. & Ohlstein, B. A transient niche regulates the drial maturation and myocyte differentiation. Dev. Cell 21, 469–478 (2011). specification of Drosophila intestinal stem cells. Science 327,210–213 (2010). 8. Dai, D. F.,Danoviz,M.E., Wiczer,B., Laflamme,M.A.&Tian,R. Mitochondrial 36. Takashima,S., Younossi-Hartenstein, A.,Ortiz,P.A.& Hartenstein, V. A novel maturation in human pluripotent stem cell derived cardiomyocytes. Stem Cells tissue in an established model system: the Drosophila pupal midgut. Dev. Int. 2017, 5153625 (2017). Genes Evol. 221,69–81 (2011). 9. McQuibban, G. A.,Lee, J. R.,Zheng,L., Juusola, M. & Freeman,M.Normal 37. Jiang, H. et al. Cytokine/Jak/Stat signaling mediates regeneration and home- mitochondrial dynamics requires rhomboid-7 and affects Drosophila lifespan ostasis in the Drosophila midgut. Cell 137, 1343–1355 (2009). and neuronal function. Curr. Biol. 16,982–989 (2006). 38. Affolter, M., Walldorf, U., Kloter, U.,Schier, A. F. &Gehring, W.J.Regional 10. Deng, H., Dodson, M. W., Huang, H. & Guo, M. The Parkinson’sdisease genes repression of a Drosophila POU box gene in the endoderm involves inductive pink1 and parkin promote mitochondrial fission and/or inhibit fusion in interactions between germ layers. Development 117,1199–1210 (1993). 39. Jiang, H., Grenley, M. O., Bravo, M. J., Blumhagen, R. Z. & Edgar, B. A. EGFR/Ras/ Drosophila. Proc. Natl Acad. Sci. USA 105,14503–14508 (2008). MAPK signaling mediates adult midgut epithelial homeostasis and regen- 11. Poole,A.C.etal. ThePINK1/Parkinpathway regulates mitochondrial mor- eration in Drosophila. Cell Stem Cell 8,84–95 (2011). phology. Proc. Natl Acad. Sci. USA 105, 1638–1643 (2008). Official journal of the Cell Death Differentiation Association Deng et al. Cell Death Discovery (2019) 5:17 Page 13 of 13 40. Hernandez-Garcia, D., Wood, C. D., Castro-Obregon, S. & Covarrubias, L. 43. Chen, C. H. et al. A synthetic maternal-effect selfish genetic element drives Reactive oxygen species: a radical role in development? Free Radic. Biol. Med. population replacement in Drosophila. Science 316,597–600 (2007). 49,130–143 (2010). 44. Takashima, S. et al. Development of the Drosophila entero-endocrine lineage 41. Szabadkai, G. et al. Mitochondrial dynamics and Ca2+signaling. Biochim. and its specification by the Notch signaling pathway. Dev. Biol. 353,161–172 Biophys. Acta 1763,442–449 (2006). (2011). 42. Deng, H.,Gerencser,A.A.&Jasper,H.Signalintegration by Ca(2+) regulates intestinal stem-cell activity. Nature 528, 212–217 (2015). Official journal of the Cell Death Differentiation Association

Journal

Cell Death Discovery – Springer Journals

Published: Jul 23, 2018

There are no references for this article.