Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/springer-journals/phenotypic-and-genotypic-characterization-of-antibiotic-resistance-in-pmJxLpY2Pv
References
References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.
- Publisher
- Springer Journals
- Copyright
- Copyright © 2019 by The Author(s).
- Subject
- Biomedicine; Medical Microbiology; Drug Resistance; Infectious Diseases
- eISSN
- 2047-2994
- DOI
- 10.1186/s13756-019-0505-7
- Publisher site
- See Article on Publisher Site
Abstract
Background: Cockroaches are one of the most important and frequent insects responsible for harboring, transmission and dissemination of human pathogens in the hospital environment. The present research was done to study the phenotypic and genotypic characterization of antibiotic resistance in the Methicillin-resistant Staphylococcus aureus strains isolated from hospital cockroaches. Methods: Five-hundred and thirty Periplanets americana and Blattella germanica cockroaches were collected and their gut content and external washing samples were subjected to bacterial isolation. MRSA strains were subjected to disk diffusion and PCR amplification of antibiotic resistance genes. Results: Prevalence of MRSA strains in P. americana and B. germanica cockroaches were 52.77 and 43.33%, respectively. External washing samples of P. americana cockroaches had the highest prevalence of MRSA strains (59. 57%). MRSA isolates of external washing samples harbored the highest prevalence of resistance against penicillin (100%), ceftaroline (100%), tetracycline (100%), gentamicin (83.33%) and trimethoprim-sulfamethoxazole (80.55%). MRSA strains isolated from gut content samples harbored the highest prevalence of resistance against penicillin (100%), ceftaroline (100%), tetracycline (100%), trimethoprim-sulfamethoxazole (80%) and gentamicin (73.33%). BlaZ, aacA-D, tetK, msrA, dfrA, ermA, gyrA, grlA and rpoB were the most commonly detected antibiotic resistance genes amongst the MRSA strains. Conclusions: The present investigation is the first report of the phenotypic and genotypic evaluation of antibiotic resistance in the MRSA strains isolated from P. americana and B. germanica hospital cockroaches. Hospital cockroaches are considered as a potential mechanical vector for MRSA strains. Keywords: Methicillin-resistant Staphylococcus aureus, Antibiotic resistance, Antibiotic resistance genes, Hospital cockroaches Introduction habitation. In addition to being a persistent pest and There are several ways to increase the survival of micro- owing to their omnivorous habit of feeding and indis- organisms in the environment and their transmission to criminate deposition of fecal materials, cockroaches are human population. Cockroaches are among the most well-known agents for harboring, transmission and dis- common insects found in industrial and residential envi- semination of human pathogens, thereby representing a ronments such as hospitals. Indeed, the species has been public health risk [1, 2]. highly successful in exploiting niches within human There are two cockroach species commonly found infesting in domestic, industrial and residential environ- ments, these are the German cockroach (Blattella ger- * Correspondence: zohreh.abdolmaleki@kiau.ac.ir manica (B. germanica)) and the American cockroach Department of Pharmacology, Faculty of Veterinary Medicine, Karaj Branch, Islamic Azad University, Karaj, Iran (Periplanets americana (P. americana)) (Dictyoptera; Full list of author information is available at the end of the article © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Abdolmaleki et al. Antimicrobial Resistance and Infection Control (2019) 8:54 Page 2 of 14 Blattidae). P. americana is the largest shiny reddish is important for public health and despite the import- brown peridomestic cockroaches measuring on average ance of such a screen, limited data are available for 4–5 cm in length, while B. germanica is light yellowish MRSA at the species level among the hospital cockroach brown with length ranging from 1.0–2.5 cm [1, 2]. B. samples. germanica are the most abundantly distributed cock- MRSA strains have been tested in hospital cockroach roach species. B. germanica are more prevalent inside samples to assess microbiological safety, sanitation con- the home, while the P. americana are common around ditions and finally epidemiological roles of these insects the home and associated with water drainage systems in survival and transmission of bacteria. High pathogen- and water pipes. Both of them can disseminate through icity of MRSA strains and general weakness of hospital- the sewage system especially in public places such as ized patients make it necessary to assess the presence of hospitals [1, 2]. MRSA strains in hospital cockroach samples. Thus, the Over 100 species of virulent and resistant bacteria current research was done to study the phenotypic and have been isolated from or passed through cockroaches. genotypic properties of antibiotic resistance in the Microbiological and epidemiological investigations re- MRSA strains isolated from P. americana and B. germa- ported that Staphylococcus aureus (S. aureus) has com- nica cockroaches in Iranian hospitals. monly been isolated from P. americana and B. germanica found in the public places and especially hos- Materials and methods pital environment [3, 4]. S. aureus is commonly found in Samples nose and respiratory system and on the skin [5]. It is re- The present descriptive study was conducted during sponsible for the occurrence of nosocomial and 2016 and 2017 at the tertiary hospitals of the Tehran community-acquired infections, food-borne diseases and province, Iran. Five-hundred and thirty cockroaches food poisoning [5]. were collected using sticky traps, vacuum cleaners and S. aureus strains are usually resist against several types hand catch methods from human dwellings. Traps were of antibiotics [6–9]. Nowadays, methicillin-resistant S. manufactured according to the design of Reierson and aureus (MRSA) has become a serious problem in hospi- Rust (1997) [11]. The traps were placed on the floor tals [6–9]. Documented data revealed that about 50– under beds, cupboards, wooden racks, and/or benches, 70% of the S. aureus strains isolated from the hospital for two consecutive days. Each trapped cockroach was environment were MRSA [6–9]. MRSA strains are re- placed in a sterile test tube before sending to the labora- sponsible for about 100,000 cases of infections with tory. After immobilization by freezing at 0 °C for 5 min, around 20% mortality rate each year in the United States the species of cockroaches were identified under a dis- [10]. High pathogenicity of MRSA strains, its high resist- secting microscope according to Harwood and James ance to several types of antibiotics and its nosocomial (1979) [12]. P. americana and B. germanica cockroaches aspects have increased the importance of isolation of were subjected to further parts of the study. MRSA from the hospital cockroaches. MRSA strains are believed to serve as important reservoirs of antimicrobial Sample preparation and isolation of S. aureus resistance genes which can transfer and integrate into Body surface of cockroaches were washed with physio- the MRSA genome leading to the emergence of new and logical saline after vortexing for 2 min and taken as a potentially more resistant strains [6–9]. Documented homogenate sample. Before gastrointestinal tract (GIT) data revealed that presence of certain antibiotic resist- dissection, each cockroach was decontaminated with ance genes is responsible for occurrence of severe anti- 95% ethanol, and the residue of ethanol was removed biotic resistance [6–9]. Reports showed the high with saline solution. The gut was dissected aseptically presence of rpoB, blaZ, mecA, aacA-D, tetK and tetM, using sterile needles and washed with 5-mL normal sa- ermA and msrA, linA, vatA and vatB, dfrA, gyrA and line solution. Caution was taken to reduce the number grlA and cat1 antibiotic resistance genes in the S. aureus of cut off or break in the gut. One milliliter of each strains caused severe occurrence of resistance against homogenate was inoculated separately into 9-mL of ansamycins, penicillins, methicillin, aminoglycosides, tet- buffered peptone water (Merck, Germany) for primary racyclines, macrolides–lincosamide-streptogramin B, enrichment, and incubated at 37 °C for 18–24 h. Samples lincosamides, streptogramins, folate inhibitors, fluoro- were then inoculated in screw cap test tube containing quinolones and phenicols groups of antibiotics, respect- nutrient broth (NB, Merck, Germany) for the isolation ively [6–9]. Reports of methicillin-resistant strains are of S. aureus, and enriched overnight at 37 °C. A loopful challenging due to the large proportion of of inoculum from the enriched culture was streaked on methicillin-resistant strains and increasing numbers of to Blood Agar (BA, Merck, Germany) and Mannitol Salt isolates reinforcing the need to revise their importance Agar (MSA, Merck, Germany) incubated at 37 °C for 24 to hospital [6–9]. Therefore, screening of these elements h for the observation of hemolysis and mannitol Abdolmaleki et al. Antimicrobial Resistance and Infection Control (2019) 8:54 Page 3 of 14 fermentation, respectively. Colonies with beta-hemolysis Susceptibility of MRSA isolates were tested against sev- reaction and mannitol fermentation were further identi- eral types of antibiotic groups including Penicillins fied on the basis of Gram staining, catalase activity, co- (penicillin (10 μg/disk)), Cephems (ceftaroline (30 μg/ agulated test (rabbit plasma), oxidase test, glucose O/F disk),), Aminoglycosides (gentamicin (10 μg/disk), ami- test, resistance to bacitracin (0.04 U), urease activity, ni- kacin (30 μg/disk), Macrolides (azithromycin (15 μg/disk) trate reduction, phosphatase, deoxyribonuclease (DNase, and erythromycin (15 μg/disk)), Tetracyclines (tetracyc- Merck, Germany) test, voges-proskaver (Merck, line (30 μg/disk), doxycycline (30 μg/disk)), Fluoroquino- Germany) test and carbohydrate (xylose, sucrose, trehal- lones (ciprofloxacin (5 μg/disk) and levofloxacin (5 μg/ ose and maltose, fructose, lactose, mannose) fermenta- disk)), Lincosamides (clindamycin (2 μg/disk)), Folate tion tests [13]. pathway inhibitors (trimethoprim-sulfamethoxazole (25 μg/disk)), Phenicols (chloramphenicol (30 μg/disk)) Identification of methicillin-resistant Staphylococcus and Ansamycins (rifampin (5 μg/disk)) antibiotic agents aureus strains (Oxoid, UK) using the instruction of Clinical and La- Cefoxitin (30 μg) and oxacillin (1 μg) susceptibility tests boratory Standards Institute [15]. The plates containing were used to distinguish the MRSA strains from S. aur- the discs were allowed to stand for at least 30 min before eus isolates of hospital cockroaches. All tests were per- incubated at 37 °C for 24 h. The diameter of the zone of formed using the guidelines of the Clinical and inhibition produced by each antibiotic disc was mea- Laboratory Standards Institute (CLSI) [14]. sured and interpreted using the CLSI zone diameter in- MRSA isolates were identified another time using the terpretative standards [15]. Staphylococcus aureus ATCC PCR-based amplification of mecA gene. MRSA strains 25923 was used as quality control organism in anti- were sub-cultured on TSB media (Merck, Germany) and microbial susceptibility determination. further incubated for 48 h at 37 °C. Genomic DNA was extracted from bacterial colonies using the DNA extrac- Genotypic evaluation of antibiotic resistance tion kit (Thermo Fisher Scientific, St. Leon-Rot, Table 1 represents the list of primers and PCR condi- Germany) according to manufacturer’s instruction. Pur- tions used for amplification of antibiotic resistance genes ity (A260/A280) and concentration of extracted DNA in the MRSA strains isolated from hospital cockroaches were then checked (NanoDrop, Thermo Scientific, Wal- [16–22]. A programmable DNA thermo-cycler (Eppen- tham, MA, USA). The truth of the DNA was assessed dorf Mastercycler 5330, Eppendorf-Nethel-Hinz GmbH, on a 2% agarose gel stained with ethidium bromide Hamburg, Germany) was used in all PCR reactions. (0.5 μg/mL) (Thermo Fisher Scientific, St. Leon-Rot, Amplified samples were analyzed by electrophoresis Germany). (120 V/208 mA) in 2.5% agarose gel. The gel was stained The PCR reactions were performed in a total volume with 0.1% ethidium bromide (0.4 μg/ml). The UVI doc of 25 μL, including 1.5 mM MgCl2, 50 mM KCl, 10 mM gel documentation systems (Grade GB004, Jencons PLC, Tris-HCl (pH 9.0), 0.1% Triton X-100, 200 μM dNTPs London, UK) was applied for analysis of images. each (Thermo Fisher Scientific, St. Leon-Rot, Germany), 2.5 μL PCR buffer (10X), 2.5 mM of each primer mecA1 Statistical analysis (5′-ACGAGTAGATGCTCAATATAA-3′)and mecA2 Statistical analysis was done using the SPSS 21.0 statis- (5′-CTTAGTTCTTTAGCGATTGC-3′) (Gen Bank Ac- tical software (SPSS Inc., Chicago, IL, USA). Chi-square cession Number NC_003923M, 293 bp), 1.5 U of Taq test and Fisher’s exact two-tailed test were used to assess DNA polymerase (Thermo Fisher Scientific, St. any significant relationship between prevalence of S. Leon-Rot, Germany) and 5 μL of the extracted DNA aureus and MRSA strains and their phenotypic and template of the MRSA isolates. The PCR cycling condi- genotypic properties of antibiotic resistance. P value < tions were as follows: initial denaturation at 94 °C for 3 0.05 was considered as statistical significant level. min, followed by 30 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s, followed by an extra cycle of an- Results nealing at 60 °C for 30 s, and a final extension at 72 °C Table 2 represents the prevalence of S. aureus and for 5 min. MRSA strains in different types of hospital cockroaches. Sixty-five out of 530 (12.26%) external washing samples Phenotypic evaluation of antibiotic resistance of hospital cockroaches and thirty-seven out of 530 Patterns of antimicrobial resistance of the MRSA strains (6.98%) gut content samples of hospital cockroaches isolated from hospital cockroaches were studied using were positive for S. aureus strains. Prevalence of S. aur- the simple disk diffusion according to the Kirby-Baur eus strains in P. americana and B. germanica hospital disc diffusion technique. The Mueller–Hinton agar cockroaches were 11.61% (72/620) and 6.81% (30/440), (Merck, Germany) medium was used for this purpose. respectively. External washing samples of P. americana Abdolmaleki et al. Antimicrobial Resistance and Infection Control (2019) 8:54 Page 4 of 14 Table 1 Target genes, oligonucleotide primers and PCR conditions used for detection of antibiotic resistance genes in the MRSA strains isolated from hospital cockroaches (16–22) Target gene Primer sequence (5′-3′) PCR product (bp) PCR programs PCR volume (50 μL) AacA-D F: TAATCCAAGAGCAATAAGGGC 227 1 cycle: 5 μL PCR buffer 10X 0C R: GCCACACTATCATAACCACTA 94 ------------ 5 min. 1.5 mM Mgcl 25 cycle: 200 μM dNTP (Fermentas) ermA F: AAGCGGTAAACCCCTCTGA 190 0C 94 ------------ 60 s 0.5 μM of each primers F & R R: TTCGCAAATCCCTTCTCAAC 0C 55 ------------ 70 s 1.25 U Taq DNA polymerase (Fermentas) 0C 72 ------------ 60 s 2.5 μL DNA template tetK F: GTAGCGACAATAGGTAATAGT 360 1 cycle: R: GTAGTGACAATAAACCTCCTA 0C 72 ------------ 10 min tetM F: AGTGGAGCGATTACAGAA 158 1 cycle: 5 μL PCR buffer 10X 0C R: CATATGTCCTGGCGTGTCTA 94 ------------ 6 min. 2 mM Mgcl 34 cycle: 200 μM dNTP (Fermentas) vatA F: TGGTCCCGGAACAACATTTAT 268 0C 95 ------------ 50 s 0.5 μM of each primers F & R R: TCCACCGACAATAGAATAGGG 0C 55 ------------ 70 s 1.5 U Taq DNA polymerase (Fermentas) 0C 72 ------------ 60 s 5 μL DNA template 1 cycle: 0C 72 ------------ 8 min msrA F: GGCACAATAAGAGTGTTTAAAGG 940 1 cycle: 5 μL PCR buffer 10X 0C R: AAGTTATATCATGAATAGATTGTCCTGTT 94 ------------ 6 min. 2 mM Mgcl 34 cycle: 150 μM dNTP (Fermentas) 0C 95 ------------ 60 s 0.75 μM of each primers F & R 0C 50 ------------ 70 s 1.5 U Taq DNA polymerase (Fermentas) 0C 72 ------------ 70 s 3 μL DNA template 1 cycle: 0C 72 ------------ 8 min vatB F: GCTGCGAATTCAGTTGTTACA 136 1 cycle: 5 μL PCR buffer 10X 0C R: CTGACCAATCCCACCATTTTA 94 ------------ 6 min. 2 mM Mgcl 35 cycle: 150 μM dNTP (Fermentas) 0C 95 ------------ 50 s 0.75 μM of each primers F & R 0C 55 ------------ 70 s 1.5 U Taq DNA polymerase (Fermentas) 0C 72 ------------ 80 s 3 μL DNA template 1 cycle: 0C 72 ------------ 10 min linA F: GGTGGCTGGGGGGTAGATGTATTAACTGG 323 1 cycle: 5 μL PCR buffer 10X 0C R: GCTTCTTTTGAAATACATGGTATTTTTCGA 94 ------------ 6 min. 2 mM Mgcl 30 cycle: 150 μM dNTP (Fermentas) 0C 95 ------------ 60 s 0.75 μM of each primers F & R 0C 57 ------------ 60 s 1.5 U Taq DNA polymerase (Fermentas) 0C 72 ------------ 60 s 3 μL DNA template 1 cycle: 0C 72 ------------ 10 min blaZ F: ACTTCAACACCTGCTGCTTTC 490 1 cycle: 5 μL PCR buffer 10X 0C R: TGACCACTTTTATCA CAACC 94 ------------ 5 min. 2 mM Mgcl 30 cycle: 150 μM dNTP (Fermentas) 0C 94 ------------ 20 s 0.75 μM of each primers F & R 0C 60 ------------ 30 s 1.5 U Taq DNA polymerase (Fermentas) 0C 72 ------------ 90 s 3 μL DNA template 1 cycle: 0C 72 ------------ 5 min cat1 F: AGTTGCTCAATGTACCTATAACC 547 1 cycle: 5 μL PCR buffer 10X 0C R: TTGTAATTCATTAAGCATTCTGCC 94 ------------ 8 min. 2 mM Mgcl 32 cycle: 150 μM dNTP (Fermentas) 0C 95 ------------ 60 s 0.75 μM of each primers F & R 0C 55 ------------ 70 s 1.5 U Taq DNA polymerase (Fermentas) 0C 72 ------------ 2 min 3 μL DNA template 1 cycle: 0C 72 ------------ 8 min gyrA F: AATGAACAAGGTATGACACC 223 1 cycle: 5 μL PCR buffer 10X 0C R: TACGCGCTTCAGTATAACGC 94 ------------ 10 min. 2 mM Mgcl 25 cycle: 150 μM dNTP (Fermentas) grlA F: ACTTGAAGATGTTTTAGGTGAT 459 0C 94 ------------ 20 s 0.75 μM of each primers F & R R: TTAGG AAATCTTGATGGCAA 0C 52 ------------ 20 s 1.5 U Taq DNA polymerase (Fermentas) 0C 72 ------------ 50 s 3 μL DNA template 1 cycle: Abdolmaleki et al. Antimicrobial Resistance and Infection Control (2019) 8:54 Page 5 of 14 Table 1 Target genes, oligonucleotide primers and PCR conditions used for detection of antibiotic resistance genes in the MRSA strains isolated from hospital cockroaches (16–22) (Continued) Target gene Primer sequence (5′-3′) PCR product (bp) PCR programs PCR volume (50 μL) 0C 72 ------------ 5 min dfrA F: CTCACGATAAACAAAGAGTCA 201 1 cycle: 5 μL PCR buffer 10X 0C R: CAATCATTGCTTCGTATAACG 94 ------------ 2 min. 2 mM Mgcl 30 cycle: 150 μM dNTP (Fermentas) 0C 94 ------------ 60 s 0.75 μM of each primers F & R 0C 50 ------------ 60 s 1.5 U Taq DNA polymerase (Fermentas) 0C 72 ------------ 60 s 3 μL DNA template 1 cycle: 0C 72 ------------ 5 min rpoB F: ACCGTCGTTTACGTTCTGTA 460 1 cycle: 5 μL PCR buffer 10X 0C R: TCAGTGATAGCATGTGTATC 94 ------------ 5 min. 2 mM Mgcl 32 cycle: 150 μM dNTP (Fermentas) 0C 94 ------------ 60 s 0.75 μM of each primers F & R 0C 56 ------------ 45 s 1.5 U Taq DNA polymerase (Fermentas) 0C 72 ------------ 60 s 3 μL DNA template 1 cycle: 0C 72 ------------ 10 min hospital cockroaches had the highest prevalence of S. of hospital cockroaches and prevalence of MRSA (P < aureus strains (15.16%), while gut content samples of P. 0.05). americana hospital cockroaches had the lowest (8.06%). MRSA isolates were subjected to disk diffusion to assess Prevalence of S. aureus strains in external washing and the antibiotic resistance pattern. Table 3 represents the gut content samples of B. germanica hospital cock- phenotypic pattern of antibiotic resistance of MRSA strains roaches were 8.18 and 5.45%, respectively. Statistically isolated from hospital cockroaches. MRSA strains isolated significant differences were seen between types of hos- from external washing samples of hospital cockroaches har- pital cockroaches and prevalence of S. aureus (P < 0.05). bored the highest prevalence of resistance against penicillin MRSA strains were further identified using the mecA (100%), ceftaroline (100%), tetracycline (100%), gentamicin gene PCR amplification. Figure 1 shows the gel electro- (83.33%) and trimethoprim-sulfamethoxazole (80.55%) anti- phoresis of the mecA gene of the MRSA strains in PCR biotic agents. MRSA strains isolated from gut content sam- reaction. Thirty-six out of 65 (55.38%) S. aureus strains ples of hospital cockroaches harbored the highest isolated from external washing samples of hospital cock- prevalence of resistance against penicillin (100%), ceftaroline roaches and fifteen out of 37 (40.54%) S. aureus strains (100%), tetracycline (100%), trimethoprim-sulfamethoxazole isolated from gut content samples of hospital cock- (80%) and gentamicin (73.33%) antibiotic agents. MRSA roaches were confirmed to be MRSA strains. Prevalence strains isolated from external washing samples of hospital of MRSA strains in P. americana and B. germanica hos- cockroaches harbored the lowest prevalence of resistance pital cockroaches were 52.77% (38/72) and 43.33% (13/ against chloramphenicol (25%), rifampin (33.33%), levofloxa- 30), respectively. External washing samples of P. ameri- cin (38.88%) and ciprofloxacin (44.44%) antibiotic agents. cana hospital cockroaches had the highest prevalence of MRSA strains isolated from gut content samples of hospital MRSA strains (59.57%), while gut content samples of P. cockroaches harbored the lowest prevalence of resistance americana hospital cockroaches had the lowest (40%). against chloramphenicol (20%), rifampin (33.33%), levofloxa- Prevalence of MRSA strains in external washing and cin (40%), ciprofloxacin (46.66%) and clindamycin (46.66%) gut content samples of B. germanica hospital cock- antibiotic agents. MRSA strains isolated from P. americana roaches were 44.44 and 41.66%, respectively. Statisti- harbored thehigherprevalenceofresistanceagainst almost cally significant differences were seen between types all antibiotic agents (P < 0.05). Additionally, those of external Table 2 Prevalence of S. aureus and MRSA strains in different types of hospital cockroaches Types of cockroaches No samples collected N (%) of S. aureus positive samples N (%) of MRSA positive samples P. americana External washing 310 47 (15.16) 28 (59.57) Gut contents 310 25 (8.06) 10 (40) B. germanica External washing 220 18 (8.18) 8 (44.44) Gut contents 220 12 (5.45) 5 (41.66) Total External washing 530 65 (12.26) 36 (55.38) Gut contents 530 37 (6.98) 15 (40.54) Abdolmaleki et al. Antimicrobial Resistance and Infection Control (2019) 8:54 Page 6 of 14 while prevalence of resistance against more than 8 clas- ses of antibiotics was 7.69%. Table 4 represents the genotypic pattern of antibiotic resistance amongst the MRSA strain isolated from differ- ent types of hospital cockroaches. We found that blaZ (100%), aacA-D (88.88%), tetK (72.22%), msrA (63.88%), and dfrA (63.88%) were the most commonly detected antibiotic resistance genes amongst the MRSA strains isolated from external washing of hospital cockroaches. Additionally, blaZ (100%), aacA-D (73.33%), msrA (66.66%), tetK (60%) and dfrA (60%) were the most com- monly detected antibiotic resistance genes amongst the MRSA strains isolated from gut contents of hospital cockroaches. We found that vatB (11.11%), cat1 (19.44%), tetM (27.77%), grlA (27.77%), rpoB (27.77%) and vatA (30.55%) had the lowest distribution amongst the antibiotic resistance genes in MRSA strains isolated from external washing of hospital cockroaches. Add- itionally, tetM (20%), linA (20%), ermA (20%), vatB (20%), grlA (20%), rpoB (20%) and cat1 (20%) had the Fig. 1 Gel electrophoresis of the mecA gene of the MRSA strains in lowest distribution amongst the antibiotic resistance PCR reaction. M: 100 bp ladder (Thermo Fisher Scientific, St. Leon- genes in MRSA strains isolated from gut contents of Rot, Germany), Lane 1: Positive control (MRSA ATCC 43300) Lanes 2– 6: Positive samples for the mecA gene (293 bp) and Lane 7: Negative hospital cockroaches. MRSA strains isolated from P. control (PCR grade water (Thermo Fisher Scientific, St. americana harbored the higher prevalence of antibiotic Leon-Rot, Germany)) resistance genes (P < 0.05). Additionally, those of exter- nal washing had the higher prevalence of antibiotic re- sistance genes (P < 0.05). Statistically significant washing samples had the higher prevalence of resistance differences were seen between types of samples and against almost all tested antibiotic agents (P < 0.05). Statisti- prevalence of antibiotic resistance genes (P < 0.05). cally significant differences were seen between types of sam- ples and prevalence of antibiotic resistance (P <0.05). Discussion Figure 2 represents the prevalence of resistant MRSA Cockroaches are among the most notorious pests, hav- strains in different types of hospital cockroaches. ing nocturnal and filthy habits, which do not only con- Multi-drug resistant strains were determined as those taminate food by indiscriminate deposition of fecal who had at least simultaneous resistance against 3 or materials and cause food poisoning but also transmit more than 3 classes of antibiotics. All of the MRSA bacteria and other pathogenic microorganisms in strains isolated from external washing samples of hos- infested areas. Cockroaches are common in many of hu- pital cockroaches at least had resistance against 3 differ- man habitations, particularly in place where food is ent classes of antibiotics, while prevalence of resistance stored, processed, prepared, or served. Apart from that, against more than 8 classes of antibiotics was 13.88%. they are also frequently detected in hospital environ- Additionally, 86.66% of the MRSA strains isolated from ments, such as wards, operational rooms, area of inten- gut content samples of hospital cockroaches at least had sive care units, and laboratory rooms. Indeed, resistance against 3 different classes of antibiotics, while cockroaches are found everywhere and possess nocturnal prevalence of resistance against more than 8 classes of and omnivorous features; these characteristics make antibiotics was 6.66%. them the ideal carriers of pathogenic, virulent and resist- Figure 3 represents the prevalence of resistant MRSA ant microorganisms and especially S. aureus [23]. strains in P. americana and B. germanica hospital cock- The present investigation showed that 12.26% of exter- roaches. All of the MRSA strains isolated from P. ameri- nal washing and 6.98% of gut content samples of hos- cana hospital cockroaches at least had resistance against pital cockroaches were positive for S. aureus strains. 3 different classes of antibiotics, while prevalence of re- Additionally, the prevalence of MRSA strains in external sistance against more than 8 classes of antibiotics was washing and gut content samples of hospital cock- 14.28%. Additionally, 84.61% of the MRSA strains iso- roaches were 6.79% (36/530) and 2.83% (15/530), re- lated from B. germanica hospital cockroaches at least spectively. Furthermore, P. americana cockroaches had had resistance against 3 different classes of antibiotics, the higher prevalence of S. aureus and also MRSA Abdolmaleki et al. Antimicrobial Resistance and Infection Control (2019) 8:54 Page 7 of 14 Table 3 Phenotypic pattern of antibiotic resistance of MRSA strains isolated from different types of hospital cockroaches Origins (N of MRSA strains) N (%) isolates resistant to each antibiotic Penicillins Cephems Aminoglycosides Macrolides Tetracyclines Fluoroquinolones Lincosamides Folate Phenicols Ansamycins inhibitors P10 Cft Gen Amk Azi Ert Tet Dox Cip Lev Clin Tr-Sul C30 Rif P. External washing 28 (100) 28 (100) 24 21 (75) 15 18 28 21 (75) 12 11 14 (50) 23 (82.14) 7 (25) 9 (36) americana (28) (85.71) (53.57) (64.28) (100) (42.85) (39.28) Gut contents (10) 10 (100) 10 (100) 8 (80) 7 (70) 5 (50) 6 (60) 10 6 (60) 5 (50) 4 (40) 5 (50) 8 (80) 2 (20) 3 (30) (100) B. External washing (8) 8 (100) 8 (100) 6 (75) 5 (62.50) 4 (50) 5 (62.50) 8 (100) 5 (62.50) 4 (50) 3 (37.50) 4 (50) 6 (75) 2 (25) 3 (37.50) germanica Gut contents (5) 5 (100) 5 (100) 3 (60) 2 (40) 3 (60) 3 (60) 5 (100) 2 (40) 2 (40) 2 (40) 2 (40) 4 (80) 1 (20) 2 (40) Total External washing 36 (100) 36 (100) 30 26 19 23 36 26 16 14 18 (50) 29 (80.55) 9 (25) 12 (33.33) (36) (83.33) (72.22) (52.77) (63.88) (100) (72.22) (44.44) (38.88) Gut contents (15) 15 (100) 15 (100) 11 9 (60) 8 (53.33) 9 (60) 15 8 (53.33) 7 (46.66) 6 (40) 7 (46.66) 12 (80) 3 (20) 5 (33.33) (73.33) (100) P10: penicillin (10 μg/disk), Cft: ceftaroline (30 μg/disk), Gen: gentamicin (10 μg/disk), Amk: amikacin (30 μg/disk), Azi: azithromycin (15 μg/disk), Ert: erythromycin (15 μg/disk), Tet: tetracycline (30 μg/disk), Do: doxycycline (30 μg/disk), Cip: ciprofloxacin (5 μg/disk), Lev: levofloxacin (5 μg/disk), Clin: clindamycin (2 μg/disk), Tr-Sul: trimethoprim-sulfamethoxazole (25 μg/disk), C30: chloramphenicol (30 μg/disk), Rif: rifampin (5 μg/disk) Abdolmaleki et al. Antimicrobial Resistance and Infection Control (2019) 8:54 Page 8 of 14 Fig. 2 Prevalence of resistant MRSA strains in external washing and gut content samples of hospital cockroaches. Results were analyzed based on the total of 36 MRSA strains isolated from external washing and 15 MRSA strains isolated from gut content samples of hospital cockroaches strains. Findings represents an important public health parts of the hospital cockroaches for dissemination of S. issue regarding the presence of B. germanica and P. aureus and also MRSA strains. Moreover, S. aureus is americana cockroaches in hospital environment and also not intestinal bacterium with high distribution in gut their high importance as a dangerous vector for survival contents of the hospital cockroaches. However, presence and dissemination of S. aureus and also MRSA strains in of S. aureus in gut content samples of hospital cock- the hospital environment. Findings also represent the roaches may be due to the permanent presence of S. higher prevalence of S. aureus and also MRSA strains in aureus in hospital food samples [6, 7, 24] which may be external washing samples of studied hospital cock- consumed by cockroaches. Higher prevalence of S. aur- roaches which may signify the higher role of external eus and MRSA in P. americana is may be due to their Fig. 3 Prevalence of resistant MRSA strains in P. americana and B. germanica hospital cockroaches. Results were analyzed based on the total of 38 MRSA strains isolated from P. americana and 13 MRSA strains isolated from B. germanica hospital cockroaches Abdolmaleki et al. Antimicrobial Resistance and Infection Control (2019) 8:54 Page 9 of 14 Table 4 Genotypic pattern of antibiotic resistance amongst the MRSA strain isolated from different types of hospital cockroaches Origins (N of MRSA strains) N (%) isolates resistant to each antibiotic Aminoglycosides Tetracyclines Macrolides Lincosamides Streptogramins Penicillins Folate Fluoroquinolones Ansamycins Phenicols inhibitors aacA-D tetK tetM msrA ermA linA vatA vatB blaZ dfrA gyrA grlA rpoB cat1 P. External washing 26 (92.85) 20 7 (25) 18 15 11 (39.28) 7 (25) 2 (7.14) 28 (100) 18 (64.28) 10 8 (28.57) 7 (25) 5 (17.85) americana (28) (71.42) (64.28) (53.57) (35.71) Gut contents (10) 8 (80) 6 (60) 3 (30) 7 (70) 6 (60) 3 (30) 4 (40) 1 (10) 10 (100) 6 (60) 4 (40) 2 (20) 2 (20) 2 (20) B. External washing 6 (75) 6 (75) 3 (37.50) 5 (62.50) 3 (37.50) 2 (25) 4 (50) 2 (25) 8 (100) 5 (62.50) 4 (50) 2 (25) 3 (37.50) 2 (25) germanica (8) Gut contents (5) 3 (60) 3 (60) 1 (20) 3 (60) 1 (20) 1 (20) 3 (60) 1 (20) 5 (100) 3 (60) 3 (60) 1 (20) 1 (20) 1 (20) Total External washing 32 (88.88) 26 10 23 18 (50) 13 (36.11) 11 4 36 (100) 23 (63.88) 14 10 10 (27.77) 7 (19.44) (36) (72.22) (27.77) (63.88) (30.55) (11.11) (38.88) (27.77) Gut contents (15) 11 (73.33) 9 (60) 4 (26.66) 10 7 (46.66) 4 (26.66) 7 (46.66) 2 15 (100) 9 (60) 7 (46.66) 3 (20) 3 (20) 3 (20) (66.66) (13.33) Abdolmaleki et al. Antimicrobial Resistance and Infection Control (2019) 8:54 Page 10 of 14 higher presence in hospital sewage than B. germanica isolates were MRSA. High prevalence of antibiotic resist- cockroaches. Although P. americana is three to four ance reported in the present study is may be due to the folds larger than B. germanica in length, the capability of unauthorized and indiscriminate prescription of antibiotic harboring microorganisms in cockroaches is not only re- agents in Iranian hospitals and health care units. The cir- lated to their sizes but may also depend on the sanita- cumstances in developing countries like Iran may be in- tion conditions of the environment. flated by easy convenience of antimicrobials at a cheaper S. aureus has been introduced as one of the most price and their extensive use in medicine. prevalent pathogenic bacteria isolated from the external According to the reports, burst of MRSA is increasing washing and gut content samples of both B. germanica in Europe. In Austria, 21.60%; Belgium, 25.10%; Spain, and P. americana cockroaches all-around the world [3, 30.30%; and France, 33.60% of isolated S. aureus strains 4, 25–27]. Prevalence of S. aureus strains amongst the are methicillin resistant [32]. Higher pathogenicity and cockroach samples collected from Bangladesh [25], Iran resistance of MRSA strains have also been reported in [28], Nigeria [29], Ethiopia [1], Algeria [4], Brazil [30] different types of human clinical infections [33, 34]. and China [31] were 38, 62.86, 7.70, 69.20, 13.80, 49 and Similar antibiotic resistance patterns of the MRSA 5%, respectively. strains have also been reported against aminoglycosides Research on S. aureus carried by cockroaches in hos- [6–9, 35–38], cephems [6–9, 35–38], penicillins [6–9, pital environments is very important in relation to the 35–38], macrolides [35–38], tetracyclines [6–9, 36, 37], control of nosocomial infections, which are becoming a fluoroquinolones [6–9, 35–38], lincosamides [6–9, 35– major challenge. These infections cause high morbidity 38], folate inhibitors [6–9, 35–38], phenicols [6–9, 36, and mortality and increased hospitalization time having 37] and ansamycins [6–9, 36, 37] groups of antibiotics. a consequent increase in costs. Cockroaches are able to Islam et al. (2016) [25] reported that S. aureus strains explore various spaces in a hospital environment, mak- isolated from cockroach samples harbored the highest ing them a potential health risk, due to their ability to prevalence of resistance against erythromycin (58%), disperse pathogenic strains. Their growth is facilitated kanamycin (23%), penicillin (71%), oxacillin (45.50%), by fluids and food, as well as structural flaws in the hos- cephalothin (11%) and clindamycin (38%) antibiotic pital environment. Hospital infection is a major chal- agents. Prado et al. (2006) [39]reported that S. aureus lenge for health professionals working in this area. The strains isolated from cockroach samples harbored the need to control and limit cockroaches has been stressed highest prevalence of resistance against ampicillin by most researchers. (30.80%), cephalexin (30.80%), cefepime (23%), and oxacil- MRSA strains isolated from hospital cockroaches har- lin (38.50%) antibiotic agents. Fowoyo and Ogunbanwo bored relatively high prevalence of resistance against (2017) [40] reported that the S. aureus strains exhibited tested antibiotic agents. MRSA strains harbored the high- the high prevalence of resistance against ampicillin est prevalence of resistance against penicillin, ceftaroline, (86.70%), trimethoprim–sulfamethoxazole (74.90%), tetracycline, gentamicin, trimethoprim-sulfamethoxazole amoxicillin–clavulanic acid (52.50%), cefotaxime (3.50%), antibiotic agents. Additionally, prevalence of blaZ, oxacillin (35.70%), ciprofloxacin (23.90%), erythromycin aacA-D, tetK, msrA and dfrA was relatively higher than (15.70%), gentamicin (11.40%) and ofloxacin (7.10%). Rong other tested antibiotic resistance genes. We found that et al. (2017) [41] reported that the prevalence of antibiotic phenotypic properties of antibiotic resistance were ap- resistance in the S. aureus strains against ampicillin, penicil- proved using the genotypic characterization of antibiotic lin, amoxicillin–clavulanic acid, cefoxitin, ceftazidime, cefe- resistance. MRSA strains isolated from P. americana pime, kanamycin, streptomycin, amikacin, gentamicin, cockroaches and also external washing samples had the norfloxacin, ciprofloxacin, erythromycin, tetracycline, clinda- higher prevalence of antibiotic resistance and antibiotic mycin, chloramphenicol, trimethoprim-sulfamethoxazole, resistance genes. We also found the higher prevalence of vancomycin and rifampicin were 88.20, 88.20, 73.90, 8.40, resistance against human-based antibiotic agents in the 10.90, 8.40, 22.70, 14.30, 1.70, 4.20, 6.70, 5.00, 53.80, 26.90, MRSA strains isolated from hospital cockroaches which 12.60, 7.50, 7.50, 0 and 2.50%, respectively. may indirectly show transmission of resistant MRSA We found that all of the MRSA strains were strains from infected patients hospitalized in hospitals and positive for the mecA gene. Most of the health care units to resident cockroaches of hospitals. An- tetracycline-resistant MRSA isolates harbored tetK tibiotics are not normally applied on cockroaches, but it is and tetM genes. Prevalence of aacA-D gene was high known that high resistance rates were reported among among gentamicin and amikacin-resistant MRSA pathogens associated foods. In fact, a great association be- strains. Prevalence of msrA, ermA and linA antibiotic tween cockroaches and foods could be the probable rea- resistance genes were also significant among the son for isolation of resistant strains from cockroaches. macrolide, erythromycin and clindamycin-resistant Our findings revealed that more than 50% of S. aureus MRSA strains. Additionally, high prevalence of dfrA, Abdolmaleki et al. Antimicrobial Resistance and Infection Control (2019) 8:54 Page 11 of 14 rpoB and cat1 antibiotic resistance genes were also tetM on conjugative transposons contributes to the found amongst the trimethoprim-sulfamethoxazole, ri- spread of these determinants [46]. Some of the MRSA fampin and chloramphenicol-resistant MRSA strains. strains harbored ermA gene.Thisgeneisoften lo- Finally, high distribution of gyrA and grlA antibiotic cated on small multicopy plasmids which are present resistance genes were found amongst the ciprofloxa- in many different staphylococcal species [46]. The cin and levofloxacin-resistant MRSA strains. There- ermA gene is usually carried by transposons which fore, the pattern of the antibiotic resistance of the could explain its high prevalence amongst the MRSA MRSA strains of hospital cockroach samples was con- strains. Resistance to aminoglycosides (60 to 83.33%) firmed by the PCR amplification of the specific anti- whichencodebythe aacA-D gene (73.33 to 88.88%) biotic resistance genes. MRSA strains of our study is also prevalent. Johler et al. (2011) [46]reported had considerable prevalence of resistance against clin- that prevalence of ermA, tetK and tetM antibiotic re- damycin (44.44 to 46.66%). The most imperative sistance genes among the S. aureus strains isolated mechanism involving resistance against clindamycin is from cases of food poisoning, milk and pork were 25, modulated by methylase enzyme which often encoded 4.87 and 0%, 50, 0 and 12.82% and 0, 12.19, and by ermA gene [42]. Prevalence of ermA antibiotic re- 53.84%, respectively. Podkowik et al. (2012) [47]re- sistance genes among the MRSA strains of our ported that the prevalence of tetracycline resistance research were 46.66 to 50%. Majority of our isolates genes (tetO, tetK and tetM) and erythromycin resist- carried two tetracyclines, two erythromycins, one ance methylase gene (ermA, ermB and ermC)among macrolide and several streptogramin resistance deter- the S. aureus strains were 44 and 60%, respectively. minants reveals a great diffusion of these types of Prevalence of blaZ, rpoB, dfrA, gyrA, grlA and cat1 resistance. TetK, ermA, msrA and aacA-D which en- antibiotic resistance genes amongst the MRSA strains code resistance against tetracycline, erythromycin, isolated from hospital cockroaches were 100%, 20– macrolides and aminoglycosides were the most com- 27.77%, 60–63.88%, 38.88–46.66%, 20–27.77% and monly detected antibiotic resistance genes in the 19.44–20%, respectively. High prevalence of blaZ, MRSA strains isolated of hospital cockroach samples. rpoB, dfrA, gyrA, grlA and cat1 antibiotic resistance Furthermore, prevalence of blaZ, dfrA and gyrA anti- genes was also reported in the S. aureus strains iso- biotic resistance genes which encode resistance lated from human clinical infection samples [48–50]. against penicillins, folate inhibitors and fluoroquino- Resistance to benzylpenicillin is mainly caused by the lones, respectively. The literature survey did not indi- blaZ gene encoding production of beta-lactamases, cate any report on the prevalence of blaZ, rpoB, which hydrolytically destroy beta-lactams. Our results gyrA, grlA, vatA, vatB, vatC, dfrA, cat1, msrA, ermA, suggest that blaZ may play a major role in occur- linA, aacA-D, tetK and tetM genes among the MRSA rence of resistance against penicillins but cannot be strains of hospital cockroach samples. Kumar et al. used alone as an indicator for penicillin resistance. Ri- (2010) [43] reported that the most commonly identi- fampin acts by interacting specifically with the β sub- fied antibiotic resistance genes among the S. aureus unit of the bacterial RNA polymerase encoded by the isolates were linA (51.60%), msrB (46.10%), tetK rpoB gene. RpoB expression will increase the preva- (34.40%), tetM (34.40%), msrA (26.60%) and aacA-D lence of resistance against rifampin in the S. aureus (26.60%). Karataş et al. (2017) [44]revealed the higher strains. Low prevalence of cat1 antibiotic resistance prevalence of ermA than ermc antibiotic resistance geneis maybedue to thelow levels of prescription genes among the clindamycin, erythromycin and of chloramphenicol in veterinary and medical sci- telithromycin-resistant and also higher prevalence of ences. Additionally, chloramphenicol is forbidden tetM than tetK antibiotic resistance genes among the antibiotic agent in Iran. We also found the high tetracycline-resistant MRSA strains which were simi- prevalence of MRSA strains in the hospital cockroach lar to our findings. Our results were also similar with samples. The multi-drug resistant S. aureus in cock- those of the previous research which was conducted roach was reported earlier from Nigeria, Ethiopia, by Simeoni et al. (2008) [45]. They reported that the Iran, and Brazil [3, 4, 51–53]. Though this study prevalence of tetM, tetO, tetK, ermA, ermB, ermC, tested multi-drug resistant against single bacterium, aac, blaZ and mecA antibiotic resistance genes in the absence of prior work, the findings of this amongst the S. aureus strains isolated from meat study would signify the emergence of MRSA in the samples were 100, 0, 91.66, 16.66, 33.33, 58.33, 0, 100 environment and the prospective likelihood of dissem- and 58.33%, respectively. High prevalence of tetK and ination of such strains through mechanical vector B. tetM antibiotic resistance genes in the MRSA isolates germanica and P. americana cockroaches in Iran. can be clarified by their usual genetic locations. Pres- MRSA strains are considered as important foodborne ence of tetK gene on small multicopy plasmids and pathogens all-around the world. Thus, their high Abdolmaleki et al. Antimicrobial Resistance and Infection Control (2019) 8:54 Page 12 of 14 prevalence in hospital cockroaches may influence on Ethics approval and consent to participate The study was approved by the Ethical Council of Research of the Faculty of their presence in food samples of hospitals. It is because Veterinary Medicine, Karaj Branch, Islamic Azad University, Karaj, Iran (Consent of the fact that cockroaches can easily penetrate into the Ref Number 1159706100005). Verification of this research project and the hospital food store units. High prevalence of S. aureus licenses related to sampling process were approved by the Dr. Zohreh Abdolmaleki and Dr. Zohreh Mashak (Approval Ref Number 25273). and other foodborne pathogens have also been reported previously [54-64]. Consent for publication There was no consent for publication. Conclusions The present investigation is the first report of the Competing interests phenotypic and genotypic evaluation of antibiotic resist- The authors declare that they have no competing interests. ance in the MRSA strains isolated from external washing and gut content samples of B. germanica and P. ameri- Publisher’sNote cana hospital cockroaches. High prevalence of S. aureus Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. and MRSA strains, higher prevalence of bacteria in P. americana cockroaches, higher prevalence of bacteria in Author details external washing samples of cockroaches, high preva- Department of Pharmacology, Faculty of Veterinary Medicine, Karaj Branch, Islamic Azad University, Karaj, Iran. Department of Food Hygiene, Faculty of lence of resistance against penicillin, ceftaroline tetracycline, Veterinary Medicine, Karaj Branch, Islamic Azad University, Karaj, Iran. Halal gentamicin and trimethoprim-sulfamethoxazole, high distri- Research Center of IRI, FDA, Tehran, Iran. bution of blaZ, aacA-D, tetK, msrA, dfrA, ermA, gyrA and Received: 17 December 2018 Accepted: 4 March 2019 grlA antibiotic resistance genes and higher prevalence of MRSA strains in external washing samples of P. americana cockroaches were the most important findings of the References present study. The present study shows the high importance 1. Moges F, Eshetie S, Endris M, Huruy K, Muluye D, Feleke T, et al. of hospital cockroaches as dangerous reservoirs for harbor- Cockroaches as a source of high bacterial pathogens with multidrug resistant strains in Gondar town, Ethiopia. Biomed Res Int. 2016;2016:1–7. ing of virulent and resistant MRSA strains in the hospital 2. Fakoorziba M, Eghbal F, Hassanzadeh J, Moemenbellah-Fard M. Cockroaches environment and their transmission to human population. (Periplaneta americana and Blattella germanica) as potential vectors of the Otherwise, external surface of the P. americana cockroaches pathogenic bacteria found in nosocomial infections. Ann Tropic Med Parasit. 2010;104:521–8. can act as a mechanical vector for transmission of MRSA 3. Akinjogunla OJ, Odeyemi A, Udoinyang E. Cockroaches (Periplaneta strains in the hospital environment in Iran. However, fur- americana and Blattella germanica): reservoirs of multi drug resistant (MDR) ther studies are required to find additional knowledge bacteria in Uyo, Akwa Ibom state. Sci J Bio Sci. 2012;1:19–30. 4. Menasria T, Moussa F, El-Hamza S, Tine S, Megri R, Chenchouni H. Bacterial about the microbiological and epidemiological roles of load of German cockroach (Blattella germanica) found in hospital the hospital cockroaches in survival and transmission environment. Pathog Glob Health. 2014;108:141–7. of antibiotic-resistant bacteria. 5. Wang L, Ruan S. Modeling nosocomial infections of methicillin-resistant Staphylococcus aureus with environment contamination. Sci Rep. 2017;7:580. Abbreviations 6. Safarpoor Dehkordi F, Gandomi H, Akhondzadeh Basti A, Misaghi A, Rahimi Blattella germanica: B. germanica; MRSA: Methicillin-resistant Staphylococcus E. Phenotypic and genotypic characterization of antibiotic resistance of aureus; PCR: Polymerase Chain Reaction; Periplanets americana: P. americana; methicillin-resistant Staphylococcus aureus isolated from hospital food. S. aureus: Staphylococcus aureus; SPSS: Statistical Package for the Social Antimicrob Resist Infect Control. 2017;6:104. Sciences 7. Safarpoor Dehkordi F, Akhondzadeh Basti A, Gandomi H, Misaghi A, Rahimi E. Pathogenic Staphylococcus aureus in hospital food samples; prevalence Acknowledgements and antimicrobial resistance properties. J Food Saf. 2018;38:e12501. The authors would like to thank Prof. Jamshidi from the Department of 8. Momtaz H, Dehkordi FS, Rahimi E, Asgarifar A, Momeni M. Virulence genes Microbiology, Science and Research Branch, Islamic Azad University, Tehran, and antimicrobial resistance profiles of Staphylococcus aureus isolated from Iran for his important roles in the research project. Authors would also thank chicken meat in Isfahan province, Iran. J Appl Poult Res. 2013;22:913–21. from the Research Deputy of the Islkamic Azad University, Science and 9. Hasanpour Dehkordi A, Khaji L, Sakhaei Shahreza M, Mashak Z, Safarpoor Research Branch, Tehran, Iran for financial support of the currenbt research. Dehkordi F, Safaee Y, et al. One-year prevalence of antimicrobial susceptibility pattern of methicillin-resistant Staphylococcus aureus Funding recovered from raw meat. Tropic Biomed. 2017;34:396–404. This work was supported by the Faculty of Veterinary Medicine, Islamic Azad 10. Klevens RM, Morrison MA, Nadle J, Petit S, Gershman K, Ray S, et al. Invasive University, Karaj Branch, Karaj, Iran (grant no. 1159706100005). methicillin-resistant Staphylococcus aureus infections in the United States. JAMA. 2007;298:1763–71. Availability of data and materials 11. Reierson DA, Rust MK. Trapping, flushing, counting German roaches. Pest All data generated or analyzed throughout this research are included in this Control. 1997;40:42–4. published article. 12. Harwood RF, James MT. Entomology in human and animal health. seventh ed. New York, NY: Macmillan Publishing; 1979. Authors’ contributions 13. Fijałkowski K, Peitler D, Karakulska J. Staphylococci isolated from ready-to-eat FSD designed the study and carried out the culture-based identification and meat–identification, antibiotic resistance and toxin gene profile. Int J Food PCR genetic alignment. ZA and ZM supported the study and carried out the Microb. 2016;238:113–20. samples collection, disk diffusion and statistical analysis. ZA carried out the 14. CLSI. Performance Standards for Antimicrobial Susceptibility Testing; 17th writing and drafting of the manuscript. All authors read and approved the Informational Supplement. In: CLSI document M100-S17. Wayne: Clinical final manuscript. and laboratory standards institute; 2007. Abdolmaleki et al. Antimicrobial Resistance and Infection Control (2019) 8:54 Page 13 of 14 15. CLSI. Performance Standards for Antimicrobial Susceptibility Testing; 37. Jackson CR, Davis JA, Barrett JB. Prevalence and characterization of Twenty-Fifth Informational Supplement. In: CLSI document M100-S25. methicillin-resistant Staphylococcus aureus isolates from retail meat and Wayne: Clinical and Laboratory Standards Institute; 2015. humans in Georgia. J Clin Microbiol. 2013;51:1199–207. 16. Lina G, Quaglia A, Reverdy M-E, Leclercq R, Vandenesch F, Etienne J. Distribution 38. Daka D, Yihdego D. Antibiotic-resistance Staphylococcus aureus isolated of genes encoding resistance to macrolides, lincosamides, and streptogramins from cow’s milk in the Hawassa area, South Ethiopia. Ann Clin Microbiol among staphylococci. Antimicrob Agents Chemother. 1999;43:1062–6. Antimicrob. 2012;11:26. 17. Strommenger B, Kettlitz C, Werner G, Witte W. Multiplex PCR assay for 39. Prado MA, Gir E, Pereira MS, Reis C, Pimenta FC. Profile of antimicrobial simultaneous detection of nine clinically relevant antibiotic resistance genes resistance of bacteria isolated from cockroaches (Periplaneta americana) in a in Staphylococcus aureus. J Clin Microb. 2003;41:4089–94. Brazilian health care institution. Braz J Infect Dis. 2006;10:26–32. 18. Baddour M, AbuElKheir M, Fatani A. Comparison of mecA polymerase chain 40. Fowoyo P, Ogunbanwo S. Antimicrobial resistance in coagulase-negative reaction with phenotypic methods for the detection of methicillin-resistant staphylococci from Nigerian traditional fermented foods. Ann Clin Microb Staphylococcus aureus. Current Microb. 2007;55:473. Antimicrob. 2017;16:4. 19. Van TTH, Chin J, Chapman T, Tran LT, Coloe PJ. Safety of raw meat and 41. Rong D, Wu Q, Xu M, Zhang J, Yu S. Prevalence, virulence genes, shellfish in Vietnam: an analysis of Escherichia coli isolations for antibiotic antimicrobial susceptibility, and genetic diversity of Staphylococcus aureus resistance and virulence genes. Int J Food Microb. 2008;124:217–23. from retail aquatic products in China. Front Microbiol. 2017;8:714. 20. Schmitz FJ, Köhrer K, Schering S, Verhoef J, Fluit A, Heinz HP, et al. The 42. Zelazny AM, Ferraro MJ, Glennen A, Hindler JF, Mann LM, Munro S, et al. stability of grlA, grlB, gyrA, gyrB and norA mutations and MIC values of five Selection of strains for quality assessment of the disk induction method for fluoroquinolones in three different clonal populations of methicillin-resistant detection of inducible clindamycin resistance in staphylococci: a CLSI Staphylococcus aureus. Clin Microb Infect. 1999;5:287–90. collaborative study. J Clin Microbiol. 2005;43:2613–5. 21. Shittu AO, Okon K, Adesida S, Oyedara O, Witte W, Strommenger B, et al. 43. Kumar R, Yadav B, Singh R. Genetic determinants of antibiotic resistance in Antibiotic resistance and molecular epidemiology of Staphylococcus aureus Staphylococcus aureus isolates from milk of mastitic crossbred cattle. Current in Nigeria. BMC Microbiol. 2011;11:92. Microbiol. 2010;60:379–86. 22. Aboshkiwa M, Rowland G, Coleman G. Nucleotide sequence of the 44. Karataş E, Fahriye EI, Yasemin Z. Investigation of antibiotic resistance Staphylococcus aureus RNA polymerase rpoB gene and comparison of its genes and panton-valentine leucocidin in Staphylococcus aureus predicted amino acid sequence with those of other bacteria. Biochim strains isolated from various clinical samples. Acta Med Mediterranea. Biophys Acta. 1995;1262:73–8. 2017;33:341–9. 23. Pai H-H, Chen W-C, Peng C-F. Isolation of bacteria with antibiotic resistance 45. Simeoni D, Rizzotti L, Cocconcelli P, Gazzola S, Dellaglio F, Torriani S. from household cockroaches (Periplaneta americana and Blattella Antibiotic resistance genes and identification of staphylococci collected germanica). Acta Trop. 2005;93:259–65. from the production chain of swine meat commodities. Food Microbiol. 2008;25:196–201. 24. Ranjbar R, Masoudimanesh M, Dehkordi FS, Jonaidi-Jafari N, Rahimi E. Shiga (Vero)-toxin producing Escherichia coli isolated from the hospital foods; 46. Johler S, Layer F, Stephan R. Comparison of virulence and antibiotic virulence factors, o-serogroups and antimicrobial resistance properties. resistance genes of food poisoning outbreak isolates of Staphylococcus Antimicrob Resist Infect Control. 2017;6:4. aureus with isolates obtained from bovine mastitis milk and pig carcasses. J 25. Islam A, Nath AD, Islam K, Islam S, Chakma S, Hossain MB, et al. Isolation, Food Protect. 2011;74:1852–9. identification and antimicrobial resistance profile of Staphylococcus aureus in 47. Podkowik M, Bystroń J, Bania J. Prevalence of antibiotic resistance genes in cockroaches (Periplaneta americana). J Adv Vet Animal Res. 2016;3:221–8. staphylococci isolated from ready-to-eat meat products. Polish J Vet Sci. 26. Feizhaddad M-H, Kassiri H, Sepand M-R, Ghasemi F. Bacteriological survey of 2012;15:233–7. American cockroaches in hospitals. Middle-East J Sci Res. 2012;12:985–9. 48. Akanbi OE, Njom HA, Fri J, Otigbu AC, Clarke AM. Antimicrobial 27. Hamid K, Shahnaz K. Cockroaches [periplaneta Americana (L.), dictyoptera; susceptibility of Staphylococcus aureus isolated from recreational waters and blattidae] as carriers of bacterial pathogens, Khorramshahr County, Iran. beach sand in eastern Cape Province of South Africa. Int J Environ Res Jundishapur J Microb. 2012;5:320–2. Public Health. 2017;14:1001. 28. Heidari Soureshjani E, Doosti A. Examination methicillin-resistant 49. Duran N, Ozer B, Duran GG, Onlen Y, Demir C. Antibiotic resistance genes & Staphylococcus aureus (MRSA) prevalence in cockroaches from hospital in susceptibility patterns in staphylococci. Indian J Med Res. 2012;135:389. Chaharmahal-va-Bakhtiari province, Iran by polymerase chain reaction (PCR). 50. Gordon N, Price J, Cole K, Everitt R, Morgan M, Finney J, et al. Prediction of Int J Med Med Sci. 2013;5:324–9. Staphylococcus aureus antimicrobial resistance from whole genome 29. Isaac C, Orue PO, Iyamu MI, Ehiaghe JI, Isaac O. Comparative analysis of sequencing. J Clin Microbiol. 2014;52:1182–91. pathogenic organisms in cockroaches from different community settings in 51. Tachbele E, Erku W, Gebre-Michael T, Ashenafi M. Cockroach-associated Edo state, Nigeria. Korean J Parasitol. 2014;52:177. food-borne bacterial pathogens from some hospitals and restaurants in 30. Oliveira PS, Souza SG, Campos GB, da Silva DC, Sousa DS, Araújo SP, et al. Addis Ababa, Ethiopia: distribution and antibiograms. J Rural Trop Public Isolation, pathogenicity and disinfection of Staphylococcus aureus carried by Health. 2006;5:34–41. insects in two public hospitals of Vitória da Conquista, Bahia, Brazil. Brazilian 52. Salehzadeh A, Tavacol P, Mahjub H. Bacterial, fungal and parasitic J Infect Dis. 2014;18:129–36. contamination of cockroaches in public hospitals of Hamadan, Iran. J Vector Borne Dis. 2007;44:105–10. 31. Pai H-H, Chen W-C, Peng C-F. Cockroaches as potential vectors of nosocomial infections. Nfect. Control Hosp Epidemiol. 2004;25:979–84. 53. Pai H-H. Multidrug resistant bacteria isolated from cockroaches in long-term 32. Ekrami A, Samarbafzadeh A, Alavi M, Kalantar E, Hamzeloi F. Prevalence of care facilities and nursing homes. Acta Tropic. 2013;125:18–22. methicillin resistant Staphylococcus species isolated from burn patients in a 54. Dehkordi FS, Haghighi N, Momtaz H, Rafsanjani MS, Momeni M. burn center, Ahvaz, Iran. Jundishapur J Microbiol. 2010;3:84–91. Conventional vs real-time PCR for detection of bovine herpes virus type 33. Jani M, Sengupta S, Hu K, Azad RK. Deciphering pathogenicity and 1 in aborted bovine, buffalo and camel foetuses. Bulgar J Vet Med. antibiotic resistance islands in methicillin-resistant Staphylococcus aureus 2013;16:102–11. genomes. Open Bio. 2017;7:170094. 55. Dehkordi FS, Khamesipour F, Momeni M. Brucella abortus and Brucella 34. Espadinha D, Faria NA, Miragaia M, Lito LM, Melo-Cristino J, de melitensis in Iranian bovine and buffalo semen samples: The first clinical trial Lencastre H, et al. Extensive dissemination of methicillin-resistant on seasonal, Senile and geographical distribution using culture, Staphylococcus aureus (MRSA) between the hospital and the community conventional and real-time polymerase chain reaction assays. Kafkas Univ in a country with a high prevalence of nosocomial MRSA. PLoS One. Vet Fak Dergisi. 2014;20:821-8. 2013;8:e59960. 56. Dehkordi FS, Parsaei P, Saberian S, Moshkelani S, Hajshafiei P, Hosseini SR, et 35. Paludi D, Vergara A, Festino AR, Di Ciccio P, Costanzo C, Conter M, et al. al Prevalence study of Theileria annulata by comparison of four diagnostic Antimicrobial resistance pattern of methicillin-resistant Staphylococcus techniques in southwest Iran. Bulgar J Vet Med. 2012;15:123-30. aureus in the food industry. J Biol Regul Homeost Agents. 2011;25:671. 57. Dehkordi FS, Valizadeh Y, Birgani TA, Dehkordi KG. Prevalence Study of 36. Sallam KI, Abd-Elghany SM, Elhadidy M, Tamura T. Molecular Brucella melitensis and Brucella abortus in cow's milk using dot enzyme characterization and antimicrobial resistance profile of methicillin-resistant linked immuno sorbent assay and duplex polymerase chain reaction. J Pure Staphylococcus aureus in retail chicken. J Food Protect. 2015;78:1879–84. Appl Microbiol. 2014;8:1065-9. Abdolmaleki et al. Antimicrobial Resistance and Infection Control (2019) 8:54 Page 14 of 14 58. Ghorbani F, Gheisari E, Dehkordi FS. Genotyping of vacA alleles of Helicobacter pylori strains recovered from some Iranian food items. Trop J Pharm Res. 2016;15;1631-6. 59. Hemmatinezhad B, Khamesipour F, Mohammadi M, Safarpoor Dehkordi F, Mashak Z. Microbiological investigation of O‐ serogroups, virulence factors and antimicrobial resistance properties of shiga toxin‐ producing Escherichia coli isolated from ostrich, turkey and quail meats. J Food Safety. 2015;35: 491-500. 60. Madahi H, Rostami F, Rahimi E, Dehkordi FS. Prevalence of enterotoxigenic Staphylococcus aureus isolated from chicken nugget in Iran. Jundishapur J Microbiol. 2013;7:e10237. 61. Momtaz H, Davood Rahimian M, Safarpoor Dehkordi F. Identification and characterization of Yersinia enterocolitica isolated from raw chicken meat based on molecular and biological techniques. J Appl Poultry Res. 2013;22: 137-45. 62. Rahimi E, Sepehri S, Dehkordi FS, Shaygan S, Momtaz H. Prevalence of Yersinia species in traditional and commercial dairy products in Isfahan Province, Iran. Jundishapur J Microbiol. 2014;7:e9249. 63. Rahimi E, Yazdanpour S, Dehkordi FS. Detection of Toxoplasma gondii antibodies in various poultry meat samples using enzyme linked immuno sorbent assay and its confirmation by polymerase chain reaction. J Pure Appl Microbiol. 2014;8:421-7. 64. Safarpoor Dehkordi F, Barati S, Momtaz H, Hosseini Ahari SN, Nejat Dehkordi S. Comparison of shedding, and antibiotic resistance properties of Listeria monocytogenes isolated from milk, feces, urine, and vaginal secretion of bovine, ovine, caprine, buffalo, and camel species in Iran. Jundishapur J Microbiol. 2013;6:284-94.
Journal
Antimicrobial Resistance & Infection Control – Springer Journals
Published: Mar 13, 2019