Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Prevalence of high-risk human papillomavirus types in Mexican women with cervical intraepithelial neoplasia and invasive carcinoma

Prevalence of high-risk human papillomavirus types in Mexican women with cervical intraepithelial... Background: Prevalence of high risk (HR) human papillomavirus (HPV) types in the states of San Luis Potosí (SLP) and Guanajuato (Gto), Mexico, was determined by restriction fragment length-polymorphism (RFLP) analysis on the E6 ~250 bp (E6-250) HR-HPV products amplified from cervical scrapings of 442 women with cervical intraepithelial neoplasia and invasive carcinoma (280 from SLP and 192 from Gto). Fresh cervical scrapings for HPV detection and typing were obtained from all of them and cytological and/or histological diagnoses were performed on 383. Results: Low grade intraepithelial squamous lesions (LSIL) were diagnosed in 280 cases (73.1%), high grade intraepithelial squamous lesions (HSIL) in 64 cases (16.7%) and invasive carcinoma in 39 cases (10.2%). In the 437 cervical scrapings containing amplifiable DNA, only four (0.9%) were not infected by HPV, whereas 402 (92.0%) were infected HR-HPV and 31 (7.1%) by low-risk HPV. RFLP analysis of the amplifiable samples identified infections by one HR-HPV type in 71.4%, by two types in 25.9% and by three types in 2.7%. The overall prevalence of HR-HPV types was, in descending order: 16 (53.4%) > 31 (15.6%) > 18 (8.9%) > 35 (5.6) > 52 (5.4%) > 33 (1.2%) > 58 (0.7%) = unidentified types (0.7%); in double infections (type 58 absent in Gto) it was 16 (88.5%) > 31 (57.7%) > 35 (19.2%) > 18 (16.3%) = 52 (16.3%) > 33 (2.8%) = 58 (2.8%) > unidentified types (1.0%); in triple infections (types 33 and 58 absent in both states) it was 16 (100.0%) > 35 (54.5%) > 31 (45.5%) = 52 (45.5%) > 18 (27.3%). Overall frequency of cervical lesions was LSIL (73.1%) > HSIL (16.7%) > invasive cancer (10.2%). The ratio of single to multiple infections was inversely proportional to the severity of the lesions: 2.46 for LSIL, 2.37 for HSIL and 2.15 for invasive cancer. The frequency of HR-HPV types in HSIL and invasive cancer lesions was 16 (55.0%) > 31 (18.6%) > 35 (7.9%) > 52 (7.1%) > 18 (4.3%) > unidentified types (3.6%) > 33 (2.9%) > 58 (0.7%). Conclusion: Ninety percent of the women included in this study were infected by HR-HPV, with a prevalence 1.14 higher in Gto. All seven HR-HPV types identifiable with the PCR-RFLP method used circulate in SLP and Gto, and were diagnosed in 99.3% of the cases. Seventy-one percent of HR-HPV infections were due to a single type, 25.9% were double and 2.7% were triple. Overall frequency of lesions was LSIL (73.1%) > HSIL (16.7%) > invasive cancer (10.2%), and the ratio of single to multiple infections was inversely proportional to severity of the lesions: 2.46 for LSIL, 2.37 for HSIL and 2.15 for invasive cancer. The frequency of HR-HPV types found in HSIL and invasive cancer was 16 (55.0%) > 31 (18.6%) > 35 (7.9%) > 52 (7.1%) > 18 (4.3%) > unidentified types (3.6%) > 33 (2.9%) > 58 (0.7%). Since the three predominant types (16, 31 and 18) cause 77.9% of the HR-HPV infections and immunization against type 16 prevents type 31 infections, in this region the efficacy of the prophylactic vaccine against types 16 and 18 would be close to 80%. Page 1 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 In the present work we determined the prevalence of the Background Cervical cancer (CC) is the second cause of death by can- HR-HPV types circulating in the neighboring states of San cer among women in the world and the first in most Luis Potosí and Guanajuato by restriction fragment length developing countries [1,2]. In the year 2000, 190,000 polymorphism (RFLP) analysis with the method of Fuji- deaths and 80% of the 500,000 new CC cases occurred in naga et al. [19], in women with precancerous and cancer- the developing world, and Latin American countries were ous lesions of the cervix that had been diagnosed by among those with the highest incidence rates, together cytological analysis; in two thirds of them biopsies or sur- with countries from Sub-Saharan Africa, South and South gical specimens were obtained and the microscopic diag- East Asia [3]. The risk of developing CC increases with nosis confirmed. early start of sexual activity, number of sexual partners, prolonged use of oral contraceptives and smoking [4]. In Results Mexico it is associated with poverty related factors such as Study population low schooling, unemployment, residence in rural areas The 442 women enrolled in this study ranged from 16 to and lack of access to health services [5-7]. 78 years of age. Fresh cervical scrapings for HPV detection and typing were obtained from all of them whereas cyto- zur Hausen [8] proposed and later demonstrated [9] that logical and/or histological diagnoses were performed on human papillomaviruses (HPV) are the infectious agents 383. Low grade intraepithelial squamous lesions (LSIL) responsible of the neoplastic transformation of the cervi- were diagnosed in 280 cases (73.1%), high grade intraep- cal epithelium. This hypothesis was validated by finding ithelial squamous lesions (HSIL) in 64 cases (16.7%) and HPV genome sequences in 99.7% of invasive CC cases invasive carcinoma in 39 cases (10.2%). [10]. It is currently accepted that HPV is the most com- mon sexually transmitted pathogen [11] and that infec- Algorithm for HPV DNA amplification of cervical scrapings tion of the cervix by 'high risk' (HR) HPV types is a Amplification of the HR-HPV E6-250 product by direct necessary factor for CC development [10,12]. Low risk and nested PCR was compared. Direct PCR was performed (LR) HPV types are those usually found in warts and with primer set pU 1M/2R whereas nested PCR was per- benign lesions whereas HR types are those found in inva- formed in two successive reactions: in the first one sive CC [13]. ('direct') the E6-650 segment was amplified using primer set LCRS/E7AS, whereas in the second one ('nested') a There are 11 major LR-HPV types (designated as 6, 11, 40, portion of the first reaction mixture (presumed to contain 42, 43, 44, 54, 61, 70, 72, 81) and 15 major HR-HPV types the E6-650 product) was used as template for the internal (designated as 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, primers (pU 1M/2R) to generate E6-250. 59, 68, 73, 82) [14]. The two most frequently associated to malignancies are HR-HPV types 16 and 18. The first is Amplification of 35 random samples showed that 11 responsible for nearly 50% and the second for nearly 20% (31.4%) were positive by direct PCR and 24 (68.6%) by of all invasive CC cases in the world [10,15]. Several HR- nested PCR. Since E6-250 detection was 2.2 times more HPV variants with higher oncogenic potential are more sensitive with nested PCR, this modality was chosen to prevalent in developing countries, where they appear to analyze all problem samples. contribute to the higher incidence and mortality rates. In Mexico the probability of developing CC by the Asian- To determine the presence of HPV DNA in cervical scrap- American variant of HPV type 16 is several times higher ings the algorithm shown in Fig. 1 was used. Each sample than by the European variant, and around 25% of invasive is first subjected to nested PCR to successively amplify the CC cases are attributed to the AA variant [16]. E6-650 and E6-250 products. If the second one is visible, the sample is considered positive for HR-HPV (examples During the year 2000 the incidence of CC in Mexico was in Fig. 2A) and typified by RFLP (examples in Fig. 2B and 40.5 cases per 100,000 women over 25 years of age and 3C). If the second product is not observed, the sample the mortality rate was 17.1 [3], which means 12 deaths could be either positive, inadequate or negative. To define per day. In the Mexican states of San Luis Potosí (SLP) and if it is positive it is subjected to PCR with the primer set Guanajuato (Gto) the mortality rates for the same year MY 09/11; if L1-450 is observed, the sample is considered were respectively 15.5 and 21.7 [17]. Lazcano-Ponce et al. positive for low risk HPV and if L1-450 is not visible, the [18] found a HPV prevalence of 16.7% in Mexican women sample may be negative or of inadequate quality and sub- below 25 years of age which decreased to 3.7% in those of jected to PCR with the β-globin primer set. If the β-globin 25–44 years and increased to 23% in those above 65 product is observed the sample is considered to be ampli- years, and that HR-HPV types are more prevalent in all age fiable but HPV-negative; if it is not visible, the sample is groups whereas LR-HPV types are less prevalent in women considered inadequate (i.e., not amplifiable) and unde- under 25 years and increase with age. fined in relation to HPV infection. Page 2 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 To identify HR-HPV types the algorithm of Fig. 3 was used. The E6-250 product from each HR-HPV type has a specific size and a single restriction site for each of the five enzymes used, which generate two fragments of specific sizes allowing the identification of seven of the most fre- quent HR-HPV types. Ava II, the first enzyme used on each HR-HPV positive sample, identifies types 16, 18 and 33 (see examples in Fig. 2A). If Ava II does not digest the E6- 250 product or does it only partially, sample aliquots are Yes Yes Yes Yes RFL RFLP P HR-HP HR-HP HR-HPV V V simultaneously incubated with each of the four remaining typing typing !  !  !  !"! "! "! "! enzymes to identify types 31, 52, 35 and 58 (see examples in Fig. 2C). No No No No No Yes Yes Yes Yes Yes HR-HPV types circulating in the region L L LR-HPV R-HPV R-HPV In 402 of the 435 samples with HPV infection, one to #$ #$ #$ #$ #$ three of the seven identifiable HR-HPV types were No No No No No No detected. Yes Yes Yes Yes Amplifia Amplifiable ble The overall prevalence of HR-HPV types was, in descend- ȕȕȕȕ % % % % & & & & DNA DNA ing order: 16 (53.4%) > 31 (15.6%) > 18 (8.9%) > 35 (5.6) > 52 (5.4%) > 33 (1.2%) > 58 (0.7%) = unidentified No No No No No types (0.7%). Types 16, 31 and 18 therefore accounted for 77.9% of all the infections whereas the other four types DNA DNA n no ott accounted for only 12.9% of them. HPV type 16 predom- a am mplifia plifiable ble inated slightly in SLP (53.3%) over Gto (52.9%), type 31 in Gto (22.3%) over SLP (10.1%), and type 18 was equally prevalent in SLP and Gto (8.8%) (Table 3). A from wo Figure 1 lgorithm for high-risk H men with dysplasP tiV dete c and ne ction in cervic oplastic lesions al scrapings Algorithm for high-risk HPV detection in cervical HR-HPV types in single and multiple infections scrapings from women with dysplastic and neoplastic The overall prevalence of infections by a single HR-HPV lesions. It checks first for the presence of HPV DNA type was 71.4%, i.e., 2.5 times higher than that of infec- through nested PCR (expected to be positive in most sam- tions by two and three types (Table 4). ples) and then for the amplificability of β-globin DNA in HPV- negative samples (expected to be rare). The prevalence of infections by a single HR-HPV type was slightly higher in SLP (75.0%) than in Gto (67.4%), In the analysis of samples from women with cervical dys- whereas the overall prevalence of infections by two and plasia and neoplasia, as is the case of this study, this algo- three HR-HPV types was respectively 25.9% and 2.7%, of rithm saves labor, time and reagents because it first which 22.6% and 2.4% corresponded to SLP and 29.5% verifies the presence of HPV through nested PCR and 3.2% to Gto (Table 4). (expected to be positive in most samples) and then the amplificability of the HPV-negative samples (expected to The HR-HPV types of single, double and triple infections be rare) by performing a PCR assay for a single copy as well as the combinations of viral types in multiple housekeeping gene such as that of β-globin. infections found in all samples and per state are shown in Table 5. Using the algorithm for HPV detection (Fig. 1) the 437 cervical scrapings with amplifiable DNA were analyzed. Single infections HPV infection was demonstrated in 433 samples (99.1%) HPV type 16 was the most prevalent (72.6%) followed by of which 402 (92.0%) corresponded to high risk viral types 18 (10.2%) and 31 (9.9%) and then by types 52 types (Table 1). (3.3%), 33 (1.3%) = 35 (1.3%), and 58 (0.3%) (Table 5). Algorithm for HR-HPV typing The descending order of frequency of the viral types in sin- The sizes of E6-250 products and their corresponding gle infections was clearly different in each state. In SLP the restriction fragments for the seven HR-HPV types that can type 16 (77.4%) predominated, followed by types 18 be identified with the PCR-RFLP method used appear in (9.4%), 31 (8.2%), 52 (2.5%), 33 (1.3%), 35 (0.6%) = 58 Table 2. (0.6%). In Gto the prevalence of type 16 was lower Page 3 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 1 1 1 1 2 2 2 2 3 3 3 3 4 4 4 4 5 5 5 5 6 6 6 6 7 7 7 7 8 8 8 8 9 9 9 9 1 1 1 10 0 0 0 1 1 1 11 1 1 1 1 1 1 12 2 2 2 1 1 1 13 3 3 3 1 1 1 14 4 4 4 1 1 1 15 5 5 5 1 1 1 16 6 6 6 1 1 1 17 7 7 7 1 1 1 18 8 8 8 1 1 1 19 9 9 9 20 20 20 20 A A A bp bp bp bp bp 300 300 300 300 300 200 200 200 200 200 1 1 1 1 2 2 2 2 3 3 3 3 4 4 4 4 5 5 5 5 6 6 6 6 7 7 7 7 8 8 8 8 9 9 9 9 1 1 1 10 0 0 0 1 1 1 11 1 1 1 1 1 1 12 2 2 2 1 1 1 13 3 3 3 1 1 1 14 4 4 4 1 1 1 15 5 5 5 1 1 1 16 6 6 6 1 1 1 17 7 7 7 1 1 1 18 8 8 8 1 1 1 19 9 9 9 2 2 2 20 0 0 0 B B B bp bp bp bp bp 300 300 300 300 300 238 238 238 238 238 200 200 200 200 200 157 157 157 157 157 100 100 100 100 100 81 81 81 81 81 18 18 18 18 18 18 ? ? ? ? ? ? 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 + ? 16 + ? 16 + ? 16 + ? 16 + ? 16 + ? 1 1 1 1 1 2 2 2 2 2 3 3 3 3 3 4 4 4 4 4 5 5 5 5 5 6 6 6 6 6 7 7 7 7 7 8 8 8 8 8 9 9 9 9 9 1 1 1 1 10 0 0 0 0 1 1 1 1 11 1 1 1 1 1 1 1 1 12 2 2 2 2 1 1 1 1 13 3 3 3 3 1 1 1 1 14 4 4 4 4 1 1 1 1 15 5 5 5 5 1 1 1 1 16 6 6 6 6 1 1 1 1 17 7 7 7 7 1 1 1 1 18 8 8 8 8 1 1 1 1 19 9 9 9 9 2 2 2 2 20 0 0 0 0 C C C C bp bp bp bp 300 300 300 300 300 ~250 ~250 ~250 ~250 ~250 ~250 200 200 200 200 200 52 52 52 52 52 52 52 31 + 52 31 + 52 31 + 52 31 + 52 31 + 52 31 + 52 31 + 52 35 35 35 35 35 35 35 52 52 52 52 52 52 52 31 31 31 31 31 31 31 31 31 31 31 31 31 31 HR-HPV DNA de Figure 2 tection and typing HR-HPV DNA detection and typing. Examples of agarose gels used for detection of the E-250 products amplified by nested PCR, for the first stage of HR-HPV typing with Ava II, and for the second stage with Rsa I, Bgl II, Ava I and Acc I endonu- cleases. Numbers to the left indicate the size of the DNA markers; arrows to the right indicate the size of the products ampli- fied or the restriction fragments obtained. (A) HR-HPV DNA detection. Lane 1, 100 bp ladder. Lanes 2–18, DNA from different patients. Lane 19, Positive control (HeLa cell DNA). Lane 20, Negative control (no DNA). The expected E6-250 band appeared in the positive control and all problem samples except that of lane 8; Note the doublets in lanes 2 and 9 suggestive of double infection. (B) Identification of HPV types 16 and 18 by restriction with Ava II. Lanes 1 and 20, 100 bp ladder. Lanes 2 and 3, Positive control: E6-250 product from HeLa cell DNA intact (lane 2) and treated with Ava II (lane 3). Lanes 4–19: neighbor- ing lanes containing E6-250 products either intact or treated with Ava II. Lanes 4 and 5, Patient 322. Lanes 6 and 7, Patient 323. Lanes 8 and 9, Patient 324. Lanes 10 and 11, Patient 325. Lanes 12 and 13, Patient 326. Lanes 14 and 15, Patient 328. Lanes 16 and 17, Patient 329. Lanes 18 and 19, Patient 306. Note the slightly larger size of HPV18 product and fragments, as well as total and partial resistance to Ava II by samples from patients 322 (lane 5) and 328 (lane 15). (C) Identification of HPV types 31, 52 and 35. Groups of three neighboring lanes contained E6-250 products in mixtures incubated separately with Rsa I, Bgl II and Ava I endonucleases from each sample. Lanes 1 and 20, 100 bp ladder. Lanes 2–4, Patient 191. Lanes 5–7, Patient 197. Lanes 8–10, Patient 203. Lanes 11–13, Patient 209. Lanes 14–16, Patient 211. Lanes 17–19, Patient 246. Note that infections by one and two HPV types are clearly distinguished. Page 4 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 Table 1: Low risk- and high risk-HPV DNA detected in amplifiable samples Sample type SLP Gto Overall n% n% n% HR-HPV (E6+) 212 86.5 190 99.0 402 92.0 LR-HPV (E6-, L1+) 30 12.2 1 0.5 31 7.1 HPV negative (E6-, L1-, β-globin+) 3 1.2 1 0.5 4 0.9 Total 245 100.0 192 100.0 437 100.0 HR-HPV, positive for E6-250 product of high risk HPV. LR-HPV, low-risk HPV (negative for E6-250; positive for L1-450). Table 2: Size of the E6-250 products and restriction fragments of the seven HR-HPV types identified Enzyme HR-HPV type 16 18 31 33 35 52 58 Total length (bp) 238 268 232 244 232 231 244 Ava II 157/81 172/96 NC 136/108 NC NC NC Rsa I NC NC 117/115 NC NC NC NC Ava INC NC NC NC 186/46 NC NC Bgl II NC NC NC NC NC 176/55 NC Acc INC NC NC NC NC NC 126/118 Taken from Hwang [26]. NC, not cut. (63.3%) and type 31 was second (13.3%), followed by E6- E6- E6-250 250 250 types 18 (12.5%), 52 (4.7%), 35 (2.3%) and 33 (1.6%) (Table 5). Yes Yes Yes Yes ¿C ¿C ¿Cut ut ut by by by Ava Ava Ava II? II? II? VP VP VPH- H- H-16, 16, 16, - - -18, 18, 18, -33 -33 -33 Multiple infections No/parti No/parti No/parti No/partial al al allllly y y y The overall prevalence of HPV type 16 increased in double infections and reached its maximum possible value ¿ ¿ ¿C C Cut ut ut by by by Rs Rs Rsa a a I? I? I? ¿C ¿C ¿Cut ut ut by by by Bgl Bgl Bgl II? II? II? ¿C ¿C ¿Cut ut ut by by by Ava Ava Ava I? I? I? ¿C ¿C ¿Cut ut ut by by by Acc Acc Acc I? I? I? (100%) in triple infections (Table 6). The overall preva- Yes Yes Yes Yes Ye Ye Ye Yes s s s Ye Ye Ye Yes s s s Yes Yes Yes Yes lence of HPV type 18 also increased in double infections VP VP VPH-31 H-31 H-31 VP VP VPH-52 H-52 H-52 VPH VPH VPH-35 -35 -35 VPH VPH VPH-58 -58 -58 and was accompanied by increases of types 31, 52 and 35 and the last two types were even higher in triple infections Algorithm Figure 3 for HR-HPV typing (Table 6). In double and triple infections of SLP the pre- Algorithm for HR-HPV typing. The PCR-RFLP method dominant types were 16, 31, 18, 35 and 52 whereas in Gto used identifies seven HR-HPV types by the size of the restric- types 16 and 31 predominated in double infections and tion fragments of the E6-250 products generated by specific types 16 and 31 in the triple ones (Table 6). cuts with five enzymes. Ava II is used first because it helps recognize types 16, 18 and 33 (16 and 18 are known to be Single and multiple infections and HR-HPV types in lesions the most prevalent globally). PCR products not restricted by Ava II are incubated separately with each of the four remain- of increasing severity ing enzymes to identify the other five HR-HPV types. The overall frequency of cervical lesions was, in decreasing order, LSIL (73.1%) > HSIL (16.7%) > invasive cancer (10.2%) (Table 7). The ratio of single to multiple infec- Page 5 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 Table 3: Prevalence of HR-HPV types Table 4: Prevalence of single and multiple HR-HPV infections HR-HPV type SLP Gto Overall Infections SLP Gto Overall n % n% n% n% n% n% 16 169 53.3 138 52.9 307 53.4 Single 159 75.0 128 67.4 287 71.4 31 32 10.1 58 22.3 90 15.6 Double 48 22.6 56 29.5 104 25.9 18 28 8.8 23 8.8 51 8.9 Triple 5 2.4 6 3.2 11 2.7 35 15 4.7 17 6.5 32 5.6 52 16 5.1 15 5.7 31 5.4 Total 212 100.0 190 100.0 402 100.0 33 3 0.9 4 1.6 7 1.2 58 4 1.3 0 0.0 4 0.7 NI 1 0.3 3 1.2 4 0.7 for the first ('direct') reaction amplified the E6-650 prod- uct [19,26] and the primer set used in the second Total 268 84.5 258 99.0 526 91.4 ('nested') reaction amplified the E6-250 product [27]. The use of duplex PCR was discarded to amplify E6-250 and NI, type not identified. L1-450 due to the interference observed when simultane- tions was inversely proportional to the severity of the ous amplification of both products was attempted (Fig. lesions: 2.46 for LSIL, 2.37 for HSIL and 2.15 for invasive 4). The scarce E6-negative samples were tested later with a cancer (Table 8). universal primer set that amplifies L1-450 segments of both low risk- as well as HR-HPV types [28]. From these The frequency of HR-HPV types found in the cervical HSIL observations we concluded that to determine HR-HPV and invasive cancer (n = 140) was, in decreasing order, 16 infection in women with dysplasia and neoplasia it is con- (55.0%) > 31 (18.6%) > 35 (7.9%) > 52 (7.1%) > 18 venient first to identify the HPV-positive samples and (4.3%) > unidentified types (3.6%) > 33 (2.9%) > 58 then to check the amplificability of the negative ones. (0.7%) (Table 9). Eight HR-HPV types (16, 18, 31, 33, 35, 45, 52 and 58) are responsible for 95% of the invasive CC cases in the world Discussion Studies on the prevalence of HPV cervical infection in [14]. The PCR-RFLP used in this work identified all of Mexico are scarce [7,20-22] and information on HR-HPV them except type 45. prevalence is even scarcer [12,22] or deals only with HPV types 16 and 18 [23,24]. Considering all cervical samples included in this work, 98.8% contained amplifiable DNA, 97.8% had HPV infec- Since our aim was to determine the prevalence of the HR- tions which in 90.2% of the cases corresponded to HR- HPV types causing cervical infections in the states of SLP HPV types whose prevalence was higher in Gto (99.0%) and Gto, the study included women with cervical intraep- than in SLP (82.6%) (Table 3). ithelial lesions (73.1% low grade, 16.7% high grade and 10.2% invasive carcinoma), expected to be HPV-positive. In the 437 samples with amplifiable DNA included in this This prediction was fulfilled because nearly all women study, 528 cervical infections were demonstrated by HR- were shown to be infected with HPV, and HR types were HPV types that were identified in 99.1% of the cases identified in most of them. (Table 4). In this way we demonstrated that in our region circulate the seven HR-HPV types identified with the To determine HPV infection and to identify the high-risk method used and their overall prevalence is, in descend- types involved we used the PCR-RFLP method based on ing order, 16 (53.4%) > 31 (15.6%) > 18 (8.9%) > 35 amplification of the E6-250 HR-HPV product followed by (5.6) > 52 (5.4%) > 33 (1.2%) > 58 (0.7%) = unidentified digestion with endonucleases [19] and fragment sizing in types (0.7%). From these results we recommend that for high resolution agarose gels [25]. Obtaining cervical analysis of cervical samples with dysplasia it is convenient scrapings with the cytobrush allowed us to obtain more to identify first the types 16, 18 and 33 by restriction with than enough amplifiable DNA in nearly all samples and Ava II and then the types 31, 35, 52 and 58 by restriction PCR optimization assured efficient amplification with the with Rsa I, Ava I, Bgl II and Acc I. primer sets employed. The prevalence of high and low risk HPV types found by The E6-250 HR-HPV product was amplified through us is similar to that already seen in Mexico and other nested PCR because this modality turned out to be at least regions of high CC incidence [20,21,29]. The predomi- twice as sensitive as direct PCR. The universal primer sets nant HR-HPV types in our region are 16, 31 and 18 which Page 6 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 Table 5: Prevalence of HR-HPV types in single, double and triple infections Infections HR-HPV ypes SLP Gto Overall n % n% n% Single 16 123 77.4 81 63.3 204 72.6 18 15 9.4 16 12.5 31 10.2 31 13 8.2 17 13.3 30 9.9 52 4 2.5 6 4.7 10 3.3 33 2 1.3 21.6 41.3 35 1 0.6 32.3 41.3 58 1 0.6 00.0 10.3 NI 0 0.0 3 2.3 3 1.0 Sum 159 100.0 128 100.0 287 100.0 Double 16/18 7 14.6 4 7.1 11 10.6 16/31 14 29.2 35 63.0 49 47.1 16/33 1 2.1 1 1.8 2 1.9 16/35 7 14.6 611.0 1312.5 16/52 9 18.8 5 8.9 14 13.5 16/58 3 6.3 0 0.0 3 2.9 18/31 1 2.1 1 1.8 2 1.9 18/35 2 4.2 0 0.0 2 1.9 18/52 1 2.1 0 0.0 1 1.0 18/NI 1 2.1 0 0.0 1 1.0 31/33 0 0.0 1 1.8 1 1.0 31/35 1 2.1 1 1.8 2 1.9 35/52 1 2.1 2 3.6 3 2.9 Sum 48 100.0 56 100.0 104 100.0 Triple 16/31/52 2 40.0 1 17.0 3 27.3 16/18/35 1 20.0 2 33.0 3 27.3 16/31/35 1 20.0 2 33.0 3 27.3 16/35/52 1 20.0 1 17.0 2 18.2 Sum 5 100.0 6 100.0 11 100.0 Total 212 52.7 190 47.3 402 100.0 NI, type not identified. together represent 77.9% of all cervical infections. The Single and triple infections were more frequent in SLP, four remaining types cause 12.9%, and unidentified types whereas double infections were more frequent in Gto. only 0.7% of the HR-HPV infections. Types 16 and 18 are Single infections included all seven HR-HPV identifiable slightly more prevalent in SLP, whereas type 31 is nearly types where the three predominant ones were, in descend- two times more prevalent in Gto. ing order, 16 > 18 > 31 with a cumulative frequency of 92.7%. The prevalence of these types in SLP was, in The overall prevalence of HPV type 16 in our region descending order, 16 > 18 > 31 with a cumulative fre- (53.4%) is almost identical to the world average (53%) quency of 95.0%, whereas in Gto it was 16 > 31 > 18 with calculated by Munoz (2000). In contrast, the regional a cumulative frequency of 89.1%. prevalence of type 18 (8.9%) is substantially lower than the world average (15%) calculated by Munoz [21]. The The typing method allowed us to identify a considerable prevalence of types 31 (15.6%) and 35 (5.6%) is higher proportion of infections by two viral types (overall preva- than the average for Latin America [21], whereas that of lence of 25.9%, with 22.6% for SLP and 29.5% for Gto) type 33 (1.2%) is nearly 10 times lower than the average and three viral types (overall prevalence of 2.7%, with for Central America (11.8%) recently obtained by Clifford 2.4% for SLP and 3.2% for Gto) (Table 4). Type 16 was et al. [30]. found in all multiple infections. Page 7 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 Table 6: Prevalence (%) of HR-HPV types in single, double and triple infections HR-HPV types SLP Gto Overall Single Double Triple Single Double Triple Single Double Triple 16 77.4 85.4 100.0 36.7 91.1 100.0 71.1 88.5 100.0 18 9.4 25.0 20.0 10.0 8.9 33.3 10.8 16.3 27.3 31 8.2 33.3 40.0 16.7 78.6 50.0 10.5 57.7 45.5 52 2.5 20.8 60.0 16.7 12.5 33.3 3.5 16.3 45.5 33 1.3 2.1 0.0 0.0 3.6 0.0 0.0 2.9 0.0 35 0.6 22.9 60.0 20.0 16.1 50.0 1.4 19.2 54.5 58 0.6 6.3 0.0 0.0 0.0 0.0 0.3 2.9 0.0 NI 0.0 2.1 0.0 0.0 0.0 0.0 1.0 1.0 0.0 NI, type not identified. Table 7: HR-HPV types of single and multiple infections in lesions of increasing severity Infections HR-HPV types LSIL HSIL Cancer Overall n% n% n% n % Single 16 149 38.9 37 9.7 17 4.4 203 53.0 18 21 5.5 0 0.0 1 0.3 22 5.7 31 17 4.4 5 1.3 4 1.0 26 6.8 33 0 0.0 1 0.3 2 0.5 3 0.8 35 4 1.0 1 0.3 1 0.3 6 1.6 52 7 1.8 1 0.3 1 0.3 9 2.3 58 1 0.3 0 0.0 0 0.0 1 0.3 Sum 199 52.0 45 11.7 26 6.8 270 70.5 Double 16/18 9 2.3 4 1.0 0 0.0 13 3.4 16/31 36 9.4 4 1.0 9 2.3 49 12.8 16/33 1 0.3 0 0.0 0 0.0 1 0.3 16/35 10 2.6 2 0.5 1 0.3 13 3.4 16/52 8 2.1 3 0.8 1 0.3 12 3.1 16/58 2 0.5 1 0.3 0 0.0 3 0.8 18/35 3 0.8 0 0.0 1 0.3 4 1.0 18/NI 1 0.3 0 0.0 0 0.0 1 0.3 31/33 0 0.0 1 0.3 0 0.0 1 0.3 31/35 2 0.5 0 0.0 0 0.0 2 0.5 31/52 1 0.3 1 0.3 0 0.0 2 0.5 35/52 0 0.0 1 0.3 0 0.0 1 0.3 Sum 73 19.1 17 4.4 12 3.1 102 26.6 Triple 16/18/35 1 0.3 1 0.3 0 0.0 2 0.5 16/31/35 2 0.5 1 0.3 1 0.3 4 1.0 16/31/52 2 0.5 0 0.0 0 0.0 2 0.5 16/35/52 2 0.5 0 0.0 0 0.0 2 0.5 18/31/52 1 0.3 0 0.0 0 0.0 1 0.3 Sum 8 2.1 2 0.5 1 0.3 11 2.9 Total 280 73.1 64 16.7 39 10.2 383 100.0 Page 8 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 Table 8: Frequency of single and multiple HR-HPV infections in Table 9: HR-HPV types in HSIL and invasive cancer lesions lesions of increasing severity HR-HPV type Frequency (%) O/H ratio Lesion Type of infection S/M ratio Overall (O) In HSIL and cancer (H) Single (S) Multiple (M) Overall 16 53.4 55.0 0.97 n% n % n % 31 15.6 18.6 0.84 18 8.9 4.3 2.07 35 5.6 7.9 0.71 LSIL 199 52.0 81 21.1 280 73.1 2.46 52 5.4 7.1 0.76 HSIL 45 11.7 19 5.0 64 16.7 2.37 33 1.2 2.9 0.41 Cancer 26 6.8 13 3.4 39 10.2 2.00 58 0.7 0.7 1.00 NI 0.7 3.6 0.19 Total 280 70.5 113 29.5 383 100.0 --- NI, type not identified. LSIL, low-grade squamous intraepithelial lesion. HSIL, high-grade squamous intraepithelial lesion. Infections by two or more HPV types are markers of per- Double infections from SLP were caused by the seven sistent cervical disease, of multiple cervical lesions and of identifiable types but type 58 was absent in Gto. The over- progression from low to high grade lesions [33]. There is all predominant types in double infections were 16 > 31 > scarce evidence on the interaction of HPV types to 35 > 18 = 52. Their prevalence differed in each state since enhance CC pathogenesis and it is unknown if some HPV the descending order in SLP was 16 > 31 > 18 > 35 > 52, types promote or exclude infection by others. Careful fol- whereas in Gto it was 16 > 31 > 35 > 52 > 18 (Table 6). low up of multiple infections may help to pinpoint the relevance of the interactions of different HPV types in dis- Types 33 and 58 were absent from triple infections in both ease progression [34]. states and the overall predominant types were 16 > 35 > 31 = 52 > 18. There were also differences in the prevalence HPV16, the most frequent type in single and multiple by state since in SLP the descending order was 16 > 35 = infections in SLP and Gto, just as in the rest of the world 52 > 31 > 18 whereas in Gto it was 16 > 35 = 52 > 31 > 18 [14,21] appears to be the most persistent type [32,35,36] (Table 6). increasing the risk of developing severe preneoplastic lesions [37]. Our algorithm for typing, designed to identify first the high-risk viral types and then the low risk ones, probably Our work confirms the usefulness of the PCR-RFLP underestimates the prevalence of low risk types in samples method of Fujinaga et al. [19,26,27] for diagnosis and typ- where high risk types are demonstrated. However, it is ing cervical infections by HR-HPV, whose sensitivity was worth noting that in low grade intraepithelial cervical at least doubled by amplifying the E6-250 product lesions practically all genital HPV types are found, through nested rather than direct PCR and whose typing whereas in high grade lesions only high risk types are precision was improved by using high resolution electro- found [31]. phoresis. In this way we could identify the HR-HPV types circulating in our region and their distribution in the two The proportion of multiple infections found by us neighboring states analyzed, which reflect the endemic (28.6%) is over three times higher than the world average behavior of the various HPV types as well as local environ- (8.1%) calculated by Molano et al. [32]. This feature is mental or genetic conditions of the hosts [38]. probably due to the fact that the women in our study are themselves a high risk group since they were included for Besides being of use to carry out molecular epidemiology having cervical dysplasia and cancer. This idea is rein- studies and to predict the individual risk of each patient, forced by our finding that 10.6% of the double infections HR-HPV typing is essential to plan the administration of are due to the 16/18 type couple, whose prevalence was prophylactic vaccines directed against one or more spe- nearly six times higher than the world average (1.8%) esti- cific HPV types, which is questionable in populations mated by Clifford et al. [30]. where prevalence of the circulating types is unknown [31,39,40]. Since in our region HPV type 16 has the high- The five predominant HR-HPV types (16, 31, 18, 35 and est overall prevalence (53.4%), type 31 is second (15.6%) 52) found in the 140 HSIL and invasive cancer lesions and type 18 is third (8.9%), the vaccine against HR-HPV accounted for 92.9% of the cases and their frequency was types 16 and 18 [41] whose license was granted first in similar to their overall prevalence (Table 9). Mexico and the United States [42,43] would be expected Page 9 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 single to multiple infections was inversely proportional to 1 1 2 2 3 3 4 4 5 5 the severity of the lesions: 2.46 for LSIL, 2.37 for HSIL and 2.15 for invasive cancer. The frequency of HR-HPV types found in HSIL and inva- sive cancer was 16 (55.0%) > 31 (18.6%) > 35 (7.9%) > 52 (7.1%) > 18 (4.3%) > unidentified types (3.6%) > 33 50 500 0 (2.9%) > 58 (0.7%). 45 45 450 0 0 Since the three predominant HR-HPV types found (16, 31 25 25 250 0 0 200 200 and 18) cause 77.9% of the HR-HPV infections associated to cervical dysplasia in this region, and immunization against type 16 prevents type 31 infections, in this region the efficacy of the prophylactic vaccine against types 16 Inhibition of L1-450 duplex PCR m 2R Figure 4 ixtures with pr and E6-250 seg imer sets MY 09/1 ment amplifica 1 and pU 1M/ tion in and 18 would be close to 80%. Inhibition of L1-450 and E6-250 segment amplifica- tion in duplex PCR mixtures with primer sets MY 09/ 11 and pU 1M/2R. Mixtures contained 50 ng DNA from Methods Patient 1 as well as primer set MY 09/11, pU 1M/2R, or both. Source of women Arrows to the left indicate positions of the bands expected. The 442 women included in this study were selected for Lane 1, 100 bp ladder. Lane 2, Uniplex 1 mixture (set MY 09/ having precancerous or cancerous lesions of the cervical 11). Lane 3, Uniplex mixture 2 (set pU 1M/2R). Lane 4, epithelium confirmed by cytologic analysis. Two hundred Duplex mixture (sets MY 09/11 and pU 1M/2R). Lane 5, Neg- and eighteen resided in the city of San Luis Potosí, capital ative control (without DNA). Major bands expected in uni- of the state of San Luis Potosí (SLP), and 192 in the cities plex and duplex mixtures: ~450 bp with set MY 09/11 (Lanes of León, Celaya and Irapuato from the state of Guanajuato 2 and 4) and ~250 bp with set pU 1M/2R (Lanes 3 and 4). (Gto), Mexico. Cervical scrapings from SLP were obtained Note the decrease in the intensity of bands in the duplex at the Dysplasia Clinic of the SLP Health Services, the mixture (lane 4), especially ~450 bp. School of Nursing of Universidad Autónoma de San Luis Potosí, and from private patients. Samples from Gto were to cover at least these three types [44] and would have a obtained at the Dysplasia Clinics of the cities of Irapuato, 78% efficacy. Celaya and León and sent to our laboratory by the Guana- juato Health Secretariat. The study was authorized by the Health Secretariats of SLP and Gto and performed with Conclusion Enough DNA is obtained from cervical scrapings of the informed consent of all participating women. women with dysplasia in order to detect high risk-HPV by Cervical scrapings and DNA extraction PCR amplification followed by typing through restriction fragment length polymorphism analysis. Each scraping was taken with an endocervical brush ('cytobrush') that was immediately inserted in a 5 ml Sensitivity of HR-HPV detection is nearly doubled by polypropylene tube (Nalge Nunc, Rochester, NY) contain- nested rather than direct PCR amplification. ing 1 ml phosphate buffered saline supplemented with sterile disodium ethtylene-diamino-tetraacetate (PBS- Ninety-two percent of the 437 Mexican women with cer- EDTA: 137 mM NaCl, 2.7 mM KCl, 10 mM Na HPO , 2 2 4 vical dysplasia and cancer included in this study were mM KH HPO , 25 mM disodium EDTA, pH 7.4). Once 2 2 infected by HR-HPV, with a prevalence 1.14 times higher detached from the cytobrush and suspended in the PBS- in the state of Guanajuato than in San Luis Potosí. EDTA vehicle, each sample was fixed by addition of 1.5 ml 96% ethanol and processed to extract DNA on the same All seven HR-HPV types identifiable with the method day or up to 30 days after being kept at room temperature. used (16, 18, 31, 33, 35, 52, 58) circulate in SLP and Gto Reagents were purchased from J.T. Baker (Xalostoc, Méxi- and were diagnosed in nearly all (99.3%) the cases. co) unless other source is specified. Seventy-one percent of the infections were caused by one To extract the DNA each fixed sample was mixed by vor- HR-HPV type, 25.9% by two types and 2.7% by three texing and 1 ml transfered to a 1.5 ml tube and spun in a types. Hettich Mikro 20 microcentrifuge (Cologne, Germany) for 5 min at 13,000 rpm (16,250×g). The supernatant was The overall frequency of cervical lesions was LSIL (73.1%) discarded by decantation and to each pellet were added > HSIL (16.7%) > invasive cancer (10.2%) and the ratio of 500 μl of Tris-EDTA-saline (TES: 10 mM Tris-HCl; 2 mM Page 10 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 disodium EDTA, 0.4 M NaCl, pH 8.0 at 25°C), 50 μl of fluorometer (Tecan Systems, San Jose, CA) with the Mag- 10% sodium dodecyl sulphate and 20 μl of proteinase K ellan 4 software. (20 mg/ml). Mixtures were incubated at 55°C for 3 h, at the end of which 150 μl of 5 M NaCl were added and cen- Since amplification of the β-globin gene required = 25 ng trifuged again for 15 min. Each supernatant was aspirated DNA per PCR mixture, 100 ng was the minimum amount and transferred to a tube to which 577 μl cold isopropa- of DNA required from each cervical scraping in order to nol were immediately added and then left stand for 10 prepare at least four PCR mixtures. min at 4°C to precipitate the nucleic acids. The tubes were centrifuged again for 10 min and supernatants discarded The range of pure DNA obtained from the first 370 cervi- by decantation. Each pellet was washed by vortexing with cal scrapings was 53–16,590 ng. The amount of purified 1 ml of 70% cold ethanol and centrifuged for 10 min at DNA was sufficient (i.e., = 100 ng) in all samples except 10,000 rpm (9,615×g) and room temperature. Superna- five of the initial ones. tants were discarded by aspiration and the pellets dried out by inverting the tubes for 15 min on a paper towel. PCR conditions The oligonucleotide primer sets and the sizes expected for Each pellet was dissolved with 50 μl TE (10 mM Tris-HCl, 1 mM disodium EDTA, pH 8.0 at 25°C). the HPV amplification products are depicted in Table 10. To optimize PCR with each primer set variable DNA and The quality of extracted DNA was verified by electro- MgCl concentrations and annealing temperatures were phoretic analysis in 1% agarose gels with TAE (40 mM tested. The β-globin primer set was added to PCR mixtures Tris-acetate, 1 mM disodium EDTA, pH 8.2 at 25°C). containing double-serial dilutions of DNA from a HPV- Two-μl from each sample were applied to gels which were positive sample (range: 0.78–50 ng). To optimize condi- run at 60 V for 90 min. λ-phage? DNA digested with Hind tions for HPV primer sets, 1–5 mM MgCl concentrations III (Sigma-Aldrich, Mexico) was used as marker. After and annealing temperatures from 55°C to 61.4°C were staining for 20 min with ethidium bromide (1 μg/ml) gels tested. were illuminated with ultraviolet light and their fluores- cence recorded with the Bio-Rad ChemiDoc EQ (Her- To maximize HPV detection through PCR amplification, cules, CA) photo documenter. three variables were optimized: DNA content, annealing temperature and magnesium concentration. DNA was quantitated by fluorometry with the PicoGreen dsDNA Quantitation kit (Molecular Probes; Eugene, OR) With the PC04/GH20 primer set for β-globin the mini- by interpolation in a standard curve containing up to 50 mum amount of template DNA required in PCR mixtures ng of λ-phage DNA. To each well of a black FIA 96 well was determined with double serial dilutions leading to a plate (Greiner Bio-One, Frickenhausen, Germany) 198 μl maximum of 50 ng DNA per mixture. Fluorescence of the of the assay solution (PicoGreen diluted 1:400 in TE) and E6-250 product increased with DNA content up to 25 ng, 2 μl of standard DNA or problem samples were added, which was the amount selected to amplify HPV DNA from and their fluorescence determined using a 485 nm excita- each sample. Annealing temperature in the range of 55°C tion filter and a 535 emission filter in the GENios Pro to 62°C was assessed with each primer set. As major prod- ucts attained maximum fluorescence at 57°C this anneal- Table 10: Oligonucleotides used Oligonucleotides Gene amplified Amplicon size Set Name Sequence (5' → 3') Position 1 LCRS AAGGGAGTAACCGAAAACGGT 26 E6 ~650 bp E7AS TCATCCTCCTCCTCTGAG 671 2 pU1M TGTCAAAAACCGTTGTGTCC 419 E6 ~250 bp pU2R GAGCTGTCGCTTAATTGCTC 656 3 MY09 CGTCCMARRGGAWACTGATC 6584 L1 ~450 bp MY11 GCMCAGGGWCATAAYAATGG 7035 4 PC04 CAACTTCATCCACGTTCAACC --- β-globin ~260 bp GH20 GAAGAGCCAAGGACAGGTAC --- Nucleotide of the HPV16 genome at which the 5' end of each primer is bound. Fujinaga et al. [19]. Sotlar et al. [46]. Page 11 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 ing temperature was used with all primer sets for the rest Ava I, Ava II and Bgl II endonucleases and their buffers of the work. MgCl concentrations in the 1–5 mM range were purchased from Biolabs (Beverly, MA), whereas Rsa were tested. Maximum efficiency was attained at 2.5 mM, I and Acc I and their buffers were obtained from Invitro- concentration chosen for the rest of the work. gen (Carlsbad, CA). Digestion mixtures containing 8 μl of PCR amplification mixture, 1.5 μl endonuclease solution The primer set LCRS/E7AS amplifies the E6-650 segment (10 U/μl), 2 μl buffer and 8.5 μl water were incubated 3 h and the set pU 1M/2R amplifies the 'nested' E6-250 seg- at 37°C. The restriction fragments present in 10 μl from ment included in the first one. In the HPV16 genome, the each digestion mixture were analyzed by electrophoresis set LCRS/E7AS spans nucleotides 26–671 (645 bp) and in 2% agarose gels with 5 mM sodium borate, pH 8.5 the set pU 1M/2R spans nt 419–656 (237 bp). The set MY (Brody and Kern 2004) that were run at 120 V for 90 min. 09/11 amplifies the L1-450 segment which spans nt 6584–7035 (451 bp). To explore the feasibility of using Competing interests duplex PCR to simultaneously amplify E6-250 with The author(s) declare that they have no competing inter- primer set pU 1M/2R and L1-450 with primer set MY 09/ ests. 11, we tested both sets at 0.6 μM concentration. However, our finding that in duplex mixtures the L1-450 band was Authors' contributions nearly lost and the E6-250 band was less intense than in LAMC performed most of the molecular studies. MSG uniplex mixtures (Fig. 4) led us to discard the use of suggested and set up the PCR-RFLP method. RLR con- duplex mixtures. ceived and designed the study, obtained the funds to carry it out and drafted the manuscript. All authors read and Detection of the HPV DNA amplification products approved the final manuscript. LCR/E7 ~650 bp (E6-650), E6/E7 ~250 bp (E6-250) and L1 ~450 bp (L1-450) products were amplified with primer Acknowledgements We wish to thank all the women included in this study, as well as Julio Ortiz, sets pU 1M/2R, LCRS/E7AS and MY 09/11, respectively Ma. de Lourdes Martínez, Yolanda Terán and Dalila Álvarez for providing (Table 7). Each 50 μl PCR mixture was prepared in 200 μl the cervical scrapings from San Luis Potosí, and Raúl Rojas and Silvia Quin- Axygen tubes (Union City, CA). PCR mixtures contained tana for providing those from Guanajuato. We also thank Aurora Londoño , 0.4 mM of each dNTP, 0.6 μM of each oli- 2.5 mM MgCl for her efficient collaboration in sample processing. The interest and sup- gonucleotide, 1.5 units of recombinant Taq DNA port of the health authorities and of numerous collaborators from San Luis polymerase and 25 ng DNA, 20 mM Tris-HCl, 50 mM Potosí and Guanajuato, especially Fernando Toranzo and Raúl Martínez of KCl, pH 8.4 at 25°C; oligonucleotides were synthesized the San Luis Potosí Health Secretariat, and Éctor Jaime Ramírez Barba and by Accesolab (Mexico) and other components were pur- Raúl Rojas of the Guanajuato Health Secretariat, is highly appreciated. The chased from Invitrogen (Mexico). research was partially funded by grants FONINV-Gto-C01-5751 and FMSLP-4441. LAMC received a CONACYT scholarship during the course of the work. PCR mixtures were incubated 40 cycles in a Techne Touch- gene Gradient thermocycler (Staffordshire, England). References Before starting they were incubated at 94°C for 4 min. 1. Pisani P, Parkin DM, Bray F, Ferlay J: Estimates of the worldwide Each cycle consisted of 1 min periods at 94°C (denatura- mortality from 25 cancers in 1990. Int J Cancer 1999, 83:18-29. 2. Pisani P, Bray F, Parkin DM: Estimates of the world-wide preva- tion), 57°C (annealing) and 72°C (extension), followed lence of cancer for 25 sites in the adult population. Int J Cancer by 10 min final extension at 72°C. Each run included a 2002, 97:72-81. positive control with 25 ng of HeLa cell DNA known to 3. Arrossi S, Sankaranarayanan R, Parkin DM: Incidence and mortal- ity of cervical cancer in Latin America. Salud Publica Mex 2003, contain 10–50 copies of the HPV type 18 genome per cell 45 Suppl 3:S306-14. [45], and a negative control with water instead of DNA. 4. Reeves WC, Brinton LA, Garcia M, Brenes MM, Herrero R, Gaitan E, Tenorio F, de Britton RC, Rawls WE: Human papillomavirus infection and cervical cancer in Latin America. N Engl J Med PCR products (10 μl from each mixture) were subjected to 1989, 320:1437-1441. electrophoresis in 1.5% agarose gels with 5 mM sodium 5. Soe MM: Screening for cervical cancer in developing coun- tries. Bmj 1992, 304:983-984. borate, pH 8.5 [25] that were run at 120 V for 90 min. 6. Lazcano-Ponce EC, Moss S, Alonso de Ruiz P, Salmeron Castro J, Hernandez Avila M: Cervical cancer screening in developing High-risk HPV typing countries: why is it ineffective? The case of Mexico. Arch Med Res 1999, 30:240-250. To identify HR-HPV types the method of Fujinaga et al. 7. Palacio-Mejia LS, Rangel-Gomez G, Hernandez-Avila M, Lazcano- [19] was used. The size of the two E6-250 restriction frag- Ponce E: Cervical cancer, a disease of poverty: mortality dif- ferences between urban and rural areas in Mexico. Salud Pub- ments generated with endonucleases for each of the seven lica Mex 2003, 45 Suppl 3:S315-25. HR-HPV types that can be identified with this method are 8. zur Hausen H: Human papillomaviruses and their possible role shown in Table 2. in squamous cell carcinomas. Curr Top Microbiol Immunol 1977, 78:1-30. 9. Zur Hausen H: Papillomaviruses in human cancers. Mol Carcinog 1988, 1:147-150. Page 12 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 10. Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah 30. Clifford GM, Rana RK, Franceschi S, Smith JS, Gough G, Pimenta JM: KV, Snijders PJ, Peto J, Meijer CJ, Munoz N: Human papillomavirus Human papillomavirus genotype distribution in low-grade is a necessary cause of invasive cervical cancer worldwide. J cervical lesions: comparison by geographic region and with Pathol 1999, 189:12-19. cervical cancer. Cancer Epidemiol Biomarkers Prev 2005, 11. Volkow P, Rubi S, Lizano M, Carrillo A, Vilar-Compte D, Garcia-Car- 14:1157-1164. ranca A, Sotelo R, Garcia B, Sierra-Madero J, Mohar A: High preva- 31. Garland SM: Human papillomavirus update with a particular lence of oncogenic human papillomavirus in the genital tract focus on cervical disease. Pathology 2002, 34:213-224. of women with human immunodeficiency virus. Gynecol Oncol 32. Molano M, Van den Brule A, Plummer M, Weiderpass E, Posso H, 2001, 82:27-31. Arslan A, Meijer CJ, Munoz N, Franceschi S: Determinants of 12. Munoz N, Bosch FX, de Sanjose S, Vergara A, del Moral A, Munoz MT, clearance of human papillomavirus infections in Colombian Tafur L, Gili M, Izarzugaza I, Viladiu P, et al.: Risk factors for cervical women with normal cytology: a population-based, 5-year fol- intraepithelial neoplasia grade III/carcinoma in situ in Spain low-up study. Am J Epidemiol 2003, 158:486-494. and Colombia. Cancer Epidemiol Biomarkers Prev 1993, 2:423-431. 33. Becker TM, Wheeler CM, McGough NS, Parmenter CA, Jordan SW, 13. de Villiers EM, Fauquet C, Broker TR, Bernard HU, zur Hausen H: Stidley CA, McPherson RS, Dorin MH: Sexually transmitted dis- Classification of papillomaviruses. Virology 2004, 324:17-27. eases and other risk factors for cervical dysplasia among 14. Munoz N, Bosch FX, de Sanjose S, Herrero R, Castellsague X, Shah southwestern Hispanic and non-Hispanic white women. Jama KV, Snijders PJ, Meijer CJ: Epidemiologic classification of human 1994, 271:1181-1188. papillomavirus types associated with cervical cancer. N Engl 34. Hubbard RA: Human papillomavirus testing methods. Arch J Med 2003, 348:518-527. Pathol Lab Med 2003, 127:940-945. 15. Bosch FX, Manos MM, Munoz N, Sherman M, Jansen AM, Peto J, 35. Londesborough P, Ho L, Terry G, Cuzick J, Wheeler C, Singer A: Schiffman MH, Moreno V, Kurman R, Shah KV: Prevalence of Human papillomavirus genotype as a predictor of persist- human papillomavirus in cervical cancer: a worldwide per- ence and development of high-grade lesions in women with spective. International biological study on cervical cancer minor cervical abnormalities. Int J Cancer 1996, 69:364-368. (IBSCC) Study Group. J Natl Cancer Inst 1995, 87:796-802. 36. Richardson H, Kelsall G, Tellier P, Voyer H, Abrahamowicz M, Fer- 16. Berumen J, Ordonez RM, Lazcano E, Salmeron J, Galvan SC, Estrada enczy A, Coutlee F, Franco EL: The natural history of type-spe- RA, Yunes E, Garcia-Carranca A, Gonzalez-Lira G, Madrigal-de la cific human papillomavirus infections in female university Campa A: Asian-American variants of human papillomavirus students. Cancer Epidemiol Biomarkers Prev 2003, 12:485-490. 16 and risk for cervical cancer: a case-control study. J Natl 37. Woodman CB, Collins S, Winter H, Bailey A, Ellis J, Prior P, Yates M, Cancer Inst 2001, 93:1325-1330. Rollason TP, Young LS: Natural history of cervical human pap- 17. Tasa de mortalidad por cáncer cérvico uterino. Sistema para illomavirus infection in young women: a longitudinal cohort el Seguimiento de la Situación de la Mujer en México (SIS- study. Lancet 2001, 357:1831-1836. ESIM) [http://dgcnesyp.inegi.gob.mx/sisesim/sisesim.html] 38. Hildesheim A, Wang SS: Host and viral genetics and risk of cer- 18. Lazcano-Ponce E, Herrero R, Munoz N, Cruz A, Shah KV, Alonso P, vical cancer: a review. Virus Res 2002, 89:229-240. Hernandez P, Salmeron J, Hernandez M: Epidemiology of HPV 39. Williams OM, Hart KW, Wang EC, Gelder CM: Analysis of CD4(+) infection among Mexican women with normal cervical cytol- T-cell responses to human papillomavirus (HPV) type 11 L1 ogy. Int J Cancer 2001, 91:412-420. in healthy adults reveals a high degree of responsiveness and 19. Fujinaga Y, Shimada M, Okazawa K, Fukushima M, Kato I, Fujinaga K: cross-reactivity with other HPV types. J Virol 2002, Simultaneous detection and typing of genital human papillo- 76:7418-7429. mavirus DNA using the polymerase chain reaction. J Gen Virol 40. Corona Gutierrez CM, Tinoco A, Navarro T, Contreras ML, Cortes 1991, 72 ( Pt 5):1039-1044. RR, Calzado P, Reyes L, Posternak R, Morosoli G, Verde ML, Rosales 20. Torroella-Kouri M, Morsberger S, Carrillo A, Mohar A, Meneses A, R: Therapeutic vaccination with MVA E2 can eliminate pre- Ibarra M, Daniel RW, Ghaffari AM, Solorza G, Shah KV: HPV prev- cancerous lesions (CIN 1, CIN 2, and CIN 3) associated with alence among Mexican women with neoplastic and normal infection by oncogenic human papillomavirus. Hum Gene Ther cervixes. Gynecol Oncol 1998, 70:115-120. 2004, 15:421-431. 21. Munoz N: Human papillomavirus and cancer: the epidemio- 41. Villa LL, Costa RL, Petta CA, Andrade RP, Ault KA, Giuliano AR, logical evidence. J Clin Virol 2000, 19:1-5. Wheeler CM, Koutsky LA, Malm C, Lehtinen M, Skjeldestad FE, Ols- 22. Gonzalez-Losa Mdel R, Rosado-Lopez I, Valdez-Gonzalez N, Puerto- son SE, Steinwall M, Brown DR, Kurman RJ, Ronnett BM, Stoler MH, Solis M: High prevalence of human papillomavirus type 58 in Ferenczy A, Harper DM, Tamms GM, Yu J, Lupinacci L, Railkar R, Tad- Mexican colposcopy patients. J Clin Virol 2004, 29:202-205. deo FJ, Jansen KU, Esser MT, Sings HL, Saah AJ, Barr E: Prophylactic 23. Berumen J, Unger ER, Casas L, Figueroa P: Amplification of human quadrivalent human papillomavirus (types 6, 11, 16, and 18) papillomavirus types 16 and 18 in invasive cervical cancer. L1 virus-like particle vaccine in young women: a randomised Hum Pathol 1995, 26:676-681. double-blind placebo-controlled multicentre phase II effi- 24. Hernandez-Avila M, Lazcano-Ponce EC, Berumen-Campos J, Cruz- cacy trial. Lancet Oncol 2005, 6:271-278. Valdez A, Alonso de Ruiz PP, Gonzalez-Lira G: Human papilloma 42. Markowitz LE, Dunne EF, Saraiya M, Lawson HW, Chesson H, Unger virus 16-18 infection and cervical cancer in Mexico: a case- ER: Quadrivalent Human Papillomavirus Vaccine: Recom- control study. Arch Med Res 1997, 28:265-271. mendations of the Advisory Committee on Immunization 25. Brody JR, Kern SE: Sodium boric acid: a Tris-free, cooler con- Practices (ACIP). MMWR Recomm Rep 2007, 56:1-24. ductive medium for DNA electrophoresis. Biotechniques 2004, 43. McLemore MR: Gardasil: Introducing the new human papillo- 36:214-216. mavirus vaccine. Clin J Oncol Nurs 2006, 10:559-560. 26. Hwang T: Detection and typing of human papillomavirus 44. Harper DM, Franco EL, Wheeler CM, Moscicki AB, Romanowski B, DNA by PCR using consensus primers in various cervical Roteli-Martins CM, Jenkins D, Schuind A, Costa Clemens SA, Dubin lesions of Korean women. J Korean Med Sci 1999, 14:593-599. G: Sustained efficacy up to 4.5 years of a bivalent L1 virus-like 27. Noda T, Sasagawa T, Dong Y, Fuse H, Namiki M, Inoue M: Detection particle vaccine against human papillomavirus types 16 and of human papillomavirus (HPV) DNA in archival specimens 18: follow-up from a randomised control trial. Lancet 2006, of benign prostatic hyperplasia and prostatic cancer using a 367:1247-1255. highly sensitive nested PCR method. Urol Res 1998, 26:165-169. 45. Chardonnet Y, Lizard G, Chignol MC, Schmitt D: Analytical meth- 28. Bernard HU, Chan SY, Manos MM, Ong CK, Villa LL, Delius H, Peyton ods for evaluation on whole cells of human papillomavirus CL, Bauer HM, Wheeler CM: Identification and assessment of infection. Bull Cancer 1995, 82:107-113. known and novel human papillomaviruses by polymerase 46. Sotlar K, Diemer D, Dethleffs A, Hack Y, Stubner A, Vollmer N, Men- chain reaction amplification, restriction fragment length ton S, Menton M, Dietz K, Wallwiener D, Kandolf R, Bultmann B: polymorphisms, nucleotide sequence, and phylogenetic Detection and typing of human papillomavirus by e6 nested algorithms. J Infect Dis 1994, 170:1077-1085. multiplex PCR. J Clin Microbiol 2004, 42:3176-3184. 29. Wright TC Jr., Denny L, Kuhn L, Pollack A, Lorincz A: HPV DNA testing of self-collected vaginal samples compared with cyto- logic screening to detect cervical cancer. Jama 2000, 283:81-86. Page 13 of 13 (page number not for citation purposes) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Infectious Agents and Cancer Springer Journals

Prevalence of high-risk human papillomavirus types in Mexican women with cervical intraepithelial neoplasia and invasive carcinoma

Download PDF
13 pages

Loading next page...
 
/lp/springer-journals/prevalence-of-high-risk-human-papillomavirus-types-in-mexican-women-gqzapYANtd

References (45)

Publisher
Springer Journals
Copyright
Copyright © 2008 by López-Revilla et al; licensee BioMed Central Ltd.
Subject
Biomedicine; Cancer Research; Infectious Diseases; Oncology
eISSN
1750-9378
DOI
10.1186/1750-9378-3-3
pmid
18307798
Publisher site
See Article on Publisher Site

Abstract

Background: Prevalence of high risk (HR) human papillomavirus (HPV) types in the states of San Luis Potosí (SLP) and Guanajuato (Gto), Mexico, was determined by restriction fragment length-polymorphism (RFLP) analysis on the E6 ~250 bp (E6-250) HR-HPV products amplified from cervical scrapings of 442 women with cervical intraepithelial neoplasia and invasive carcinoma (280 from SLP and 192 from Gto). Fresh cervical scrapings for HPV detection and typing were obtained from all of them and cytological and/or histological diagnoses were performed on 383. Results: Low grade intraepithelial squamous lesions (LSIL) were diagnosed in 280 cases (73.1%), high grade intraepithelial squamous lesions (HSIL) in 64 cases (16.7%) and invasive carcinoma in 39 cases (10.2%). In the 437 cervical scrapings containing amplifiable DNA, only four (0.9%) were not infected by HPV, whereas 402 (92.0%) were infected HR-HPV and 31 (7.1%) by low-risk HPV. RFLP analysis of the amplifiable samples identified infections by one HR-HPV type in 71.4%, by two types in 25.9% and by three types in 2.7%. The overall prevalence of HR-HPV types was, in descending order: 16 (53.4%) > 31 (15.6%) > 18 (8.9%) > 35 (5.6) > 52 (5.4%) > 33 (1.2%) > 58 (0.7%) = unidentified types (0.7%); in double infections (type 58 absent in Gto) it was 16 (88.5%) > 31 (57.7%) > 35 (19.2%) > 18 (16.3%) = 52 (16.3%) > 33 (2.8%) = 58 (2.8%) > unidentified types (1.0%); in triple infections (types 33 and 58 absent in both states) it was 16 (100.0%) > 35 (54.5%) > 31 (45.5%) = 52 (45.5%) > 18 (27.3%). Overall frequency of cervical lesions was LSIL (73.1%) > HSIL (16.7%) > invasive cancer (10.2%). The ratio of single to multiple infections was inversely proportional to the severity of the lesions: 2.46 for LSIL, 2.37 for HSIL and 2.15 for invasive cancer. The frequency of HR-HPV types in HSIL and invasive cancer lesions was 16 (55.0%) > 31 (18.6%) > 35 (7.9%) > 52 (7.1%) > 18 (4.3%) > unidentified types (3.6%) > 33 (2.9%) > 58 (0.7%). Conclusion: Ninety percent of the women included in this study were infected by HR-HPV, with a prevalence 1.14 higher in Gto. All seven HR-HPV types identifiable with the PCR-RFLP method used circulate in SLP and Gto, and were diagnosed in 99.3% of the cases. Seventy-one percent of HR-HPV infections were due to a single type, 25.9% were double and 2.7% were triple. Overall frequency of lesions was LSIL (73.1%) > HSIL (16.7%) > invasive cancer (10.2%), and the ratio of single to multiple infections was inversely proportional to severity of the lesions: 2.46 for LSIL, 2.37 for HSIL and 2.15 for invasive cancer. The frequency of HR-HPV types found in HSIL and invasive cancer was 16 (55.0%) > 31 (18.6%) > 35 (7.9%) > 52 (7.1%) > 18 (4.3%) > unidentified types (3.6%) > 33 (2.9%) > 58 (0.7%). Since the three predominant types (16, 31 and 18) cause 77.9% of the HR-HPV infections and immunization against type 16 prevents type 31 infections, in this region the efficacy of the prophylactic vaccine against types 16 and 18 would be close to 80%. Page 1 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 In the present work we determined the prevalence of the Background Cervical cancer (CC) is the second cause of death by can- HR-HPV types circulating in the neighboring states of San cer among women in the world and the first in most Luis Potosí and Guanajuato by restriction fragment length developing countries [1,2]. In the year 2000, 190,000 polymorphism (RFLP) analysis with the method of Fuji- deaths and 80% of the 500,000 new CC cases occurred in naga et al. [19], in women with precancerous and cancer- the developing world, and Latin American countries were ous lesions of the cervix that had been diagnosed by among those with the highest incidence rates, together cytological analysis; in two thirds of them biopsies or sur- with countries from Sub-Saharan Africa, South and South gical specimens were obtained and the microscopic diag- East Asia [3]. The risk of developing CC increases with nosis confirmed. early start of sexual activity, number of sexual partners, prolonged use of oral contraceptives and smoking [4]. In Results Mexico it is associated with poverty related factors such as Study population low schooling, unemployment, residence in rural areas The 442 women enrolled in this study ranged from 16 to and lack of access to health services [5-7]. 78 years of age. Fresh cervical scrapings for HPV detection and typing were obtained from all of them whereas cyto- zur Hausen [8] proposed and later demonstrated [9] that logical and/or histological diagnoses were performed on human papillomaviruses (HPV) are the infectious agents 383. Low grade intraepithelial squamous lesions (LSIL) responsible of the neoplastic transformation of the cervi- were diagnosed in 280 cases (73.1%), high grade intraep- cal epithelium. This hypothesis was validated by finding ithelial squamous lesions (HSIL) in 64 cases (16.7%) and HPV genome sequences in 99.7% of invasive CC cases invasive carcinoma in 39 cases (10.2%). [10]. It is currently accepted that HPV is the most com- mon sexually transmitted pathogen [11] and that infec- Algorithm for HPV DNA amplification of cervical scrapings tion of the cervix by 'high risk' (HR) HPV types is a Amplification of the HR-HPV E6-250 product by direct necessary factor for CC development [10,12]. Low risk and nested PCR was compared. Direct PCR was performed (LR) HPV types are those usually found in warts and with primer set pU 1M/2R whereas nested PCR was per- benign lesions whereas HR types are those found in inva- formed in two successive reactions: in the first one sive CC [13]. ('direct') the E6-650 segment was amplified using primer set LCRS/E7AS, whereas in the second one ('nested') a There are 11 major LR-HPV types (designated as 6, 11, 40, portion of the first reaction mixture (presumed to contain 42, 43, 44, 54, 61, 70, 72, 81) and 15 major HR-HPV types the E6-650 product) was used as template for the internal (designated as 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, primers (pU 1M/2R) to generate E6-250. 59, 68, 73, 82) [14]. The two most frequently associated to malignancies are HR-HPV types 16 and 18. The first is Amplification of 35 random samples showed that 11 responsible for nearly 50% and the second for nearly 20% (31.4%) were positive by direct PCR and 24 (68.6%) by of all invasive CC cases in the world [10,15]. Several HR- nested PCR. Since E6-250 detection was 2.2 times more HPV variants with higher oncogenic potential are more sensitive with nested PCR, this modality was chosen to prevalent in developing countries, where they appear to analyze all problem samples. contribute to the higher incidence and mortality rates. In Mexico the probability of developing CC by the Asian- To determine the presence of HPV DNA in cervical scrap- American variant of HPV type 16 is several times higher ings the algorithm shown in Fig. 1 was used. Each sample than by the European variant, and around 25% of invasive is first subjected to nested PCR to successively amplify the CC cases are attributed to the AA variant [16]. E6-650 and E6-250 products. If the second one is visible, the sample is considered positive for HR-HPV (examples During the year 2000 the incidence of CC in Mexico was in Fig. 2A) and typified by RFLP (examples in Fig. 2B and 40.5 cases per 100,000 women over 25 years of age and 3C). If the second product is not observed, the sample the mortality rate was 17.1 [3], which means 12 deaths could be either positive, inadequate or negative. To define per day. In the Mexican states of San Luis Potosí (SLP) and if it is positive it is subjected to PCR with the primer set Guanajuato (Gto) the mortality rates for the same year MY 09/11; if L1-450 is observed, the sample is considered were respectively 15.5 and 21.7 [17]. Lazcano-Ponce et al. positive for low risk HPV and if L1-450 is not visible, the [18] found a HPV prevalence of 16.7% in Mexican women sample may be negative or of inadequate quality and sub- below 25 years of age which decreased to 3.7% in those of jected to PCR with the β-globin primer set. If the β-globin 25–44 years and increased to 23% in those above 65 product is observed the sample is considered to be ampli- years, and that HR-HPV types are more prevalent in all age fiable but HPV-negative; if it is not visible, the sample is groups whereas LR-HPV types are less prevalent in women considered inadequate (i.e., not amplifiable) and unde- under 25 years and increase with age. fined in relation to HPV infection. Page 2 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 To identify HR-HPV types the algorithm of Fig. 3 was used. The E6-250 product from each HR-HPV type has a specific size and a single restriction site for each of the five enzymes used, which generate two fragments of specific sizes allowing the identification of seven of the most fre- quent HR-HPV types. Ava II, the first enzyme used on each HR-HPV positive sample, identifies types 16, 18 and 33 (see examples in Fig. 2A). If Ava II does not digest the E6- 250 product or does it only partially, sample aliquots are Yes Yes Yes Yes RFL RFLP P HR-HP HR-HP HR-HPV V V simultaneously incubated with each of the four remaining typing typing !  !  !  !"! "! "! "! enzymes to identify types 31, 52, 35 and 58 (see examples in Fig. 2C). No No No No No Yes Yes Yes Yes Yes HR-HPV types circulating in the region L L LR-HPV R-HPV R-HPV In 402 of the 435 samples with HPV infection, one to #$ #$ #$ #$ #$ three of the seven identifiable HR-HPV types were No No No No No No detected. Yes Yes Yes Yes Amplifia Amplifiable ble The overall prevalence of HR-HPV types was, in descend- ȕȕȕȕ % % % % & & & & DNA DNA ing order: 16 (53.4%) > 31 (15.6%) > 18 (8.9%) > 35 (5.6) > 52 (5.4%) > 33 (1.2%) > 58 (0.7%) = unidentified No No No No No types (0.7%). Types 16, 31 and 18 therefore accounted for 77.9% of all the infections whereas the other four types DNA DNA n no ott accounted for only 12.9% of them. HPV type 16 predom- a am mplifia plifiable ble inated slightly in SLP (53.3%) over Gto (52.9%), type 31 in Gto (22.3%) over SLP (10.1%), and type 18 was equally prevalent in SLP and Gto (8.8%) (Table 3). A from wo Figure 1 lgorithm for high-risk H men with dysplasP tiV dete c and ne ction in cervic oplastic lesions al scrapings Algorithm for high-risk HPV detection in cervical HR-HPV types in single and multiple infections scrapings from women with dysplastic and neoplastic The overall prevalence of infections by a single HR-HPV lesions. It checks first for the presence of HPV DNA type was 71.4%, i.e., 2.5 times higher than that of infec- through nested PCR (expected to be positive in most sam- tions by two and three types (Table 4). ples) and then for the amplificability of β-globin DNA in HPV- negative samples (expected to be rare). The prevalence of infections by a single HR-HPV type was slightly higher in SLP (75.0%) than in Gto (67.4%), In the analysis of samples from women with cervical dys- whereas the overall prevalence of infections by two and plasia and neoplasia, as is the case of this study, this algo- three HR-HPV types was respectively 25.9% and 2.7%, of rithm saves labor, time and reagents because it first which 22.6% and 2.4% corresponded to SLP and 29.5% verifies the presence of HPV through nested PCR and 3.2% to Gto (Table 4). (expected to be positive in most samples) and then the amplificability of the HPV-negative samples (expected to The HR-HPV types of single, double and triple infections be rare) by performing a PCR assay for a single copy as well as the combinations of viral types in multiple housekeeping gene such as that of β-globin. infections found in all samples and per state are shown in Table 5. Using the algorithm for HPV detection (Fig. 1) the 437 cervical scrapings with amplifiable DNA were analyzed. Single infections HPV infection was demonstrated in 433 samples (99.1%) HPV type 16 was the most prevalent (72.6%) followed by of which 402 (92.0%) corresponded to high risk viral types 18 (10.2%) and 31 (9.9%) and then by types 52 types (Table 1). (3.3%), 33 (1.3%) = 35 (1.3%), and 58 (0.3%) (Table 5). Algorithm for HR-HPV typing The descending order of frequency of the viral types in sin- The sizes of E6-250 products and their corresponding gle infections was clearly different in each state. In SLP the restriction fragments for the seven HR-HPV types that can type 16 (77.4%) predominated, followed by types 18 be identified with the PCR-RFLP method used appear in (9.4%), 31 (8.2%), 52 (2.5%), 33 (1.3%), 35 (0.6%) = 58 Table 2. (0.6%). In Gto the prevalence of type 16 was lower Page 3 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 1 1 1 1 2 2 2 2 3 3 3 3 4 4 4 4 5 5 5 5 6 6 6 6 7 7 7 7 8 8 8 8 9 9 9 9 1 1 1 10 0 0 0 1 1 1 11 1 1 1 1 1 1 12 2 2 2 1 1 1 13 3 3 3 1 1 1 14 4 4 4 1 1 1 15 5 5 5 1 1 1 16 6 6 6 1 1 1 17 7 7 7 1 1 1 18 8 8 8 1 1 1 19 9 9 9 20 20 20 20 A A A bp bp bp bp bp 300 300 300 300 300 200 200 200 200 200 1 1 1 1 2 2 2 2 3 3 3 3 4 4 4 4 5 5 5 5 6 6 6 6 7 7 7 7 8 8 8 8 9 9 9 9 1 1 1 10 0 0 0 1 1 1 11 1 1 1 1 1 1 12 2 2 2 1 1 1 13 3 3 3 1 1 1 14 4 4 4 1 1 1 15 5 5 5 1 1 1 16 6 6 6 1 1 1 17 7 7 7 1 1 1 18 8 8 8 1 1 1 19 9 9 9 2 2 2 20 0 0 0 B B B bp bp bp bp bp 300 300 300 300 300 238 238 238 238 238 200 200 200 200 200 157 157 157 157 157 100 100 100 100 100 81 81 81 81 81 18 18 18 18 18 18 ? ? ? ? ? ? 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 + ? 16 + ? 16 + ? 16 + ? 16 + ? 16 + ? 1 1 1 1 1 2 2 2 2 2 3 3 3 3 3 4 4 4 4 4 5 5 5 5 5 6 6 6 6 6 7 7 7 7 7 8 8 8 8 8 9 9 9 9 9 1 1 1 1 10 0 0 0 0 1 1 1 1 11 1 1 1 1 1 1 1 1 12 2 2 2 2 1 1 1 1 13 3 3 3 3 1 1 1 1 14 4 4 4 4 1 1 1 1 15 5 5 5 5 1 1 1 1 16 6 6 6 6 1 1 1 1 17 7 7 7 7 1 1 1 1 18 8 8 8 8 1 1 1 1 19 9 9 9 9 2 2 2 2 20 0 0 0 0 C C C C bp bp bp bp 300 300 300 300 300 ~250 ~250 ~250 ~250 ~250 ~250 200 200 200 200 200 52 52 52 52 52 52 52 31 + 52 31 + 52 31 + 52 31 + 52 31 + 52 31 + 52 31 + 52 35 35 35 35 35 35 35 52 52 52 52 52 52 52 31 31 31 31 31 31 31 31 31 31 31 31 31 31 HR-HPV DNA de Figure 2 tection and typing HR-HPV DNA detection and typing. Examples of agarose gels used for detection of the E-250 products amplified by nested PCR, for the first stage of HR-HPV typing with Ava II, and for the second stage with Rsa I, Bgl II, Ava I and Acc I endonu- cleases. Numbers to the left indicate the size of the DNA markers; arrows to the right indicate the size of the products ampli- fied or the restriction fragments obtained. (A) HR-HPV DNA detection. Lane 1, 100 bp ladder. Lanes 2–18, DNA from different patients. Lane 19, Positive control (HeLa cell DNA). Lane 20, Negative control (no DNA). The expected E6-250 band appeared in the positive control and all problem samples except that of lane 8; Note the doublets in lanes 2 and 9 suggestive of double infection. (B) Identification of HPV types 16 and 18 by restriction with Ava II. Lanes 1 and 20, 100 bp ladder. Lanes 2 and 3, Positive control: E6-250 product from HeLa cell DNA intact (lane 2) and treated with Ava II (lane 3). Lanes 4–19: neighbor- ing lanes containing E6-250 products either intact or treated with Ava II. Lanes 4 and 5, Patient 322. Lanes 6 and 7, Patient 323. Lanes 8 and 9, Patient 324. Lanes 10 and 11, Patient 325. Lanes 12 and 13, Patient 326. Lanes 14 and 15, Patient 328. Lanes 16 and 17, Patient 329. Lanes 18 and 19, Patient 306. Note the slightly larger size of HPV18 product and fragments, as well as total and partial resistance to Ava II by samples from patients 322 (lane 5) and 328 (lane 15). (C) Identification of HPV types 31, 52 and 35. Groups of three neighboring lanes contained E6-250 products in mixtures incubated separately with Rsa I, Bgl II and Ava I endonucleases from each sample. Lanes 1 and 20, 100 bp ladder. Lanes 2–4, Patient 191. Lanes 5–7, Patient 197. Lanes 8–10, Patient 203. Lanes 11–13, Patient 209. Lanes 14–16, Patient 211. Lanes 17–19, Patient 246. Note that infections by one and two HPV types are clearly distinguished. Page 4 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 Table 1: Low risk- and high risk-HPV DNA detected in amplifiable samples Sample type SLP Gto Overall n% n% n% HR-HPV (E6+) 212 86.5 190 99.0 402 92.0 LR-HPV (E6-, L1+) 30 12.2 1 0.5 31 7.1 HPV negative (E6-, L1-, β-globin+) 3 1.2 1 0.5 4 0.9 Total 245 100.0 192 100.0 437 100.0 HR-HPV, positive for E6-250 product of high risk HPV. LR-HPV, low-risk HPV (negative for E6-250; positive for L1-450). Table 2: Size of the E6-250 products and restriction fragments of the seven HR-HPV types identified Enzyme HR-HPV type 16 18 31 33 35 52 58 Total length (bp) 238 268 232 244 232 231 244 Ava II 157/81 172/96 NC 136/108 NC NC NC Rsa I NC NC 117/115 NC NC NC NC Ava INC NC NC NC 186/46 NC NC Bgl II NC NC NC NC NC 176/55 NC Acc INC NC NC NC NC NC 126/118 Taken from Hwang [26]. NC, not cut. (63.3%) and type 31 was second (13.3%), followed by E6- E6- E6-250 250 250 types 18 (12.5%), 52 (4.7%), 35 (2.3%) and 33 (1.6%) (Table 5). Yes Yes Yes Yes ¿C ¿C ¿Cut ut ut by by by Ava Ava Ava II? II? II? VP VP VPH- H- H-16, 16, 16, - - -18, 18, 18, -33 -33 -33 Multiple infections No/parti No/parti No/parti No/partial al al allllly y y y The overall prevalence of HPV type 16 increased in double infections and reached its maximum possible value ¿ ¿ ¿C C Cut ut ut by by by Rs Rs Rsa a a I? I? I? ¿C ¿C ¿Cut ut ut by by by Bgl Bgl Bgl II? II? II? ¿C ¿C ¿Cut ut ut by by by Ava Ava Ava I? I? I? ¿C ¿C ¿Cut ut ut by by by Acc Acc Acc I? I? I? (100%) in triple infections (Table 6). The overall preva- Yes Yes Yes Yes Ye Ye Ye Yes s s s Ye Ye Ye Yes s s s Yes Yes Yes Yes lence of HPV type 18 also increased in double infections VP VP VPH-31 H-31 H-31 VP VP VPH-52 H-52 H-52 VPH VPH VPH-35 -35 -35 VPH VPH VPH-58 -58 -58 and was accompanied by increases of types 31, 52 and 35 and the last two types were even higher in triple infections Algorithm Figure 3 for HR-HPV typing (Table 6). In double and triple infections of SLP the pre- Algorithm for HR-HPV typing. The PCR-RFLP method dominant types were 16, 31, 18, 35 and 52 whereas in Gto used identifies seven HR-HPV types by the size of the restric- types 16 and 31 predominated in double infections and tion fragments of the E6-250 products generated by specific types 16 and 31 in the triple ones (Table 6). cuts with five enzymes. Ava II is used first because it helps recognize types 16, 18 and 33 (16 and 18 are known to be Single and multiple infections and HR-HPV types in lesions the most prevalent globally). PCR products not restricted by Ava II are incubated separately with each of the four remain- of increasing severity ing enzymes to identify the other five HR-HPV types. The overall frequency of cervical lesions was, in decreasing order, LSIL (73.1%) > HSIL (16.7%) > invasive cancer (10.2%) (Table 7). The ratio of single to multiple infec- Page 5 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 Table 3: Prevalence of HR-HPV types Table 4: Prevalence of single and multiple HR-HPV infections HR-HPV type SLP Gto Overall Infections SLP Gto Overall n % n% n% n% n% n% 16 169 53.3 138 52.9 307 53.4 Single 159 75.0 128 67.4 287 71.4 31 32 10.1 58 22.3 90 15.6 Double 48 22.6 56 29.5 104 25.9 18 28 8.8 23 8.8 51 8.9 Triple 5 2.4 6 3.2 11 2.7 35 15 4.7 17 6.5 32 5.6 52 16 5.1 15 5.7 31 5.4 Total 212 100.0 190 100.0 402 100.0 33 3 0.9 4 1.6 7 1.2 58 4 1.3 0 0.0 4 0.7 NI 1 0.3 3 1.2 4 0.7 for the first ('direct') reaction amplified the E6-650 prod- uct [19,26] and the primer set used in the second Total 268 84.5 258 99.0 526 91.4 ('nested') reaction amplified the E6-250 product [27]. The use of duplex PCR was discarded to amplify E6-250 and NI, type not identified. L1-450 due to the interference observed when simultane- tions was inversely proportional to the severity of the ous amplification of both products was attempted (Fig. lesions: 2.46 for LSIL, 2.37 for HSIL and 2.15 for invasive 4). The scarce E6-negative samples were tested later with a cancer (Table 8). universal primer set that amplifies L1-450 segments of both low risk- as well as HR-HPV types [28]. From these The frequency of HR-HPV types found in the cervical HSIL observations we concluded that to determine HR-HPV and invasive cancer (n = 140) was, in decreasing order, 16 infection in women with dysplasia and neoplasia it is con- (55.0%) > 31 (18.6%) > 35 (7.9%) > 52 (7.1%) > 18 venient first to identify the HPV-positive samples and (4.3%) > unidentified types (3.6%) > 33 (2.9%) > 58 then to check the amplificability of the negative ones. (0.7%) (Table 9). Eight HR-HPV types (16, 18, 31, 33, 35, 45, 52 and 58) are responsible for 95% of the invasive CC cases in the world Discussion Studies on the prevalence of HPV cervical infection in [14]. The PCR-RFLP used in this work identified all of Mexico are scarce [7,20-22] and information on HR-HPV them except type 45. prevalence is even scarcer [12,22] or deals only with HPV types 16 and 18 [23,24]. Considering all cervical samples included in this work, 98.8% contained amplifiable DNA, 97.8% had HPV infec- Since our aim was to determine the prevalence of the HR- tions which in 90.2% of the cases corresponded to HR- HPV types causing cervical infections in the states of SLP HPV types whose prevalence was higher in Gto (99.0%) and Gto, the study included women with cervical intraep- than in SLP (82.6%) (Table 3). ithelial lesions (73.1% low grade, 16.7% high grade and 10.2% invasive carcinoma), expected to be HPV-positive. In the 437 samples with amplifiable DNA included in this This prediction was fulfilled because nearly all women study, 528 cervical infections were demonstrated by HR- were shown to be infected with HPV, and HR types were HPV types that were identified in 99.1% of the cases identified in most of them. (Table 4). In this way we demonstrated that in our region circulate the seven HR-HPV types identified with the To determine HPV infection and to identify the high-risk method used and their overall prevalence is, in descend- types involved we used the PCR-RFLP method based on ing order, 16 (53.4%) > 31 (15.6%) > 18 (8.9%) > 35 amplification of the E6-250 HR-HPV product followed by (5.6) > 52 (5.4%) > 33 (1.2%) > 58 (0.7%) = unidentified digestion with endonucleases [19] and fragment sizing in types (0.7%). From these results we recommend that for high resolution agarose gels [25]. Obtaining cervical analysis of cervical samples with dysplasia it is convenient scrapings with the cytobrush allowed us to obtain more to identify first the types 16, 18 and 33 by restriction with than enough amplifiable DNA in nearly all samples and Ava II and then the types 31, 35, 52 and 58 by restriction PCR optimization assured efficient amplification with the with Rsa I, Ava I, Bgl II and Acc I. primer sets employed. The prevalence of high and low risk HPV types found by The E6-250 HR-HPV product was amplified through us is similar to that already seen in Mexico and other nested PCR because this modality turned out to be at least regions of high CC incidence [20,21,29]. The predomi- twice as sensitive as direct PCR. The universal primer sets nant HR-HPV types in our region are 16, 31 and 18 which Page 6 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 Table 5: Prevalence of HR-HPV types in single, double and triple infections Infections HR-HPV ypes SLP Gto Overall n % n% n% Single 16 123 77.4 81 63.3 204 72.6 18 15 9.4 16 12.5 31 10.2 31 13 8.2 17 13.3 30 9.9 52 4 2.5 6 4.7 10 3.3 33 2 1.3 21.6 41.3 35 1 0.6 32.3 41.3 58 1 0.6 00.0 10.3 NI 0 0.0 3 2.3 3 1.0 Sum 159 100.0 128 100.0 287 100.0 Double 16/18 7 14.6 4 7.1 11 10.6 16/31 14 29.2 35 63.0 49 47.1 16/33 1 2.1 1 1.8 2 1.9 16/35 7 14.6 611.0 1312.5 16/52 9 18.8 5 8.9 14 13.5 16/58 3 6.3 0 0.0 3 2.9 18/31 1 2.1 1 1.8 2 1.9 18/35 2 4.2 0 0.0 2 1.9 18/52 1 2.1 0 0.0 1 1.0 18/NI 1 2.1 0 0.0 1 1.0 31/33 0 0.0 1 1.8 1 1.0 31/35 1 2.1 1 1.8 2 1.9 35/52 1 2.1 2 3.6 3 2.9 Sum 48 100.0 56 100.0 104 100.0 Triple 16/31/52 2 40.0 1 17.0 3 27.3 16/18/35 1 20.0 2 33.0 3 27.3 16/31/35 1 20.0 2 33.0 3 27.3 16/35/52 1 20.0 1 17.0 2 18.2 Sum 5 100.0 6 100.0 11 100.0 Total 212 52.7 190 47.3 402 100.0 NI, type not identified. together represent 77.9% of all cervical infections. The Single and triple infections were more frequent in SLP, four remaining types cause 12.9%, and unidentified types whereas double infections were more frequent in Gto. only 0.7% of the HR-HPV infections. Types 16 and 18 are Single infections included all seven HR-HPV identifiable slightly more prevalent in SLP, whereas type 31 is nearly types where the three predominant ones were, in descend- two times more prevalent in Gto. ing order, 16 > 18 > 31 with a cumulative frequency of 92.7%. The prevalence of these types in SLP was, in The overall prevalence of HPV type 16 in our region descending order, 16 > 18 > 31 with a cumulative fre- (53.4%) is almost identical to the world average (53%) quency of 95.0%, whereas in Gto it was 16 > 31 > 18 with calculated by Munoz (2000). In contrast, the regional a cumulative frequency of 89.1%. prevalence of type 18 (8.9%) is substantially lower than the world average (15%) calculated by Munoz [21]. The The typing method allowed us to identify a considerable prevalence of types 31 (15.6%) and 35 (5.6%) is higher proportion of infections by two viral types (overall preva- than the average for Latin America [21], whereas that of lence of 25.9%, with 22.6% for SLP and 29.5% for Gto) type 33 (1.2%) is nearly 10 times lower than the average and three viral types (overall prevalence of 2.7%, with for Central America (11.8%) recently obtained by Clifford 2.4% for SLP and 3.2% for Gto) (Table 4). Type 16 was et al. [30]. found in all multiple infections. Page 7 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 Table 6: Prevalence (%) of HR-HPV types in single, double and triple infections HR-HPV types SLP Gto Overall Single Double Triple Single Double Triple Single Double Triple 16 77.4 85.4 100.0 36.7 91.1 100.0 71.1 88.5 100.0 18 9.4 25.0 20.0 10.0 8.9 33.3 10.8 16.3 27.3 31 8.2 33.3 40.0 16.7 78.6 50.0 10.5 57.7 45.5 52 2.5 20.8 60.0 16.7 12.5 33.3 3.5 16.3 45.5 33 1.3 2.1 0.0 0.0 3.6 0.0 0.0 2.9 0.0 35 0.6 22.9 60.0 20.0 16.1 50.0 1.4 19.2 54.5 58 0.6 6.3 0.0 0.0 0.0 0.0 0.3 2.9 0.0 NI 0.0 2.1 0.0 0.0 0.0 0.0 1.0 1.0 0.0 NI, type not identified. Table 7: HR-HPV types of single and multiple infections in lesions of increasing severity Infections HR-HPV types LSIL HSIL Cancer Overall n% n% n% n % Single 16 149 38.9 37 9.7 17 4.4 203 53.0 18 21 5.5 0 0.0 1 0.3 22 5.7 31 17 4.4 5 1.3 4 1.0 26 6.8 33 0 0.0 1 0.3 2 0.5 3 0.8 35 4 1.0 1 0.3 1 0.3 6 1.6 52 7 1.8 1 0.3 1 0.3 9 2.3 58 1 0.3 0 0.0 0 0.0 1 0.3 Sum 199 52.0 45 11.7 26 6.8 270 70.5 Double 16/18 9 2.3 4 1.0 0 0.0 13 3.4 16/31 36 9.4 4 1.0 9 2.3 49 12.8 16/33 1 0.3 0 0.0 0 0.0 1 0.3 16/35 10 2.6 2 0.5 1 0.3 13 3.4 16/52 8 2.1 3 0.8 1 0.3 12 3.1 16/58 2 0.5 1 0.3 0 0.0 3 0.8 18/35 3 0.8 0 0.0 1 0.3 4 1.0 18/NI 1 0.3 0 0.0 0 0.0 1 0.3 31/33 0 0.0 1 0.3 0 0.0 1 0.3 31/35 2 0.5 0 0.0 0 0.0 2 0.5 31/52 1 0.3 1 0.3 0 0.0 2 0.5 35/52 0 0.0 1 0.3 0 0.0 1 0.3 Sum 73 19.1 17 4.4 12 3.1 102 26.6 Triple 16/18/35 1 0.3 1 0.3 0 0.0 2 0.5 16/31/35 2 0.5 1 0.3 1 0.3 4 1.0 16/31/52 2 0.5 0 0.0 0 0.0 2 0.5 16/35/52 2 0.5 0 0.0 0 0.0 2 0.5 18/31/52 1 0.3 0 0.0 0 0.0 1 0.3 Sum 8 2.1 2 0.5 1 0.3 11 2.9 Total 280 73.1 64 16.7 39 10.2 383 100.0 Page 8 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 Table 8: Frequency of single and multiple HR-HPV infections in Table 9: HR-HPV types in HSIL and invasive cancer lesions lesions of increasing severity HR-HPV type Frequency (%) O/H ratio Lesion Type of infection S/M ratio Overall (O) In HSIL and cancer (H) Single (S) Multiple (M) Overall 16 53.4 55.0 0.97 n% n % n % 31 15.6 18.6 0.84 18 8.9 4.3 2.07 35 5.6 7.9 0.71 LSIL 199 52.0 81 21.1 280 73.1 2.46 52 5.4 7.1 0.76 HSIL 45 11.7 19 5.0 64 16.7 2.37 33 1.2 2.9 0.41 Cancer 26 6.8 13 3.4 39 10.2 2.00 58 0.7 0.7 1.00 NI 0.7 3.6 0.19 Total 280 70.5 113 29.5 383 100.0 --- NI, type not identified. LSIL, low-grade squamous intraepithelial lesion. HSIL, high-grade squamous intraepithelial lesion. Infections by two or more HPV types are markers of per- Double infections from SLP were caused by the seven sistent cervical disease, of multiple cervical lesions and of identifiable types but type 58 was absent in Gto. The over- progression from low to high grade lesions [33]. There is all predominant types in double infections were 16 > 31 > scarce evidence on the interaction of HPV types to 35 > 18 = 52. Their prevalence differed in each state since enhance CC pathogenesis and it is unknown if some HPV the descending order in SLP was 16 > 31 > 18 > 35 > 52, types promote or exclude infection by others. Careful fol- whereas in Gto it was 16 > 31 > 35 > 52 > 18 (Table 6). low up of multiple infections may help to pinpoint the relevance of the interactions of different HPV types in dis- Types 33 and 58 were absent from triple infections in both ease progression [34]. states and the overall predominant types were 16 > 35 > 31 = 52 > 18. There were also differences in the prevalence HPV16, the most frequent type in single and multiple by state since in SLP the descending order was 16 > 35 = infections in SLP and Gto, just as in the rest of the world 52 > 31 > 18 whereas in Gto it was 16 > 35 = 52 > 31 > 18 [14,21] appears to be the most persistent type [32,35,36] (Table 6). increasing the risk of developing severe preneoplastic lesions [37]. Our algorithm for typing, designed to identify first the high-risk viral types and then the low risk ones, probably Our work confirms the usefulness of the PCR-RFLP underestimates the prevalence of low risk types in samples method of Fujinaga et al. [19,26,27] for diagnosis and typ- where high risk types are demonstrated. However, it is ing cervical infections by HR-HPV, whose sensitivity was worth noting that in low grade intraepithelial cervical at least doubled by amplifying the E6-250 product lesions practically all genital HPV types are found, through nested rather than direct PCR and whose typing whereas in high grade lesions only high risk types are precision was improved by using high resolution electro- found [31]. phoresis. In this way we could identify the HR-HPV types circulating in our region and their distribution in the two The proportion of multiple infections found by us neighboring states analyzed, which reflect the endemic (28.6%) is over three times higher than the world average behavior of the various HPV types as well as local environ- (8.1%) calculated by Molano et al. [32]. This feature is mental or genetic conditions of the hosts [38]. probably due to the fact that the women in our study are themselves a high risk group since they were included for Besides being of use to carry out molecular epidemiology having cervical dysplasia and cancer. This idea is rein- studies and to predict the individual risk of each patient, forced by our finding that 10.6% of the double infections HR-HPV typing is essential to plan the administration of are due to the 16/18 type couple, whose prevalence was prophylactic vaccines directed against one or more spe- nearly six times higher than the world average (1.8%) esti- cific HPV types, which is questionable in populations mated by Clifford et al. [30]. where prevalence of the circulating types is unknown [31,39,40]. Since in our region HPV type 16 has the high- The five predominant HR-HPV types (16, 31, 18, 35 and est overall prevalence (53.4%), type 31 is second (15.6%) 52) found in the 140 HSIL and invasive cancer lesions and type 18 is third (8.9%), the vaccine against HR-HPV accounted for 92.9% of the cases and their frequency was types 16 and 18 [41] whose license was granted first in similar to their overall prevalence (Table 9). Mexico and the United States [42,43] would be expected Page 9 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 single to multiple infections was inversely proportional to 1 1 2 2 3 3 4 4 5 5 the severity of the lesions: 2.46 for LSIL, 2.37 for HSIL and 2.15 for invasive cancer. The frequency of HR-HPV types found in HSIL and inva- sive cancer was 16 (55.0%) > 31 (18.6%) > 35 (7.9%) > 52 (7.1%) > 18 (4.3%) > unidentified types (3.6%) > 33 50 500 0 (2.9%) > 58 (0.7%). 45 45 450 0 0 Since the three predominant HR-HPV types found (16, 31 25 25 250 0 0 200 200 and 18) cause 77.9% of the HR-HPV infections associated to cervical dysplasia in this region, and immunization against type 16 prevents type 31 infections, in this region the efficacy of the prophylactic vaccine against types 16 Inhibition of L1-450 duplex PCR m 2R Figure 4 ixtures with pr and E6-250 seg imer sets MY 09/1 ment amplifica 1 and pU 1M/ tion in and 18 would be close to 80%. Inhibition of L1-450 and E6-250 segment amplifica- tion in duplex PCR mixtures with primer sets MY 09/ 11 and pU 1M/2R. Mixtures contained 50 ng DNA from Methods Patient 1 as well as primer set MY 09/11, pU 1M/2R, or both. Source of women Arrows to the left indicate positions of the bands expected. The 442 women included in this study were selected for Lane 1, 100 bp ladder. Lane 2, Uniplex 1 mixture (set MY 09/ having precancerous or cancerous lesions of the cervical 11). Lane 3, Uniplex mixture 2 (set pU 1M/2R). Lane 4, epithelium confirmed by cytologic analysis. Two hundred Duplex mixture (sets MY 09/11 and pU 1M/2R). Lane 5, Neg- and eighteen resided in the city of San Luis Potosí, capital ative control (without DNA). Major bands expected in uni- of the state of San Luis Potosí (SLP), and 192 in the cities plex and duplex mixtures: ~450 bp with set MY 09/11 (Lanes of León, Celaya and Irapuato from the state of Guanajuato 2 and 4) and ~250 bp with set pU 1M/2R (Lanes 3 and 4). (Gto), Mexico. Cervical scrapings from SLP were obtained Note the decrease in the intensity of bands in the duplex at the Dysplasia Clinic of the SLP Health Services, the mixture (lane 4), especially ~450 bp. School of Nursing of Universidad Autónoma de San Luis Potosí, and from private patients. Samples from Gto were to cover at least these three types [44] and would have a obtained at the Dysplasia Clinics of the cities of Irapuato, 78% efficacy. Celaya and León and sent to our laboratory by the Guana- juato Health Secretariat. The study was authorized by the Health Secretariats of SLP and Gto and performed with Conclusion Enough DNA is obtained from cervical scrapings of the informed consent of all participating women. women with dysplasia in order to detect high risk-HPV by Cervical scrapings and DNA extraction PCR amplification followed by typing through restriction fragment length polymorphism analysis. Each scraping was taken with an endocervical brush ('cytobrush') that was immediately inserted in a 5 ml Sensitivity of HR-HPV detection is nearly doubled by polypropylene tube (Nalge Nunc, Rochester, NY) contain- nested rather than direct PCR amplification. ing 1 ml phosphate buffered saline supplemented with sterile disodium ethtylene-diamino-tetraacetate (PBS- Ninety-two percent of the 437 Mexican women with cer- EDTA: 137 mM NaCl, 2.7 mM KCl, 10 mM Na HPO , 2 2 4 vical dysplasia and cancer included in this study were mM KH HPO , 25 mM disodium EDTA, pH 7.4). Once 2 2 infected by HR-HPV, with a prevalence 1.14 times higher detached from the cytobrush and suspended in the PBS- in the state of Guanajuato than in San Luis Potosí. EDTA vehicle, each sample was fixed by addition of 1.5 ml 96% ethanol and processed to extract DNA on the same All seven HR-HPV types identifiable with the method day or up to 30 days after being kept at room temperature. used (16, 18, 31, 33, 35, 52, 58) circulate in SLP and Gto Reagents were purchased from J.T. Baker (Xalostoc, Méxi- and were diagnosed in nearly all (99.3%) the cases. co) unless other source is specified. Seventy-one percent of the infections were caused by one To extract the DNA each fixed sample was mixed by vor- HR-HPV type, 25.9% by two types and 2.7% by three texing and 1 ml transfered to a 1.5 ml tube and spun in a types. Hettich Mikro 20 microcentrifuge (Cologne, Germany) for 5 min at 13,000 rpm (16,250×g). The supernatant was The overall frequency of cervical lesions was LSIL (73.1%) discarded by decantation and to each pellet were added > HSIL (16.7%) > invasive cancer (10.2%) and the ratio of 500 μl of Tris-EDTA-saline (TES: 10 mM Tris-HCl; 2 mM Page 10 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 disodium EDTA, 0.4 M NaCl, pH 8.0 at 25°C), 50 μl of fluorometer (Tecan Systems, San Jose, CA) with the Mag- 10% sodium dodecyl sulphate and 20 μl of proteinase K ellan 4 software. (20 mg/ml). Mixtures were incubated at 55°C for 3 h, at the end of which 150 μl of 5 M NaCl were added and cen- Since amplification of the β-globin gene required = 25 ng trifuged again for 15 min. Each supernatant was aspirated DNA per PCR mixture, 100 ng was the minimum amount and transferred to a tube to which 577 μl cold isopropa- of DNA required from each cervical scraping in order to nol were immediately added and then left stand for 10 prepare at least four PCR mixtures. min at 4°C to precipitate the nucleic acids. The tubes were centrifuged again for 10 min and supernatants discarded The range of pure DNA obtained from the first 370 cervi- by decantation. Each pellet was washed by vortexing with cal scrapings was 53–16,590 ng. The amount of purified 1 ml of 70% cold ethanol and centrifuged for 10 min at DNA was sufficient (i.e., = 100 ng) in all samples except 10,000 rpm (9,615×g) and room temperature. Superna- five of the initial ones. tants were discarded by aspiration and the pellets dried out by inverting the tubes for 15 min on a paper towel. PCR conditions The oligonucleotide primer sets and the sizes expected for Each pellet was dissolved with 50 μl TE (10 mM Tris-HCl, 1 mM disodium EDTA, pH 8.0 at 25°C). the HPV amplification products are depicted in Table 10. To optimize PCR with each primer set variable DNA and The quality of extracted DNA was verified by electro- MgCl concentrations and annealing temperatures were phoretic analysis in 1% agarose gels with TAE (40 mM tested. The β-globin primer set was added to PCR mixtures Tris-acetate, 1 mM disodium EDTA, pH 8.2 at 25°C). containing double-serial dilutions of DNA from a HPV- Two-μl from each sample were applied to gels which were positive sample (range: 0.78–50 ng). To optimize condi- run at 60 V for 90 min. λ-phage? DNA digested with Hind tions for HPV primer sets, 1–5 mM MgCl concentrations III (Sigma-Aldrich, Mexico) was used as marker. After and annealing temperatures from 55°C to 61.4°C were staining for 20 min with ethidium bromide (1 μg/ml) gels tested. were illuminated with ultraviolet light and their fluores- cence recorded with the Bio-Rad ChemiDoc EQ (Her- To maximize HPV detection through PCR amplification, cules, CA) photo documenter. three variables were optimized: DNA content, annealing temperature and magnesium concentration. DNA was quantitated by fluorometry with the PicoGreen dsDNA Quantitation kit (Molecular Probes; Eugene, OR) With the PC04/GH20 primer set for β-globin the mini- by interpolation in a standard curve containing up to 50 mum amount of template DNA required in PCR mixtures ng of λ-phage DNA. To each well of a black FIA 96 well was determined with double serial dilutions leading to a plate (Greiner Bio-One, Frickenhausen, Germany) 198 μl maximum of 50 ng DNA per mixture. Fluorescence of the of the assay solution (PicoGreen diluted 1:400 in TE) and E6-250 product increased with DNA content up to 25 ng, 2 μl of standard DNA or problem samples were added, which was the amount selected to amplify HPV DNA from and their fluorescence determined using a 485 nm excita- each sample. Annealing temperature in the range of 55°C tion filter and a 535 emission filter in the GENios Pro to 62°C was assessed with each primer set. As major prod- ucts attained maximum fluorescence at 57°C this anneal- Table 10: Oligonucleotides used Oligonucleotides Gene amplified Amplicon size Set Name Sequence (5' → 3') Position 1 LCRS AAGGGAGTAACCGAAAACGGT 26 E6 ~650 bp E7AS TCATCCTCCTCCTCTGAG 671 2 pU1M TGTCAAAAACCGTTGTGTCC 419 E6 ~250 bp pU2R GAGCTGTCGCTTAATTGCTC 656 3 MY09 CGTCCMARRGGAWACTGATC 6584 L1 ~450 bp MY11 GCMCAGGGWCATAAYAATGG 7035 4 PC04 CAACTTCATCCACGTTCAACC --- β-globin ~260 bp GH20 GAAGAGCCAAGGACAGGTAC --- Nucleotide of the HPV16 genome at which the 5' end of each primer is bound. Fujinaga et al. [19]. Sotlar et al. [46]. Page 11 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 ing temperature was used with all primer sets for the rest Ava I, Ava II and Bgl II endonucleases and their buffers of the work. MgCl concentrations in the 1–5 mM range were purchased from Biolabs (Beverly, MA), whereas Rsa were tested. Maximum efficiency was attained at 2.5 mM, I and Acc I and their buffers were obtained from Invitro- concentration chosen for the rest of the work. gen (Carlsbad, CA). Digestion mixtures containing 8 μl of PCR amplification mixture, 1.5 μl endonuclease solution The primer set LCRS/E7AS amplifies the E6-650 segment (10 U/μl), 2 μl buffer and 8.5 μl water were incubated 3 h and the set pU 1M/2R amplifies the 'nested' E6-250 seg- at 37°C. The restriction fragments present in 10 μl from ment included in the first one. In the HPV16 genome, the each digestion mixture were analyzed by electrophoresis set LCRS/E7AS spans nucleotides 26–671 (645 bp) and in 2% agarose gels with 5 mM sodium borate, pH 8.5 the set pU 1M/2R spans nt 419–656 (237 bp). The set MY (Brody and Kern 2004) that were run at 120 V for 90 min. 09/11 amplifies the L1-450 segment which spans nt 6584–7035 (451 bp). To explore the feasibility of using Competing interests duplex PCR to simultaneously amplify E6-250 with The author(s) declare that they have no competing inter- primer set pU 1M/2R and L1-450 with primer set MY 09/ ests. 11, we tested both sets at 0.6 μM concentration. However, our finding that in duplex mixtures the L1-450 band was Authors' contributions nearly lost and the E6-250 band was less intense than in LAMC performed most of the molecular studies. MSG uniplex mixtures (Fig. 4) led us to discard the use of suggested and set up the PCR-RFLP method. RLR con- duplex mixtures. ceived and designed the study, obtained the funds to carry it out and drafted the manuscript. All authors read and Detection of the HPV DNA amplification products approved the final manuscript. LCR/E7 ~650 bp (E6-650), E6/E7 ~250 bp (E6-250) and L1 ~450 bp (L1-450) products were amplified with primer Acknowledgements We wish to thank all the women included in this study, as well as Julio Ortiz, sets pU 1M/2R, LCRS/E7AS and MY 09/11, respectively Ma. de Lourdes Martínez, Yolanda Terán and Dalila Álvarez for providing (Table 7). Each 50 μl PCR mixture was prepared in 200 μl the cervical scrapings from San Luis Potosí, and Raúl Rojas and Silvia Quin- Axygen tubes (Union City, CA). PCR mixtures contained tana for providing those from Guanajuato. We also thank Aurora Londoño , 0.4 mM of each dNTP, 0.6 μM of each oli- 2.5 mM MgCl for her efficient collaboration in sample processing. The interest and sup- gonucleotide, 1.5 units of recombinant Taq DNA port of the health authorities and of numerous collaborators from San Luis polymerase and 25 ng DNA, 20 mM Tris-HCl, 50 mM Potosí and Guanajuato, especially Fernando Toranzo and Raúl Martínez of KCl, pH 8.4 at 25°C; oligonucleotides were synthesized the San Luis Potosí Health Secretariat, and Éctor Jaime Ramírez Barba and by Accesolab (Mexico) and other components were pur- Raúl Rojas of the Guanajuato Health Secretariat, is highly appreciated. The chased from Invitrogen (Mexico). research was partially funded by grants FONINV-Gto-C01-5751 and FMSLP-4441. LAMC received a CONACYT scholarship during the course of the work. PCR mixtures were incubated 40 cycles in a Techne Touch- gene Gradient thermocycler (Staffordshire, England). References Before starting they were incubated at 94°C for 4 min. 1. Pisani P, Parkin DM, Bray F, Ferlay J: Estimates of the worldwide Each cycle consisted of 1 min periods at 94°C (denatura- mortality from 25 cancers in 1990. Int J Cancer 1999, 83:18-29. 2. Pisani P, Bray F, Parkin DM: Estimates of the world-wide preva- tion), 57°C (annealing) and 72°C (extension), followed lence of cancer for 25 sites in the adult population. Int J Cancer by 10 min final extension at 72°C. Each run included a 2002, 97:72-81. positive control with 25 ng of HeLa cell DNA known to 3. Arrossi S, Sankaranarayanan R, Parkin DM: Incidence and mortal- ity of cervical cancer in Latin America. Salud Publica Mex 2003, contain 10–50 copies of the HPV type 18 genome per cell 45 Suppl 3:S306-14. [45], and a negative control with water instead of DNA. 4. Reeves WC, Brinton LA, Garcia M, Brenes MM, Herrero R, Gaitan E, Tenorio F, de Britton RC, Rawls WE: Human papillomavirus infection and cervical cancer in Latin America. N Engl J Med PCR products (10 μl from each mixture) were subjected to 1989, 320:1437-1441. electrophoresis in 1.5% agarose gels with 5 mM sodium 5. Soe MM: Screening for cervical cancer in developing coun- tries. Bmj 1992, 304:983-984. borate, pH 8.5 [25] that were run at 120 V for 90 min. 6. Lazcano-Ponce EC, Moss S, Alonso de Ruiz P, Salmeron Castro J, Hernandez Avila M: Cervical cancer screening in developing High-risk HPV typing countries: why is it ineffective? The case of Mexico. Arch Med Res 1999, 30:240-250. To identify HR-HPV types the method of Fujinaga et al. 7. Palacio-Mejia LS, Rangel-Gomez G, Hernandez-Avila M, Lazcano- [19] was used. The size of the two E6-250 restriction frag- Ponce E: Cervical cancer, a disease of poverty: mortality dif- ferences between urban and rural areas in Mexico. Salud Pub- ments generated with endonucleases for each of the seven lica Mex 2003, 45 Suppl 3:S315-25. HR-HPV types that can be identified with this method are 8. zur Hausen H: Human papillomaviruses and their possible role shown in Table 2. in squamous cell carcinomas. Curr Top Microbiol Immunol 1977, 78:1-30. 9. Zur Hausen H: Papillomaviruses in human cancers. Mol Carcinog 1988, 1:147-150. Page 12 of 13 (page number not for citation purposes) Infectious Agents and Cancer 2008, 3:3 http://www.infectagentscancer.com/content/3/1/3 10. Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah 30. Clifford GM, Rana RK, Franceschi S, Smith JS, Gough G, Pimenta JM: KV, Snijders PJ, Peto J, Meijer CJ, Munoz N: Human papillomavirus Human papillomavirus genotype distribution in low-grade is a necessary cause of invasive cervical cancer worldwide. J cervical lesions: comparison by geographic region and with Pathol 1999, 189:12-19. cervical cancer. Cancer Epidemiol Biomarkers Prev 2005, 11. Volkow P, Rubi S, Lizano M, Carrillo A, Vilar-Compte D, Garcia-Car- 14:1157-1164. ranca A, Sotelo R, Garcia B, Sierra-Madero J, Mohar A: High preva- 31. Garland SM: Human papillomavirus update with a particular lence of oncogenic human papillomavirus in the genital tract focus on cervical disease. Pathology 2002, 34:213-224. of women with human immunodeficiency virus. Gynecol Oncol 32. Molano M, Van den Brule A, Plummer M, Weiderpass E, Posso H, 2001, 82:27-31. Arslan A, Meijer CJ, Munoz N, Franceschi S: Determinants of 12. Munoz N, Bosch FX, de Sanjose S, Vergara A, del Moral A, Munoz MT, clearance of human papillomavirus infections in Colombian Tafur L, Gili M, Izarzugaza I, Viladiu P, et al.: Risk factors for cervical women with normal cytology: a population-based, 5-year fol- intraepithelial neoplasia grade III/carcinoma in situ in Spain low-up study. Am J Epidemiol 2003, 158:486-494. and Colombia. Cancer Epidemiol Biomarkers Prev 1993, 2:423-431. 33. Becker TM, Wheeler CM, McGough NS, Parmenter CA, Jordan SW, 13. de Villiers EM, Fauquet C, Broker TR, Bernard HU, zur Hausen H: Stidley CA, McPherson RS, Dorin MH: Sexually transmitted dis- Classification of papillomaviruses. Virology 2004, 324:17-27. eases and other risk factors for cervical dysplasia among 14. Munoz N, Bosch FX, de Sanjose S, Herrero R, Castellsague X, Shah southwestern Hispanic and non-Hispanic white women. Jama KV, Snijders PJ, Meijer CJ: Epidemiologic classification of human 1994, 271:1181-1188. papillomavirus types associated with cervical cancer. N Engl 34. Hubbard RA: Human papillomavirus testing methods. Arch J Med 2003, 348:518-527. Pathol Lab Med 2003, 127:940-945. 15. Bosch FX, Manos MM, Munoz N, Sherman M, Jansen AM, Peto J, 35. Londesborough P, Ho L, Terry G, Cuzick J, Wheeler C, Singer A: Schiffman MH, Moreno V, Kurman R, Shah KV: Prevalence of Human papillomavirus genotype as a predictor of persist- human papillomavirus in cervical cancer: a worldwide per- ence and development of high-grade lesions in women with spective. International biological study on cervical cancer minor cervical abnormalities. Int J Cancer 1996, 69:364-368. (IBSCC) Study Group. J Natl Cancer Inst 1995, 87:796-802. 36. Richardson H, Kelsall G, Tellier P, Voyer H, Abrahamowicz M, Fer- 16. Berumen J, Ordonez RM, Lazcano E, Salmeron J, Galvan SC, Estrada enczy A, Coutlee F, Franco EL: The natural history of type-spe- RA, Yunes E, Garcia-Carranca A, Gonzalez-Lira G, Madrigal-de la cific human papillomavirus infections in female university Campa A: Asian-American variants of human papillomavirus students. Cancer Epidemiol Biomarkers Prev 2003, 12:485-490. 16 and risk for cervical cancer: a case-control study. J Natl 37. Woodman CB, Collins S, Winter H, Bailey A, Ellis J, Prior P, Yates M, Cancer Inst 2001, 93:1325-1330. Rollason TP, Young LS: Natural history of cervical human pap- 17. Tasa de mortalidad por cáncer cérvico uterino. Sistema para illomavirus infection in young women: a longitudinal cohort el Seguimiento de la Situación de la Mujer en México (SIS- study. Lancet 2001, 357:1831-1836. ESIM) [http://dgcnesyp.inegi.gob.mx/sisesim/sisesim.html] 38. Hildesheim A, Wang SS: Host and viral genetics and risk of cer- 18. Lazcano-Ponce E, Herrero R, Munoz N, Cruz A, Shah KV, Alonso P, vical cancer: a review. Virus Res 2002, 89:229-240. Hernandez P, Salmeron J, Hernandez M: Epidemiology of HPV 39. Williams OM, Hart KW, Wang EC, Gelder CM: Analysis of CD4(+) infection among Mexican women with normal cervical cytol- T-cell responses to human papillomavirus (HPV) type 11 L1 ogy. Int J Cancer 2001, 91:412-420. in healthy adults reveals a high degree of responsiveness and 19. Fujinaga Y, Shimada M, Okazawa K, Fukushima M, Kato I, Fujinaga K: cross-reactivity with other HPV types. J Virol 2002, Simultaneous detection and typing of genital human papillo- 76:7418-7429. mavirus DNA using the polymerase chain reaction. J Gen Virol 40. Corona Gutierrez CM, Tinoco A, Navarro T, Contreras ML, Cortes 1991, 72 ( Pt 5):1039-1044. RR, Calzado P, Reyes L, Posternak R, Morosoli G, Verde ML, Rosales 20. Torroella-Kouri M, Morsberger S, Carrillo A, Mohar A, Meneses A, R: Therapeutic vaccination with MVA E2 can eliminate pre- Ibarra M, Daniel RW, Ghaffari AM, Solorza G, Shah KV: HPV prev- cancerous lesions (CIN 1, CIN 2, and CIN 3) associated with alence among Mexican women with neoplastic and normal infection by oncogenic human papillomavirus. Hum Gene Ther cervixes. Gynecol Oncol 1998, 70:115-120. 2004, 15:421-431. 21. Munoz N: Human papillomavirus and cancer: the epidemio- 41. Villa LL, Costa RL, Petta CA, Andrade RP, Ault KA, Giuliano AR, logical evidence. J Clin Virol 2000, 19:1-5. Wheeler CM, Koutsky LA, Malm C, Lehtinen M, Skjeldestad FE, Ols- 22. Gonzalez-Losa Mdel R, Rosado-Lopez I, Valdez-Gonzalez N, Puerto- son SE, Steinwall M, Brown DR, Kurman RJ, Ronnett BM, Stoler MH, Solis M: High prevalence of human papillomavirus type 58 in Ferenczy A, Harper DM, Tamms GM, Yu J, Lupinacci L, Railkar R, Tad- Mexican colposcopy patients. J Clin Virol 2004, 29:202-205. deo FJ, Jansen KU, Esser MT, Sings HL, Saah AJ, Barr E: Prophylactic 23. Berumen J, Unger ER, Casas L, Figueroa P: Amplification of human quadrivalent human papillomavirus (types 6, 11, 16, and 18) papillomavirus types 16 and 18 in invasive cervical cancer. L1 virus-like particle vaccine in young women: a randomised Hum Pathol 1995, 26:676-681. double-blind placebo-controlled multicentre phase II effi- 24. Hernandez-Avila M, Lazcano-Ponce EC, Berumen-Campos J, Cruz- cacy trial. Lancet Oncol 2005, 6:271-278. Valdez A, Alonso de Ruiz PP, Gonzalez-Lira G: Human papilloma 42. Markowitz LE, Dunne EF, Saraiya M, Lawson HW, Chesson H, Unger virus 16-18 infection and cervical cancer in Mexico: a case- ER: Quadrivalent Human Papillomavirus Vaccine: Recom- control study. Arch Med Res 1997, 28:265-271. mendations of the Advisory Committee on Immunization 25. Brody JR, Kern SE: Sodium boric acid: a Tris-free, cooler con- Practices (ACIP). MMWR Recomm Rep 2007, 56:1-24. ductive medium for DNA electrophoresis. Biotechniques 2004, 43. McLemore MR: Gardasil: Introducing the new human papillo- 36:214-216. mavirus vaccine. Clin J Oncol Nurs 2006, 10:559-560. 26. Hwang T: Detection and typing of human papillomavirus 44. Harper DM, Franco EL, Wheeler CM, Moscicki AB, Romanowski B, DNA by PCR using consensus primers in various cervical Roteli-Martins CM, Jenkins D, Schuind A, Costa Clemens SA, Dubin lesions of Korean women. J Korean Med Sci 1999, 14:593-599. G: Sustained efficacy up to 4.5 years of a bivalent L1 virus-like 27. Noda T, Sasagawa T, Dong Y, Fuse H, Namiki M, Inoue M: Detection particle vaccine against human papillomavirus types 16 and of human papillomavirus (HPV) DNA in archival specimens 18: follow-up from a randomised control trial. Lancet 2006, of benign prostatic hyperplasia and prostatic cancer using a 367:1247-1255. highly sensitive nested PCR method. Urol Res 1998, 26:165-169. 45. Chardonnet Y, Lizard G, Chignol MC, Schmitt D: Analytical meth- 28. Bernard HU, Chan SY, Manos MM, Ong CK, Villa LL, Delius H, Peyton ods for evaluation on whole cells of human papillomavirus CL, Bauer HM, Wheeler CM: Identification and assessment of infection. Bull Cancer 1995, 82:107-113. known and novel human papillomaviruses by polymerase 46. Sotlar K, Diemer D, Dethleffs A, Hack Y, Stubner A, Vollmer N, Men- chain reaction amplification, restriction fragment length ton S, Menton M, Dietz K, Wallwiener D, Kandolf R, Bultmann B: polymorphisms, nucleotide sequence, and phylogenetic Detection and typing of human papillomavirus by e6 nested algorithms. J Infect Dis 1994, 170:1077-1085. multiplex PCR. J Clin Microbiol 2004, 42:3176-3184. 29. Wright TC Jr., Denny L, Kuhn L, Pollack A, Lorincz A: HPV DNA testing of self-collected vaginal samples compared with cyto- logic screening to detect cervical cancer. Jama 2000, 283:81-86. Page 13 of 13 (page number not for citation purposes)

Journal

Infectious Agents and Cancer – Springer Journals

Published: Feb 28, 2008

There are no references for this article.