Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Notch signaling in astrocytes mediates their morphological response to an inflammatory challenge

Notch signaling in astrocytes mediates their morphological response to an inflammatory challenge In the nervous system, Notch pathway has a prominent role in the control of neuronal morphology and in the determination of the astrocyte fate. However, the role of Notch in morphological astrocyte plasticity is unknown. Here, we have explored the role of Notch activity on the morphological reactivity of primary astrocytes in response to LPS, an inflammatory stimulus. We found that LPS induces reactive astrocyte morphology by the inhibition of Notch signaling via NFκB activation and Jagged upregulation. In contrast, IGF-1, an anti-inflammatory molecule, inhibits LPS- induced reactive astrocyte morphological phenotype by enhancing Notch signaling through the inhibition of NFκB and the activation of MAPK. Therefore, Notch signaling pathway emerges as a mediator of the regulation of astrocyte morphology by inflammatory and anti-inflammatory stimuli. Introduction astrocytes . Although hypertrophy of astrocytes has been Reactive astrogliosis involves several processes that profusely studied, the signaling mechanisms that regulate 1–4 astrocytes undergo under pathological conditions . The morphological aspects of reactive astrogliosis remain unclear. alterations suffered by reactive astrocytes vary with the nature and severity of the insult. Modest metabolic sti- Notch1 receptor and ligands, Delta-like-1 (Dll-1) and mulus, infections, inflammatory processes or mild trauma Jaggeg-1 (Jag-1), have been extensively studied in relation 6–8 induce moderate reactive astrogliosis characterized by with cell fate specification of neurons , vascular smooth 9 10 changes in the molecular expression of pro-inflammatory muscle cells , pancreatic endocrine cells , and astro- 11,12 cytokines together with cellular hypertrophy. However, in cytes . In addition, Notch signaling regulates the severe central nervous system (CNS) injury models, expression of molecules involved in the regulation of cell 13,14 astrogliosis also involves cell proliferation and scar morphology in developing neurons . The canonical formation . trans-activation of the Notch pathway starts with the Astrocytic hypertrophy of reactive astrocytes is char- binding of the extracellular domain of the ligand to the acterized by an increase in the number, thickness, and extracellular domain of the receptor expressed in an length of the main cellular processes, which also present a adjacent cell. This allows a conformational change in the greater content in GFAP bundles than in nonreactive receptor that favors its cleavage by metalloproteases and by the enzymatic complex γ-secretase, resulting in the release of the intracellular domain of Notch (NICD), the Correspondence: Maria-Angeles Arevalo (arevalo@cajal.csic.es) active fragment of the receptor. NICD is then translocated Instituto Cajal, Consejo Superior de Investigaciones Científicas (CSIC), Madrid, into the cell nucleus, where it initiates the transcription of Spain CIBER de Investigación Biomédica en Red de Fragilidad y Envejecimiento Notch target genes, mainly hairy and enhancer of 6,15 Saludable (CIBERFES), Instituto de Salud Carlos III, Madrid, Spain split (HES)-1 and 5 , the main effectors of the pathway Full list of author information is available at the end of the article. in the CNS . Hes-1 and Hes-5 play a crucial role in These authors contributed equally: Estefania Acaz-Fonseca, Ana Ortiz-Rodriguez. Edited by N. Barlev © The Author(s) 2019 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to theCreativeCommons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Official journal of the Cell Death Differentiation Association 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 2 of 14 neurogenesis, gliogenesis, neuritogenesis as well as Moreover, this LPS dose induced changes in astrocyte 17–19 in the development of sensory organs . In the morphology that are compatible with an increased reac- adult brain, Notch is involved in long-term memory , tivity. Thus, as shown in Fig. 1e, the percentage of cells 8 21 dendritic plasticity , synaptic plasticity , and postnatal with bipolar and stellate shapes was higher in the cultures neurogenesis . treated with LPS than in the control conditions. There- Even if Notch functions in differentiated glial cells have fore, we established a model that at least mimics some of the main components of reactive astrogliosis by exposing not been deeply investigated, it is clear that it plays a role in neuroinflammation. For instance, Notch regulates primary cultures of cortical astrocytes to 500 ng/mL LPS microglia activation and pro-inflammatory cytokine for 24 h. 23,24 release by its interaction with NFκB . It has also been shown that hypertrophic astrocytes express Jag-1 in vivo Notch signaling is regulated by LPS in astrocytes and that the intermediate filaments GFAP and vimentin To determine the possible implication of the Notch control Notch pathway activity in astrocytes . Further- signaling pathway in the changes induced by LPS in more, Notch pathway regulates proliferation in reactive astrocytes, we evaluated the mRNA expression of differ- 26,27 astrocytes surrounding an ischemic lesion . However, ent genes related with Notch signaling. LPS positively the implication of Notch signaling in the morphological regulated the transcription of the ligand Jagged-1 (Jag-1) changes experimented by reactive astrocytes has not been while significantly reduced the expression of the Notch-1 explored previously. receptor and the Notch-1 effector Hes-5 (Fig. 2a). In In the present study, we have assessed whether Notch contrast, LPS did not significantly affect the expression of signaling is involved in the activation of astrocytes by an Dll and Hes-1 (Fig. 2a). inflammatory challenge: the treatment with the bacterial endotoxin lipopolysaccharide (LPS). We have also NFκB activation is involved in the transcriptional explored whether Notch signaling in astrocytes is regu- regulation of Jag-1 and Hes-5 by LPS lated by insulin-like growth factor 1 (IGF-1), since this We had already demonstrated that the increase in the factor reduces the astrocytic response to inflammatory expression of pro-inflammatory cytokines by astrocytes in stimuli and their expression of inflammatory mediators response to LPS is mediated by NFκB activation . such as interleukin 6 (IL-6), tumor necrosis factor-α Accordingly, in our model, the NFκB inhibitor BAY-11, (TNF-α), interleukin-1β (IL-1β), toll-like receptor 4, and significantly reduced the effect of LPS on the transcription 28,29 iNOS of IL-6 and IP-10 (Fig. 2b, c). In addition, the upregulation of Jag-1 and the downregulation of Hes-5 induced by LPS Results were abrogated by this drug (Fig. 2d, e), indicating that the LPS induces a reactive inflammatory phenotype in primary transcriptional effect of LPS on Jag-1 and Hes-5 depends astrocytes on activation of NFκB. In contrast, the effect of LPS on Reactive astrogliosis is a set of changes that occur in Notch-1 transcription was not modified by BAY-11 astrocytes in response to CNS injury or disease. We (Fig. 2f). evaluated the use of mouse primary astrocyte cultures exposed to LPS during 24 h, as a model of in vitro Hes-5 downregulation by LPS in astrocytes is mediated by astrogliosis . The addition of LPS in concentrations a decrease in NICD ranging from 50 to 5000 ng/mL did not decrease cell We also evaluated the levels of the Notch intracellular viability, as assessed by a FDA test (Fig. 1a). In addition, domain (NICD), which is released when Notch is acti- immunocytochemistry of astrocytes treated with BrdU vated. We observed that the astrocytes stimulated with showed that LPS treatment did not change cell pro- LPS had lower amounts of NICD than control ones liferation (Fig. 1b). However, 100 and 500 ng/mL LPS (Fig. 3a). Furthermore, we transfected a NICD-expressing induced a significant increase in the optical density in the myc-tagged plasmid into primary astrocytes. Constitutive MTS test, while the dose of 5000 ng/mL LPS decreased expression of NICD generated an activated Notch phe- the optical density compared to the control group notype that was confirmed by a significant increase in (Fig. 1c). Based on the results of FDA test and of BrdU Hes-5 mRNA expression (Fig. 3b). Interestingly, NICD quantification, the changes observed in MTS test may overexpression prevented the LPS-induced Hes-5 tran- represent differences in cell metabolic activity induced by scriptional downregulation observed in control astrocytes, LPS treatment. clearly indicating that Hes-5 downregulation provoked by Stimulation of astrocytes with 500 ng/ml LPS also LPS in astrocytes relies upon Notch-1 processing and enhanced the expression of two of the main pro- NICD release (Fig. 3b). inflammatory factors released by reactive astrocytes: the NICD overexpression in astrocytes did not modify Jag-1 cytokine IL-6 and the chemokine IP-10 (Fig. 1d). mRNA expression under control conditions, nor Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 3 of 14 Fig. 1 LPS stimulation of primary astrocytes. a LPS stimulation (500 ng/mL) during 24 h preserves cell viability as it was evaluated by FDA fluorescence emission and b it does not modify cell proliferation analyzed by immunocytochemistry against BrdU. c MTS oxidation rate (mitochondrial respiration) is modified by LPS. * Significant differences (p < 0.05) versus control (Student’s t-test, n = 4). d LPS treatment induces the transcription of pro-inflammatory cytokines; ** significant differences (p < 0.01) versus control (Student’s t-test, n = 4). e Astrocytes exposed to LPS display a significant change in their morphology, transitioning from a polygonal shape towards more elongated (bipolar and stellate) shapes. Immunofluorescence images show an example of the three types of astrocytes morphology in cultures, after immunostaining with an antibody against GFAP. Graphs represent the percentage of each cell type in the culture. *significant differences (p < 0.05) versus control polygonal cells. $ # significant differences (p < 0.05) versus control bipolar cells. significant differences (p < 0.05) versus control stellate cells (Student’s t-test, n = 4) prevented its induction by LPS (Fig. 3c). Besides, the with polygonal morphology and a significant increase in addition of DAPT (the γ-secretase inhibitor) to the the proportion of cells with stellate morphology compared astrocytic cultures did not alter Jag-1 mRNA expression to control astrocytes (Fig. 4a). The morphological effect of (Fig. 3d), indicating that Jag-1 transcription is not under LPS was blocked in the NICD overexpressing astrocytes the control of Notch-1 receptor activation. (Fig. 4a), suggesting that Notch signaling mediates the effect of LPS on astrocyte morphology. Notch signaling is involved in the effect of LPS on In contrast to astrocyte morphology, the expression of astrocyte morphology IL-6 and IP-10 under basal conditions and after LPS sti- Astrocytes were also transfected with NICD-expressing mulation was not affected by overexpression of NICD in plasmid to determine whether Notch signaling is involved astrocytes (Fig. 4b, c). This suggests that canonical Notch- in the morphological effects of LPS on these cells. Over- 1 signaling does not mediate the expression of IL-6 and expression of NICD in astrocytes resulted in a significant IP-10 under basal conditions and does not mediate their increase in the proportion of cells with a polygonal upregulation by LPS. morphology and in a significant decrease in the propor- tion of bipolar cells compared to control astrocytes IGF-1 regulates Notch signaling and morphology in transfected with the empty vector (Fig. 4a). This suggests astrocytes that Notch signaling regulates astrocyte morphology IGF-1 is a neuroprotective factor that is known to under basal conditions. In addition, the treatment with reduce reactive astrogliosis by the inhibition of NFκBin 29,31,32 LPS of astrocytes transfected with the empty vector astrocytes . Since our previous results indicate that resulted in a significant decrease in the proportion of cells NFκB is involved in the regulation of Notch signaling, we Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 4 of 14 Fig. 2 LPS regulates Notch signaling in primary astrocytes. a LPS treatment induces the transcription of the ligand Jagged-1, while reduces the expression of the receptor Notch-1 and the effector Hes-5. *, **, *** significant differences (p < 0.05, p < 0.01, and p < 0.001) versus control (Student’s t- test, n = 4). b–e The NFκB inhibitor BAY-1 is able to significantly reduce the LPS-induced increase in the transcription of IL-6, IP-10, and Jag-1 (b–d) and decrease of Hes-5 (e). f LPS downregulation on Notch-1 transcription is not modified by BAY-11. Statistical significance was determined using one-way ANOVA and Bonferroni post hoc test; *, **, ***significant differences (p < 0.05, p < 0.01, and p < 0.001) versus control. significant differences (p < 0.05) versus LPS hypothesized that IGF-1 could regulate Notch signaling in Inhibition of the PI3K pathway with wortmannin did not astrocytes. significantly affect the action of IGF-1. However, the To explore this possibility, astrocyte cultures were blockade of the MAPK pathway with U0126 resulted in a treated with the growth factor for 24 h. In addition, some total inhibition of Hes5 expression (Fig. 5b) and NICD cultures were pre-treated for 4 h with NVP, a specific production (Fig. 5c). inhibitor of IGF-1R, and then stimulated with IGF-1 for Since our results indicate that Notch signaling mediates 24 h. The expression levels of Hes-5 mRNA were mea- the morphological changes induced by LPS on astrocytes sured by real-time PCR. IGF-1 increased the expression of and that IGF-1 regulates Notch signaling, we decided to Hes-5 (Fig. 5a) and NVP significantly reduced this effect, assess whether IGF-1 regulates astrocyte morphology. indicating that the effect of IGF-1 on the regulation of Fig. 5d shows that IGF-1 increased the proportion of Notch pathway is mediated, at least in part, by its binding astrocytes with a polygonal morphology and decreased to IGF-1R. the proportion of bipolar astrocytes. This effect is oppo- To test whether the PI3K or the MAPK pathways, which site to the effect of LPS and seems to depend on Notch are activated by IGF-1R, mediate the effect of IGF-1 on signaling since it was blocked by DAPT, indicating that it Notch signaling, we stimulated astrocytes in the presence depends on the γ-secretase activity. of selective inhibitors of these two signaling pathways. Astrocytes were pre-treated for 4 h with each inhibitor IGF-1 blocks the effect of LPS on Notch signaling and and then stimulated with IGF-1 for 24 h. Levels of Hes-5 morphology in astrocytes mRNA transcription were measured by real-time PCR Since IGF-1 exerted opposite effects to LPS on Notch (Fig. 5b) and the levels of NICD were measured by wes- signaling, we tested whether IGF-1 could counteract the tern Blot (Fig. 5c). IGF-1 significantly increased the levels effect of LPS on Notch signaling in astrocytes. Fig. 6a of Hes-5 mRNA (Fig. 5b) and the levels of NICD (Fig. 5c). shows that, in agreement with our previous experiments, Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 5 of 14 Fig. 3 Hes-5 downregulation by LPS in astrocytes is mediated by a decrease in NICD. a Representative immunoblot shows NICD expression levels in astrocytes cultures treated with LPS. Actin was used as a loading control. Statistical significance (p < 0.01) was determined using Student’s t- test, n = 7. b, c The influence of LPS on the expression of Hes-5 and Jag-1 determined by qPCR in astrocytes cultures overexpressing NICD. **, ***Significant differences (p < 0.01 and p < 0.001) versus control cultures that express myc-tag and significant difference (p < 0.05) versus control that express myc-NICD (Student’s t-test, n = 4). d Expression of Jag-1 determined by qPCR in cultures treated with DAPT the addition of IGF-1 to the astrocyte cultures increased expression (Fig. 6e) suggesting that the effect of IGF-1 on Hes-5 mRNA levels and abrogated the reduced expression Notch signaling depends on the γ-secretase activity. of Hes-5 induced by LPS. In addition, IGF-1 significantly As our results indicated that IGF-1 neutralizes the effect decreased the expression of Jag-1 and counteracted the of LPS on Notch signaling in astrocytes, we decided to upregulation of Jag-1 by LPS (Fig. 6b). assess whether IGF-1 was also able to block the changes Astrocytes treated with IGF-1 showed a striking induced by LPS on astrocyte morphology. Fig. 6f shows increase in NICD levels (Fig. 6c), indicating a strong that IGF-1 counteracted the effect of LPS on the pro- Notch activation. LPS was able to significantly reduce portion of astrocytes with polygonal and bipolar NICD levels in the astrocytes treated with IGF-1. How- morphology. ever, NICD levels in astrocytes treated with LPS and IGF- 1 were much higher than the levels in astrocytes treated Jag-1 depletion impairs the effect of LPS on the astrocyte with LPS alone. This indicates that Notch maintains a morphology high degree of activation in IGF-1 treated astrocytes even The above experiments show that astrocytes treated in the presence of LPS. Treatment of astrocytes with with LPS have higher levels of Jag-1 expression and more DAPT blocked the effect of IGF-1 on NICD levels reactive morphology. On the contrary, cultures treated (Fig. 6c), on Hes-5 expression (Fig. 6d) and on Jag-1 with IGF-1 present Jag-1 downregulation and more Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 6 of 14 Fig. 4 Notch activation counteracts the effect of LPS on astrocytes morphology but not on the transcription of pro-inflammatory cytokines. a Notch activation by overexpressing NICD in the culture, changes astrocyte morphology in the opposite way that LPS: increases the proportion of polygonal cells, decreases the proportion of bipolar cells and does not change the stellates. Overexpression of NICD rescues the phenotype to control values in LPS treated astrocytes. Statistical significance was determined using one-way ANOVA and Bonferroni post hoc test for each phenotype separately, *significant differences (p < 0.05) versus their respective control, n = 4. b, c Notch activity does not modulate pro- inflammatory cytokines expression and does not interact with the effect of LPS on their expression. ***significant differences (p < 0.001) versus $$$ control cultures that express myc-tag and significant differences (p < 0.001) versus control that express myc-NICD resting morphology. To directly assess the role of Jag-1 on Our results show that LPS decreases the expression of astrocyte morphology, we transfected astrocyte cultures Hes-5 and Notch-1 and increases the expression of Jag-1, with a specific Jag-1-siRNA. The silencing efficacy was but does not affect the expression of Dll. The increased confirmed measuring Jag-1 expression by real-time PCR expression of Jag-1 by LPS is in concordance with pre- (Fig. 7a) and by western blotting (Fig. 7b). We found that vious results that shown that Jag-1 is under the control of 33,34 silencing of Jag-1 expression had no effect on IL-6 the NFκB signaling pathway and that LPS activates (Fig. 7c) and IP-10 (Fig. 7d) mRNA levels, under basal NFκB in astrocytes by promoting the translocation of conditions and after LPS stimulation. In contrast, Jag-1 p65/NFκB subunit to the cell nucleus . silencing impaired the effect of LPS on astrocyte mor- Canonical Notch signaling is initiated by ligand binding phology (Fig. 7e). to the Notch receptor on neighboring cells, which leads to the proteolytic processing of the receptor and the release Discussion of NICD. Nevertheless, our experiments demonstrate that Our findings indicate that Notch signaling is involved in LPS induces changes in astrocyte morphology by blocking the reactive morphological changes of astrocytes in Notch signaling, while enhancing the mRNA expression response to a pro-inflammatory stimulus, such as LPS. of Jag-1. Jagged ligands have been described as inhibitory Indeed, our data suggest that the effects of LPS on or antagonistic for the activation of Notch signaling by astrocyte morphology depend on the upregulation of Jag- Dll . Several studies demonstrated that Dll and Jagged 1byNFκB. In turn, Jag-1 upregulation causes the may have opposite functions. In angiogenesis, activation downregulation of NICD, which mediates the change in of Notch by Dll4 inhibits tip cell selection . In contrast, astrocyte morphology. In contrast, Notch signaling is not Jagged-Notch signaling promotes tip cell selection and 35,37,38 involved in the upregulation of the pro-inflammatory sprouting by antagonizing Dll4-Notch signaling . molecules IL-6 and IP-10 in response to LPS. These findings clearly show that the balance between the Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 7 of 14 Fig. 5 IGF-1 regulates Notch signaling and morphology in astrocytes. a IGF-1-induced Hes-5 overexpression involves IGF-1R. b. c IGF-1 increases &&, Hes-5 transcription (b) and NICD production (c) through MAPK pathway. **, ***significant differences (p < 0.01 and p < 0.001) versus control cells. &&& significant differences (p < 0.01 and p < 0.001) versus IGF-1-treated cells. d To determine whether exogenous addition of IGF-1 is able to modify astrocyte morphology, primary cultures were treated with 100 nM IGF-1 alone or in the presence of DAPT. Graph represents the percentage of cell type in each condition. Statistical significance was determined using one-way ANOVA and Bonferroni post hoc test for each phenotype separately, **, &&& ***(p < 0.01 and p < 0.001) versus their respective control; (p < 0.001) versus IGF-1-treated astrocytes, n = 4. Note that the effect of IGF-1 on astrocyte morphology is similar to NICD expression and opposite to LPS treatment two Notch ligands is a key factor in cell fate definition and astrocytes, LPS was unable to modify the expression of in cell morphology acquisition. Inhibition of Notch sig- Hes-5, indicating that the effect of LPS on Notch activity naling by γ-secretase inhibitors or Dll blockade produces is produced by the canonical signaling pathway . Fur- hyperbranching in endothelial cells; however, Jagged thermore, Jag-1 silencing or NICD overexpression in inhibition decreases branching and reduces angiogen- astrocytes resulted in a resting cellular phenotype after 37,39 esis . The attenuation of Notch signaling induced by LPS stimulation, suggesting that increased Jag-1 expres- Jag-1 can be attributed to cis-inhibition by Jag-1 binding sion and the consequent reduction in Notch activity to the Notch receptor and inhibition of the signal medi- mediates the effect of LPS in the induction of reactive 40–43 ated Dll in receiver cell . morphology. Considering the different function of the two Notch The involvement of Notch signaling in the morphology ligands, the LPS-induced altered balance in the expression of astrocytes after LPS stimulation may be relevant for the of Jag-1 and Dll in astrocytes may explain that the mechanisms of reactive gliosis. Thus, reactive astrocytes increase in Jag-1 expression after LPS is associated with present hypertrophy of cell body and increase the thick- 5,44 lower levels of NICD and Hes-5, indicating an inhibition ness of their main cellular processes . Further studies of Notch signaling. When NICD was overexpressed in should determine whether Notch signaling is also Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 8 of 14 Fig. 6 IGF-1 counteracts the effect of LPS on Notch signaling and astrocyte morphology. a, b Expression levels of Hes-5 and Jag-1 in cortical astrocytes treated with IGF-1 alone or in the presence of LPS. c–e LPS and gamma-secretase activity mediate IGF-1-induced Noth-1 cleavage (c) and &, Hes-5 (d) and Jag-1 (e) transcription in cortical astrocytes in vitro. *, **, ***significant differences (p < 0.05, p < 0.01 and p < 0.001) versus control cells; &&& $$$ significant differences (p < 0.05 and p < 0.001) versus IGF-1-treated cells; significant difference (p < 0.001) versus LPS treated cells and % (p < 0.05) significant difference versus DAPT-treated cells (one-way ANOVA and Bonferroni post hoc test, n = 4). f IGF-1 is able to counteract the effect of LPS on astrocytes morphology. Graph represents the percentage of cell type in each condition. Statistical significance was determined using one-way $$ ANOVA and Bonferroni post hoc test for each phenotype separately, ***(p < 0.001) versus their respective control; (p < 0.01) versus LPS-treated astrocytes, n = 4 involved in the changes in morphology of microglia, production of cytokines by astrocytes involves the acti- 30,46,47 which upon stimulation changes from a ramified, quies- vation of the NFκB pathway . Thus, we may hypo- cent morphology to an amoeboid, activated thesize that NFκB stimulates neuroinflammation in morphology . reactive astrocytes by the upregulation of pro- In microglia cells, Notch signaling amplifies the pro- inflammatory molecules and, in parallel, by the upregu- inflammatory response by enhancing NFκB/ lation of Jag-1, which induces reactive morphological 23,24 p65 signaling , suggesting that both pathways syner- changes in astrocytes (Fig. 8a). gistically regulate the inflammatory function in activated IGF-1 regulates inflammation in a context-dependent microglia. In contrast, in astrocytes our findings indicate manner. In the brain, several studies showed anti- that this signaling pathway is not involved in the effect of inflammatory effects of IGF-1 acting on astrocytes and LPS on the expression of pro-inflammatory molecules. microglia and revealed that IGF-1 levels may be critical This further suggests that the regulation of Notch sig- for regulating the neuroinflammatory response . naling in astrocytes by LPS is downstream of NFκB acti- Experiments in vivo show that the level of IGF-1 increases vation since the inhibition of NFκB with BAY-11 blocked at the injury site, but at least part of it comes from the the upregulation of Jag-1 and the downregulation of Hes- periphery in response to brain damage . Following this 5 by LPS. Previous studies have shown that LPS-mediated paradigm, we analyzed the effect of exogenous IGF-1 in Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 9 of 14 Fig. 7 Jag-1 downregulation rescues the effect of LPS on astrocyte morphology but not on the transcription of pro-inflammatory cytokines. Astrocytes were transfected with a specific Jag-1 and a non-target siRNA, and then exposed to LPS. a, b Jag-1-siRNA significantly decreased both Jag-1 mRNA (a) and protein expression (b). c, d Jag-1 downregulation do not alter the expression of pro-inflammatory cytokines under either control or inflammatory conditions. *, ***significant differences (p < 0.05 and p < 0.001) versus control non-target siRNA; ^, ^^, ### ^^^^significant difference (p < 0.05, p < 0.01 and p < 0.001) versus control Jag-siRNA and (p < 0.001) significant difference versus non-target siRNA transfected cells (one-way ANOVA and Bonferroni post hoc test, n = 4). E. Jag-1 downregulation abolishes the effects of LPS on astrocyte morphology. Statistical significance was determined using one-way ANOVA and Bonferroni post hoc test for each phenotype separately, *, ***(p < 0.05 and p < 0.001) versus their respective control Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 10 of 14 So our results suggest that actions of IGF-1 on astrocytes involve both, blockade of NFκB pathway and activation of MAPK signaling (Fig. 8b). In summary, our findings demonstrate for the first time, that Notch signaling is involved in the morphological changes induced in astrocytes by inflammatory and anti- inflammatory factors, expanding the known roles of Notch to the regulation of astrocyte morphology. Materials and methods Animals Postnatal day 0 (PND0)–PND2 male and female CD1 mouse pups were raised in our in-house colony at the Cajal Institute. Male pups were distinguished from female pups by a larger genital papilla and longer anogenital distance. All the procedures applied to the animals used in this study were in accordance with the European Com- mission guidelines (2010/63/UE) and the Spanish reg- Fig. 8 Summary of the effects of LPS and IGF-1 on Notch ulation (R. D. 53/2013) on the protection of animals for signaling in astrocytes. a Inflammatory conditions in primary experimental use. These procedures were approved by our astrocytes: LPS activates NFκB that promotes the expression of (1) institutional animal care and use committee (Comité de molecules that generate inflammation and (2) the Notch ligand Jag-1 Ética de Experimentación Animal del Instituto Cajal) and that reduces Notch activity and consequently induce a reactive morphology in astrocytes. b Anti-inflammatory conditions in primary the Consejería del Medio Ambiente y Territorio (Comu- astrocytes: IGF-1 produces an increase of Notch activity by: (1) nidad de Madrid, PROEX 200/14). activating MAPK signaling pathway and (2) reducing Jag-1 NFκB- dependent expression. Both IGF-1 effects drive to enhance Hes-5 Cortical astrocyte cultures expression and result in a resting morphology in astrocytes Astrocytes were cultured from male and female PND0–PND2 pups (50% each). The brain was extracted, meninges were removed, and the cerebral cortex was astrocytes. Our findings indicate that Notch signaling in astrocytes also mediates their morphological transforma- isolated under a dissecting microscope and then tion induced by IGF-1. In contrast to LPS, IGF-1 induced mechanically dissociated and washed twice in Hank’s a significant decrease in the expression of Jag-1 and a balanced salt solution (Sigma-Aldrich, Tres Cantos, significant increase in the levels of NICD and the Madrid). After complete dissociation in Dulbecco’s expression of Hes-5. Thus, IGF-1 and LPS had opposite modified Eagle’s medium/Nutrient mixture F-12 effects on Notch signaling in astrocytes (activation and (DMEM/F-12) culture medium with phenol red (Sigma- inhibition, respectively). In agreement with this, IGF-1 Aldrich) containing 10% fetal bovine serum (FBS, Invi- and LPS exerted also opposite effects on astrocyte mor- trogen, Carlsbad, CA) and 1% antibiotic–antimycotic phology. Thus, IGF-1 decreased, while LPS increased, the (Invitrogen), the cells were filtered through a 40 μm nylon proportion of astrocytes with reactive morphology, an cell strainer (Corning Inc., Corning, NY). The cells were effect that was mediated by γ-secretase. In addition, IGF-1 centrifuged, resuspended in the same medium, and plated was able to counteract the effect of LPS on Notch sig- onto poly-L-lysine-coated 75-cm flasks at 37 °C and 5% naling and on astrocyte morphology. Since Jag-1 expres- CO . The medium was replaced after the first day in vitro sion is regulated by NFκB signaling (our present findings) and twice per week until the cells reached confluence and NFκB pathway is blocked by IGF-1 , we may hypo- (~7 days). Then, the cell cultures were shaken overnight at thesize that the action of IGF-1 on Notch signaling is 37 °C and 280 rpm on a tabletop shaker (Infors HT, upstream of NFκB. Nevertheless, the IGF-1 induced Bottmingen, Switzerland) in order to minimize oligo- decrease in Jag-1 expression is not enough to explain the dendrocyte and microglia contamination. The astrocytes huge accumulation of NICD generation and the change in were incubated with 0.5% trypsin (Sigma-Aldrich), cen- astrocyte morphology. Jag-1 mRNA downregulation in trifuged, resuspended in DMEM/F-12 with 10% FBS and astrocytes was achieved by siRNA and by IGF-1 treat- 1% antibiotic–antimycotic, and seeded in poly-L-lysine- ment, however, only the later was able to increase the coated 75-cm2 flasks at 37 °C and 5% CO2. When the percentage of cells displaying less reactive shapes. Block- cells reached confluence for the second time (~ after ade of MAPK pathway completely suppress IGF-1 pro- 5 days), the subculture process was repeated but the duction of NICD as well as increased expression of Hes-5. astrocytes were plated onto poly-L-lysine-coated plates (6, Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 11 of 14 24, or 48 wells) or glass coverslips using DMEM/F-12 with Proliferation assay 10% FBS and 1% antibiotic–antimycotic. Using this pro- Astrocytes were seeded in glass coverslips (pre-coated tocol we obtained cultures with less than 4% of Iba-1 with poly-l-lysine) at a density of 25,000 cells/cm and positive cells, checked by double immunocytochemistry exposed to a 30 min-pulse of BrdU (bromodeoxyuridine, with anti-Iba I (microglial marker) and anti-GFAP anti- 10 µM) in order to assess cell proliferation. BrdU bodies (astroglial marker). Fibroblast contamination was incorporation was detected by double immunocy- also assessed by immunocytochemistry using an anti-Thy tochemistry using antibodies against BrdU and GFAP. 1 antibody (against CD90, 1:500), but no staining was Briefly, paraformaldehyde-fixed cells were incubated detected. with 2 N HCl/ 0.5% triton X-100 during 30 min at room temperature. Then, pH was neutralized with sodium Cell treatments tetraborate and primary and secondary antibodies were When cells were confluent in the multiwell plates, they added. were rinsed once with pre-warmed PBS and then the treatments were applied in DMEM-F12 without additives. Transfections Cells were pre-treated with the inhibitory drugs (Table 1) Astrocytes were transfected at 60% of confluence using for 4 h, and then IGF-1 (100 nM), and/or LPS (500 ng/mL) the Effectene Transfection Reagent (Qiagen GmbH, Hil- were added to the culture medium for 24 h. den, Germany), following the manufacturer’s instructions. Cells were transfected with a pcDNA1 vector encoding a Cell viability assay myc epitope and NICD using the empty vector as The non-cytotoxic dose of LPS used for all the experi- control; other cultures were co-transfected with pmax- ments was set after the analyses of a dose-viability curve GFP plus small interfering RNA (siRNA) oligonucleotide using LPS at final concentrations from 50 to 5000 ng/mL targeted to Jag-1. After 20 h of expression time, cells were in the culture. To assess cell viability, we performed the treated with the indicated drugs for each assay during 24 fluorescein diacetate (FDA)/propidium iodide (PI) assay. h. Then the astrocytes were harvested and processed for Cells were seeded in 24-well plates and treated for 24 h real-time polymerase chain reaction (PCR) and western with increasing concentrations of LPS (in phenol red-free blot analysis or fixed in 4% paraformaldehyde in 0.1 M DMEM-F12 medium without additives). Just before the phosphate buffer for immunostaining. end of the treatment, cells were incubated for 50 min at SiRNA oligonucleotides were purchased from Applied 37 °C with FDA (100 μM) and PI (15 μM). Fluorescence at Biosystems/Ambion and the concentration was 30 nM 520 and 620 nm wavelength was measured in a plate during transfection. SiRNAs targeting Jag-1 was Silencer® reader (FluoStar OPTIMA, BMG Labtech, Germany). Select siRNA ID # s68530. A non-targeting siRNA was To evaluate the cells metabolic activity (mitochondrial used as negative control (Silencer® Select Negative Con- respiration), the 3-(4,5-dimethylthiazol-2-yl)-5-(3-car- trol #1 siRNA, catalog number 4390843). boxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay was performed with the same LPS Quantitative RT-PCR concentrations (50–5000 ng/mL). Astrocytes were plated Total RNA was extracted from cultures with Illustra in 48-well microplates and treated for 24 h with LPS at RNAspin Mini RNA isolation kit from GE Healthcare concentrations of 50, 100, 500, 1000, or 5000 μg/mL. After (Buckinghamshire, UK). First strand cDNA was pre- the addition of 20 μL of CellTiter 96 AQueous One pared from RNA using the Moloney murine leukemia Solution (Promega, Madison, USA), the plates were virus reverse transcriptase (Promega Corp., Madison, incubated for 4 h at 37 °C and 5 % CO . Absorbance at Wisconsin) following the manufacturer’s instructions. 490 nm wavelength was measured in a plate reader. Quantitative PCR reactions were carried out on an ABI Prism 7500 Sequence Detector (Applied Biosystems, Weiterstadt, Germany) using the TaqMan or Sybr Table 1 Inhibitory drugs Green Universal PCR Master Mix. TaqMan probe and primers for Hes-5 were Assay-on-Demand gene Target Inhibitor Concentration Supplier expression products (Applied Biosystems). Primer sequences for the rest of genes evaluated and control IGF-1R NVP 400 nM Cayman Chemical housekeeping gene 18S rRNA, were designed using PI3K Wortmannin 100 nM Calbiochem Primer Express (Applied Biosystems) (Table 2). All MEK 1/2 U1026 10 µM Cell Signaling reactions were done in duplicates, from at least 4 dif- γ-secretase DAPT 2,5 µM Calbiochem ferent cultures. Gene expression was normalized for 18S rRNA expression. The ΔΔCT method was used for NFκB BAY-11 10 µM Calbiochem relative quantification analysis. Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 12 of 14 Table 2 Primer sequences for real-time polymerase chain reaction Gene Symbol Forward 5´–3´ Reverse 5´–3´ 18S-rRNA CGCCGCTAGAGGTGAAATTCT CATTCTTGGCAAATGCTTTCG Hes-1 CCAGCCAGTGTCAACACGA AATGCCGGGAGCTATCTTTCT Notch-1 CCCTTGCTCTGCCTAACGC GGAGTCCTGGCATCGTTGG Dlk-1 AATGTCTGCAGGTGCCATGTT TGCACTGCCATGGTTCCTT Jag-1 TCAGGACACACAACTCGGAAGT CTCCTCTCTGTCTACCAGCGTATACA IGF-1 GTGATCTGAGGAGACTGGAGATGTACT TGAGTCTTGGGCATGTCAGTGT IL-6 GAAACCGCTATGAAGTTCCTCTCTG TGTTGGGAGTGGTATCCTCTGTGA IP-10 CAGGAGAATGAGGGCCATAGG CGGATTCAGACATCTCTGCTCAT Western blot Primary cultures were lysed in 150 µL of Laemmli buf- Table 3 Antibodies used fer, heated during 5 min at 100 °C and sonicated for 5 min. Antigen Host Dilution Source Solubilized proteins (30 µL) were resolved in 8–10% SDS- PAGE bis-acrylamide gels and transferred to nitrocellu- NICD, cleaved at Val Rabbit 1:500 Cell Signaling lose membranes (Trans-Blot turbo transfer pack, Biorad) in a semi-dry system (Trans-Blot Turbo Transfer System, Jagged-1 Rabbit 1:500 Santa Cruz Biorad). Membranes were blocked for 2 h in a 5% BSA- β-actin Mouse 1:5000 Sigma-Aldrich TTBS (138 mM NaCl, 25 mM Tris-HCl, pH 8.0 and 0.1% Tween-20) solution, and incubated overnight with the α-Tubulin Mouse 1:5000 Sigma-Aldrich primary antibodies (Table 3) at 4 °C under moderate Iba1 Rabbit 1:2000 Wako shaking. Anti-β-actin, anti-Tubulin and anti-GAPDH GFAP(GA5 clon) Mouse 1:500 Sigma-Aldrich mouse monoclonal antibodies were used as loading con- BrdU Mouse 1:50 Hybridoma Bank trols. All secondary antibodies were from Jackson Immuno Research (West Grove, PA, USA). Proteins were GFAP Rabbit 1:500 Dako visualized with a chemiluminescence detection reagent c-myc (9E10) Mouse 1:500 Roche according to the manufacturer’s instructions (Amersham, Thy-1 (against CD90) Mouse 1:500 Bio-Rad (Formerly AbD GE Healthcare Europe, Barcelona, Spain). The densito- Serotec) metric analysis of scanned films was performed with Anti-mouse-HRP Goat 1:10000 Jackson Laboratories ImageJ software (Maryland, USA. http://imagej.nih.gov/). Anti-rabbit-HRP Goat 1:10000 Jackson Laboratories Immunocytochemistry Anti-mouse Alexa 488 Goat 1:1000 Jackson Laboratories Cells were seeded in glass coverslips (pre-coated with Anti-rabbit Alexa 594 Goat 1:1000 Jackson Laboratories poly-l-lysine) at a density of 25,000 cells/cm . After the Anti-mouse Alexa 647 Goat 1:50 Invitrogen appropriate treatments, astrocytes were fixed for 20 min with 4% paraformaldehyde at room temperature and permeabilized for 4 min with 0.12% Triton-X plus 0.12% gelatin in PBS. Cells were then washed with PBS/gelatin Statistical analysis and incubated for 1 h with primary antibodies (Table 3). Data shown in the figures are the result of 4–10 inde- After washing in the same buffer, cells were incubated for pendent experiments and are presented as the mean ± 45 min at room temperature with the proper fluorescent standard error of the mean (SEM). Statistical analyses secondary antibodies (Table 3). For morphology assess- were carried out using SPSS Statistics 23 software (IBM, ment, GFAP-positive cells were classified into three dif- Armonk, NY). Gaussian distribution of data sets was ferent categories: Polygonal astrocytes were those assessed by Kolmogorov–Smirnov test. Statistical sig- without any cytoplasmic protrusions, Bipolar astrocytes nificance was evaluated by the unpaired Student´s T-test presented an elongated cell body or one thin and long for one to one comparisons, and by two-way analysis of protrusion, and Stellate astrocytes were those with a variance (ANOVA) followed by Bonferroni or Games- reduced cell body and three or more long ramifications Howell post hoc tests (depending on whether variances (Fig. 1e). were homogeneous or not, respectively) for multiple Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 13 of 14 comparisons. When an interaction between two factors 14. Salama-Cohen, P.,Arevalo,M.A., Meier, J., Grantyn, R. & Rodríguez-Tébar, A. NGF controls dendrite development in hippocampal neurons by binding to was not detected, data were split and each factor was p75(NTR) andmodulatingthe cellular targets of Notch. Mol. Biol. Cell. 16, analyzed by one-way ANOVA followed by Bonferroni or 339–347 (2005). Student’s t-test. The statistical significance level was set at 15. Kopan, R. & Ilagan, M. X. The canonical Notch signaling pathway: unfolding the activation mechanism. Cell 137,216–233 (2009). p < 0.05. 16. Davis,R.L.& Turner,D.L. Vertebratehairy andEnhancerofsplit related proteins: transcriptional repressors regulating cellular differentiation and Acknowledgements embryonic patterning. Oncogene 20,8342–8357 (2002). We thank Elisa Baides Rosell for excellent technical assistance. This work was 17. Fischer, A. & Gessler, M. Delta–Notch—and then? Protein interactions and supported by grants from Agencia Estatal de Investigación, Spain (grant proposed modes of repression by Hes and Hey bHLH factors. Nucleic Acids Res. number BFU2017-82754-R), Centro de Investigación Biomédica en Red de 35,4583–4596 (2007). Fragilidad y Envejecimiento Saludable (CIBERFES), Instituto de Salud Carlos III, 18. Hojo, M. et al. Glial cell fate specification modulated by the bHLH gene Hes5 Madrid, Spain and Fondos FEDER. in mouse retina. Development 127,2515–2522 (2000). 19. Kageyama, R.,Ohtsuka, T., Hatakeyama,J. & Ohsawa,R.Roles of bHLH genesin Author details neural stem cell differentiation. Exp. Cell Res. 306,343–348 (2005). Instituto Cajal, Consejo Superior de Investigaciones Científicas (CSIC), Madrid, 20. Costa, R. M., Honjo, T. & Silva, A. J. Learning and memory deficits in Notch Spain. CIBER de Investigación Biomédica en Red de Fragilidad y mutant mice. Curr. Biol. 13,1348–1354 (2003). Envejecimiento Saludable (CIBERFES), Instituto de Salud Carlos III, Madrid, 21. Dahlhaus, M. et al. Notch1 signaling in pyramidal neurons regulates synaptic Spain. Department of Cell Biology, Faculty of Biology, Universidad connectivity and experience-dependent modifications of acuity in the visual Complutense, Madrid 28040, Spain cortex. J. Neurosci. 28, 10794–10802 (2008). 22. Zhang, K. et al. Notch1 mediates postnatal neurogenesis in hippocampus Conflict of interest enhanced by intermittent hypoxia. Neurobiol. Dis. 64,66–78 (2014). The authors declare that they have no conflict of interest. 23. Cao,Q., Karthikeyan, A.,Dheen, S.T., Kaur,C.& Ling, E.A.Production of proinflammatory mediators in activated microglia is synergistically regulated by Notch-1, glycogen synthase kinase (GSK-3β)and NF-κB/p65 signalling. PLoS ONE 12, e0186764 (2017). Publisher’s note 24. Yao, L. et al. Notch-1 signaling regulates microglia activation via NF-κB Springer Nature remains neutral with regard to jurisdictional claims in pathway after hypoxic exposure in vivo and in vitro. PLoS ONE 8, e78439 published maps and institutional affiliations. (2013). 25. John, G. R. et al. Multiple sclerosis: re-expression of a developmental Received: 30 January 2019 Revised: 8 March 2019 Accepted: 18 March 2019 pathway that restricts oligodendrocyte maturation. Nat. Med. 8,1115–1121 (2002). 26. LeComte,M.D., Shimada, I. S.,Sherwin,C.&Spees, J. L. Notch1–STAT3–ETBR signaling axis controls reactive astrocyte proliferation after brain injury. Proc. Natl Acad.Sci.USA 112,8726–8731 (2015). 27. Shimada,I.S., Borders, A.,Aronshtam,A.&Spees, J. L. Proliferatingreactive References astrocytes are regulated by Notch-1 in the peri-infarct area after stroke. Stroke 1. Milos, P. & Michael, N. Astrocyte activation and reactive gliosis. Glia 50, 427–434 (2005). 42,3231–3237 (2011). 28. Park, S. E.,Dantzer,R., Kelley,K.W.&McCusker,R.H. Central adminis- 2. Robel, S.,Berninger,B.&Götz, M.The stem cell potentialofglia:lessons from tration of insulin-like growth factor-I decreases depressive-like behavior reactive gliosis. Nat. Rev. Neurosci. 12,88–104 (2011). and brain cytokine expression in mice. J. Neuroinflammation. 8,12 3. Sofroniew, M. V. Molecular dissection of reactive astrogliosis and glial scar (2011). formation. Trends in Neurosci. 32,638–647 (2009). 29. Bellini,M. J., Hereñú,C.B., Goya,R.G.& Garcia-Segura, L. M. Insulin-like growth 4. Acaz-Fonseca, E., Duran, J. C., Carrero, P., Garcia-Segura, L. M. & Arevalo, M. A. factor-I gene delivery to astrocytes reduces their inflammatory response to Sex differences in glia reactivity after cortical brain injury. Glia 63,1966–1981 lipopolysaccharide. J. Neuroinflammation. 8, 21 (2011). (2015). 30. Cerciat, M., Unkila, M., Garcia-Segura, L. M. & Arevalo, M. A. Selective estrogen 5. Wilhelmsson, U. et al. Redefining the concept of reactive astrocytes as cells receptor modulators decrease the production of interleukin‐6 and interferon‐ that remain within their unique domains upon reaction to injury. Proc. Natl γ‐inducible protein‐10 by astrocytes exposed to inflammatory challenge Acad. Sci. USA 103, 17513–17518 (2006). in vitro. Glia 58,93–102 (2010). 6. Mumm, J. S. & Kopan, R. Notch signaling: from the outside in. Dev. Biol. 228, 31. Pons, S. & Torres-Aleman, I. Insulin-like growth factor-I stimulates depho- 151–165 (2000). sphorylation of IκB through the serine phosphatase calcineurin (protein 7. Šestan, N., Artavanis-Tsakonas, S. & Rakic, P. Contact-dependent inhibition of phosphatase 2B). J. Biol. Chem. 275, 38620–38625 (2000). cortical neurite growth mediated by Notch signaling. Science 286,741–746 32. Fernandez,A.M., Garcia-Estrada,J., Garcia-Segura, L. M. & Torres-Aleman, I. (1999). Insulin-like growth factor I modulates c-fos induction and astrocytosis in 8. Breunig, J. J., Silbereis, J., Vaccarino, F. M., Šestan, N. & Rakic,P.Notch regulates response to neurotoxic insult. Neuroscience 76,117–122 (1996). cell fate and dendrite morphology of newborn neurons in the postnatal 33. Judy, B. et al. Rel/NF‐κB can trigger the Notch signaling pathway by inducing dentate gyrus. Proc. Natl. Acad. Sci. USA 104, 20558–20563 (2007). the expression of Jagged1, a ligand for Notch receptors. EMBO J. 18, 9. Boucher, J.,Gridley,T.&Liaw,L.Molecular pathways of Notchsignalingin 2803–2811 (1999). vascular smooth muscle cells. Front. Physiol. 3, 81 (2012). 34. Sierra, R. A. et al. Anti-Jagged immunotherapy inhibits MDSCs and overcomes 10. Kim, W., Shin, Y. K., Kim, B. J. & Egan, J. M. Notch signaling in pancreatic tumor-induced tolerance. Cancer Res. 77,5628–5638 (2017). endocrine cell and diabetes. Biochem. Biophys. Res. Commun. 392,247–251 35. Boareto, M., Jolly, M. K.,Ben-Jacob,E.& Onuchic, J. N. Jaggedmediatesdif- (2010). ferences in normal and tumor angiogenesis by affecting tip-stalk fate decision. 11. Weihong, G. et al. Notch signaling promotes astrogliogenesis via direct CSL‐ Proc. Natl Acad. Sci. USA 112, E3836–E3844 (2015). mediated glial gene activation. J. Neurosci. Res. 69,848–860 (2002). 36. Hellström, M. et al. Dll4 signalling through Notch1 regulates formation of tip 12. Martini,S.etal. ACriticalrolefor Sox9 in Notch‐induced astrogliogenesis and cells during angiogenesis. Nature 445,776–780 (2007). stem cell maintenance. Stem Cells 3,741–751 (2013). 37. Benedito, R. et al. The Notch ligands Dll4 and Jagged1 have opposing effects 13. Salama-Cohen, P., Arevalo, M. A., Grantyn, R. & Rodríguez-Tébar, A. Notch and on angiogenesis. Cell 137,1124–1135 (2009). NGF/p75NTR control dendrite morphology and the balance of excitatory/ 38. Gama-Norton, L. et al. Notch signal strength controls cell fate in the hae- inhibitory synaptic input to hippocampal neurones through Neurogenin 3. J. mogenic endothelium. Nat. Commun. 6, 8510 (2015). Neurochem. 97,1269–1278 (2006). Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 14 of 14 39. Pedrosa,A.R.etal. EndothelialJagged1 antagonizes Dll4 regulation of 45. Eng‐Ang, L. & Wai‐Chow, W. The origin and nature of ramified and amoeboid endothelial branching and promotes vascular maturation downstream of microglia: A historical review and current concepts. Glia 7,9–18 (1993). Dll4/Notch1. Arterioscler. Thromb. Vasc. Biol. 35, 1134–1146 (2015). 46. Akira, S. & Takeda, K. Toll-like receptor signalling. Nat. Rev. Immunol. 4,499–511 40. Cordle, J. et al. A Conserved face of the Jagged/Serrate DSL domain is (2004). involved in Notch trans-activation and cis-inhibition. Nat. Struct. Mol. Biol. 15, 47. Beutler, B. & Rietschel, E. T. Innate immune sensing and its roots: the story of 849–857 (2008). endotoxin. Nat. Rev. Immunol. 3,169–176 (2003). 41. Glittenberg, M., Pitsouli, C., Garvey, C.,Delidakis,C.&Bray,S. Role ofconserved 48. Labandeira-Garcia,J.L., Costa-Besada,M.A., Labandeira,C.M., Villar-Cheda,B.& intracellular motifs in Serrate signalling, cis‐inhibition and endocytosis. EMBO J. Rodríguez-Perez, A. I. Insulin-like growth factor-1 and neuroinflammation. 25,4697–4706 (2006). Front. Aging Neurosci. 9, e00365 (2017). 42. Sprinzak, D. et al. Cis interactions between Notch and Delta generate mutually 49. Santi, A., Genis, L. & Torres-Aleman, I. A coordinated action of blood-borne and exclusive signaling states. Nature 465,86–90 (2010). brain Insulin-like growth factor I in theresponsetotraumatic brain injury. 43. Nonneman, A. et al. Astrocyte-derived Jagged-1 mitigates deleterious Notch Cereb. Cortex 28,2007–2014 (2018). signaling in amyotrophic lateral sclerosis. Neurobiol. Dis. 119,26–40 (2018). 50. Nye, J. S., Kopan, R. & Axel, R. An activated Notch suppresses neurogenesis and 44. Anderson, M. A., Ao, Y. & Sofroniew, M. V. Heterogeneity of reactive astrocytes. myogenesis but not gliogenesis in mammalian cells. Development 120, Neurosci. Lett. 565,23–29 (2014). 2421–2430 (1994). Official journal of the Cell Death Differentiation Association http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Cell Death Discovery Springer Journals

Notch signaling in astrocytes mediates their morphological response to an inflammatory challenge

Download PDF
14 pages

Loading next page...
 
/lp/springer-journals/notch-signaling-in-astrocytes-mediates-their-morphological-response-to-R0YaTCzH9c

References (55)

Publisher
Springer Journals
Copyright
Copyright © 2019 by The Author(s)
Subject
Life Sciences; Life Sciences, general; Biochemistry, general; Cell Biology; Stem Cells; Apoptosis; Cell Cycle Analysis
eISSN
2058-7716
DOI
10.1038/s41420-019-0166-6
Publisher site
See Article on Publisher Site

Abstract

In the nervous system, Notch pathway has a prominent role in the control of neuronal morphology and in the determination of the astrocyte fate. However, the role of Notch in morphological astrocyte plasticity is unknown. Here, we have explored the role of Notch activity on the morphological reactivity of primary astrocytes in response to LPS, an inflammatory stimulus. We found that LPS induces reactive astrocyte morphology by the inhibition of Notch signaling via NFκB activation and Jagged upregulation. In contrast, IGF-1, an anti-inflammatory molecule, inhibits LPS- induced reactive astrocyte morphological phenotype by enhancing Notch signaling through the inhibition of NFκB and the activation of MAPK. Therefore, Notch signaling pathway emerges as a mediator of the regulation of astrocyte morphology by inflammatory and anti-inflammatory stimuli. Introduction astrocytes . Although hypertrophy of astrocytes has been Reactive astrogliosis involves several processes that profusely studied, the signaling mechanisms that regulate 1–4 astrocytes undergo under pathological conditions . The morphological aspects of reactive astrogliosis remain unclear. alterations suffered by reactive astrocytes vary with the nature and severity of the insult. Modest metabolic sti- Notch1 receptor and ligands, Delta-like-1 (Dll-1) and mulus, infections, inflammatory processes or mild trauma Jaggeg-1 (Jag-1), have been extensively studied in relation 6–8 induce moderate reactive astrogliosis characterized by with cell fate specification of neurons , vascular smooth 9 10 changes in the molecular expression of pro-inflammatory muscle cells , pancreatic endocrine cells , and astro- 11,12 cytokines together with cellular hypertrophy. However, in cytes . In addition, Notch signaling regulates the severe central nervous system (CNS) injury models, expression of molecules involved in the regulation of cell 13,14 astrogliosis also involves cell proliferation and scar morphology in developing neurons . The canonical formation . trans-activation of the Notch pathway starts with the Astrocytic hypertrophy of reactive astrocytes is char- binding of the extracellular domain of the ligand to the acterized by an increase in the number, thickness, and extracellular domain of the receptor expressed in an length of the main cellular processes, which also present a adjacent cell. This allows a conformational change in the greater content in GFAP bundles than in nonreactive receptor that favors its cleavage by metalloproteases and by the enzymatic complex γ-secretase, resulting in the release of the intracellular domain of Notch (NICD), the Correspondence: Maria-Angeles Arevalo (arevalo@cajal.csic.es) active fragment of the receptor. NICD is then translocated Instituto Cajal, Consejo Superior de Investigaciones Científicas (CSIC), Madrid, into the cell nucleus, where it initiates the transcription of Spain CIBER de Investigación Biomédica en Red de Fragilidad y Envejecimiento Notch target genes, mainly hairy and enhancer of 6,15 Saludable (CIBERFES), Instituto de Salud Carlos III, Madrid, Spain split (HES)-1 and 5 , the main effectors of the pathway Full list of author information is available at the end of the article. in the CNS . Hes-1 and Hes-5 play a crucial role in These authors contributed equally: Estefania Acaz-Fonseca, Ana Ortiz-Rodriguez. Edited by N. Barlev © The Author(s) 2019 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to theCreativeCommons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Official journal of the Cell Death Differentiation Association 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 2 of 14 neurogenesis, gliogenesis, neuritogenesis as well as Moreover, this LPS dose induced changes in astrocyte 17–19 in the development of sensory organs . In the morphology that are compatible with an increased reac- adult brain, Notch is involved in long-term memory , tivity. Thus, as shown in Fig. 1e, the percentage of cells 8 21 dendritic plasticity , synaptic plasticity , and postnatal with bipolar and stellate shapes was higher in the cultures neurogenesis . treated with LPS than in the control conditions. There- Even if Notch functions in differentiated glial cells have fore, we established a model that at least mimics some of the main components of reactive astrogliosis by exposing not been deeply investigated, it is clear that it plays a role in neuroinflammation. For instance, Notch regulates primary cultures of cortical astrocytes to 500 ng/mL LPS microglia activation and pro-inflammatory cytokine for 24 h. 23,24 release by its interaction with NFκB . It has also been shown that hypertrophic astrocytes express Jag-1 in vivo Notch signaling is regulated by LPS in astrocytes and that the intermediate filaments GFAP and vimentin To determine the possible implication of the Notch control Notch pathway activity in astrocytes . Further- signaling pathway in the changes induced by LPS in more, Notch pathway regulates proliferation in reactive astrocytes, we evaluated the mRNA expression of differ- 26,27 astrocytes surrounding an ischemic lesion . However, ent genes related with Notch signaling. LPS positively the implication of Notch signaling in the morphological regulated the transcription of the ligand Jagged-1 (Jag-1) changes experimented by reactive astrocytes has not been while significantly reduced the expression of the Notch-1 explored previously. receptor and the Notch-1 effector Hes-5 (Fig. 2a). In In the present study, we have assessed whether Notch contrast, LPS did not significantly affect the expression of signaling is involved in the activation of astrocytes by an Dll and Hes-1 (Fig. 2a). inflammatory challenge: the treatment with the bacterial endotoxin lipopolysaccharide (LPS). We have also NFκB activation is involved in the transcriptional explored whether Notch signaling in astrocytes is regu- regulation of Jag-1 and Hes-5 by LPS lated by insulin-like growth factor 1 (IGF-1), since this We had already demonstrated that the increase in the factor reduces the astrocytic response to inflammatory expression of pro-inflammatory cytokines by astrocytes in stimuli and their expression of inflammatory mediators response to LPS is mediated by NFκB activation . such as interleukin 6 (IL-6), tumor necrosis factor-α Accordingly, in our model, the NFκB inhibitor BAY-11, (TNF-α), interleukin-1β (IL-1β), toll-like receptor 4, and significantly reduced the effect of LPS on the transcription 28,29 iNOS of IL-6 and IP-10 (Fig. 2b, c). In addition, the upregulation of Jag-1 and the downregulation of Hes-5 induced by LPS Results were abrogated by this drug (Fig. 2d, e), indicating that the LPS induces a reactive inflammatory phenotype in primary transcriptional effect of LPS on Jag-1 and Hes-5 depends astrocytes on activation of NFκB. In contrast, the effect of LPS on Reactive astrogliosis is a set of changes that occur in Notch-1 transcription was not modified by BAY-11 astrocytes in response to CNS injury or disease. We (Fig. 2f). evaluated the use of mouse primary astrocyte cultures exposed to LPS during 24 h, as a model of in vitro Hes-5 downregulation by LPS in astrocytes is mediated by astrogliosis . The addition of LPS in concentrations a decrease in NICD ranging from 50 to 5000 ng/mL did not decrease cell We also evaluated the levels of the Notch intracellular viability, as assessed by a FDA test (Fig. 1a). In addition, domain (NICD), which is released when Notch is acti- immunocytochemistry of astrocytes treated with BrdU vated. We observed that the astrocytes stimulated with showed that LPS treatment did not change cell pro- LPS had lower amounts of NICD than control ones liferation (Fig. 1b). However, 100 and 500 ng/mL LPS (Fig. 3a). Furthermore, we transfected a NICD-expressing induced a significant increase in the optical density in the myc-tagged plasmid into primary astrocytes. Constitutive MTS test, while the dose of 5000 ng/mL LPS decreased expression of NICD generated an activated Notch phe- the optical density compared to the control group notype that was confirmed by a significant increase in (Fig. 1c). Based on the results of FDA test and of BrdU Hes-5 mRNA expression (Fig. 3b). Interestingly, NICD quantification, the changes observed in MTS test may overexpression prevented the LPS-induced Hes-5 tran- represent differences in cell metabolic activity induced by scriptional downregulation observed in control astrocytes, LPS treatment. clearly indicating that Hes-5 downregulation provoked by Stimulation of astrocytes with 500 ng/ml LPS also LPS in astrocytes relies upon Notch-1 processing and enhanced the expression of two of the main pro- NICD release (Fig. 3b). inflammatory factors released by reactive astrocytes: the NICD overexpression in astrocytes did not modify Jag-1 cytokine IL-6 and the chemokine IP-10 (Fig. 1d). mRNA expression under control conditions, nor Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 3 of 14 Fig. 1 LPS stimulation of primary astrocytes. a LPS stimulation (500 ng/mL) during 24 h preserves cell viability as it was evaluated by FDA fluorescence emission and b it does not modify cell proliferation analyzed by immunocytochemistry against BrdU. c MTS oxidation rate (mitochondrial respiration) is modified by LPS. * Significant differences (p < 0.05) versus control (Student’s t-test, n = 4). d LPS treatment induces the transcription of pro-inflammatory cytokines; ** significant differences (p < 0.01) versus control (Student’s t-test, n = 4). e Astrocytes exposed to LPS display a significant change in their morphology, transitioning from a polygonal shape towards more elongated (bipolar and stellate) shapes. Immunofluorescence images show an example of the three types of astrocytes morphology in cultures, after immunostaining with an antibody against GFAP. Graphs represent the percentage of each cell type in the culture. *significant differences (p < 0.05) versus control polygonal cells. $ # significant differences (p < 0.05) versus control bipolar cells. significant differences (p < 0.05) versus control stellate cells (Student’s t-test, n = 4) prevented its induction by LPS (Fig. 3c). Besides, the with polygonal morphology and a significant increase in addition of DAPT (the γ-secretase inhibitor) to the the proportion of cells with stellate morphology compared astrocytic cultures did not alter Jag-1 mRNA expression to control astrocytes (Fig. 4a). The morphological effect of (Fig. 3d), indicating that Jag-1 transcription is not under LPS was blocked in the NICD overexpressing astrocytes the control of Notch-1 receptor activation. (Fig. 4a), suggesting that Notch signaling mediates the effect of LPS on astrocyte morphology. Notch signaling is involved in the effect of LPS on In contrast to astrocyte morphology, the expression of astrocyte morphology IL-6 and IP-10 under basal conditions and after LPS sti- Astrocytes were also transfected with NICD-expressing mulation was not affected by overexpression of NICD in plasmid to determine whether Notch signaling is involved astrocytes (Fig. 4b, c). This suggests that canonical Notch- in the morphological effects of LPS on these cells. Over- 1 signaling does not mediate the expression of IL-6 and expression of NICD in astrocytes resulted in a significant IP-10 under basal conditions and does not mediate their increase in the proportion of cells with a polygonal upregulation by LPS. morphology and in a significant decrease in the propor- tion of bipolar cells compared to control astrocytes IGF-1 regulates Notch signaling and morphology in transfected with the empty vector (Fig. 4a). This suggests astrocytes that Notch signaling regulates astrocyte morphology IGF-1 is a neuroprotective factor that is known to under basal conditions. In addition, the treatment with reduce reactive astrogliosis by the inhibition of NFκBin 29,31,32 LPS of astrocytes transfected with the empty vector astrocytes . Since our previous results indicate that resulted in a significant decrease in the proportion of cells NFκB is involved in the regulation of Notch signaling, we Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 4 of 14 Fig. 2 LPS regulates Notch signaling in primary astrocytes. a LPS treatment induces the transcription of the ligand Jagged-1, while reduces the expression of the receptor Notch-1 and the effector Hes-5. *, **, *** significant differences (p < 0.05, p < 0.01, and p < 0.001) versus control (Student’s t- test, n = 4). b–e The NFκB inhibitor BAY-1 is able to significantly reduce the LPS-induced increase in the transcription of IL-6, IP-10, and Jag-1 (b–d) and decrease of Hes-5 (e). f LPS downregulation on Notch-1 transcription is not modified by BAY-11. Statistical significance was determined using one-way ANOVA and Bonferroni post hoc test; *, **, ***significant differences (p < 0.05, p < 0.01, and p < 0.001) versus control. significant differences (p < 0.05) versus LPS hypothesized that IGF-1 could regulate Notch signaling in Inhibition of the PI3K pathway with wortmannin did not astrocytes. significantly affect the action of IGF-1. However, the To explore this possibility, astrocyte cultures were blockade of the MAPK pathway with U0126 resulted in a treated with the growth factor for 24 h. In addition, some total inhibition of Hes5 expression (Fig. 5b) and NICD cultures were pre-treated for 4 h with NVP, a specific production (Fig. 5c). inhibitor of IGF-1R, and then stimulated with IGF-1 for Since our results indicate that Notch signaling mediates 24 h. The expression levels of Hes-5 mRNA were mea- the morphological changes induced by LPS on astrocytes sured by real-time PCR. IGF-1 increased the expression of and that IGF-1 regulates Notch signaling, we decided to Hes-5 (Fig. 5a) and NVP significantly reduced this effect, assess whether IGF-1 regulates astrocyte morphology. indicating that the effect of IGF-1 on the regulation of Fig. 5d shows that IGF-1 increased the proportion of Notch pathway is mediated, at least in part, by its binding astrocytes with a polygonal morphology and decreased to IGF-1R. the proportion of bipolar astrocytes. This effect is oppo- To test whether the PI3K or the MAPK pathways, which site to the effect of LPS and seems to depend on Notch are activated by IGF-1R, mediate the effect of IGF-1 on signaling since it was blocked by DAPT, indicating that it Notch signaling, we stimulated astrocytes in the presence depends on the γ-secretase activity. of selective inhibitors of these two signaling pathways. Astrocytes were pre-treated for 4 h with each inhibitor IGF-1 blocks the effect of LPS on Notch signaling and and then stimulated with IGF-1 for 24 h. Levels of Hes-5 morphology in astrocytes mRNA transcription were measured by real-time PCR Since IGF-1 exerted opposite effects to LPS on Notch (Fig. 5b) and the levels of NICD were measured by wes- signaling, we tested whether IGF-1 could counteract the tern Blot (Fig. 5c). IGF-1 significantly increased the levels effect of LPS on Notch signaling in astrocytes. Fig. 6a of Hes-5 mRNA (Fig. 5b) and the levels of NICD (Fig. 5c). shows that, in agreement with our previous experiments, Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 5 of 14 Fig. 3 Hes-5 downregulation by LPS in astrocytes is mediated by a decrease in NICD. a Representative immunoblot shows NICD expression levels in astrocytes cultures treated with LPS. Actin was used as a loading control. Statistical significance (p < 0.01) was determined using Student’s t- test, n = 7. b, c The influence of LPS on the expression of Hes-5 and Jag-1 determined by qPCR in astrocytes cultures overexpressing NICD. **, ***Significant differences (p < 0.01 and p < 0.001) versus control cultures that express myc-tag and significant difference (p < 0.05) versus control that express myc-NICD (Student’s t-test, n = 4). d Expression of Jag-1 determined by qPCR in cultures treated with DAPT the addition of IGF-1 to the astrocyte cultures increased expression (Fig. 6e) suggesting that the effect of IGF-1 on Hes-5 mRNA levels and abrogated the reduced expression Notch signaling depends on the γ-secretase activity. of Hes-5 induced by LPS. In addition, IGF-1 significantly As our results indicated that IGF-1 neutralizes the effect decreased the expression of Jag-1 and counteracted the of LPS on Notch signaling in astrocytes, we decided to upregulation of Jag-1 by LPS (Fig. 6b). assess whether IGF-1 was also able to block the changes Astrocytes treated with IGF-1 showed a striking induced by LPS on astrocyte morphology. Fig. 6f shows increase in NICD levels (Fig. 6c), indicating a strong that IGF-1 counteracted the effect of LPS on the pro- Notch activation. LPS was able to significantly reduce portion of astrocytes with polygonal and bipolar NICD levels in the astrocytes treated with IGF-1. How- morphology. ever, NICD levels in astrocytes treated with LPS and IGF- 1 were much higher than the levels in astrocytes treated Jag-1 depletion impairs the effect of LPS on the astrocyte with LPS alone. This indicates that Notch maintains a morphology high degree of activation in IGF-1 treated astrocytes even The above experiments show that astrocytes treated in the presence of LPS. Treatment of astrocytes with with LPS have higher levels of Jag-1 expression and more DAPT blocked the effect of IGF-1 on NICD levels reactive morphology. On the contrary, cultures treated (Fig. 6c), on Hes-5 expression (Fig. 6d) and on Jag-1 with IGF-1 present Jag-1 downregulation and more Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 6 of 14 Fig. 4 Notch activation counteracts the effect of LPS on astrocytes morphology but not on the transcription of pro-inflammatory cytokines. a Notch activation by overexpressing NICD in the culture, changes astrocyte morphology in the opposite way that LPS: increases the proportion of polygonal cells, decreases the proportion of bipolar cells and does not change the stellates. Overexpression of NICD rescues the phenotype to control values in LPS treated astrocytes. Statistical significance was determined using one-way ANOVA and Bonferroni post hoc test for each phenotype separately, *significant differences (p < 0.05) versus their respective control, n = 4. b, c Notch activity does not modulate pro- inflammatory cytokines expression and does not interact with the effect of LPS on their expression. ***significant differences (p < 0.001) versus $$$ control cultures that express myc-tag and significant differences (p < 0.001) versus control that express myc-NICD resting morphology. To directly assess the role of Jag-1 on Our results show that LPS decreases the expression of astrocyte morphology, we transfected astrocyte cultures Hes-5 and Notch-1 and increases the expression of Jag-1, with a specific Jag-1-siRNA. The silencing efficacy was but does not affect the expression of Dll. The increased confirmed measuring Jag-1 expression by real-time PCR expression of Jag-1 by LPS is in concordance with pre- (Fig. 7a) and by western blotting (Fig. 7b). We found that vious results that shown that Jag-1 is under the control of 33,34 silencing of Jag-1 expression had no effect on IL-6 the NFκB signaling pathway and that LPS activates (Fig. 7c) and IP-10 (Fig. 7d) mRNA levels, under basal NFκB in astrocytes by promoting the translocation of conditions and after LPS stimulation. In contrast, Jag-1 p65/NFκB subunit to the cell nucleus . silencing impaired the effect of LPS on astrocyte mor- Canonical Notch signaling is initiated by ligand binding phology (Fig. 7e). to the Notch receptor on neighboring cells, which leads to the proteolytic processing of the receptor and the release Discussion of NICD. Nevertheless, our experiments demonstrate that Our findings indicate that Notch signaling is involved in LPS induces changes in astrocyte morphology by blocking the reactive morphological changes of astrocytes in Notch signaling, while enhancing the mRNA expression response to a pro-inflammatory stimulus, such as LPS. of Jag-1. Jagged ligands have been described as inhibitory Indeed, our data suggest that the effects of LPS on or antagonistic for the activation of Notch signaling by astrocyte morphology depend on the upregulation of Jag- Dll . Several studies demonstrated that Dll and Jagged 1byNFκB. In turn, Jag-1 upregulation causes the may have opposite functions. In angiogenesis, activation downregulation of NICD, which mediates the change in of Notch by Dll4 inhibits tip cell selection . In contrast, astrocyte morphology. In contrast, Notch signaling is not Jagged-Notch signaling promotes tip cell selection and 35,37,38 involved in the upregulation of the pro-inflammatory sprouting by antagonizing Dll4-Notch signaling . molecules IL-6 and IP-10 in response to LPS. These findings clearly show that the balance between the Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 7 of 14 Fig. 5 IGF-1 regulates Notch signaling and morphology in astrocytes. a IGF-1-induced Hes-5 overexpression involves IGF-1R. b. c IGF-1 increases &&, Hes-5 transcription (b) and NICD production (c) through MAPK pathway. **, ***significant differences (p < 0.01 and p < 0.001) versus control cells. &&& significant differences (p < 0.01 and p < 0.001) versus IGF-1-treated cells. d To determine whether exogenous addition of IGF-1 is able to modify astrocyte morphology, primary cultures were treated with 100 nM IGF-1 alone or in the presence of DAPT. Graph represents the percentage of cell type in each condition. Statistical significance was determined using one-way ANOVA and Bonferroni post hoc test for each phenotype separately, **, &&& ***(p < 0.01 and p < 0.001) versus their respective control; (p < 0.001) versus IGF-1-treated astrocytes, n = 4. Note that the effect of IGF-1 on astrocyte morphology is similar to NICD expression and opposite to LPS treatment two Notch ligands is a key factor in cell fate definition and astrocytes, LPS was unable to modify the expression of in cell morphology acquisition. Inhibition of Notch sig- Hes-5, indicating that the effect of LPS on Notch activity naling by γ-secretase inhibitors or Dll blockade produces is produced by the canonical signaling pathway . Fur- hyperbranching in endothelial cells; however, Jagged thermore, Jag-1 silencing or NICD overexpression in inhibition decreases branching and reduces angiogen- astrocytes resulted in a resting cellular phenotype after 37,39 esis . The attenuation of Notch signaling induced by LPS stimulation, suggesting that increased Jag-1 expres- Jag-1 can be attributed to cis-inhibition by Jag-1 binding sion and the consequent reduction in Notch activity to the Notch receptor and inhibition of the signal medi- mediates the effect of LPS in the induction of reactive 40–43 ated Dll in receiver cell . morphology. Considering the different function of the two Notch The involvement of Notch signaling in the morphology ligands, the LPS-induced altered balance in the expression of astrocytes after LPS stimulation may be relevant for the of Jag-1 and Dll in astrocytes may explain that the mechanisms of reactive gliosis. Thus, reactive astrocytes increase in Jag-1 expression after LPS is associated with present hypertrophy of cell body and increase the thick- 5,44 lower levels of NICD and Hes-5, indicating an inhibition ness of their main cellular processes . Further studies of Notch signaling. When NICD was overexpressed in should determine whether Notch signaling is also Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 8 of 14 Fig. 6 IGF-1 counteracts the effect of LPS on Notch signaling and astrocyte morphology. a, b Expression levels of Hes-5 and Jag-1 in cortical astrocytes treated with IGF-1 alone or in the presence of LPS. c–e LPS and gamma-secretase activity mediate IGF-1-induced Noth-1 cleavage (c) and &, Hes-5 (d) and Jag-1 (e) transcription in cortical astrocytes in vitro. *, **, ***significant differences (p < 0.05, p < 0.01 and p < 0.001) versus control cells; &&& $$$ significant differences (p < 0.05 and p < 0.001) versus IGF-1-treated cells; significant difference (p < 0.001) versus LPS treated cells and % (p < 0.05) significant difference versus DAPT-treated cells (one-way ANOVA and Bonferroni post hoc test, n = 4). f IGF-1 is able to counteract the effect of LPS on astrocytes morphology. Graph represents the percentage of cell type in each condition. Statistical significance was determined using one-way $$ ANOVA and Bonferroni post hoc test for each phenotype separately, ***(p < 0.001) versus their respective control; (p < 0.01) versus LPS-treated astrocytes, n = 4 involved in the changes in morphology of microglia, production of cytokines by astrocytes involves the acti- 30,46,47 which upon stimulation changes from a ramified, quies- vation of the NFκB pathway . Thus, we may hypo- cent morphology to an amoeboid, activated thesize that NFκB stimulates neuroinflammation in morphology . reactive astrocytes by the upregulation of pro- In microglia cells, Notch signaling amplifies the pro- inflammatory molecules and, in parallel, by the upregu- inflammatory response by enhancing NFκB/ lation of Jag-1, which induces reactive morphological 23,24 p65 signaling , suggesting that both pathways syner- changes in astrocytes (Fig. 8a). gistically regulate the inflammatory function in activated IGF-1 regulates inflammation in a context-dependent microglia. In contrast, in astrocytes our findings indicate manner. In the brain, several studies showed anti- that this signaling pathway is not involved in the effect of inflammatory effects of IGF-1 acting on astrocytes and LPS on the expression of pro-inflammatory molecules. microglia and revealed that IGF-1 levels may be critical This further suggests that the regulation of Notch sig- for regulating the neuroinflammatory response . naling in astrocytes by LPS is downstream of NFκB acti- Experiments in vivo show that the level of IGF-1 increases vation since the inhibition of NFκB with BAY-11 blocked at the injury site, but at least part of it comes from the the upregulation of Jag-1 and the downregulation of Hes- periphery in response to brain damage . Following this 5 by LPS. Previous studies have shown that LPS-mediated paradigm, we analyzed the effect of exogenous IGF-1 in Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 9 of 14 Fig. 7 Jag-1 downregulation rescues the effect of LPS on astrocyte morphology but not on the transcription of pro-inflammatory cytokines. Astrocytes were transfected with a specific Jag-1 and a non-target siRNA, and then exposed to LPS. a, b Jag-1-siRNA significantly decreased both Jag-1 mRNA (a) and protein expression (b). c, d Jag-1 downregulation do not alter the expression of pro-inflammatory cytokines under either control or inflammatory conditions. *, ***significant differences (p < 0.05 and p < 0.001) versus control non-target siRNA; ^, ^^, ### ^^^^significant difference (p < 0.05, p < 0.01 and p < 0.001) versus control Jag-siRNA and (p < 0.001) significant difference versus non-target siRNA transfected cells (one-way ANOVA and Bonferroni post hoc test, n = 4). E. Jag-1 downregulation abolishes the effects of LPS on astrocyte morphology. Statistical significance was determined using one-way ANOVA and Bonferroni post hoc test for each phenotype separately, *, ***(p < 0.05 and p < 0.001) versus their respective control Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 10 of 14 So our results suggest that actions of IGF-1 on astrocytes involve both, blockade of NFκB pathway and activation of MAPK signaling (Fig. 8b). In summary, our findings demonstrate for the first time, that Notch signaling is involved in the morphological changes induced in astrocytes by inflammatory and anti- inflammatory factors, expanding the known roles of Notch to the regulation of astrocyte morphology. Materials and methods Animals Postnatal day 0 (PND0)–PND2 male and female CD1 mouse pups were raised in our in-house colony at the Cajal Institute. Male pups were distinguished from female pups by a larger genital papilla and longer anogenital distance. All the procedures applied to the animals used in this study were in accordance with the European Com- mission guidelines (2010/63/UE) and the Spanish reg- Fig. 8 Summary of the effects of LPS and IGF-1 on Notch ulation (R. D. 53/2013) on the protection of animals for signaling in astrocytes. a Inflammatory conditions in primary experimental use. These procedures were approved by our astrocytes: LPS activates NFκB that promotes the expression of (1) institutional animal care and use committee (Comité de molecules that generate inflammation and (2) the Notch ligand Jag-1 Ética de Experimentación Animal del Instituto Cajal) and that reduces Notch activity and consequently induce a reactive morphology in astrocytes. b Anti-inflammatory conditions in primary the Consejería del Medio Ambiente y Territorio (Comu- astrocytes: IGF-1 produces an increase of Notch activity by: (1) nidad de Madrid, PROEX 200/14). activating MAPK signaling pathway and (2) reducing Jag-1 NFκB- dependent expression. Both IGF-1 effects drive to enhance Hes-5 Cortical astrocyte cultures expression and result in a resting morphology in astrocytes Astrocytes were cultured from male and female PND0–PND2 pups (50% each). The brain was extracted, meninges were removed, and the cerebral cortex was astrocytes. Our findings indicate that Notch signaling in astrocytes also mediates their morphological transforma- isolated under a dissecting microscope and then tion induced by IGF-1. In contrast to LPS, IGF-1 induced mechanically dissociated and washed twice in Hank’s a significant decrease in the expression of Jag-1 and a balanced salt solution (Sigma-Aldrich, Tres Cantos, significant increase in the levels of NICD and the Madrid). After complete dissociation in Dulbecco’s expression of Hes-5. Thus, IGF-1 and LPS had opposite modified Eagle’s medium/Nutrient mixture F-12 effects on Notch signaling in astrocytes (activation and (DMEM/F-12) culture medium with phenol red (Sigma- inhibition, respectively). In agreement with this, IGF-1 Aldrich) containing 10% fetal bovine serum (FBS, Invi- and LPS exerted also opposite effects on astrocyte mor- trogen, Carlsbad, CA) and 1% antibiotic–antimycotic phology. Thus, IGF-1 decreased, while LPS increased, the (Invitrogen), the cells were filtered through a 40 μm nylon proportion of astrocytes with reactive morphology, an cell strainer (Corning Inc., Corning, NY). The cells were effect that was mediated by γ-secretase. In addition, IGF-1 centrifuged, resuspended in the same medium, and plated was able to counteract the effect of LPS on Notch sig- onto poly-L-lysine-coated 75-cm flasks at 37 °C and 5% naling and on astrocyte morphology. Since Jag-1 expres- CO . The medium was replaced after the first day in vitro sion is regulated by NFκB signaling (our present findings) and twice per week until the cells reached confluence and NFκB pathway is blocked by IGF-1 , we may hypo- (~7 days). Then, the cell cultures were shaken overnight at thesize that the action of IGF-1 on Notch signaling is 37 °C and 280 rpm on a tabletop shaker (Infors HT, upstream of NFκB. Nevertheless, the IGF-1 induced Bottmingen, Switzerland) in order to minimize oligo- decrease in Jag-1 expression is not enough to explain the dendrocyte and microglia contamination. The astrocytes huge accumulation of NICD generation and the change in were incubated with 0.5% trypsin (Sigma-Aldrich), cen- astrocyte morphology. Jag-1 mRNA downregulation in trifuged, resuspended in DMEM/F-12 with 10% FBS and astrocytes was achieved by siRNA and by IGF-1 treat- 1% antibiotic–antimycotic, and seeded in poly-L-lysine- ment, however, only the later was able to increase the coated 75-cm2 flasks at 37 °C and 5% CO2. When the percentage of cells displaying less reactive shapes. Block- cells reached confluence for the second time (~ after ade of MAPK pathway completely suppress IGF-1 pro- 5 days), the subculture process was repeated but the duction of NICD as well as increased expression of Hes-5. astrocytes were plated onto poly-L-lysine-coated plates (6, Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 11 of 14 24, or 48 wells) or glass coverslips using DMEM/F-12 with Proliferation assay 10% FBS and 1% antibiotic–antimycotic. Using this pro- Astrocytes were seeded in glass coverslips (pre-coated tocol we obtained cultures with less than 4% of Iba-1 with poly-l-lysine) at a density of 25,000 cells/cm and positive cells, checked by double immunocytochemistry exposed to a 30 min-pulse of BrdU (bromodeoxyuridine, with anti-Iba I (microglial marker) and anti-GFAP anti- 10 µM) in order to assess cell proliferation. BrdU bodies (astroglial marker). Fibroblast contamination was incorporation was detected by double immunocy- also assessed by immunocytochemistry using an anti-Thy tochemistry using antibodies against BrdU and GFAP. 1 antibody (against CD90, 1:500), but no staining was Briefly, paraformaldehyde-fixed cells were incubated detected. with 2 N HCl/ 0.5% triton X-100 during 30 min at room temperature. Then, pH was neutralized with sodium Cell treatments tetraborate and primary and secondary antibodies were When cells were confluent in the multiwell plates, they added. were rinsed once with pre-warmed PBS and then the treatments were applied in DMEM-F12 without additives. Transfections Cells were pre-treated with the inhibitory drugs (Table 1) Astrocytes were transfected at 60% of confluence using for 4 h, and then IGF-1 (100 nM), and/or LPS (500 ng/mL) the Effectene Transfection Reagent (Qiagen GmbH, Hil- were added to the culture medium for 24 h. den, Germany), following the manufacturer’s instructions. Cells were transfected with a pcDNA1 vector encoding a Cell viability assay myc epitope and NICD using the empty vector as The non-cytotoxic dose of LPS used for all the experi- control; other cultures were co-transfected with pmax- ments was set after the analyses of a dose-viability curve GFP plus small interfering RNA (siRNA) oligonucleotide using LPS at final concentrations from 50 to 5000 ng/mL targeted to Jag-1. After 20 h of expression time, cells were in the culture. To assess cell viability, we performed the treated with the indicated drugs for each assay during 24 fluorescein diacetate (FDA)/propidium iodide (PI) assay. h. Then the astrocytes were harvested and processed for Cells were seeded in 24-well plates and treated for 24 h real-time polymerase chain reaction (PCR) and western with increasing concentrations of LPS (in phenol red-free blot analysis or fixed in 4% paraformaldehyde in 0.1 M DMEM-F12 medium without additives). Just before the phosphate buffer for immunostaining. end of the treatment, cells were incubated for 50 min at SiRNA oligonucleotides were purchased from Applied 37 °C with FDA (100 μM) and PI (15 μM). Fluorescence at Biosystems/Ambion and the concentration was 30 nM 520 and 620 nm wavelength was measured in a plate during transfection. SiRNAs targeting Jag-1 was Silencer® reader (FluoStar OPTIMA, BMG Labtech, Germany). Select siRNA ID # s68530. A non-targeting siRNA was To evaluate the cells metabolic activity (mitochondrial used as negative control (Silencer® Select Negative Con- respiration), the 3-(4,5-dimethylthiazol-2-yl)-5-(3-car- trol #1 siRNA, catalog number 4390843). boxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay was performed with the same LPS Quantitative RT-PCR concentrations (50–5000 ng/mL). Astrocytes were plated Total RNA was extracted from cultures with Illustra in 48-well microplates and treated for 24 h with LPS at RNAspin Mini RNA isolation kit from GE Healthcare concentrations of 50, 100, 500, 1000, or 5000 μg/mL. After (Buckinghamshire, UK). First strand cDNA was pre- the addition of 20 μL of CellTiter 96 AQueous One pared from RNA using the Moloney murine leukemia Solution (Promega, Madison, USA), the plates were virus reverse transcriptase (Promega Corp., Madison, incubated for 4 h at 37 °C and 5 % CO . Absorbance at Wisconsin) following the manufacturer’s instructions. 490 nm wavelength was measured in a plate reader. Quantitative PCR reactions were carried out on an ABI Prism 7500 Sequence Detector (Applied Biosystems, Weiterstadt, Germany) using the TaqMan or Sybr Table 1 Inhibitory drugs Green Universal PCR Master Mix. TaqMan probe and primers for Hes-5 were Assay-on-Demand gene Target Inhibitor Concentration Supplier expression products (Applied Biosystems). Primer sequences for the rest of genes evaluated and control IGF-1R NVP 400 nM Cayman Chemical housekeeping gene 18S rRNA, were designed using PI3K Wortmannin 100 nM Calbiochem Primer Express (Applied Biosystems) (Table 2). All MEK 1/2 U1026 10 µM Cell Signaling reactions were done in duplicates, from at least 4 dif- γ-secretase DAPT 2,5 µM Calbiochem ferent cultures. Gene expression was normalized for 18S rRNA expression. The ΔΔCT method was used for NFκB BAY-11 10 µM Calbiochem relative quantification analysis. Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 12 of 14 Table 2 Primer sequences for real-time polymerase chain reaction Gene Symbol Forward 5´–3´ Reverse 5´–3´ 18S-rRNA CGCCGCTAGAGGTGAAATTCT CATTCTTGGCAAATGCTTTCG Hes-1 CCAGCCAGTGTCAACACGA AATGCCGGGAGCTATCTTTCT Notch-1 CCCTTGCTCTGCCTAACGC GGAGTCCTGGCATCGTTGG Dlk-1 AATGTCTGCAGGTGCCATGTT TGCACTGCCATGGTTCCTT Jag-1 TCAGGACACACAACTCGGAAGT CTCCTCTCTGTCTACCAGCGTATACA IGF-1 GTGATCTGAGGAGACTGGAGATGTACT TGAGTCTTGGGCATGTCAGTGT IL-6 GAAACCGCTATGAAGTTCCTCTCTG TGTTGGGAGTGGTATCCTCTGTGA IP-10 CAGGAGAATGAGGGCCATAGG CGGATTCAGACATCTCTGCTCAT Western blot Primary cultures were lysed in 150 µL of Laemmli buf- Table 3 Antibodies used fer, heated during 5 min at 100 °C and sonicated for 5 min. Antigen Host Dilution Source Solubilized proteins (30 µL) were resolved in 8–10% SDS- PAGE bis-acrylamide gels and transferred to nitrocellu- NICD, cleaved at Val Rabbit 1:500 Cell Signaling lose membranes (Trans-Blot turbo transfer pack, Biorad) in a semi-dry system (Trans-Blot Turbo Transfer System, Jagged-1 Rabbit 1:500 Santa Cruz Biorad). Membranes were blocked for 2 h in a 5% BSA- β-actin Mouse 1:5000 Sigma-Aldrich TTBS (138 mM NaCl, 25 mM Tris-HCl, pH 8.0 and 0.1% Tween-20) solution, and incubated overnight with the α-Tubulin Mouse 1:5000 Sigma-Aldrich primary antibodies (Table 3) at 4 °C under moderate Iba1 Rabbit 1:2000 Wako shaking. Anti-β-actin, anti-Tubulin and anti-GAPDH GFAP(GA5 clon) Mouse 1:500 Sigma-Aldrich mouse monoclonal antibodies were used as loading con- BrdU Mouse 1:50 Hybridoma Bank trols. All secondary antibodies were from Jackson Immuno Research (West Grove, PA, USA). Proteins were GFAP Rabbit 1:500 Dako visualized with a chemiluminescence detection reagent c-myc (9E10) Mouse 1:500 Roche according to the manufacturer’s instructions (Amersham, Thy-1 (against CD90) Mouse 1:500 Bio-Rad (Formerly AbD GE Healthcare Europe, Barcelona, Spain). The densito- Serotec) metric analysis of scanned films was performed with Anti-mouse-HRP Goat 1:10000 Jackson Laboratories ImageJ software (Maryland, USA. http://imagej.nih.gov/). Anti-rabbit-HRP Goat 1:10000 Jackson Laboratories Immunocytochemistry Anti-mouse Alexa 488 Goat 1:1000 Jackson Laboratories Cells were seeded in glass coverslips (pre-coated with Anti-rabbit Alexa 594 Goat 1:1000 Jackson Laboratories poly-l-lysine) at a density of 25,000 cells/cm . After the Anti-mouse Alexa 647 Goat 1:50 Invitrogen appropriate treatments, astrocytes were fixed for 20 min with 4% paraformaldehyde at room temperature and permeabilized for 4 min with 0.12% Triton-X plus 0.12% gelatin in PBS. Cells were then washed with PBS/gelatin Statistical analysis and incubated for 1 h with primary antibodies (Table 3). Data shown in the figures are the result of 4–10 inde- After washing in the same buffer, cells were incubated for pendent experiments and are presented as the mean ± 45 min at room temperature with the proper fluorescent standard error of the mean (SEM). Statistical analyses secondary antibodies (Table 3). For morphology assess- were carried out using SPSS Statistics 23 software (IBM, ment, GFAP-positive cells were classified into three dif- Armonk, NY). Gaussian distribution of data sets was ferent categories: Polygonal astrocytes were those assessed by Kolmogorov–Smirnov test. Statistical sig- without any cytoplasmic protrusions, Bipolar astrocytes nificance was evaluated by the unpaired Student´s T-test presented an elongated cell body or one thin and long for one to one comparisons, and by two-way analysis of protrusion, and Stellate astrocytes were those with a variance (ANOVA) followed by Bonferroni or Games- reduced cell body and three or more long ramifications Howell post hoc tests (depending on whether variances (Fig. 1e). were homogeneous or not, respectively) for multiple Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 13 of 14 comparisons. When an interaction between two factors 14. Salama-Cohen, P.,Arevalo,M.A., Meier, J., Grantyn, R. & Rodríguez-Tébar, A. NGF controls dendrite development in hippocampal neurons by binding to was not detected, data were split and each factor was p75(NTR) andmodulatingthe cellular targets of Notch. Mol. Biol. Cell. 16, analyzed by one-way ANOVA followed by Bonferroni or 339–347 (2005). Student’s t-test. The statistical significance level was set at 15. Kopan, R. & Ilagan, M. X. The canonical Notch signaling pathway: unfolding the activation mechanism. Cell 137,216–233 (2009). p < 0.05. 16. Davis,R.L.& Turner,D.L. Vertebratehairy andEnhancerofsplit related proteins: transcriptional repressors regulating cellular differentiation and Acknowledgements embryonic patterning. Oncogene 20,8342–8357 (2002). We thank Elisa Baides Rosell for excellent technical assistance. This work was 17. Fischer, A. & Gessler, M. Delta–Notch—and then? Protein interactions and supported by grants from Agencia Estatal de Investigación, Spain (grant proposed modes of repression by Hes and Hey bHLH factors. Nucleic Acids Res. number BFU2017-82754-R), Centro de Investigación Biomédica en Red de 35,4583–4596 (2007). Fragilidad y Envejecimiento Saludable (CIBERFES), Instituto de Salud Carlos III, 18. Hojo, M. et al. Glial cell fate specification modulated by the bHLH gene Hes5 Madrid, Spain and Fondos FEDER. in mouse retina. Development 127,2515–2522 (2000). 19. Kageyama, R.,Ohtsuka, T., Hatakeyama,J. & Ohsawa,R.Roles of bHLH genesin Author details neural stem cell differentiation. Exp. Cell Res. 306,343–348 (2005). Instituto Cajal, Consejo Superior de Investigaciones Científicas (CSIC), Madrid, 20. Costa, R. M., Honjo, T. & Silva, A. J. Learning and memory deficits in Notch Spain. CIBER de Investigación Biomédica en Red de Fragilidad y mutant mice. Curr. Biol. 13,1348–1354 (2003). Envejecimiento Saludable (CIBERFES), Instituto de Salud Carlos III, Madrid, 21. Dahlhaus, M. et al. Notch1 signaling in pyramidal neurons regulates synaptic Spain. Department of Cell Biology, Faculty of Biology, Universidad connectivity and experience-dependent modifications of acuity in the visual Complutense, Madrid 28040, Spain cortex. J. Neurosci. 28, 10794–10802 (2008). 22. Zhang, K. et al. Notch1 mediates postnatal neurogenesis in hippocampus Conflict of interest enhanced by intermittent hypoxia. Neurobiol. Dis. 64,66–78 (2014). The authors declare that they have no conflict of interest. 23. Cao,Q., Karthikeyan, A.,Dheen, S.T., Kaur,C.& Ling, E.A.Production of proinflammatory mediators in activated microglia is synergistically regulated by Notch-1, glycogen synthase kinase (GSK-3β)and NF-κB/p65 signalling. PLoS ONE 12, e0186764 (2017). Publisher’s note 24. Yao, L. et al. Notch-1 signaling regulates microglia activation via NF-κB Springer Nature remains neutral with regard to jurisdictional claims in pathway after hypoxic exposure in vivo and in vitro. PLoS ONE 8, e78439 published maps and institutional affiliations. (2013). 25. John, G. R. et al. Multiple sclerosis: re-expression of a developmental Received: 30 January 2019 Revised: 8 March 2019 Accepted: 18 March 2019 pathway that restricts oligodendrocyte maturation. Nat. Med. 8,1115–1121 (2002). 26. LeComte,M.D., Shimada, I. S.,Sherwin,C.&Spees, J. L. Notch1–STAT3–ETBR signaling axis controls reactive astrocyte proliferation after brain injury. Proc. Natl Acad.Sci.USA 112,8726–8731 (2015). 27. Shimada,I.S., Borders, A.,Aronshtam,A.&Spees, J. L. Proliferatingreactive References astrocytes are regulated by Notch-1 in the peri-infarct area after stroke. Stroke 1. Milos, P. & Michael, N. Astrocyte activation and reactive gliosis. Glia 50, 427–434 (2005). 42,3231–3237 (2011). 28. Park, S. E.,Dantzer,R., Kelley,K.W.&McCusker,R.H. Central adminis- 2. Robel, S.,Berninger,B.&Götz, M.The stem cell potentialofglia:lessons from tration of insulin-like growth factor-I decreases depressive-like behavior reactive gliosis. Nat. Rev. Neurosci. 12,88–104 (2011). and brain cytokine expression in mice. J. Neuroinflammation. 8,12 3. Sofroniew, M. V. Molecular dissection of reactive astrogliosis and glial scar (2011). formation. Trends in Neurosci. 32,638–647 (2009). 29. Bellini,M. J., Hereñú,C.B., Goya,R.G.& Garcia-Segura, L. M. Insulin-like growth 4. Acaz-Fonseca, E., Duran, J. C., Carrero, P., Garcia-Segura, L. M. & Arevalo, M. A. factor-I gene delivery to astrocytes reduces their inflammatory response to Sex differences in glia reactivity after cortical brain injury. Glia 63,1966–1981 lipopolysaccharide. J. Neuroinflammation. 8, 21 (2011). (2015). 30. Cerciat, M., Unkila, M., Garcia-Segura, L. M. & Arevalo, M. A. Selective estrogen 5. Wilhelmsson, U. et al. Redefining the concept of reactive astrocytes as cells receptor modulators decrease the production of interleukin‐6 and interferon‐ that remain within their unique domains upon reaction to injury. Proc. Natl γ‐inducible protein‐10 by astrocytes exposed to inflammatory challenge Acad. Sci. USA 103, 17513–17518 (2006). in vitro. Glia 58,93–102 (2010). 6. Mumm, J. S. & Kopan, R. Notch signaling: from the outside in. Dev. Biol. 228, 31. Pons, S. & Torres-Aleman, I. Insulin-like growth factor-I stimulates depho- 151–165 (2000). sphorylation of IκB through the serine phosphatase calcineurin (protein 7. Šestan, N., Artavanis-Tsakonas, S. & Rakic, P. Contact-dependent inhibition of phosphatase 2B). J. Biol. Chem. 275, 38620–38625 (2000). cortical neurite growth mediated by Notch signaling. Science 286,741–746 32. Fernandez,A.M., Garcia-Estrada,J., Garcia-Segura, L. M. & Torres-Aleman, I. (1999). Insulin-like growth factor I modulates c-fos induction and astrocytosis in 8. Breunig, J. J., Silbereis, J., Vaccarino, F. M., Šestan, N. & Rakic,P.Notch regulates response to neurotoxic insult. Neuroscience 76,117–122 (1996). cell fate and dendrite morphology of newborn neurons in the postnatal 33. Judy, B. et al. Rel/NF‐κB can trigger the Notch signaling pathway by inducing dentate gyrus. Proc. Natl. Acad. Sci. USA 104, 20558–20563 (2007). the expression of Jagged1, a ligand for Notch receptors. EMBO J. 18, 9. Boucher, J.,Gridley,T.&Liaw,L.Molecular pathways of Notchsignalingin 2803–2811 (1999). vascular smooth muscle cells. Front. Physiol. 3, 81 (2012). 34. Sierra, R. A. et al. Anti-Jagged immunotherapy inhibits MDSCs and overcomes 10. Kim, W., Shin, Y. K., Kim, B. J. & Egan, J. M. Notch signaling in pancreatic tumor-induced tolerance. Cancer Res. 77,5628–5638 (2017). endocrine cell and diabetes. Biochem. Biophys. Res. Commun. 392,247–251 35. Boareto, M., Jolly, M. K.,Ben-Jacob,E.& Onuchic, J. N. Jaggedmediatesdif- (2010). ferences in normal and tumor angiogenesis by affecting tip-stalk fate decision. 11. Weihong, G. et al. Notch signaling promotes astrogliogenesis via direct CSL‐ Proc. Natl Acad. Sci. USA 112, E3836–E3844 (2015). mediated glial gene activation. J. Neurosci. Res. 69,848–860 (2002). 36. Hellström, M. et al. Dll4 signalling through Notch1 regulates formation of tip 12. Martini,S.etal. ACriticalrolefor Sox9 in Notch‐induced astrogliogenesis and cells during angiogenesis. Nature 445,776–780 (2007). stem cell maintenance. Stem Cells 3,741–751 (2013). 37. Benedito, R. et al. The Notch ligands Dll4 and Jagged1 have opposing effects 13. Salama-Cohen, P., Arevalo, M. A., Grantyn, R. & Rodríguez-Tébar, A. Notch and on angiogenesis. Cell 137,1124–1135 (2009). NGF/p75NTR control dendrite morphology and the balance of excitatory/ 38. Gama-Norton, L. et al. Notch signal strength controls cell fate in the hae- inhibitory synaptic input to hippocampal neurones through Neurogenin 3. J. mogenic endothelium. Nat. Commun. 6, 8510 (2015). Neurochem. 97,1269–1278 (2006). Official journal of the Cell Death Differentiation Association Acaz-Fonseca et al. Cell Death Discovery (2019) 5:85 Page 14 of 14 39. Pedrosa,A.R.etal. EndothelialJagged1 antagonizes Dll4 regulation of 45. Eng‐Ang, L. & Wai‐Chow, W. The origin and nature of ramified and amoeboid endothelial branching and promotes vascular maturation downstream of microglia: A historical review and current concepts. Glia 7,9–18 (1993). Dll4/Notch1. Arterioscler. Thromb. Vasc. Biol. 35, 1134–1146 (2015). 46. Akira, S. & Takeda, K. Toll-like receptor signalling. Nat. Rev. Immunol. 4,499–511 40. Cordle, J. et al. A Conserved face of the Jagged/Serrate DSL domain is (2004). involved in Notch trans-activation and cis-inhibition. Nat. Struct. Mol. Biol. 15, 47. Beutler, B. & Rietschel, E. T. Innate immune sensing and its roots: the story of 849–857 (2008). endotoxin. Nat. Rev. Immunol. 3,169–176 (2003). 41. Glittenberg, M., Pitsouli, C., Garvey, C.,Delidakis,C.&Bray,S. Role ofconserved 48. Labandeira-Garcia,J.L., Costa-Besada,M.A., Labandeira,C.M., Villar-Cheda,B.& intracellular motifs in Serrate signalling, cis‐inhibition and endocytosis. EMBO J. Rodríguez-Perez, A. I. Insulin-like growth factor-1 and neuroinflammation. 25,4697–4706 (2006). Front. Aging Neurosci. 9, e00365 (2017). 42. Sprinzak, D. et al. Cis interactions between Notch and Delta generate mutually 49. Santi, A., Genis, L. & Torres-Aleman, I. A coordinated action of blood-borne and exclusive signaling states. Nature 465,86–90 (2010). brain Insulin-like growth factor I in theresponsetotraumatic brain injury. 43. Nonneman, A. et al. Astrocyte-derived Jagged-1 mitigates deleterious Notch Cereb. Cortex 28,2007–2014 (2018). signaling in amyotrophic lateral sclerosis. Neurobiol. Dis. 119,26–40 (2018). 50. Nye, J. S., Kopan, R. & Axel, R. An activated Notch suppresses neurogenesis and 44. Anderson, M. A., Ao, Y. & Sofroniew, M. V. Heterogeneity of reactive astrocytes. myogenesis but not gliogenesis in mammalian cells. Development 120, Neurosci. Lett. 565,23–29 (2014). 2421–2430 (1994). Official journal of the Cell Death Differentiation Association

Journal

Cell Death Discovery – Springer Journals

Published: Apr 3, 2019

There are no references for this article.