Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Molecular impact of launch related dynamic vibrations and static hypergravity in planarians

Molecular impact of launch related dynamic vibrations and static hypergravity in planarians www.nature.com/npjmgrav ARTICLE OPEN Molecular impact of launch related dynamic vibrations and static hypergravity in planarians 1 2 3 1 1 1 Nídia de Sousa , Marcello Caporicci , Jeroen Vandersteen , Jose Ignacio Rojo-Laguna , Emili Saló , Teresa Adell , 4,5 2,6 Gennaro Auletta and Jack J.W.A. van Loon Although many examples of simulated and real microgravity demonstrating their profound effect on biological systems are described in literature, few reports deal with hypergravity and vibration effects, the levels of which are severely increased during the launch preceding the desired microgravity period. Here, we used planarians, flatworms that can regenerate any body part in a few days. Planarians are an ideal model to study the impact of launch-related hypergravity and vibration during a regenerative process in a “whole animal” context. Therefore, planarians were subjected to 8.5 minutes of 4 g hypergravity (i.e. a human-rated launch level) in the Large Diameter Centrifuge (LDC) and/or to vibrations (20–2000 Hz, 11.3 G ) simulating the conditions of a rms standard rocket launch. The transcriptional levels of genes (erg-1, runt-1, fos, jnk, and yki) related with the early stress response were quantified through qPCR. The results show that early response genes are severely deregulated after static and dynamic loads but more so after a combined exposure of dynamic (vibration) and static (hypergravity) loads, more closely simulating real launch exposure profiles. Importantly, at least four days after the exposure, the transcriptional levels of those genes are still deregulated. Our results highlight the deep impact that short exposures to hypergravity and vibration have in organisms, and thus the implications that space flight launch could have. These phenomena should be taken into account when planning for well- controlled microgravity studies. npj Microgravity (2020) 6:25 ; https://doi.org/10.1038/s41526-020-00115-7 INTRODUCTION pharynx, and an excretory system . The amazing regenerative ability of planarians is due to the presence of a population of adult There is currently an increased interest in space research and stem cells—called neoblasts—that are totipotent, and thus able to gravity-related sciences, especially since commercial space travels 18–20 opened broad and new perspectives in medical and physical give rise to any planarian cell type . Planarian plasticity is also research, innovative tourism, or even in terms of territorial visible during their normal homeostasis, since they continuously 18,21 expansion towards the Moon and Mars. The 2005 NASA initiative grow and degrow depending on food availability . The to designate the US segment of the International Space Station presence of these unique adult stem cells and their plasticity 1–3 (ISS) as a US national lab is in line with this trend. In this renders planarians in a unique model to study the impact of scenario, more research is required on the mechanisms of the environmental factors like hypergravity and vibration in adult cells effect of space flights on the function of cells and organisms. in the context of a “whole animal”, in contrast to the partial view Fluctuations in gravity, vibration, pressure, temperature and inherent to “in vitro” cell cultures. Also, there is an increasing radiation are the main parameters to take into account in space interest to study these animals under various altered gravity 4–6 flight studies . While many examples of how simulated and real 22–26 conditions . microgravity, simulated and real partial gravity, and hypergravity Planarians were subjected to 4 g hypergravity in the Large demonstrate their profound effects on biological and physiologi- Diameter Centrifuge (LDC) and/or to vibration for 8.5 minutes 7–10 cal systems are found in literature, see for review , a limited (20–2000 Hz, 11.3 G ), simulating the conditions of a standard rms number of reports deal with specific launch-related hypergrav- human-rated rocket launch. The transcriptional levels of genes 11–13 13–16 ity or vibration effects, the levels of which are severely related with the early response were quantified through qPCR. The increased in every space flight during ascent. There are, up till results show that despite planarians regenerate apparently as now, no ground-based research reports where the effects of good as controls, genes that respond just a few hours after launch vibrations and static g loads are applied simultaneously. wounding (early response genes) are significantly up- or down- To learn of the effects of hypergravity and vibration in living regulated after the various treatments. Furthermore, the dereg- organisms, we report on the impact of static and dynamic loads ulation is higher after the combined exposure of static and on planarians. Planarian are flatworms with the unique ability to dynamic g loads. Importantly, four days after exposure, the regenerate any missing part of their body, even the head, after 17,18 transcriptional levels of those genes are still deregulated. These amputation . Planarians show a centralized nervous system, with an anterior brain to which two nerve cords are connected, results highlight the deep impact that launch-related hypergravity two eyes, a digestive system that connects to an evaginable and vibrational loads can have on cells and whole organisms, and 1 2 Department of Genetics, Microbiology and Statistics, Institute of Biomedicine, University of Barcelona (IBUB), Barcelona, Spain. Life Support and Physical Sciences Section (TEC- MMG), European Space Agency—European Space Research and Technology Centre (ESA-ESTEC), Noordwijk, The Netherlands. TEC-ECC, European Space Agency—European 4 5 Space Research and Technology Centre (ESA-ESTEC), Noordwijk, The Netherlands. Pontifical Gregorian University, Roma, Italy. University of Cassino, Cassino, Frosinone, Italy. DESC (Dutch Experiment Support Center), Amsterdam University Medical Center location VUmc and Academic Centre for Dentistry Amsterdam (ACTA), Vrije Universiteit Amsterdam, Department of Oral and Maxillofacial Surgery/Pathology, Amsterdam Movement Sciences, Amsterdam, The Netherlands. email: j.vanloon@amsterdamumc.nl Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA 1234567890():,; N. de Sousa et al. thus the implications for space flights experiment design and were loaded into the LDC in which a vibration system was logistics. adapted (Figs. 1a and 2). To explore the effects of hypergravity and vibration individually and combined, four animal groups were included: planarians at 1 g without vibration (control group), planarians at 4 g without RESULTS vibration, planarians at 1 g with vibration, and planarians at 4 g Planarians after short-duration vibration and/or 4 g hypergravity with vibration (see Fig. 1b). In vivo observation of the animals are able to properly regenerate the missing head immediately after the treatment (0 h) and 4 days (4d) after showed In order to verify whether vibration and hypergravity conditions no obvious difference in the regenerative abilities between the various planarian groups (Fig. 3). Thus, planarians under vibration affects planarian regeneration, 1-day-regenerating planarian trunks - the head and the tail were amputated the day before - and/or 4 g hypergravity, regenerate an apparently proper head. Fig. 1 Experimental design. a Animals were amputated the day before of the exposure to simulated launch loads (day −1). At day 0, animals were loaded into T25 flasks and the experiment was initiated. Immediately after the exposure to hypergravity, vibration or both, RNA was extracted from half of the animals (0 h). Four days after the exposure, the RNA of the rest of the animals was extracted (4d). The regenerated structures were imaged at 4 days after the exposure. b The four experimental groups of animals. Fig. 2 Vibration system. a Inside of the LDC gondola the vibration system consisting of the actuator, the amplifier and the data acquisition system was mounted in one gondola. The cooling system was placed in a second gondola (not visible in the image). b Detail of the top part of the actual actuator shown here with a T25 flask attached which contained five animals. The flasks were completely filled with planarian artificial medium, leaving no air bubbles. During simulated launch exposures the animals were at ambient conditions. During other periods the temperatures were 20–22 °C. npj Microgravity (2020) 25 Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA 1234567890():,; N. de Sousa et al. Planarians after short-duration vibration and/or 4 g hypergravity effector of the Hippo pathway, involved in tumor progression in 30,31 show a transcriptomic deregulation of genes essential for mammals and also in planarians . Importantly, we show that yki regeneration is significantly down-regulated in samples exposed to vibration and 4 g (Fig. 4). Maybe the most important result is that four days In planarians, the onset of regeneration relies on the transcrip- after the exposure the transcriptional levels of some early genes tional activation of early response genes, which are known to be remained significantly de-regulated in 4 g hypergravity or vibra- quickly activated after any kind of wound. Those genes are tion alone, and even more so in the samples subjected to essential for the proper proliferation and differentiation of stem 27,28 simultaneous exposure to static and dynamic loads. However, in cells after an injury in order to restore the missing structures. the latter samples the levels of de-regulation of fos, were much We performed a qPCR analysis to explore the expression levels of lower than the initially very high levels observed in the 0 h specific early response genes in the animals corresponding to the samples. It must be also noted that expression levels of piwi, which four conditions studied. We analyzed the expression of the is a marker of stem cells, does not change in a significant manner transcription factors runt-1, which is normally expressed 3–6h in any sample. This result suggests that despite the deregulation after wounding and is required for specifying different cell types 27,28 of the genes required to respond to stimulus, the organism is able during regeneration and egr-1 (early growth response-1), which to maintain a stable population of stem cells, which also agrees is expressed 1 h after wounding (Fig. 4). We also analyzed the with the observation that planarians can regenerate properly. expression of JNK pathway-related genes (fos-1, jnk), which Overall, these results indicate that exposure to static and coordinate the apoptotic and the mitotic response required for dynamic loads, similar to the ones experienced during a rocket proper regeneration (Fig. 4). Our results show that immediately launch produces a high impact in the transcriptional regulation of after the exposure (0 h) planarians that were subjected to only a genes required to properly respond to any injury. Furthermore, static load of 4 g show a significant decrease in the transcriptional the deregulation is reinforced when both elements, hypergravity levels of egr-1 and jnk. Planarians which were subjected to only a and vibration, are applied simultaneously, as it occurs during dynamic load of a random vibration showed a significant increase launch. Importantly, the deregulation of the transcripts occurs in the transcriptional levels of egr-1 and a decrease of jnk. The immediately after the exposure and persists throughout the most interesting result was that the simultaneous exposure of following days. planarians to 4 g hypergravity and vibration severely affected the transcription of the early genes. Thus, five genes analyzed were significantly up- or down-regulated with respect to controls. The DISCUSSION two genes related with the JNK pathway (fos and jnk), which are Although planarians regenerate an apparent proper head, our an evolutionarily conserved signal to regulate cell death and cell results indicate that short exposures to hypergravity and vibration proliferation in response to injury were the most severely affected. do elicit important transcriptional changes at a genetic level. The runt-1 was also up-regulated more than two-fold. In these analyses deregulation of the early response genes at 0 h indicates that the we also quantified the expression of yki, which is the nuclear cells are sensing the ‘stressing’ mechanical stimulus applied and respond by regulating genes that control essential cellular processes as proliferation and cell death. Importantly, although hypergravity or vibration alone already produce transcriptomic alterations, the simultaneous application of both for several minutes produces an even higher alteration of the transcriptional levels of the genes analyzed. The high up-regulation of fos,an oncogene involved in the control of cell death in all animal species , indicates the profound effects that this treatment produces in cells. Even more important is the finding that 4 days Fig. 3 In vivo phenotype of animals exposed to hypergravity and/ after returning the animals to normal 1 g conditions the or vibration 4 days after the exposure. Animals in all groups were transcriptional levels of some genes analyzed do not reach basal able to regenerate the head (the eyes are indicated with arrow levels. In fact, egr-1, and fos show a transcriptional alteration that is heads). No alterations are observed between the animals from the inverse with respect to the samples at 0 h, which could indicate four different conditions. n ≥ 10. Scale bar = 1 mm. that a rebound effect is occurring. Hypergravity or vibration alone Fig. 4 qPCR analysis of planarians exposed to vibration or/and 4 g hypergravity compared to 1 g static controls directly after exposure or at 4 days post exposure. The mRNA levels of the indicated genes are analyzed with respect to the levels of ura4. Values represent the means of at least two biological replicates each one with five animals. Error bars represent standard deviation. Data was analyzed by two-sided Student’s t-test. *p < 0.05; **p < 0.01; ***p < 0.001. Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA npj Microgravity (2020) 25 N. de Sousa et al. are also not completely recovered at 4 days. It must be stressed account by either a delay the in-flight start of an experiment or an that these alterations are observed in a context of a “whole implementation of the launch fade out phase by increasing the animal”. Thus, the sustained activation of the early response total active experiment time. This can be combined with the well- genes, which main function is to control apoptosis, stem cell established reduction of cellular activity by lowering temperature proliferation, and differentiation can have an impact in the cell or reducing medium serum content. During a pilot study in renewal of the organisms affected. The early response genes (c- preparation of a sounding rocket study we exposed primary myc, c-fos) expression after launch-related vibrations was also osteoblast to an 11 g launch simulation in the MidiCAR centrifuge identified by Tjandrawinata and colleagues where higher levels at 37 °C. It was shown that cells do sense this profile by of both genes were reported 30 min after exposure to a one-axis phosphorylation of some proteins which could be stopped by simulated space shuttle launch (2 min 7.83 G followed by 6 min ‘launching’ at 8 °C . rms at 4.098 G ). However, in that cell monolayer in vitro experiment This study demonstrated the importance of pre-flight tests rms this increase disappeared after 3 h. Using a whole animal like a especially related to launch effects for life sciences/biological planarian provides a more realistic situation where we do not see experiments. It might be argued that, especially for institutionally a recovery even after 4 days. funded basic research experiments, one needs, as part of the The study by Kumei and coworkers was one of the very first qualification process, to demonstrate how a particular experiment published experiments that explored the role hypergravity on the responds to launch loads (static, dynamic, and combined) and expression of early response genes such as c-fos, c-myc, and c-myb. how this relates to the initiation of the experiment while in HeLa cells were exposed for 2–4 days to either 18, 35 of 70 g and microgravity. This is especially true for short-duration microgravity only experiments that make use of platforms such as parabolic 45 46 c-myc showed an increase in expression. In another study, c-fos aircraft , drop towers or sounding rockets but also the more expression also increased, gradually, in an MC-3T3 bone cell line recent commercial suborbital platforms such as the Blue Origin 47 48 exposed for 5 min from 50 to as much as 2000 g, while erg-1 was New Shepard , future Virgin Galactic White Knight , Dream 35 49 more expressed at lower g levels . The very first study regarding Chaser from Sierra Nevada Company or the upcoming Space c-fos in real microgravity showed an opposite effect of gravity. In Rider from the European Space Agency . It is even more alarming that paper by de Groot and colleagues they reported a strongly since our data showed that launch effects are visible directly after decreased epidermal growth factor (EGF)-induced expression of lift off until even 4 days post exposure. This indicates that the c-fos and c-jun proto-oncogenes in a Maser sounding rocket although systems like the Russian Soyuz or the Space-X Dragon experiment . In the preparation for a spaceflight experiment we are now sometimes coupling to the International Space Station identified also the possible anabolic effects of vibration providing within a day, which has always been favored by the life sciences the opportunity to elucidate how bone cells (MC-3T3) sense community, an experiment might still need more time to vibration stress . More recent studies explored the effects of overcome the launch stress effects before a clear and reliable parabolic flight-related vibrations on thyroid cancer cells and the actual microgravity experiment can be initiated. possible anabolic effects in chondrocytes . We may conclude that in this study, where we exposed whole Comparing launch vibration simulation with in-flight data animals to static g-loads and, for the first time, also used Cubano and Lewis concluded that the regulation of heat shock combined launch effects with an actuator located inside a large proteins hsp27 and hsp70 in Jurkat cells was due to spaceflight . centrifuge, demonstrated the long-lasting effects of launch loads However, based on the current data, it might not be excluded that with a limited number of early response genes. Future experi- the effect on hsp27 could also have been generated by the ments should explore the full spectrum of genes and proteins combined effect of vibration and hypergravity loads during relevant for the research of a particular cell, tissue or animal. Also, launch. Such a combined test was not performed in that study. we applied a generic launch vibration profile in only one axis, In spaceflight experiments, the interest is not generally the effect while profiles of the various rockets are different and the location, of the launch, but the effect of microgravity specifically. However, fixation and/or stowage of the samples during launch are very the effect of the launch most likely affects the parameters during relevant parameters for the actual vibration profile. the next hours or even days. Thus, understanding what happens We showed that launch effects and especially the combined during the launch is required to optimize the experimental static g-loads and dynamic vibration, based on our findings parameters. concerning expression of five early response gene’s expressions Overall, our results indicate that a relatively short exposure to can be more important, and long lasting than previously expected. hypergravity and / or vibration can elicit short-term but also long- Ideally, any space-flight experiment should be exposed to such lasting cellular responses on a genetic and likely proteomic level. launch loads and these tests should be made part of the standard Even if effects of either static g loads or vibration might have no or flight-related requirements tests an experiment has to go through little effect separately, paradigms such as stochastic residence before an actual study in real microgravity may be performed and 39,40 might transpose sub-threshold responses to a relevant level .It produce relevant results. would be interesting to explore the nature of the cellular or tissue responses due to vibration. Would the effects be the result of METHODS organelle intracellular replacements like the relatively heavier nucleus or, also depending on the compliance of the experiment Planarian culture and exposure to hypergravity and/or vibration volume, a deformation of the whole-cell/tissue body due to Asexual planarians from a clonal strain of Schmidtea mediterranea BCN-10 inertial gravitational shear . In this respect, it is worth mentioning were maintained at 20 °C in planarian artificial medium (PAM) water, as that yki as the effector of the Hippo pathway, which is involved in previously described . Animals were fed with veal liver and starved for at least one week before beginning the experiments. Animals were force transduction of the cellular environment to the nucleus. It transported from Barcelona/Spain to ESA-ESTEC Noordwijk/the Nether- has been demonstrated that a direct force on to the cell leads to lands in PAM water using 50 mL falcon tubes. nuclear translocation of YAP which is the yki homolog in To study the regeneration process in planarians after exposure to vertebrates . hypergravity and/or vibration animals were amputated (head and tail) one The better experimental design in gravity-related space day before the exposure. The day after trunk fragments were loaded into research is to apply an on-board 1 g centrifuges to control for T25 flasks (day 1 of regeneration) (Fig. 1a). Four groups of animals were any spaceflight related effects such as radiation and launch . analyzed: planarians at 1 g without vibration (control), planarians at four However, based on current results also the factor time, which is times Earth gravity static accelerations without vibration (4 g), planarians at required to fade out launch effects, should also be taken into 1 g with dynamic g-loads (vibration), and planarians at 4 g with vibration npj Microgravity (2020) 25 Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA N. de Sousa et al. (Fig. 1B). Three flasks per condition (three replicates), were included with 5 study we applied that same profile to test the biological responses. The planarians per flask. RNA was extracted from those animals immediately total load experienced by the samples is 11.3 G in the frequency range rms after the exposure (0 h) and 4 days after (4d). between 20 and 2000 Hz (Table 1, Fig. 5b). These vibration levels are also comparable to the acceptance levels profile of the Generalized Random Vibration Test Levels Components (GELV) for payloads of 22.7 kg (50-lb) or Simulation of rocket launch less with have an overall G of 10.0 as are set in NASA standards . rms Planarians were amputated (head and tail) one day before the exposure to The vibration was applied for only one of the three orthogonal axes and launch-related mechanical loads. The day after, trunk fragments were was slightly modified because the shaker could not output the force loaded into T25 flasks (day 1 of regeneration). Three T25 flasks were required by the profile at higher g levels. In the range from 150 to 600 Hz included per condition, and 5 planarians were loaded into each flask. The 2 we did lower the power from 0.16 to 0.13 g /Hz. The force was lessened by setup includes the Large Diameter Centrifuge (LDC) (Fig. 5a ref. ), to ~20 Newton. Due to the unorthodox application of an actuator inside a simulate hypergravity (4 g) and a vibration system, which was bolted to the centrifuge, and despite the slight adaptation we made, the high vibration floor plate of one of the gondolas (Fig. 2). The hardware components of at 4 g ran for 240 s (4 min) at maximum intensity and stopped the set-up included the actual shaker model 2075E, a linear power automatically due to reaching the over-heating settings of the system. amplifier model 2050E09 both from The Modal Shop (TMS, Cincinnati, OH, We immediately restarted the actuator set-up to run for another 270 s USA), a front-end 8-channel data acquisition system (LMS / Siemens (4.5 min) in order to complete the full launch time simulation of SCADAS), a cooling system (Asynchronous Motors Cl. 71\2), and a laptop to 8.5 minutes. control the shaker with the companies dedicated control software. To fix the flasks with planarians on the shaker, an aluminum plate wrapped in a thin rubber sheet was used. The rubber sheet impeded the movement of Planarian RNA extraction the flasks along the metal plate. Planarians were subjected to vibration and To perform the transcriptomic analysis through quantitative real-time PCR static hypergravity separately or simultaneously. Four groups of animals (qPCR) analysis, total RNA was extracted from the four groups of planarians were analyzed: planarians at 1 g without vibration (control), planarians at immediately (0 h) and after four days after exposure (4d). Three replicates four times Earth’s gravitational force static accelerations without vibration each containing a pool of five animals were analyzed per condition. RNA (4 g), planarians at 1 g with dynamic g-loads (vibration), and planarians at was extracted with Trizol (Invitrogen, Carlsbad, CA, USA), following the 4 g with vibration. The parameters used to simulate launch vibration are manufacturer’s instructions. RNA was quantified with a Nanodrop ND-1000 shown in Fig. 5b and Table 1. spectrophotometer (Thermo Scientific, Waltham, MA, USA) and cDNA was The applied vibration profile was based on the Code of Federal synthesized using SuperScript™ III Reverse Transcriptase (Thermo Scientific Regulations (CRF) of the Office of the Federal Register National Archives Waltham, MA, USA) following the manufacturer’s instructions. and Record Administration, for launches into space from the Federal Aviation Administration (FAA) . These random vibration tests are usually Quantitative real-time PCR performed at the payload level of assembly for proto-flight hardware that is subjected to a random vibration test to verify its ability to survive the lift-off Quantitative PCR’s were performed using Power SYBR™ Green PCR Master environment and also to provide a final workmanship vibration test. In this Mix (Applied Biosystems) on 7500 Real-Time PCR Systems (Applied Fig. 5 The six red-colored swing-out and one central gondola from the 8-meter diameter Large Diameter Centrifuge (LDC). a Both centrifuges are currently located at the technology center (ESTEC) from the European Space Agency ESA) in Noordwijk, the Netherlands. b The Acceleration Spectral Density (ASD) of the random vibration test specification profile from the 20 to 2000 Hz range as used for exposing planarians to a simulated launch load. This profile is based on the minimum workmanship levels for random vibration testing . The equipment set-up was divided over two gondolas where the actual actuator was placed in the outer gondola (see for further details Fig. 2). Table 1. Vibration parameters, frequency range and power spectral density, as actually used in the dynamic g exposure of planarians for a period of 8.5 min. Maximum Maximum Maximum Maximum force Frequency (Hz) Slope Amplitude acceleration (g) velocity (m/s) displacement (mm) (N) (dB/Oct) (g /Hz) High 48 0.378 1.42 213 20 0.021 Vibration 20–150 3 0.130 150–600 −6 0.130 600–2000 2000 0.014 Overall G = 11.28 rms From ref. Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA npj Microgravity (2020) 25 N. de Sousa et al. 14. Baert, P. et al. The potential (radio-)biological impact of launch vibration. Acta Table 2. Sequence of primers used in the qPCR experiments. Astronaut. 58, 456–463 (2006). 15. Cubano, L. A. & Lewis, M. L. Effect of vibrational stress and spaceflight on reg- Genes Primers (5′−3′) ulation of heat shock proteins hsp70 and hsp27 in human lymphocytes (Jurkat). J. Leukoc. Biol. 69, 755–761 (2001). runt1 TCCTATCGGAGACGGACA GCTTCACCGTTGACGAGT 16. Wehland, M. et al. The impact of altered gravity and vibration on endothelial cells egr1 GTTAGCGTGCCATTTTTGT AGCTGCATTGATAAGGCTTC during a parabolic flight. Cell Physiol. Biochem. 31, 432–451 (2013). 17. Gentile, L., Cebria, F. & Bartscherer, K. The planarian flatworm: an in vivo model fos GAACGACGCCAATTTCAG CGCTTCGAGTTGTTTGAGT for stem cell biology and nervous system regeneration. Dis. Model Mech. 4,12–19 jnk TCAACGAATCTCGGTCG AGTGAGCTCTCTTTCATCAACC (2011). yorkie ATTTGTGTCGACTCCATCC CCATTAAGACATGTCGACAAG 18. Saló, E. et al. Planarian regeneration: achievements and future directions after 20 years of research. Int. J. Dev. Biol. 53, 1317–1327 (2009). piwi ATCCTATGGCACCGAATGAG CCCTTATGCACCTTTCCAAC 19. Baguñà, J. The planarian neoblast: the rambling history of its origin and some current black boxes. Int. J. Dev. Biol. 56,19–37 (2012). 20. Rink, J. C. Stem cell systems and regeneration in planaria. Dev. Genes evolution 223,67–84 (2013). Biosystems) by denaturation at 95 °C for 10 min, followed by 40 cycles at 21. Felix, D. A. et al. It is not all about regeneration: Planarians striking power to stand 95 °C for 15 s and 60 °C for 40 s. Melting curve analyses were performed to starvation. Semin. Cell. Dev. Biol. 87, 169–181 (2019). verify the amplification specificity. Relative quantification of gene 22. Adell, T., Salo, E., van Loon, J. J. & Auletta, G. Planarians sense simulated micro- expression was performed according to the ΔΔ-CT method with at least gravity and hypergravity. Biomed. Res. Int 2014, 679672 (2014). two technical replicates per sample and at least two biological replicates. 23. de Sousa, N. et al. Transcriptomic analysis of planarians under simulated micro- The measured C values were normalized to the ubiquitously expressed gravity or 8 g demonstrates that alteration of gravity induces genomic and control mRNA smed-ura4. Student t-test was used for differential cellular alterations that could facilitate tumoral transformation. Int. J. Mol. Sci. 20, expression analysis between samples. The set of used primers in qPCR 720 (2019). analysis in provided in Table 2. 24. Gorgiladze, G. I. Regenerative capacity of the eye of Helix lucorum in a 163-day orbital flight aboard the International Space Station. Dokl. Biol Sci. 440, 316–319 Reporting summary (2011). 25. Lu, H. M. et al. Effects of large gradient high magnetic field (LG-HMF) on the long- Further information on experimental design is available in the Nature term culture of aquatic organisms: planarians example. Bioelectromagnetics 39, Research Reporting Summary linked to this paper. 428–440 (2018). 26. Morokuma, J. et al. Planarian regeneration in space: persistent anatomical, behavioral, and bacteriological changes induced by space travel. Regeneration 4, DATA AVAILABILITY 85–102 (2017). The data that support the findings of this study are available from the corresponding 27. Sandmann, T., Vogg, M. C., Owlarn, S., Boutros, M. & Bartscherer, K. The head- author upon reasonable request. regeneration transcriptome of the planarian Schmidtea mediterranea. Genome Biol. 12, R76 (2011). Received: 30 March 2020; Accepted: 11 August 2020; 28. Wenemoser, D., Lapan, S. W., Wilkinson, A. W., Bell, G. W. & Reddien, P. W. A molecular wound response program associated with regeneration initiation in planarians. Genes Dev. 26, 988–1002 (2012). 29. Almuedo-Castillo, M. et al. JNK controls the onset of mitosis in planarian stem cells and triggers apoptotic cell death required for regeneration and remodeling. PLoS Genet. 10, e1004400 (2014). REFERENCES 30. de Sousa, N., Rodríguez-Esteban, G., Rojo-Laguna, J. I., Saló, E. & Adell, T. Hippo signaling controls cell cycle and restricts cell plasticity in planarians. PLoS Biol. 16, 1. Harris, B. et al. International Space Station Utilization and Advancing Research in e2002399 (2018). Space. In AIAA SPACE 2013 Conference and Exposition. San Diego, CA, U.S.A., 31. Zanconato, F., Cordenonsi, M. & Piccolo, S. YAP/TAZ at the roots of cancer. Cancer American Institute of Aeronautics and Astronautics. (2013). Cell 29, 783–803 (2016). 2. Chang, Y.-W. The first decade of commercial space tourism. Acta Astronaut. 108, 32. Gozdecka, M. & Breitwieser, W. The roles of ATF2 (activating transcription factor 2) 79–91 (2015). in tumorigenesis. (Portland Press Limited, 2012). 3. Moro-Aguilar, R. The new commercial suborbital vehicles: an opportunity for 33. Tjandrawinata, R. R., Vincent, V. L. & Hughes-Fulford, M. Vibrational force alters scientific and microgravity research. Microgravity Sci. Technol. 26, 219–227 (2014). mRNA expression in osteoblasts. FASEB J. 11, 493–497 (1997). 4. Cottin, H. et al. Space as a tool for astrobiology: review and recommendations for 34. Kumei, Y., Nakajima, T., Sato, A., Kamata, N. & Enomoto, S. Reduction of G1 phase experimentations in earth orbit and beyond. Space Sci. Rev. 209,83–181 (2017). duration and enhancement of c-myc gene expression in HeLa cells at hyper- 5. Huang, B., Li, D. G., Huang, Y. & Liu, C. T. Effects of spaceflight and simulated gravity. J. Cell Sci. 93, 221–226 (1989). microgravity on microbial growth and secondary metabolism. Mil. Med. Res 5,18 35. Nose, K. & Shibanuma, M. Induction of early response genes by hypergravity in (2018). cultured mouse osteoblastic cells (MC3T3-E1). Exp. Cell Res. 211, 168–170 (1994). 6. Horneck, G., Klaus, D. M. & Mancinelli, R. L. Space microbiology. Microbiol. Mol. 36. de Groot, R. P. et al. Microgravity decreases c-fos induction and serum response Biol. Rev. 74, 121–156 (2010). element activity. J. Cell Sci. 97,33–38 (1990). 7. Becker, J. L. & Souza, G. R. Using space-based investigations to inform cancer 37. Bacabac, R. G. et al. Bone cell responses to high-frequency vibration stress: does research on Earth. Nat. Rev. Cancer 13, 315–327 (2013). the nucleus oscillate within the cytoplasm? FASEB J. 20, 858–864 (2006). 8. Beysens, D. A. & van Loon, J. in Generation and Applications of Extra-Terrestrial 38. Lützenberg, R. et al. Pathway analysis hints towards beneficial effects of long- Environments on Earth (eds Daniel A Beysens & JJWA van Loon) Ch. 1, 5–9 (Rivers term vibration on human chondrocytes. Cell. Physiol. Biochem. 47, 1729–1741 Publishers, 2015). (2018). 9. Najrana, T. & Sanchez-Esteban, J. Mechanotransduction as an adaptation to 39. Bacabac, R. G., Van Loon, J. J., Smit, T. H. & Klein-Nulend, J. Noise enhances the gravity. Front. Pediatr. 4, 140 (2016). rapid nitric oxide production by bone cells in response to fluid shear stress. 10. Manzano, A. et al. Novel, Moon and Mars, partial gravity simulation paradigms Technol. Health Care 17,57–65 (2009). and their effects on the balance between cell growth and cell proliferation during 40. Van Loon, J. J. Micro-gravity and mechanomics. Gravit. Space Res. 20,3–17 (2007). early plant development. npj Microgravity 4, 9 (2018). 41. van Loon, J. J., Folgering, E. H., Bouten, C. V., Veldhuijzen, J. P. & Smit, T. H. Inertial 11. Fitzgerald, J. & Hughes-fulford, M. Mechanically induced c-fos expression is shear forces and the use of centrifuges in gravity research. What is the proper mediated by cAMP in MC3T3-E1 osteoblasts. FASEB J. 13, 553–557 (1999). control?. J. Biomech. Eng. 125, 342–346 (2003). 12. Kopp, S. et al. Thyroid cancer cells in space during the TEXUS-53 sounding rocket 42. Elosegui-Artola, A. et al. Force triggers YAP nuclear entry by regulating transport mission–The THYROID Project. Sci. Rep. 8, 10355 (2018). across nuclear pores. Cell 171, 1397–1410 (2017). 13. Ulbrich, C. et al. Differential gene regulation under altered gravity conditions in 43. Van Loon, J. in Biology in Space and Life on Earth. Effects of Spaceflight on Bio- follicular thyroid cancer cells: relationship between the extracellular matrix and logical Systems (ed. E. Brinckmann) 17–32 (John Wiley and Sons Ltd., 2007). the cytoskeleton. Cell Physiol. Biochem. 28, 185–198 (2011). npj Microgravity (2020) 25 Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA N. de Sousa et al. 44. Guntermann, A. Untersuchungen zellulärer Proteinphosphorylierungsmuster pri- AUTHOR CONTRIBUTIONS märer Osteoblasten nach Hypergravitationsbelastung PhD thesis, Philipps-Uni- N.d.S., J.I.R.-L., E.S., T.A.: set-up and analyzed the data from the planarian experiments; versität Marburg, (2002). G.A.: overall PI of planarian study; M.C., J.V.: set-up and operation vibration study; J.J. 45. Pletser, V. & Kumei, Y. in Generation and Applications of Extra-Terrestrial Environ- W.A.v.L.: initiation of this particular launch load study, set-up and operations of the ments on Earth (eds Daniel, A. B. & Jack, JWA v. L.) 61–73 (Rivers Publishers, 2015). LDC centrifuge. All authors discussed the results and revised and edited the paper. 46. von Kampen, P., Kaczmarczik, U. & Rath, H. J. The new drop tower catapult system. Acta Astronaut. 59, 278–283 (2006). 47. Blue Origin. New Shepard Payload User’s Guide. Revision E NSPM-MAD002. Texas, COMPETING INTERESTS USA, Blue Origin Texas, LLC. 98 (2018). The authors declare no competing interests. 48. Virgin Galactic. SpaceShipTwo: An Introductory Guide for Payload Users. Santa Fe, New Mexico, USA, Virgin Galactic. Revision Number: WEB005:34 (2016). 49. Taylor, F. W. et al. Challenges and Opportunities Related to Landing the Dream ADDITIONAL INFORMATION Chaser® Reusable Space Vehicle at a Public-Use Airport. Space Traffic Manage- Supplementary information is available for this paper at https://doi.org/10.1038/ ment Conference, Embry-Riddle Aeronautical University, Daytona Beach, FL, USA s41526-020-00115-7. (2014). 50. Fedele, A. et al. The Space Rider Programme: end user’s needs and payload Correspondence and requests for materials should be addressed to J.J.W.A.v.L. applications survey as driver for mission and system definition. Acta Astronautica 152, 534–541 (2018). Reprints and permission information is available at http://www.nature.com/ 51. de Sousa, N. & Adell, T. Maintenance of Schmidtea mediterranea in the Labora- reprints tory. Bio-Protocol. 8,1–16 (2018). 52. van Loon, J. J. et al. The large diameter centrifuge, LDC, for life and physical Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims sciences and technology. Life in Space for Life on Earth, Anger, France, SP-663, ESA in published maps and institutional affiliations. Communication Production Office (2008). 53. Code of Federal Regulations, C. Vol. App. E 667, Table E417.611-661, Minimum Workmanship (Department of Transportation (DOT)) (2012). Open Access This article is licensed under a Creative Commons 54. NASA, G. S. F. C. in For GSFC Flight Programs and Projects Vol. GSFC-STD-7000A Attribution 4.0 International License, which permits use, sharing, GSFC-STD-7000A (NASA GSFC Technical Standards Program, Greenbelt, 2013). adaptation, distribution and reproduction in any medium or format, as long as you give 55. Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real- appropriate credit to the original author(s) and the source, provide a link to the Creative time quantitative PCR and the 2− ΔΔCT method. Methods 25, 402–408 (2001). Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the ACKNOWLEDGEMENTS article’s Creative Commons license and your intended use is not permitted by statutory We appreciate the assistance of Mr. Alan Dowson at ESA-ESTEC-TEC-MMG during the regulation or exceeds the permitted use, you will need to obtain permission directly various campaigns. This work was supported by BFU2017-83755-P from Ministerio de from the copyright holder. To view a copy of this license, visit http://creativecommons. Ciencia, Innovación y Universidades (Spain) and grant 2017SGR-1455 from AQU org/licenses/by/4.0/. (Generalitat de Catalunya) to T.A. and E.S. The study was also possible though an ESA CORA grant; contract no. 4000109540/13/NL/PG/pt and for JvL via an ESA contract 4000107455/12/NL/PA. © The Author(s) 2020 Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA npj Microgravity (2020) 25 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png npj Microgravity Springer Journals

Molecular impact of launch related dynamic vibrations and static hypergravity in planarians

Download PDF
7 pages

Loading next page...
 
/lp/springer-journals/molecular-impact-of-launch-related-dynamic-vibrations-and-static-hImTiOBRSV

References (55)

Publisher
Springer Journals
Copyright
Copyright © The Author(s) 2020
eISSN
2373-8065
DOI
10.1038/s41526-020-00115-7
Publisher site
See Article on Publisher Site

Abstract

www.nature.com/npjmgrav ARTICLE OPEN Molecular impact of launch related dynamic vibrations and static hypergravity in planarians 1 2 3 1 1 1 Nídia de Sousa , Marcello Caporicci , Jeroen Vandersteen , Jose Ignacio Rojo-Laguna , Emili Saló , Teresa Adell , 4,5 2,6 Gennaro Auletta and Jack J.W.A. van Loon Although many examples of simulated and real microgravity demonstrating their profound effect on biological systems are described in literature, few reports deal with hypergravity and vibration effects, the levels of which are severely increased during the launch preceding the desired microgravity period. Here, we used planarians, flatworms that can regenerate any body part in a few days. Planarians are an ideal model to study the impact of launch-related hypergravity and vibration during a regenerative process in a “whole animal” context. Therefore, planarians were subjected to 8.5 minutes of 4 g hypergravity (i.e. a human-rated launch level) in the Large Diameter Centrifuge (LDC) and/or to vibrations (20–2000 Hz, 11.3 G ) simulating the conditions of a rms standard rocket launch. The transcriptional levels of genes (erg-1, runt-1, fos, jnk, and yki) related with the early stress response were quantified through qPCR. The results show that early response genes are severely deregulated after static and dynamic loads but more so after a combined exposure of dynamic (vibration) and static (hypergravity) loads, more closely simulating real launch exposure profiles. Importantly, at least four days after the exposure, the transcriptional levels of those genes are still deregulated. Our results highlight the deep impact that short exposures to hypergravity and vibration have in organisms, and thus the implications that space flight launch could have. These phenomena should be taken into account when planning for well- controlled microgravity studies. npj Microgravity (2020) 6:25 ; https://doi.org/10.1038/s41526-020-00115-7 INTRODUCTION pharynx, and an excretory system . The amazing regenerative ability of planarians is due to the presence of a population of adult There is currently an increased interest in space research and stem cells—called neoblasts—that are totipotent, and thus able to gravity-related sciences, especially since commercial space travels 18–20 opened broad and new perspectives in medical and physical give rise to any planarian cell type . Planarian plasticity is also research, innovative tourism, or even in terms of territorial visible during their normal homeostasis, since they continuously 18,21 expansion towards the Moon and Mars. The 2005 NASA initiative grow and degrow depending on food availability . The to designate the US segment of the International Space Station presence of these unique adult stem cells and their plasticity 1–3 (ISS) as a US national lab is in line with this trend. In this renders planarians in a unique model to study the impact of scenario, more research is required on the mechanisms of the environmental factors like hypergravity and vibration in adult cells effect of space flights on the function of cells and organisms. in the context of a “whole animal”, in contrast to the partial view Fluctuations in gravity, vibration, pressure, temperature and inherent to “in vitro” cell cultures. Also, there is an increasing radiation are the main parameters to take into account in space interest to study these animals under various altered gravity 4–6 flight studies . While many examples of how simulated and real 22–26 conditions . microgravity, simulated and real partial gravity, and hypergravity Planarians were subjected to 4 g hypergravity in the Large demonstrate their profound effects on biological and physiologi- Diameter Centrifuge (LDC) and/or to vibration for 8.5 minutes 7–10 cal systems are found in literature, see for review , a limited (20–2000 Hz, 11.3 G ), simulating the conditions of a standard rms number of reports deal with specific launch-related hypergrav- human-rated rocket launch. The transcriptional levels of genes 11–13 13–16 ity or vibration effects, the levels of which are severely related with the early response were quantified through qPCR. The increased in every space flight during ascent. There are, up till results show that despite planarians regenerate apparently as now, no ground-based research reports where the effects of good as controls, genes that respond just a few hours after launch vibrations and static g loads are applied simultaneously. wounding (early response genes) are significantly up- or down- To learn of the effects of hypergravity and vibration in living regulated after the various treatments. Furthermore, the dereg- organisms, we report on the impact of static and dynamic loads ulation is higher after the combined exposure of static and on planarians. Planarian are flatworms with the unique ability to dynamic g loads. Importantly, four days after exposure, the regenerate any missing part of their body, even the head, after 17,18 transcriptional levels of those genes are still deregulated. These amputation . Planarians show a centralized nervous system, with an anterior brain to which two nerve cords are connected, results highlight the deep impact that launch-related hypergravity two eyes, a digestive system that connects to an evaginable and vibrational loads can have on cells and whole organisms, and 1 2 Department of Genetics, Microbiology and Statistics, Institute of Biomedicine, University of Barcelona (IBUB), Barcelona, Spain. Life Support and Physical Sciences Section (TEC- MMG), European Space Agency—European Space Research and Technology Centre (ESA-ESTEC), Noordwijk, The Netherlands. TEC-ECC, European Space Agency—European 4 5 Space Research and Technology Centre (ESA-ESTEC), Noordwijk, The Netherlands. Pontifical Gregorian University, Roma, Italy. University of Cassino, Cassino, Frosinone, Italy. DESC (Dutch Experiment Support Center), Amsterdam University Medical Center location VUmc and Academic Centre for Dentistry Amsterdam (ACTA), Vrije Universiteit Amsterdam, Department of Oral and Maxillofacial Surgery/Pathology, Amsterdam Movement Sciences, Amsterdam, The Netherlands. email: j.vanloon@amsterdamumc.nl Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA 1234567890():,; N. de Sousa et al. thus the implications for space flights experiment design and were loaded into the LDC in which a vibration system was logistics. adapted (Figs. 1a and 2). To explore the effects of hypergravity and vibration individually and combined, four animal groups were included: planarians at 1 g without vibration (control group), planarians at 4 g without RESULTS vibration, planarians at 1 g with vibration, and planarians at 4 g Planarians after short-duration vibration and/or 4 g hypergravity with vibration (see Fig. 1b). In vivo observation of the animals are able to properly regenerate the missing head immediately after the treatment (0 h) and 4 days (4d) after showed In order to verify whether vibration and hypergravity conditions no obvious difference in the regenerative abilities between the various planarian groups (Fig. 3). Thus, planarians under vibration affects planarian regeneration, 1-day-regenerating planarian trunks - the head and the tail were amputated the day before - and/or 4 g hypergravity, regenerate an apparently proper head. Fig. 1 Experimental design. a Animals were amputated the day before of the exposure to simulated launch loads (day −1). At day 0, animals were loaded into T25 flasks and the experiment was initiated. Immediately after the exposure to hypergravity, vibration or both, RNA was extracted from half of the animals (0 h). Four days after the exposure, the RNA of the rest of the animals was extracted (4d). The regenerated structures were imaged at 4 days after the exposure. b The four experimental groups of animals. Fig. 2 Vibration system. a Inside of the LDC gondola the vibration system consisting of the actuator, the amplifier and the data acquisition system was mounted in one gondola. The cooling system was placed in a second gondola (not visible in the image). b Detail of the top part of the actual actuator shown here with a T25 flask attached which contained five animals. The flasks were completely filled with planarian artificial medium, leaving no air bubbles. During simulated launch exposures the animals were at ambient conditions. During other periods the temperatures were 20–22 °C. npj Microgravity (2020) 25 Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA 1234567890():,; N. de Sousa et al. Planarians after short-duration vibration and/or 4 g hypergravity effector of the Hippo pathway, involved in tumor progression in 30,31 show a transcriptomic deregulation of genes essential for mammals and also in planarians . Importantly, we show that yki regeneration is significantly down-regulated in samples exposed to vibration and 4 g (Fig. 4). Maybe the most important result is that four days In planarians, the onset of regeneration relies on the transcrip- after the exposure the transcriptional levels of some early genes tional activation of early response genes, which are known to be remained significantly de-regulated in 4 g hypergravity or vibra- quickly activated after any kind of wound. Those genes are tion alone, and even more so in the samples subjected to essential for the proper proliferation and differentiation of stem 27,28 simultaneous exposure to static and dynamic loads. However, in cells after an injury in order to restore the missing structures. the latter samples the levels of de-regulation of fos, were much We performed a qPCR analysis to explore the expression levels of lower than the initially very high levels observed in the 0 h specific early response genes in the animals corresponding to the samples. It must be also noted that expression levels of piwi, which four conditions studied. We analyzed the expression of the is a marker of stem cells, does not change in a significant manner transcription factors runt-1, which is normally expressed 3–6h in any sample. This result suggests that despite the deregulation after wounding and is required for specifying different cell types 27,28 of the genes required to respond to stimulus, the organism is able during regeneration and egr-1 (early growth response-1), which to maintain a stable population of stem cells, which also agrees is expressed 1 h after wounding (Fig. 4). We also analyzed the with the observation that planarians can regenerate properly. expression of JNK pathway-related genes (fos-1, jnk), which Overall, these results indicate that exposure to static and coordinate the apoptotic and the mitotic response required for dynamic loads, similar to the ones experienced during a rocket proper regeneration (Fig. 4). Our results show that immediately launch produces a high impact in the transcriptional regulation of after the exposure (0 h) planarians that were subjected to only a genes required to properly respond to any injury. Furthermore, static load of 4 g show a significant decrease in the transcriptional the deregulation is reinforced when both elements, hypergravity levels of egr-1 and jnk. Planarians which were subjected to only a and vibration, are applied simultaneously, as it occurs during dynamic load of a random vibration showed a significant increase launch. Importantly, the deregulation of the transcripts occurs in the transcriptional levels of egr-1 and a decrease of jnk. The immediately after the exposure and persists throughout the most interesting result was that the simultaneous exposure of following days. planarians to 4 g hypergravity and vibration severely affected the transcription of the early genes. Thus, five genes analyzed were significantly up- or down-regulated with respect to controls. The DISCUSSION two genes related with the JNK pathway (fos and jnk), which are Although planarians regenerate an apparent proper head, our an evolutionarily conserved signal to regulate cell death and cell results indicate that short exposures to hypergravity and vibration proliferation in response to injury were the most severely affected. do elicit important transcriptional changes at a genetic level. The runt-1 was also up-regulated more than two-fold. In these analyses deregulation of the early response genes at 0 h indicates that the we also quantified the expression of yki, which is the nuclear cells are sensing the ‘stressing’ mechanical stimulus applied and respond by regulating genes that control essential cellular processes as proliferation and cell death. Importantly, although hypergravity or vibration alone already produce transcriptomic alterations, the simultaneous application of both for several minutes produces an even higher alteration of the transcriptional levels of the genes analyzed. The high up-regulation of fos,an oncogene involved in the control of cell death in all animal species , indicates the profound effects that this treatment produces in cells. Even more important is the finding that 4 days Fig. 3 In vivo phenotype of animals exposed to hypergravity and/ after returning the animals to normal 1 g conditions the or vibration 4 days after the exposure. Animals in all groups were transcriptional levels of some genes analyzed do not reach basal able to regenerate the head (the eyes are indicated with arrow levels. In fact, egr-1, and fos show a transcriptional alteration that is heads). No alterations are observed between the animals from the inverse with respect to the samples at 0 h, which could indicate four different conditions. n ≥ 10. Scale bar = 1 mm. that a rebound effect is occurring. Hypergravity or vibration alone Fig. 4 qPCR analysis of planarians exposed to vibration or/and 4 g hypergravity compared to 1 g static controls directly after exposure or at 4 days post exposure. The mRNA levels of the indicated genes are analyzed with respect to the levels of ura4. Values represent the means of at least two biological replicates each one with five animals. Error bars represent standard deviation. Data was analyzed by two-sided Student’s t-test. *p < 0.05; **p < 0.01; ***p < 0.001. Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA npj Microgravity (2020) 25 N. de Sousa et al. are also not completely recovered at 4 days. It must be stressed account by either a delay the in-flight start of an experiment or an that these alterations are observed in a context of a “whole implementation of the launch fade out phase by increasing the animal”. Thus, the sustained activation of the early response total active experiment time. This can be combined with the well- genes, which main function is to control apoptosis, stem cell established reduction of cellular activity by lowering temperature proliferation, and differentiation can have an impact in the cell or reducing medium serum content. During a pilot study in renewal of the organisms affected. The early response genes (c- preparation of a sounding rocket study we exposed primary myc, c-fos) expression after launch-related vibrations was also osteoblast to an 11 g launch simulation in the MidiCAR centrifuge identified by Tjandrawinata and colleagues where higher levels at 37 °C. It was shown that cells do sense this profile by of both genes were reported 30 min after exposure to a one-axis phosphorylation of some proteins which could be stopped by simulated space shuttle launch (2 min 7.83 G followed by 6 min ‘launching’ at 8 °C . rms at 4.098 G ). However, in that cell monolayer in vitro experiment This study demonstrated the importance of pre-flight tests rms this increase disappeared after 3 h. Using a whole animal like a especially related to launch effects for life sciences/biological planarian provides a more realistic situation where we do not see experiments. It might be argued that, especially for institutionally a recovery even after 4 days. funded basic research experiments, one needs, as part of the The study by Kumei and coworkers was one of the very first qualification process, to demonstrate how a particular experiment published experiments that explored the role hypergravity on the responds to launch loads (static, dynamic, and combined) and expression of early response genes such as c-fos, c-myc, and c-myb. how this relates to the initiation of the experiment while in HeLa cells were exposed for 2–4 days to either 18, 35 of 70 g and microgravity. This is especially true for short-duration microgravity only experiments that make use of platforms such as parabolic 45 46 c-myc showed an increase in expression. In another study, c-fos aircraft , drop towers or sounding rockets but also the more expression also increased, gradually, in an MC-3T3 bone cell line recent commercial suborbital platforms such as the Blue Origin 47 48 exposed for 5 min from 50 to as much as 2000 g, while erg-1 was New Shepard , future Virgin Galactic White Knight , Dream 35 49 more expressed at lower g levels . The very first study regarding Chaser from Sierra Nevada Company or the upcoming Space c-fos in real microgravity showed an opposite effect of gravity. In Rider from the European Space Agency . It is even more alarming that paper by de Groot and colleagues they reported a strongly since our data showed that launch effects are visible directly after decreased epidermal growth factor (EGF)-induced expression of lift off until even 4 days post exposure. This indicates that the c-fos and c-jun proto-oncogenes in a Maser sounding rocket although systems like the Russian Soyuz or the Space-X Dragon experiment . In the preparation for a spaceflight experiment we are now sometimes coupling to the International Space Station identified also the possible anabolic effects of vibration providing within a day, which has always been favored by the life sciences the opportunity to elucidate how bone cells (MC-3T3) sense community, an experiment might still need more time to vibration stress . More recent studies explored the effects of overcome the launch stress effects before a clear and reliable parabolic flight-related vibrations on thyroid cancer cells and the actual microgravity experiment can be initiated. possible anabolic effects in chondrocytes . We may conclude that in this study, where we exposed whole Comparing launch vibration simulation with in-flight data animals to static g-loads and, for the first time, also used Cubano and Lewis concluded that the regulation of heat shock combined launch effects with an actuator located inside a large proteins hsp27 and hsp70 in Jurkat cells was due to spaceflight . centrifuge, demonstrated the long-lasting effects of launch loads However, based on the current data, it might not be excluded that with a limited number of early response genes. Future experi- the effect on hsp27 could also have been generated by the ments should explore the full spectrum of genes and proteins combined effect of vibration and hypergravity loads during relevant for the research of a particular cell, tissue or animal. Also, launch. Such a combined test was not performed in that study. we applied a generic launch vibration profile in only one axis, In spaceflight experiments, the interest is not generally the effect while profiles of the various rockets are different and the location, of the launch, but the effect of microgravity specifically. However, fixation and/or stowage of the samples during launch are very the effect of the launch most likely affects the parameters during relevant parameters for the actual vibration profile. the next hours or even days. Thus, understanding what happens We showed that launch effects and especially the combined during the launch is required to optimize the experimental static g-loads and dynamic vibration, based on our findings parameters. concerning expression of five early response gene’s expressions Overall, our results indicate that a relatively short exposure to can be more important, and long lasting than previously expected. hypergravity and / or vibration can elicit short-term but also long- Ideally, any space-flight experiment should be exposed to such lasting cellular responses on a genetic and likely proteomic level. launch loads and these tests should be made part of the standard Even if effects of either static g loads or vibration might have no or flight-related requirements tests an experiment has to go through little effect separately, paradigms such as stochastic residence before an actual study in real microgravity may be performed and 39,40 might transpose sub-threshold responses to a relevant level .It produce relevant results. would be interesting to explore the nature of the cellular or tissue responses due to vibration. Would the effects be the result of METHODS organelle intracellular replacements like the relatively heavier nucleus or, also depending on the compliance of the experiment Planarian culture and exposure to hypergravity and/or vibration volume, a deformation of the whole-cell/tissue body due to Asexual planarians from a clonal strain of Schmidtea mediterranea BCN-10 inertial gravitational shear . In this respect, it is worth mentioning were maintained at 20 °C in planarian artificial medium (PAM) water, as that yki as the effector of the Hippo pathway, which is involved in previously described . Animals were fed with veal liver and starved for at least one week before beginning the experiments. Animals were force transduction of the cellular environment to the nucleus. It transported from Barcelona/Spain to ESA-ESTEC Noordwijk/the Nether- has been demonstrated that a direct force on to the cell leads to lands in PAM water using 50 mL falcon tubes. nuclear translocation of YAP which is the yki homolog in To study the regeneration process in planarians after exposure to vertebrates . hypergravity and/or vibration animals were amputated (head and tail) one The better experimental design in gravity-related space day before the exposure. The day after trunk fragments were loaded into research is to apply an on-board 1 g centrifuges to control for T25 flasks (day 1 of regeneration) (Fig. 1a). Four groups of animals were any spaceflight related effects such as radiation and launch . analyzed: planarians at 1 g without vibration (control), planarians at four However, based on current results also the factor time, which is times Earth gravity static accelerations without vibration (4 g), planarians at required to fade out launch effects, should also be taken into 1 g with dynamic g-loads (vibration), and planarians at 4 g with vibration npj Microgravity (2020) 25 Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA N. de Sousa et al. (Fig. 1B). Three flasks per condition (three replicates), were included with 5 study we applied that same profile to test the biological responses. The planarians per flask. RNA was extracted from those animals immediately total load experienced by the samples is 11.3 G in the frequency range rms after the exposure (0 h) and 4 days after (4d). between 20 and 2000 Hz (Table 1, Fig. 5b). These vibration levels are also comparable to the acceptance levels profile of the Generalized Random Vibration Test Levels Components (GELV) for payloads of 22.7 kg (50-lb) or Simulation of rocket launch less with have an overall G of 10.0 as are set in NASA standards . rms Planarians were amputated (head and tail) one day before the exposure to The vibration was applied for only one of the three orthogonal axes and launch-related mechanical loads. The day after, trunk fragments were was slightly modified because the shaker could not output the force loaded into T25 flasks (day 1 of regeneration). Three T25 flasks were required by the profile at higher g levels. In the range from 150 to 600 Hz included per condition, and 5 planarians were loaded into each flask. The 2 we did lower the power from 0.16 to 0.13 g /Hz. The force was lessened by setup includes the Large Diameter Centrifuge (LDC) (Fig. 5a ref. ), to ~20 Newton. Due to the unorthodox application of an actuator inside a simulate hypergravity (4 g) and a vibration system, which was bolted to the centrifuge, and despite the slight adaptation we made, the high vibration floor plate of one of the gondolas (Fig. 2). The hardware components of at 4 g ran for 240 s (4 min) at maximum intensity and stopped the set-up included the actual shaker model 2075E, a linear power automatically due to reaching the over-heating settings of the system. amplifier model 2050E09 both from The Modal Shop (TMS, Cincinnati, OH, We immediately restarted the actuator set-up to run for another 270 s USA), a front-end 8-channel data acquisition system (LMS / Siemens (4.5 min) in order to complete the full launch time simulation of SCADAS), a cooling system (Asynchronous Motors Cl. 71\2), and a laptop to 8.5 minutes. control the shaker with the companies dedicated control software. To fix the flasks with planarians on the shaker, an aluminum plate wrapped in a thin rubber sheet was used. The rubber sheet impeded the movement of Planarian RNA extraction the flasks along the metal plate. Planarians were subjected to vibration and To perform the transcriptomic analysis through quantitative real-time PCR static hypergravity separately or simultaneously. Four groups of animals (qPCR) analysis, total RNA was extracted from the four groups of planarians were analyzed: planarians at 1 g without vibration (control), planarians at immediately (0 h) and after four days after exposure (4d). Three replicates four times Earth’s gravitational force static accelerations without vibration each containing a pool of five animals were analyzed per condition. RNA (4 g), planarians at 1 g with dynamic g-loads (vibration), and planarians at was extracted with Trizol (Invitrogen, Carlsbad, CA, USA), following the 4 g with vibration. The parameters used to simulate launch vibration are manufacturer’s instructions. RNA was quantified with a Nanodrop ND-1000 shown in Fig. 5b and Table 1. spectrophotometer (Thermo Scientific, Waltham, MA, USA) and cDNA was The applied vibration profile was based on the Code of Federal synthesized using SuperScript™ III Reverse Transcriptase (Thermo Scientific Regulations (CRF) of the Office of the Federal Register National Archives Waltham, MA, USA) following the manufacturer’s instructions. and Record Administration, for launches into space from the Federal Aviation Administration (FAA) . These random vibration tests are usually Quantitative real-time PCR performed at the payload level of assembly for proto-flight hardware that is subjected to a random vibration test to verify its ability to survive the lift-off Quantitative PCR’s were performed using Power SYBR™ Green PCR Master environment and also to provide a final workmanship vibration test. In this Mix (Applied Biosystems) on 7500 Real-Time PCR Systems (Applied Fig. 5 The six red-colored swing-out and one central gondola from the 8-meter diameter Large Diameter Centrifuge (LDC). a Both centrifuges are currently located at the technology center (ESTEC) from the European Space Agency ESA) in Noordwijk, the Netherlands. b The Acceleration Spectral Density (ASD) of the random vibration test specification profile from the 20 to 2000 Hz range as used for exposing planarians to a simulated launch load. This profile is based on the minimum workmanship levels for random vibration testing . The equipment set-up was divided over two gondolas where the actual actuator was placed in the outer gondola (see for further details Fig. 2). Table 1. Vibration parameters, frequency range and power spectral density, as actually used in the dynamic g exposure of planarians for a period of 8.5 min. Maximum Maximum Maximum Maximum force Frequency (Hz) Slope Amplitude acceleration (g) velocity (m/s) displacement (mm) (N) (dB/Oct) (g /Hz) High 48 0.378 1.42 213 20 0.021 Vibration 20–150 3 0.130 150–600 −6 0.130 600–2000 2000 0.014 Overall G = 11.28 rms From ref. Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA npj Microgravity (2020) 25 N. de Sousa et al. 14. Baert, P. et al. The potential (radio-)biological impact of launch vibration. Acta Table 2. Sequence of primers used in the qPCR experiments. Astronaut. 58, 456–463 (2006). 15. Cubano, L. A. & Lewis, M. L. Effect of vibrational stress and spaceflight on reg- Genes Primers (5′−3′) ulation of heat shock proteins hsp70 and hsp27 in human lymphocytes (Jurkat). J. Leukoc. Biol. 69, 755–761 (2001). runt1 TCCTATCGGAGACGGACA GCTTCACCGTTGACGAGT 16. Wehland, M. et al. The impact of altered gravity and vibration on endothelial cells egr1 GTTAGCGTGCCATTTTTGT AGCTGCATTGATAAGGCTTC during a parabolic flight. Cell Physiol. Biochem. 31, 432–451 (2013). 17. Gentile, L., Cebria, F. & Bartscherer, K. The planarian flatworm: an in vivo model fos GAACGACGCCAATTTCAG CGCTTCGAGTTGTTTGAGT for stem cell biology and nervous system regeneration. Dis. Model Mech. 4,12–19 jnk TCAACGAATCTCGGTCG AGTGAGCTCTCTTTCATCAACC (2011). yorkie ATTTGTGTCGACTCCATCC CCATTAAGACATGTCGACAAG 18. Saló, E. et al. Planarian regeneration: achievements and future directions after 20 years of research. Int. J. Dev. Biol. 53, 1317–1327 (2009). piwi ATCCTATGGCACCGAATGAG CCCTTATGCACCTTTCCAAC 19. Baguñà, J. The planarian neoblast: the rambling history of its origin and some current black boxes. Int. J. Dev. Biol. 56,19–37 (2012). 20. Rink, J. C. Stem cell systems and regeneration in planaria. Dev. Genes evolution 223,67–84 (2013). Biosystems) by denaturation at 95 °C for 10 min, followed by 40 cycles at 21. Felix, D. A. et al. It is not all about regeneration: Planarians striking power to stand 95 °C for 15 s and 60 °C for 40 s. Melting curve analyses were performed to starvation. Semin. Cell. Dev. Biol. 87, 169–181 (2019). verify the amplification specificity. Relative quantification of gene 22. Adell, T., Salo, E., van Loon, J. J. & Auletta, G. Planarians sense simulated micro- expression was performed according to the ΔΔ-CT method with at least gravity and hypergravity. Biomed. Res. Int 2014, 679672 (2014). two technical replicates per sample and at least two biological replicates. 23. de Sousa, N. et al. Transcriptomic analysis of planarians under simulated micro- The measured C values were normalized to the ubiquitously expressed gravity or 8 g demonstrates that alteration of gravity induces genomic and control mRNA smed-ura4. Student t-test was used for differential cellular alterations that could facilitate tumoral transformation. Int. J. Mol. Sci. 20, expression analysis between samples. The set of used primers in qPCR 720 (2019). analysis in provided in Table 2. 24. Gorgiladze, G. I. Regenerative capacity of the eye of Helix lucorum in a 163-day orbital flight aboard the International Space Station. Dokl. Biol Sci. 440, 316–319 Reporting summary (2011). 25. Lu, H. M. et al. Effects of large gradient high magnetic field (LG-HMF) on the long- Further information on experimental design is available in the Nature term culture of aquatic organisms: planarians example. Bioelectromagnetics 39, Research Reporting Summary linked to this paper. 428–440 (2018). 26. Morokuma, J. et al. Planarian regeneration in space: persistent anatomical, behavioral, and bacteriological changes induced by space travel. Regeneration 4, DATA AVAILABILITY 85–102 (2017). The data that support the findings of this study are available from the corresponding 27. Sandmann, T., Vogg, M. C., Owlarn, S., Boutros, M. & Bartscherer, K. The head- author upon reasonable request. regeneration transcriptome of the planarian Schmidtea mediterranea. Genome Biol. 12, R76 (2011). Received: 30 March 2020; Accepted: 11 August 2020; 28. Wenemoser, D., Lapan, S. W., Wilkinson, A. W., Bell, G. W. & Reddien, P. W. A molecular wound response program associated with regeneration initiation in planarians. Genes Dev. 26, 988–1002 (2012). 29. Almuedo-Castillo, M. et al. JNK controls the onset of mitosis in planarian stem cells and triggers apoptotic cell death required for regeneration and remodeling. PLoS Genet. 10, e1004400 (2014). REFERENCES 30. de Sousa, N., Rodríguez-Esteban, G., Rojo-Laguna, J. I., Saló, E. & Adell, T. Hippo signaling controls cell cycle and restricts cell plasticity in planarians. PLoS Biol. 16, 1. Harris, B. et al. International Space Station Utilization and Advancing Research in e2002399 (2018). Space. In AIAA SPACE 2013 Conference and Exposition. San Diego, CA, U.S.A., 31. Zanconato, F., Cordenonsi, M. & Piccolo, S. YAP/TAZ at the roots of cancer. Cancer American Institute of Aeronautics and Astronautics. (2013). Cell 29, 783–803 (2016). 2. Chang, Y.-W. The first decade of commercial space tourism. Acta Astronaut. 108, 32. Gozdecka, M. & Breitwieser, W. The roles of ATF2 (activating transcription factor 2) 79–91 (2015). in tumorigenesis. (Portland Press Limited, 2012). 3. Moro-Aguilar, R. The new commercial suborbital vehicles: an opportunity for 33. Tjandrawinata, R. R., Vincent, V. L. & Hughes-Fulford, M. Vibrational force alters scientific and microgravity research. Microgravity Sci. Technol. 26, 219–227 (2014). mRNA expression in osteoblasts. FASEB J. 11, 493–497 (1997). 4. Cottin, H. et al. Space as a tool for astrobiology: review and recommendations for 34. Kumei, Y., Nakajima, T., Sato, A., Kamata, N. & Enomoto, S. Reduction of G1 phase experimentations in earth orbit and beyond. Space Sci. Rev. 209,83–181 (2017). duration and enhancement of c-myc gene expression in HeLa cells at hyper- 5. Huang, B., Li, D. G., Huang, Y. & Liu, C. T. Effects of spaceflight and simulated gravity. J. Cell Sci. 93, 221–226 (1989). microgravity on microbial growth and secondary metabolism. Mil. Med. Res 5,18 35. Nose, K. & Shibanuma, M. Induction of early response genes by hypergravity in (2018). cultured mouse osteoblastic cells (MC3T3-E1). Exp. Cell Res. 211, 168–170 (1994). 6. Horneck, G., Klaus, D. M. & Mancinelli, R. L. Space microbiology. Microbiol. Mol. 36. de Groot, R. P. et al. Microgravity decreases c-fos induction and serum response Biol. Rev. 74, 121–156 (2010). element activity. J. Cell Sci. 97,33–38 (1990). 7. Becker, J. L. & Souza, G. R. Using space-based investigations to inform cancer 37. Bacabac, R. G. et al. Bone cell responses to high-frequency vibration stress: does research on Earth. Nat. Rev. Cancer 13, 315–327 (2013). the nucleus oscillate within the cytoplasm? FASEB J. 20, 858–864 (2006). 8. Beysens, D. A. & van Loon, J. in Generation and Applications of Extra-Terrestrial 38. Lützenberg, R. et al. Pathway analysis hints towards beneficial effects of long- Environments on Earth (eds Daniel A Beysens & JJWA van Loon) Ch. 1, 5–9 (Rivers term vibration on human chondrocytes. Cell. Physiol. Biochem. 47, 1729–1741 Publishers, 2015). (2018). 9. Najrana, T. & Sanchez-Esteban, J. Mechanotransduction as an adaptation to 39. Bacabac, R. G., Van Loon, J. J., Smit, T. H. & Klein-Nulend, J. Noise enhances the gravity. Front. Pediatr. 4, 140 (2016). rapid nitric oxide production by bone cells in response to fluid shear stress. 10. Manzano, A. et al. Novel, Moon and Mars, partial gravity simulation paradigms Technol. Health Care 17,57–65 (2009). and their effects on the balance between cell growth and cell proliferation during 40. Van Loon, J. J. Micro-gravity and mechanomics. Gravit. Space Res. 20,3–17 (2007). early plant development. npj Microgravity 4, 9 (2018). 41. van Loon, J. J., Folgering, E. H., Bouten, C. V., Veldhuijzen, J. P. & Smit, T. H. Inertial 11. Fitzgerald, J. & Hughes-fulford, M. Mechanically induced c-fos expression is shear forces and the use of centrifuges in gravity research. What is the proper mediated by cAMP in MC3T3-E1 osteoblasts. FASEB J. 13, 553–557 (1999). control?. J. Biomech. Eng. 125, 342–346 (2003). 12. Kopp, S. et al. Thyroid cancer cells in space during the TEXUS-53 sounding rocket 42. Elosegui-Artola, A. et al. Force triggers YAP nuclear entry by regulating transport mission–The THYROID Project. Sci. Rep. 8, 10355 (2018). across nuclear pores. Cell 171, 1397–1410 (2017). 13. Ulbrich, C. et al. Differential gene regulation under altered gravity conditions in 43. Van Loon, J. in Biology in Space and Life on Earth. Effects of Spaceflight on Bio- follicular thyroid cancer cells: relationship between the extracellular matrix and logical Systems (ed. E. Brinckmann) 17–32 (John Wiley and Sons Ltd., 2007). the cytoskeleton. Cell Physiol. Biochem. 28, 185–198 (2011). npj Microgravity (2020) 25 Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA N. de Sousa et al. 44. Guntermann, A. Untersuchungen zellulärer Proteinphosphorylierungsmuster pri- AUTHOR CONTRIBUTIONS märer Osteoblasten nach Hypergravitationsbelastung PhD thesis, Philipps-Uni- N.d.S., J.I.R.-L., E.S., T.A.: set-up and analyzed the data from the planarian experiments; versität Marburg, (2002). G.A.: overall PI of planarian study; M.C., J.V.: set-up and operation vibration study; J.J. 45. Pletser, V. & Kumei, Y. in Generation and Applications of Extra-Terrestrial Environ- W.A.v.L.: initiation of this particular launch load study, set-up and operations of the ments on Earth (eds Daniel, A. B. & Jack, JWA v. L.) 61–73 (Rivers Publishers, 2015). LDC centrifuge. All authors discussed the results and revised and edited the paper. 46. von Kampen, P., Kaczmarczik, U. & Rath, H. J. The new drop tower catapult system. Acta Astronaut. 59, 278–283 (2006). 47. Blue Origin. New Shepard Payload User’s Guide. Revision E NSPM-MAD002. Texas, COMPETING INTERESTS USA, Blue Origin Texas, LLC. 98 (2018). The authors declare no competing interests. 48. Virgin Galactic. SpaceShipTwo: An Introductory Guide for Payload Users. Santa Fe, New Mexico, USA, Virgin Galactic. Revision Number: WEB005:34 (2016). 49. Taylor, F. W. et al. Challenges and Opportunities Related to Landing the Dream ADDITIONAL INFORMATION Chaser® Reusable Space Vehicle at a Public-Use Airport. Space Traffic Manage- Supplementary information is available for this paper at https://doi.org/10.1038/ ment Conference, Embry-Riddle Aeronautical University, Daytona Beach, FL, USA s41526-020-00115-7. (2014). 50. Fedele, A. et al. The Space Rider Programme: end user’s needs and payload Correspondence and requests for materials should be addressed to J.J.W.A.v.L. applications survey as driver for mission and system definition. Acta Astronautica 152, 534–541 (2018). Reprints and permission information is available at http://www.nature.com/ 51. de Sousa, N. & Adell, T. Maintenance of Schmidtea mediterranea in the Labora- reprints tory. Bio-Protocol. 8,1–16 (2018). 52. van Loon, J. J. et al. The large diameter centrifuge, LDC, for life and physical Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims sciences and technology. Life in Space for Life on Earth, Anger, France, SP-663, ESA in published maps and institutional affiliations. Communication Production Office (2008). 53. Code of Federal Regulations, C. Vol. App. E 667, Table E417.611-661, Minimum Workmanship (Department of Transportation (DOT)) (2012). Open Access This article is licensed under a Creative Commons 54. NASA, G. S. F. C. in For GSFC Flight Programs and Projects Vol. GSFC-STD-7000A Attribution 4.0 International License, which permits use, sharing, GSFC-STD-7000A (NASA GSFC Technical Standards Program, Greenbelt, 2013). adaptation, distribution and reproduction in any medium or format, as long as you give 55. Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real- appropriate credit to the original author(s) and the source, provide a link to the Creative time quantitative PCR and the 2− ΔΔCT method. Methods 25, 402–408 (2001). Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the ACKNOWLEDGEMENTS article’s Creative Commons license and your intended use is not permitted by statutory We appreciate the assistance of Mr. Alan Dowson at ESA-ESTEC-TEC-MMG during the regulation or exceeds the permitted use, you will need to obtain permission directly various campaigns. This work was supported by BFU2017-83755-P from Ministerio de from the copyright holder. To view a copy of this license, visit http://creativecommons. Ciencia, Innovación y Universidades (Spain) and grant 2017SGR-1455 from AQU org/licenses/by/4.0/. (Generalitat de Catalunya) to T.A. and E.S. The study was also possible though an ESA CORA grant; contract no. 4000109540/13/NL/PG/pt and for JvL via an ESA contract 4000107455/12/NL/PA. © The Author(s) 2020 Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA npj Microgravity (2020) 25

Journal

npj Microgravity – Springer Journals

Published: Sep 8, 2020

There are no references for this article.